Molecular Endocrinology 15 (4): 638-653
Copyright © 2001 by The Endocrine Society
Identification of a Decidua-Specific Enhancer on the Human Prolactin Gene with Two Critical Activator Protein 1 (AP-1) Binding Sites
Kako Watanabe,
Cherie A. Kessler,
Cindy J. Bachurski,
Yuki Kanda,
Brian D. Richardson,
Jerzy Stanek,
Stuart Handwerger and
Anoop K. Brar
Division of Endocrinology (K.W., C.A.K., Y.K., B.D.R., S.H.,
A.K.B.) and Pulmonary Biology (C.J.B.) Childrens Hospital
Research Foundation Department of Pediatrics, and Department of
Pathology (J.S.) University of Cincinnati College of Medicine
Cincinnati, Ohio 45229-3039
 |
ABSTRACT
|
|---|
Deletion analysis of the human PRL promoter in
endometrial stromal cells decidualized in vitro revealed a
536-bp enhancer located between nucleotide (nt) -2,040 to -1,505 in
the 5'-flanking region. The 536-bp enhancer fragment ligated into a
thymidine kinase (TK) promoter-luciferase reporter plasmid conferred
enhancer activity in decidual-type cells but not nondecidual cells.
DNase I footprint analysis of decidualized endometrial stromal cells
revealed three protected regions, FP1FP3. Transfection of overlapping
100-bp fragments of the 536-bp enhancer indicated that FP1 and FP3 each
conferred enhancer activity. Gel shift assays indicated that both FP1
and FP3 bind activator protein 1 (AP-1), and JunD and Fra-2 are
components of the AP-1 complex in decidual fibroblasts. Mutation of the
AP-1 binding site in either FP1 or FP3 decreased enhancer activity by
approximately 50%, while mutation of both sites almost completely
abolished activity. Coexpression of the 536-bp enhancer and A-fos, a
dominant negative to AP-1, decreased enhancer activity by approximately
70%. Conversely, coexpression of Fra-2 in combination with JunD or
c-Jun and p300 increased enhancer activity 6- to 10-fold. Introduction
of JunD and Fra-2 into nondecidual cells is sufficient to confer
enhancer activity. JunD and Fra-2 protein expression was markedly
increased in secretory phase endometrium and decidua of early pregnancy
(high PRL content) compared with proliferative phase endometrium (no
PRL). These investigations indicate that the 5'-flanking region of the
human PRL gene contains a decidua-specific enhancer between nt
-2,040/-1,505 and AP-1 binding sites within this enhancer region are
critical for activity.
 |
INTRODUCTION
|
|---|
The expression of PRL in extrapituitary tissues, such as uterine
decidua and lymphocytes, is regulated by a different promoter than the
promoter that regulates pituitary PRL gene expression (1). The
pituitary PRL promoter is located immediately upstream of the
transcription initiation site in exon 1, while the promoter for PRL in
extrapituitary tissues is located immediately upstream of exon 1a,
which is 5.3 kb upstream of the same initiation site. At present, very
little is known about the cis-acting elements on the
decidual PRL promoter and the transcription factors that are important
in the regulation of decidual PRL gene expression.
Transfection studies indicate that the decidual PRL promoter is
transcriptionally active in decidualized endometrial stromal cells but
not in undecidualized endometrial stromal cells, strongly suggesting
that endometrial stromal cells must undergo decidualization before the
PRL gene is expressed (2). Decidualization can be induced in
vitro by incubating primary cultures of endometrial stromal cells
with medroxyprogesterone acetate (MPA) in combination with estradiol or
relaxin, or with high levels of cAMP in the absence of exogenous
hormone. PRL gene expression can also be induced in primary cultures of
human decidual fibroblasts (3) and in St-2 cells, a human endometrial
fibroblast cell line that was immortalized by infection with simian 40
virus (4). MPA, alone or in combination with estradiol, was unable to
induce PRL gene expression in the decidual fibroblast and St-2 cells,
but potentiated the effect of cAMP on PRL expression in these cells.
PRL gene expression has also been observed in the N5 endometrial cell
line that was immortalized by transfection with an SV40 mutant and
which expresses the PRL gene driven by the extrapituitary promoter (5).
The N5 cells have phenotypic features of primary cultures of
decidualized human endometrial stromal cells and secrete low levels of
PRL and insulin-like growth factor binding protein-1 (IGFBP-1), both
of which are markers of decidualized endometrial cells (6, 7).
To date, few studies have examined the molecular mechanisms involved in
the induction of decidual PRL gene expression during endometrial
stromal cell decidualization. Several studies have shown that the cAMP
signal cascade is activated during in vitro decidualization
(8, 9). Telgmann et al. (9) have demonstrated that
activation of protein kinase A is required for induction of decidual
PRL gene transcription. Within 12 h of treatment with 8-Br-cAMP, a
weak induction of gene expression occurs that is mediated by an
imperfect cAMP response element at position -12 relative to the
transcription start site. A strong induction that is dependent on a
region of the decidual PRL promoter at -332/-270 occurs after 12
h (9). More recently, CCAAT/enhancer binding proteins in endometrial
stromal cell extracts have been shown to be important in transducing
the cAMP signal to the decidual PRL promoter (10).
A few studies have been performed on PRL gene expression in the human
B-lymphoblastoid cell line IM-9-B-3 (11) and the T-lymphoblastic Jurkat
cell line (12). Both cell lines express a PRL mRNA that appears to be
identical to that of the decidual PRL mRNA. Berwaer and co-workers (12)
noted that the region of the promoter between nt -453 and -67 is
critical for basal activity of the promoter in the Jurkat cell line.
DNase I footprinting studies and further 5'- and 3'-deletion analyses
identified transcription factor binding sites within an enhancer
element localized at -375 to -212 bp, which contributed approximately
50% of the promoter activity in the lymphoid cells (12). The
transcription factors that bind to this region of the promoter have not
been characterized, and similar experiments were not subsequently
performed in endometrial stromal cells. In addition, footprint analysis
has not been performed using nuclear extracts from decidual cells.
In this study, we determined by deletion analysis that the 5'-flanking
region of the human PRL gene between nt 2,040 and 1,505 acts as an
enhancer of gene expression in decidualized endometrial stromal cells
and fibroblasts, and in N5 endometrial cells. Using DNase I footprint
analysis, gel mobility shift assays, and transient transfection assays,
we found that JunD and Fra-2 bind two activator protein-1 (AP-1)
response elements in the enhancer to activate transcription in
decidua-type cells but not nondecidual cells.
 |
RESULTS
|
|---|
Deletion Analysis of the Decidual PRL Promoter
To determine the location of putative cis-acting
regulatory elements on the 5'- flanking region of the decidual PRL
gene, a series of deletion constructs (nt -2,927 to +66) were
transfected into primary cultures of endometrial stromal cells that had
been decidualized in vitro by treatment with MPA and
estradiol (Fig. 1
). Transient
transfection of expression vectors containing nt 2,927/+66 and nt
2,040/+66 of the 5'-flanking region coupled to a luciferase reporter
gene resulted in increases in luciferase activity that were 20- and
23-fold greater than that of the expression vector without the promoter
(pGL3E). Deletion of the 536 bp of the 5'-flanking region from nt
2,040 to 1,505 resulted in a 2.4-fold decrease in luciferase
activity. Deletion of the promoter to nt -317 had no further effect.
However, deletion from nt -317 to -6 resulted in a loss of luciferase
expression to levels identical to that observed with pGL3E alone.
Transient transfection of the same series of deletion constructs into
N5 endometrial stromal cells and treated decidual fibroblast cells,
both of which express PRL under control of the decidual type PRL
promoter, resulted in a similar pattern of luciferase activity (data
not shown). Taken together, these results indicate that two regulatory
domains are present on the 5'-flanking region of the decidual PRL gene,
one domain from nt -2,040 to -1,505 and another from nt -317 to -6.
The location of the proximal regulatory region is similar to that
observed previously by others (2).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 1. Deletion Analysis of the 5'-Flanking Region of the
Decidual PRL Gene
Plasmid constructs containing progressive deletions of the 5'-flanking
region were transiently transfected into primary cultures of human
endometrial stromal cells that had been decidualized in
vitro by treatment with MPA and estradiol. Each
bar represents the mean ± SE of
triplicate culture wells. The relative luciferase activity in each well
was determined by normalizing the luciferase activity to the activity
of pSV-ß-galactosidase (Promega Corp.). The mean
relative luciferase activities of the wells were then normalized to the
mean activity of pGL3E, which was assigned a value of 1. Similar
results were observed in five other experiments with decidualized
endometrial stromal cells, decidual fibroblast cells treated with MPA,
estradiol, and cAMP, and N5 endometrial cells.
|
|
Transfection of TK-Promoter Constructs
Experiments were next performed to determine whether the 536-bp
enhancer region between nt 2,040/-1,505 is capable of enhancing the
activity of a heterologous promoter. The 536-bp region was subcloned in
the forward and reverse orientations into pGL3-TK (Fig. 2A
). As shown in Fig. 2B
, the 536-bp
fragment significantly enhanced luciferase activity of the TK promoter
in in vitro decidualized endometrial stromal cells and
treated decidual fibroblasts as well as in N5 endometrial cells. In the
endometrial stromal cells and decidual fibroblasts, the 536-bp fragment
of the decidual PRL promoter enhanced TK promoter activity by 4.9- and
7.0-fold in the forward orientation and by 2.3- and 2.2-fold in the
reverse orientation, respectively. In N5 cells, the 536-bp fragment
enhanced TK promoter activity by 3.4-fold in the forward orientation
and by 4.7-fold in the reverse orientation. The 536-bp fragment in
either orientation did not, however, enhance TK promoter activity in
nondecidual cells (HeLa, Jurkat, and BeWo cells).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Effect of the Enhancer in the 5'-Flanking Region of
the Decidual PRL Gene on Activity of the Heterologous TK Promoter in
Decidual and Nondecidual Cells
A, Schematic representations of pGL3-TK containing the 536-bp enhancer
fragment in the forward (536bp(+)-TK) or reverse (536bp(-)-TK)
orientation. B, Transient transfections were performed with the three
pGL3-TK expression plasmids in decidual cells (top
panel) and nondecidual cells (bottom panel). The
decidual cells were primary cultures of treated endometrial cells (ESC)
and decidual fibroblasts (DF), and N5 endometrial cells (N5). The
nondecidual cells were HeLa, Jurkat, and BeWo. The relative luciferase
activity in each well was normalized to the relative activity of
pGL3-TK, which was assigned a value of 1. Each bar
represents the mean ± SE of three wells. Similar
results were obtained in five other experiments. *,
P < 0.001; **, P < 0.01; ***,
P < 0.05 relative to the empty vector. 536(+)TK
and 536 (-)TK refer to pGL3-TK containing the 536-bp enhancer fragment
in the forward (+) and reverse (-) orientation, respectively.
|
|
DNase I Footprint Analysis of the Decidual PRL Enhancer
To characterize further the 536-bp enhancer, DNase I footprint
analysis was performed using nuclear extracts from primary cultures of
decidual-type cells, treated endometrial stromal cells (ESC), and
decidual fibroblasts (DF), and N5 endometrial cells (N5) as well as
nondecidual cells, Jurkat, GH3, and BeWo cells. As shown in Fig. 3A
, three footprinted regions (FP1-FP3)
at nt -1,727/-1,686 (FP1), nt 1,810/-1,783 (FP2) and nt
-1,864/-1,843 (FP3) were detected using nuclear extracts from
decidual-type cells (N5, ESC, and DF). In addition, FP1 was present in
extracts of GH3 cells and FP-1 and FP3 were present in extracts of BeWo
cells. Computer analysis revealed that FP1 contains several putative
transcription factor-binding sites including sites for AP-1, a
half-site for the glucocorticoid receptor (GR), and TRF, a cellular
octamer binding protein (Fig. 3B
). FP2 contains putative transcription
factor binding sites for hepatocyte nuclear factor-3 (HNF-3) and a
DNA-binding protein that recognizes the Y-box of major
histocompatibility complex class ll genes (NF-Y). FP3 contains
overlapping putative sites for AP-1, a GR half -site and upstream
stimulatory factor (USF), a member of the c-myc-related
family of DNA-binding proteins.

View larger version (76K):
[in this window]
[in a new window]
|
Figure 3. DNase I Footprint Analysis of the 5'-Flanking
Region of the Decidual PRL Gene
A, DNase I analysis of nt -1,939 to -1,640 region of the 5'-flanking
region. Experiments were performed using nuclear extracts from N5
endometrial cells (N5), Jurkat cells (Jur), in vitro
decidualized endometrial stromal cells (ESC), GH3 cells (GH3), decidual
fibroblasts treated with MPA, E2 and (Bu)2cAMP
(DF), and BeWo cells (BeWo). On the left are shown a
radiolabeled G/A ladder and BSA, which was used as a control. The
bars on the right indicate the positions
of the protected regions (FP1FP3) on the promoter. B, DNA sequences
and putative transcription factor binding sites present in the
footprinted regions, FP1-FP3, of the 536-bp enhancer region of the
decidual PRL gene. The abbreviations used represent TRF, a cellular
octamer binding protein; AP-1, activator protein-1; GR, glucocorticoid
receptor; HNF-3, hepatocyte nuclear factor-3; NF-Y, a sequence-specific
DNA-binding protein that recognizes the Y-box of major
histocompatibility complex class ll genes; and USF, human upstream
stimulatory factor, a member of the c-myc-related family
of DNA-binding proteins.
|
|
Functional Analysis of 100-bp Enhancer Fragments
To determine which nucleotides of the 536-bp enhancer are
responsible for enhancer activity, overlapping 100-bp fragments of the
2,040/-1,505 region were subcloned into pGL3-TK (Fig. 4A
). In transfection studies, three of
the plasmids containing 100-bp fragments (-1,939/-1,840,
-1,904/-1,805 and -1,704/-1,605) showed increased luciferase
activity in in vitro decidualized endometrial stromal cells
(Fig. 4B
). The plasmids containing the -1,939/-1,840 and
-1,904/-1,805 fragments, which overlap FP3 (Fig. 4A
) enhanced
promoter activity by 2- to 3-fold. The plasmid containing the
-1,704/-1,605 fragment, which overlaps FP1, enhanced promoter
activity by 4-fold. In contrast, fragment -1,739/--1,640, which
overlaps FP1, had no effect on promoter activity. Individual fragments
overlapping FP2 did not have enhancer activity. Similar results were
obtained with the plasmids in treated decidual fibroblast cells and N5
cells (data not shown).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 4. Transfection Studies Using Overlapping 100-bp
Fragments of the 536-bp Decidual PRL Enhancer Region
A, Schematic representation of overlapping 100-bp fragments of the
enhancer in the 5'-flanking region of the decidual PRL gene between nt
-2,040/-1,505. The relative positions of FP1FP3 are indicated at
the top. B, The 100-bp fragments were ligated into
pGL3-TK (constructs shown schematically on the left) and
transiently transfected in treated endometrial stromal cells as
described in Materials and Methods. Each
bar represents the mean ± SE relative
luciferase activity of three wells (right panel).
Similar results were obtained in five other experiments. **,
P < 0.01; ***, P < 0.05,
relative to the empty vector.
|
|
Gel Shift Assays
Since putative AP-1 binding sites are present in FP1 and FP3, and
AP-1 transcription factors have been shown to be important in the
regulation of other genes expressed in the decidua (13), we performed
experiments to determine whether putative AP-1 binding sites in FP1 and
FP3 are important for the regulation of decidual PRL gene expression.
Gel shift assays were performed to determine whether AP-1 binds to FP1
and FP3. As shown in Fig. 5A
, gel shift
assays using radiolabeled oligonucleotides encoding FP1 or FP3 and a
nuclear extract from treated decidual fibroblast cells revealed a major
retarded complex that was competed by excess unlabeled FP1 or FP3, and
by an oligonucleotide with the sequence of a consensus AP-1 binding
site. Conversely, the binding of a labeled consensus AP-1
oligonucleotide probe to the decidual fibroblast cell nuclear extract
was found to be competed by excess unlabeled FP1 and FP3 (Fig. 5B
).
However, the AP-1 probe was not competed by FP1 and FP3
oligonucleotides containing mutations in the AP-1 binding sites (FP1
AP-1 mut, AP-1 mut) (Fig. 5B
). Similar results of gel shift analysis
were obtained using FP1, FP3, or AP-1 as probes and competing with
mutant FP1 and FP3 oligonucleotides using nuclear extracts of
decidualized endometrial stromal cells and N5 cells (data not
shown).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5. Gel Shift Analysis of FP1 and FP3
A, Gel shift assays were performed using 5 µg nuclear extract from
treated decidual fibroblast cells and radiolabeled oligonucleotide
probes corresponding to the sequences of FP1 and FP3.
Arrows indicate the specific retarded complex.
Competition studies were performed using 100-fold excess of unlabeled
FP1, FP3, or AP-1 oligonucleotides. B, Gel shift analysis using nuclear
extract from treated decidual fibroblast cells and radiolabeled
oligonucleotide probes corresponding to the sequences of AP-1 is shown.
Competition studies were performed with AP-1, FP1, FP3, or mutants of
the FP1 and FP3 oligonucleotides with nucleotide substitutions in the
AP-1 binding sites that completely abolished AP-1 binding (FP1AP-1 mut
and FP3AP-1 mut). Sequences of the oligonucleotides are detailed in
Materials and Methods. Specific complexes are indicated
with an arrow.
|
|
Analysis of AP-1 Binding Sites
To evaluate the functional significance of the two AP-1 binding
sites in FP1 and FP3, pGL3-TK expression plasmids containing the 536-bp
enhancer with mutations in the AP-1 binding sites were transfected into
treated decidual fibroblast cells. The promoter activity of the mutant
plasmids was compared with that of the pGL3-TK expression plasmid
containing the wild-type enhancer (Fig. 6A
). Mutation of the AP-1 binding site in
FP1 (FP1 AP-1 mut) reduced enhancer activity by 51%, and mutation of
the AP-1 binding site in FP3 (FP3 AP-1 mut) reduced luciferase activity
by 44%. Mutation of both AP-1 binding sites (FP1 & 3 AP-1 mut) reduced
enhancer activity by 98%. Coexpression of a dominant negative AP-1
plasmid, A-fos, with the 536-bp(+)pGL3-TK plasmid resulted in an
approximately 70% decrease in expression of the enhancer
(P < 0.01) (Fig. 6B
). Expression of the vector alone
[cytomegalovirus (pRc/CMV)] showed approximately
2040% decrease in expression of the enhancer
(P > 0.05).

View larger version (17K):
[in this window]
[in a new window]
|
Figure 6. The Effect of AP-1 Binding Site Mutants in
Transient Transfection Assays of the 536-bp Enhancer
A, Mutations of the AP-1 binding sites in FP1 and FP3 of the decidual
PRL enhancer region markedly decrease enhancer activity. Treated
decidual fibroblast cells were transfected with pGL3-TK expression
plasmids containing the wild-type 536-bp enhancer (536bp(+)TK) or
mutants of the enhancer with nucleotide substitutions in the AP-1
binding sites (black blocks) within FP1 (FP1AP1 mut),
FP3 (FP3AP1 mut), or both sites (FP1&3AP1 mut). The sequences of the
mutations are described in Materials and Methods. Each
bar represents the mean of triplicate wells, and the
bars enclose 1 SE. The results are expressed
relative to the activity of empty vector pGL3-TK(TK), which has been
assigned a value of 1. Similar results were observed in three other
experiments. *, P < 0.001; **,
P < 0.01 relative to the wild-type 536-bp enhancer
(536bp(+)TK). B, Coexpression of a dominant negative AP-1 mutant. In
transient transfection assays of treated decidual fibroblast cells,
coexpression of pCMV/A-fos (3 µg) with 536bp(+)TK resulted in a 70%
decrease in enhancer expression. Expression of the vector alone
(pRc/CMV) showed approximately 40% decrease in expression of the
enhancer. **, P < 0.01.
|
|
To determine which member(s) of the AP-1 transcription factor family in
the decidua bind to the AP-1 sites in FP1 and FP3, supershift analyses
were performed using antisera against c-Fos, c-Jun, Fos-B, JunB, and
JunD. As shown in Fig. 7A
, supershifted
complexes were detected with the antiserum to JunD but not with the
other antibodies using either labeled FP1 or labeled FP3 as probes and
nuclear extracts from decidual fibroblasts. The complex formed between
labeled FP1 or FP3 and the nuclear extracts was only partially
supershifted by the JunD antiserum. However, as shown in Fig. 7B
, the
formation of the complex between JunD and the JunD antiserum was
completely prevented by the addition of excess JunD protein. Since the
complex was not completely supershifted upon incubation of extracts
with JunD antiserum, additional supershift experiments were performed
using Fra-1 and Fra-2 antiserum. These studies showed that Fra-2, but
not Fra-1, also partially supershifted the complex using FP-1 as the
probe and nuclear extracts from treated decidual fibroblasts (Fig. 7C
).
Addition of JunD and Fra-2 antisera together affected the majority of
the AP-1-DNA complex. Similar results were obtained using FP-3 as probe
(not shown).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 7. Supershift Analysis of AP-1 Binding Sites in FP1
and FP3
Panel A shows supershift analysis using nuclear extracts from treated
decidual fibroblast cells that were incubated with antisera against
c-Fos, c-Jun, FosB, JunB, or JunD before the addition of radiolabeled
oligonucleotides encoding either FP1 or FP3. Competition studies were
performed using 100-fold excess of the FP1 or FP3 oligonucleotide.
Supershift complexes detected with JunD antisera are indicated with
arrows. Panel B shows that excess JunD protein prevents
formation of the JunD antiserum-nuclear extract complex. Supershift
analysis of nuclear extracts from treated decidual fibroblasts with an
antiserum to JunD was performed as shown in panel A. The formation of
the supershifted complexes obtained with FP1 and FP3 was prevented with
excess JunD protein. Specific complexes are indicated with
arrows. The autoradiographs were overexposed to
demonstrate the supershifted bands clearly. C, Supershift analysis of
nuclear extracts from treated decidual fibroblasts with antiserum to
Fra-1, Fra-2, and JunD, alone or in combination using FP1 as probe. A
supershifted complex detected with JunD and Fra-2 antisera is indicated
with an arrow. In addition, a reduction in the intensity
of the complex was seen. Similar results were obtained using FP-3 as
probe (not shown).
|
|
JunD was coexpressed with the 536 bp(+)pGL3-TK plasmid to determine
whether increased expression of JunD could increase enhancer activity
in treated decidual fibroblasts. As shown in Fig. 8A
, cotransfection of JunD increased
expression of the 536-bp enhancer approximately 50%. Coexpression of
the coactivator, p300, increased JunD activation of the 536-bp enhancer
by greater than 2-fold, compared with expression of the enhancer alone
(P < 0.01). Coexpression of p300 with the enhancer in
the absence of JunD did not stimulate enhancer activity.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 8. Effect of Coexpression of AP-1 Family Members, p300
and the 536-bp Enhancer
A, Coexpression of JunD and p300 with the enhancer in transient
transfection assays in decidual fibroblasts. Coexpression of JunD with
536bp(+)-pGL3-TK resulted in a small increase in luciferase activity
compared with transfection of the enhancer alone in treated decidual
fibroblast cells. Coexpression of p300, JunD, and 536bp(+)-pGL3-TK
resulted in a 2- to 3-fold increase in activity compared with
transfection of the enhancer alone. There was no significant increase
in luciferase activity upon coexpression of p300 and 536bp(+)-pGL3-TK,
in the absence of JunD. Each bar represents the
mean ± SE of triplicate wells. B, Effect of
coexpression of Ap-1 family members (Fra-1, Fra-2, c-Fos, c-Jun, and
JunB) with JunD, on JunD stimulation of 536bp(+)-pGL3-TK
expression. Coexpression of JunD with either Fra-1 or Fra-2
augmented JunD stimulation of luciferase activity by approximately 2-
and 3-fold, respectively. Moreover, coexpression of 536 bp(+)pGL3-TK
with Jun D and either Fra-1 or Fra-2 increased enhancer activity
approximately 6-fold and 10-fold, respectively, compared with cells
transfected with 536 bp(+)pGL3-TK alone. In contrast, coexpression of
JunD and other AP-1 family members (c-Fos, c-Jun, and JunB) suppressed
luciferase expression levels equivalent to those of 536bp(+)-pGL3-TK
expression alone. In addition, coexpression of Fra-2 and c-Jun (but not
c-Fos) increased enhancer activity approximately 4-fold compared with
Fra-2 alone. All experiments were performed in the presence of p300.
|
|
The effect of Ap-1 family members on JunD stimulation of 536
bp(+)pGL3-TK was determined by coexpression of JunD and either Fra-1,
Fra-2, c-Fos, c-Jun, or JunB with the enhancer, in the presence of
p300. Fra-1 and Fra-2 augmented the stimulation of 536 bp enhancer
activity by JunD, while coexpression of Jun D with either c-Fos, c-Jun,
or JunB resulted in luciferase activity levels equivalent to those in
decidual fibroblasts transfected with 536 bp(+)pGL3-TK alone (Fig. 8B
).
Coexpression of 536 bp(+)pGL3-TK with Jun D and either Fra-1 or Fra-2
increased enhancer activity approximately 6-fold and 10-fold,
respectively, compared with cells transfected with 536 bp(+)pGL3-TK
alone. Furthermore, coexpression of 536 bp(+)pGL3-TK with Fra-2
and c-Jun (but not c-Fos), stimulated enhancer activity approximately
4-fold compared with Fra-2 alone.
Earlier studies showed that the activity of 536 bp(+)pGL3-TK is absent
or very low in nondecidual cells (Fig. 2B
) and untreated decidual
fibroblasts (data not shown). However, the activity of 536 bp(+)pGL3-TK
activity in HeLa cells is increased 8- to 12-fold provided the cells
are cotransfected with Fra-2 in combination with either JunD or c-Jun
(Fig. 9
). Enhancer activity is also
increased approximately 3- to 5-fold in untreated decidual fibroblasts,
which, like nondecidual cells, do not express the enhancer.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 9. Coexpression of 536 bp(+)pGL3-TK, JunD and Fra-2
with p300 and AP-1 Family Members in Transient Transfection Assays of
HeLa cells and Untreated Decidual Fibroblasts [DF(-)]
Coexpression of Hela cells and untreated decidual fibroblasts
with JunD or Fra-2 gave a similar pattern of enhancer activity as seen
in treated decidual fibroblasts (Fig. 8B ).
|
|
Immunohistochemical Staining with JunD and Fra-2 Antiserum
To determine whether the expression of JunD and Fra-2 proteins is
increased in vivo during decidualization when PRL expression
is induced, immunohistochemical analysis was performed. Sections of
human endometrium from the proliferative and secretory phases of the
menstrual cycle, and human decidua from early pregnancy, were incubated
with JunD and Fra-2 antiserum. A similar pattern of expression of JunD
and Fra-2 proteins was detected. JunD and Fra-2 immunopositive cells
(Fig. 10
, A and D, respectively) were
few and widely scattered in stroma and glands of proliferative phase
endometrium, which does not express PRL (14). In contrast, JunD and
Fra-2 immunopositive cells were abundant in stroma and glands of late
secretory phase endometrium (Fig. 10
, B and E, respectively) and
decidua from early pregnancy (Fig. 10
, C and F, respectively), when
PRL is highly expressed (14).

View larger version (149K):
[in this window]
[in a new window]
|
Figure 10. Immunohistochemical Stain for JunD and Fra-2 in
Human Endometrium and Decidua
In late proliferative endometrium, scattered JunD (panel A) and Fra-2
(panel D) immunoreactive cells were present in the stroma and the
glands. A marked increase in immunoreactivity was seen in both cell
types in late secretory endometrium with JunD (panel B) and Fra-2
(panel E) antiserum. The most prominent JunD (panel C) and Fra-2 (panel
F) immuno-staining was seen in sections from early pregnancy decidua.
Bar shown represents 200 µM.
|
|
 |
DISCUSSION
|
|---|
An enhancer of decidua-specific PRL gene expression was localized
to nt -2,040 and -1,505 of the 5'-flanking region of the human PRL
gene. Like other enhancers, the decidual PRL enhancer can activate a
promoter when placed at 1000 or more bp from the transcription
initiation site and can activate a promoter when placed in either the
forward or reverse orientation relative to the promoter. The ability of
the -2,040/-1,505 fragment to confer enhancer activity to the TK
promoter was observed in endometrial stromal cells decidualized
in vitro with MPA and estradiol, decidual fibroblast cells
treated with MPA, estradiol, and cAMP, and N5 endometrial cells but was
not observed in Jurkat, BeWo, or HeLa cells. These later findings
strongly suggest that the activity of the enhancer is deciduas
specific.
The 536-bp enhancer contains three regions protected by DNase I
footprinting (FP1, -2, and -3). Transfection studies revealed that
enhancer activity is localized to FP1 and FP3, both of which contain
AP-1 binding sites. Mutation of either binding site decreased enhancer
activity by about 50%, and mutations of both sites almost completely
abolished enhancer activity, strongly suggesting that the two sites are
critical for enhancer activity. In addition, expression of the enhancer
region is decreased upon cotransfection of the 536-bp enhancer region
and a dominant negative AP-1 mutant, A-fos, which antagonizes the DNA
binding of Fos:Jun heterodimers (15).
The AP-1 complex is a heterodimer of Jun and Fos, members of the bZIP
family of transcription factors. The Jun family consists of three
proteins, c-Jun, JunD, and JunB, while the Fos family contains four
proteins, c-Fos, FosB, Fra-1, and Fra-2 (16). Supershift experiments
using nuclear extracts of decidual fibroblast cells demonstrated that
AP-1 sites in both FP1 and FP3 bind JunD and Fra-2 but not c-Jun,
c-Fos, FosB, JunB, or Fra-1. Furthermore, excess unlabeled JunD protein
prevented the formation of the supershifted complex that was formed by
the JunD antiserum and the complex formed by the interaction of FP1 and
FP3 with nuclear extracts from decidual fibroblast cells. However, the
complex formed between labeled FP1 and FP3 and the nuclear extracts was
only partially supershifted even when both JunD and Fra-2 antisera were
added, suggesting that additional transcription factor(s) other than
JunD and Fra-2 may also bind the AP-1 site. Transfection of AP-1 family
members with the 536-bp enhancer demonstrated that after
coexpression of 536 bp(+)pGL3-TK with Fra-2 and Jun D or c-Jun,
enhancer activity was stimulated approximately 6-fold and 10-fold
respectively in treated decidual fibroblasts. While the supershift data
did not suggest a role for Fra-1 or c-Jun in binding the retarded
complex in decidual fibroblast nuclear extracts, the transfection data
support a potential role for Fra-1 and c-Jun. Moreover, the PRL
enhancer can be activated in nondecidual cells that do not express PRL,
(e.g. HeLa cells), and in cells that express low levels of
PRL (e.g. untreated decidual fibroblasts), provided JunD,
Fra-2, Fra-1, or c-Jun levels are not limiting.
The role of additional transcription factors in activation of the
decidual PRL enhancer cannot be excluded. Analysis of 100-bp enhancer
fragments of the 536-bp enhancer demonstrated that plasmids containing
the 1,704/-1,605 fragment, which overlaps FP1, enhanced luciferase
activity by 4-fold. In contrast, fragment 1,739/--1,640, which
overlaps FP1, had no effect on luciferase activity. Therefore the
region between 1,640/--1,605, while not part of a footprinted
region, is part of the 1,704/--1,605 fragment that enhances
luciferase activity and may play a role in activation of the enhancer.
The region between 1,640/-1,605 has putative binding sites for the
SV40 transcriptional enhancer factor 1 or TEF-1 (-1,634/-1,626) and
an erythroid-cell-specific nuclear factor or NF-E1.6 (-1,623/-1,116).
The role of these transcription factors, and the region between
-1,640/-1,605 of the enhancer is unclear at present and will be
explored in future experiments.
Since JunD activation of the decidual PRL enhancer is stimulated by
coexpression of the cellular coactivator p300, our studies suggest that
this factor may be part of the AP-1 multiprotein complex in the
5'-flanking region of the decidual PRL gene. There is growing evidence
that coactivators provide critical interaction points between nuclear
receptors and signal transduction pathways. p300 is closely related to
the cAMP-responsive elements binding protein coactivator protein (CBP)
and, like CBP, is thought to serve as a macromolecular docking platform
for transcription factors from several signal transduction cascades,
including the glucocorticoid and progesterone receptors (17). Some
coactivators, such as p300, have intrinsic histone acetyltransferase
activity that has been proposed to loosen chromatin structure and
facilitate the binding of transcription machinery components to DNA. By
transducing nuclear receptor signaling, coactivators can also define
the sensitivity of a cell to steroid hormones in a tissue-specific
manner. Overexpression of p300 has been demonstrated to stimulate
transcription through an AP-1 site in the collagenase promoter (18).
These studies showed that p300 is a coactivator for cJun and JunB. We
now report that p300 can act as a coactivator for JunD activation of
the decidual PRL enhancer.
Several signaling pathways activate AP-1 complexes composed of a number
of different family members (19). Moreover, there is accumulating
evidence that AP-1 complex composition can play a role in selectively
regulating gene expression during cell differentiation. For example,
during normal bone development JunD/Fra-2 dimers predominate in AP-1
complexes in differentiated osteoblasts (20). Regulation of the murine
laminin
3A promoter by a JunD/Fra-2 AP-1 complex, in combination
with TGF-ß during wound healing, has also been reported in skin wound
healing (21). Our studies support a role for a JunD/Fra-2 Ap-1 complex
in regulation of the decidual PRL enhancer.
Previous studies have reported c-Fos and c-Jun expression in human
proliferative and early to midsecretory endometrium, as well as in
fibroblasts derived from human uterine endometrium (22). The expression
of c-Fos and c-Jun in these cells is related to the estrogen receptor
status and is partly mediated via the protein kinase C pathway. In our
studies, coexpression of Fra-2 and c-Jun stimulated the PRL enhancer,
suggesting that Fra-2 may also form heterodimers with c-Jun. This
effect was not seen with c-Fos, which is closely related to Fra-2 in
its biological and biochemical functions. Earlier studies have shown
that a multiprotein complex including p300 and Fra-2/c-Jun heterodimers
activates the mouse major histocompatibility class I enhancer (23). In
chicken embryo fibroblasts the transcriptional activity of Fra-2/cJun
heterodimers is enhanced by mitogen-activated protein kinase (24).
Hormonal induction of several members of the AP-1 family (JunD, JunB,
and c-Jun but not FosB) also occurs in the rat uterus (25). There are,
however, no previous studies showing similar changes in the human
uterus or decidua. Our immunohistochemical analysis shows that the
expression of JunD and Fra-2 is increased in endometrial stromal cells
in secretory phase compared with proliferative phase, and that JunD is
highly expressed in decidua of early pregnancy. PRL is not present in
the endometrial stromal cells until the late secretory phase of the
menstrual cycle and is induced to high levels in decidua of pregnancy
(14), similar to the expression pattern of JunD and Fra-2. Our findings
indicate a potential correlation between increased expression of JunD,
Fra-2, and PRL. Future studies to colocalize expression of JunD, Fra-2,
and PRL would confirm this observation. The expression of JunD and
Fra-2 in endometrial glands, which do not express PRL, suggests that
JunD and Fra-2 may be required but not sufficient for induction of
decidual PRL gene expression.
AP-1 activity in endometrial adenocarcinoma cells is regulated by the
progesterone receptor (PR) (26). Since the progesterone receptor plays
a pivotal role in the induction of PRL gene expression during human
endometrial cell differentiation, these findings and those of the
present report suggest that the induction of decidual PRL gene
expression during endometrial stromal cell differentiation may be
regulated, at least in part, by the differential expression of AP-1
family members by progesterone and other factors.
In summary, we conclude that a decidua-specific enhancer in the
5'-flanking region of the human PRL gene is activated through two
multiprotein AP-1 complexes that consist of JunD/Fra-2, and possibly,
Fra-2/cJun and the cellular coactivator, p300.
 |
MATERIALS AND METHODS
|
|---|
Plasmid Constructs and Oligonucleotides
A plasmid containing the 5'-flanking region of the decidual PRL
gene was constructed by ligating a DNA fragment of the decidual PRL
gene from nt -2,927 to +66 (relative to the decidual PRL initiation
site) into pGL3-enhancer (pGL3E, Promega Corp., Madison,
WI). The fragment was generated by ligating together two smaller
(-2,927/-1,185 and 1,480/+66) fragments that were amplified by PCR
from a human placental DNA library using primers encoding the decidual
PRL gene, as previously described (2). The sequence of the 2,927/+66
fragment was determined before ligation into pGL3E to be certain that
the sequence was identical to the published sequence (2). Plasmids
containing smaller fragments of the 5'- flanking region were prepared
in a similar manner using fragments of the -2,927/+66 region that were
generated by digestion with mung bean nuclease and restriction enzymes.
Thymidine kinase (TK) promoter reporter constructs were prepared using
a luciferase (Luc) reporter gene in pGL3 basic (pGL3-TK), that was
constructed using a 160-bp BglIIBamHI fragment
of the TK-promoter that was excised from pBL-CAT-2 and inserted into
the BglII site of pGL3-basic. A 536-bp fragment of the 5'-
flanking region (nt 2,040/-1,505), which was excised from the
decidual PRL -2,927/+66 pGL3E construct by digestion with
StuI and PvuII, was ligated in either the plus or
minus orientations into pGL3-TK at a XhoI site upstream of
the TK promoter to generate 536(+)TK and 536(-)TK. Ten additional
TK-Luc plasmids containing 100-bp fragments of the 5'-flanking region
were generated with fragments encoding nt 2,038/-1,940,
-2,004/-1,905, -1,939/-1,840, -1,904/-1,805, -1,839/-1,740,
-1,804/-1,705, -1,739/-1,640, -1,704/-1,605, -1,639/-1,540,
-1,604/-1,505. The ten 100-bp fragment TK reporter constructs were
amplified from decidual PRL 2,927/+66 pGL3E by PCR, gel purified
using the MERMAID kit (BIO 101, Inc., Vista, CA), and cloned into pCR
2.1 vector using the TA Cloning System (Invitrogen, San
Diego, CA). After confirming the orientation of these fragments by
sequencing with Sequenase Version 2.0 (Amersham Pharmacia Biotech, Arlington Heights, IL), the
SacIXhoI fragments were excised from pCR2.1 and
ligated to the SacI-XhoI site of pGL3-TK. The
87-bp SacIXhoI fragment from pCR2.1 has no
transcriptional activity as verified by transient transfection
assays.
For gel shift analysis, mutants of AP-1 consensus sites in footprinted
regions of the 536-bp enhancer region (FP1 and FP3) were generated
using mutated oligonucleotides and 536 bp (plus orientation or +)
pGL3-TK plasmid with Quick Change Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA). The construction of all these
plasmids was confirmed by sequencing. An oligonucleotide with the
consensus AP-1 sequence (in bold) used in gel shift
analysis, purchased from Santa Cruz Biotechnology, Inc.
(Santa Cruz, CA), has the following sequence:
GCCGCAAGTGAGTCAGCGCGGG. The oligonucleotide for FP1 (nt
1,710/-1,687 of the 5'-flanking region of decidual PRL) and FP3 (nt
1,869/-1846) in which the AP-1 consensus site in shown in
bold were as follows: TATAACATGATTCAGAATCACACG
and AATTTTATGACACATGCAAGACTC, respectively. Bases within
these oligonucleotides were changed in the AP-1 consensus site (CA to
tg) to generate the mutants FP1AP-1 mut and FP3AP-1 mut as follows:
TATAACATGATTtgGAATCACACG and
AATTTTATGACAtgTGCAAGACTC, respectively. The expression
vector for a dominant negative to AP-1, CMV500/A-Fos, and the control
vector pRc/CMV was kindly provided by Charles Vinson (NIH, Bethesda,
MD). The expression vectors for RSV-JunD, pRSVc-Jun, pRSVJunB, and
pSVEc-fos were kindly provided by Moshe Yaniv (Paris, France).
pCMV-Fra-2 was purchased from the American Type Culture Collection (Manassas, VA), and pRSV-Fra-1 was kindly provided by
Michael Karin (La Jolla, CA).
Cell Culture
To prepare primary cultures of endometrial stromal cells (ESC),
uterine endometrial tissue was obtained from women with normal
menstrual cycles at the time of elective tubal ligation. Informed
consent was obtained from patients, and the Institutional Review Boards
of Childrens Hospital Medical Center and the University of Cincinnati
approved the study. Proliferative or secretary phase endometrium was
removed by suction biopsy and stromal cells were prepared as previously
described (27). ESC were cultured in DMEM containing 2% FBS, 25 U/ml
penicillin G, 25 µg/ml streptomycin, and 2.5 µg/ml
Amphotericin (Life Technologies,
Gaithersburg, MD).
To prepare the primary culture of decidual fibroblast cells, term human
placenta from cesarean section or vaginal delivery after uncomplicated
pregnancies were obtained with institutional Review Board approval from
Childrens Hospital Medical Center, Cincinnati, OH. The isolation of
cells from decidua parietalis tissue dissected from fetal membranes was
begun within 12 h after delivery, and the decidual fibroblast cells
were prepared as previously described (3). After three subpassages,
cells were plated and cultured in RPMI 1640 medium containing 2% FBS.
The N5 cell line, a human endometrial stromal cell clone immortalized
by transfection with an origin-defective construct of the temperature-
sensitive mutant of SV40 was kindly provided by Drs. C.A. Rinehart and
D.G. Kaufman (University of North Carolina, Chapel Hill, NC)(28). The
cells were cultured in 1:1 mixture of Hams F12 and Medium 199
supplemented with 2% FBS at 37 C as previously described (5). All
other cells were obtained from the American Type Culture
Collection. BeWo human choriocarcinoma cells (ATCC CCL-98) were
grown in Hams F12-K supplemented with 15% FBS. HeLa human cervical
carcinoma cells, Jurkat human T cell leukemia cells (ATCC TIB-152), and
IM-9 human B cell lymphoblast cells (ATCC CCL-159) were grown in RPMI
1640 with 10% FBS.
Treatment for Decidualization
To induce decidualization of endometrial stromal cells,
subconfluent cultures were grown in media containing 1 µM
MPA and 10 nM estradiol-17 (estradiol) as previously
described (27). The medium was changed every third day and experiments
were performed on treatment day 14. To decidualize decidual fibroblast
cells, the cultures after cell passage were maintained in media
containing 1 µM MPA, 10 nM estradiol, and 50
nM (Bu)2cAMP for 1215 days before
performing experiments. All chemicals were purchased from
Sigma (St. Louis, MO).
Transient Transfection
All DNA plasmids used in transient transfection studies were
purified by QIAGEN plasmid Maxi kits
(QIAGEN, Valencia, CA). The endometrial stromal
cells, decidual fibroblast cells, and N5 cells were transfected with
the luciferase-PRL promoter constructs at 90100% confluency using
the calcium phosphate precipitation method (5). BeWo and HeLa cells
were transfected by the same method at 6070% confluency. Cells
cultured in six-well dishes were incubated for 4 h with 10 µg
per well luciferase-PRL promoter constructs. After 4 h, the cells
were rinsed with PBS, incubated in growth media, and harvested 48
h after transfection using lysis buffer (Tropix Inc., Bedford, MA).
In experiments in which the AP-1 family of transcription factors
(2 µg/six-well cluster) and p300 (1 µg/six-well cluster) were
coexpressed with the 536 bp(+)pGL3-TK plasmid, the growth media were
replaced with serum-free media for the last 24 h before
harvesting. The cell lysate was centrifuged (12,000 x
g for 5 min), and the supernatant was assayed for luciferase
(Promega Corp.) or ß-galactosidase (Tropix, Inc.) using
a Berthold 9501 luminometer (Berthold Systems, Inc., Pittsburgh,
PA). All transfection results were normalized to ß-galactosidase
activity resulting from cotransfection of 0.5 µg per well of
pSV-ßgal (Promega Corp.). The values represent the
mean ± SE of triplicate wells. All
transfections were performed in at least three separate experiments. As
controls, cells were transfected with the promoter-less luciferase
vector (pGL3E or pGL3B).
DNase I Footprint Analysis
Nuclear extracts were prepared by the method of Bakke and Lund
(29), and DNase I footprint analysis was performed as described by
Brenowitz et al. (30). Protected regions were detected by
comparing the digestion patterns to that of control reactions using BSA
in place of nuclear extracts.
Gel Shift Assays
DNA fragments of the PRL promoter were prepared and labeled by
PCR amplification. Nuclear extracts were incubated for 10 min at room
temperature in 20 mM Tris buffer, pH 7.6, with 10%
glycerol and 40 ng/ml poly [d(I-C)]. A
32P-labeled oligonucleotide probe was added and
the incubation continued for 10 min. The mixture was electrophoresed on
a 5% polyacrylamide gel in 0.5 x TBE (Tris-borate-EDTA).
Where indicated, 100-fold molar excess competing nonlabeled
oligonucleotides were added along with the probe to determine the
specificity of binding. For supershift analysis, nuclear extracts were
incubated with the appropriate antibody before addition of the
radiolabeled probe. Antibodies to JunD, JunB, cJun, c-Fos, and FosB
were purchased from Geneka Biotechnology, Inc. (Montreal, Canada) and
antibodies to Fra-1 and Fra-2 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and used according to the
instructions provided.
Immunohistochemical Analysis
Sections from human endometrium during the proliferative and
secretory phases of the menstrual cycle and from decidua of early
pregnancy were analyzed by immunohistochemistry for the presence of Jun
D using an antirabbit polyclonal antibody (329) raised against the
carboxy terminus of Jun D p39 (Santa Cruz Biotechnology, Inc.). This antibody does not cross-react with Jun B or c-Jun.
The Fra-2 antibody (Q20) used is a polyclonal antibody raised against
the amino terminus of Fra-2 of human origin (Santa Cruz Biotechnology, Inc.). This antibody is non-cross-reactive with
Fra-1, c-Fos, and Fos B. Tissue sections were prepared and stained as
previously described (31).
Statistical Analysis
Statistical differences between group means was determined by
ANOVA with Bonferroni adjustment or a Students t
test, depending on design. Differences were considered
significant when P < 0.05. The data are presented
as the mean ± SE.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Stephen Glasser and Dr. Jeffrey Whitsett for their
helpful suggestions, Charles Vinson for the expression plasmid
CMV500/A-Fos, Moshe Yaniv for the expression plasmids for the AP-1
family, and Michael Karin for the expression plasmid for Fra-1.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Anoop K. Brar, Ph.D., Division of Endocrinology, Childrens Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, Ohio 45229-3039. E-mail: anoop.brar{at}chmcc.org
This work was supported by NIH Grant HD-05201.
Received for publication January 11, 2000.
Revision received December 14, 2000.
Accepted for publication January 5, 2001.
 |
REFERENCES
|
|---|
-
DiMattia GE, Gellersen B, Duckworth ML, Friesen HG 1990 Human prolactin gene expression. The use of an alternative noncoding
exon in decidua and the IM-9-P3 lymphoblast cell line. J
Biol Chem 265:1641216421[Abstract/Free Full Text]
-
Gellersen B, Kempf R, Telgmann R, DiMattia GE 1994 Nonpituitary human prolactin gene transcription is independent of Pit-1
and differentially controlled in lymphocytes and in endometrial stroma.
Mol Endocrinol 8:356373[Abstract/Free Full Text]
-
Richards RG, Brar AK, Frank GR, Hartman SM, Jikihara H 1995 Fibroblast cells from term human decidua closely resemble endometrial
stromal cells: induction of prolactin and insulin- like growth factor
binding protein-1 expression. Biol Reprod 52:609615[Abstract]
-
Brosens JJ, Takeda S, Acevedo CH, Lewis MP, Kirby PL, Symes
EK, Krausz T, Purohit A, Gellersen B, White JO 1996 Human endometrial
fibroblasts immortalized by simian virus 40 large T antigen
differentiate in response to a decidualization stimulus. Endocrinology 137:222531[Abstract]
-
Brar AK, Kanda Y, Kessler CA, Cedars MI, Handwerger S 1999 N5
endometrial stromal cell line: a model system to study decidual
prolactin gene expression. In Vitro Cell Dev Biol Anim 35:1504[Medline]
-
Huang JR, Tseng L, Bischof P, Jänne OA 1987 Regulation
of prolactin production by progestin, estrogen, and relaxin in human
endometrial stromal cells. Endocrinology 121:20112017[Abstract/Free Full Text]
-
Irwin JC, Kirk D, King RJ, Quigley MM, Gwatkin RB 1989 Hormonal regulation of human endometrial stromal cells in culture: an
in vitro model for decidualization. Fertil Steril 52:761768[Medline]
-
Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S 1997 Progesterone-dependent decidualization of the human endometrium is
mediated by cAMP. Endocrine 6:301307[Medline]
-
Telgmann R, Maronde E, Tasken K, Gellersen B 1997 Activated
protein kinase A is required for differentiation-dependent
transcription of the decidual prolactin gene in human endometrial
stromal cells. Endocrinology 138:92937[Abstract/Free Full Text]
-
Pohnke Y, Kempf R, Gellersen B 1999 CCAAT/enhancer-binding
proteins are mediators in the protein kinase A-dependent activation of
the decidual prolactin promoter. J Biol Chem 274:2480824818[Abstract/Free Full Text]
-
Gellersen B, DiMattia GE, Friesen HG, Bohnet HG 1989 Prolactin
(PRL) mRNA from human decidua differs from pituitary PRL mRNA but
resembles the IM-9-P3 lymphoblast PRL transcript. Mol Cell Endocrinol 64:127130[CrossRef][Medline]
-
Berwaer M, Martial JA, Davis JR 1994 Characterization of an
up-stream promoter directing extrapituitary expression of the human
prolactin gene. Mol Endocrinol 8:635642[Abstract/Free Full Text]
-
Lockwood CJ, Krikun G, Hausknecht VA, Papp C, Schatz F 1998 Matrix metalloproteinase and matrix metalloproteinase inhibitor
expression in endometrial stromal cells during progestin-initiated
decidualization and menstruation-related progestin withdrawal.
Endocrinology 139:46074613[Abstract/Free Full Text]
-
Maslar IA, Riddick DH 1979 Prolactin production by human
endometrium during the normal menstrual cycle. Am J Obstet Gynecol 135:751754[Medline]
-
Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, Vinson
C 1997 A dominant negative to activation protein-1 (AP1) that abolishes
DNA binding and inhibits oncogenesis. J Biol Chem 272:1858618594[Abstract/Free Full Text]
-
Angel P, Karin M 1991 The role of Jun, Fos and the AP-1
complex in cell-proliferation and transformation. Biochim Biophys Acta 1072:129157[Medline]
-
Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB 1998 Progesterone regulates transcription of the p21 (WAF1) cyclin-dependent
kinase inhibitor gene through SP1 and CBP/300. J Biol Chem 273:1069610701[Abstract/Free Full Text]
-
Lee JS, See RH, Deng T, Shi Y 1996 Adenovirus E1A
downregulates cJun- and JunB-mediated transcription by targeting their
coactivator p300. Mol Cell Biol 16:43124326[Abstract]
-
Karin M, Liu Z, Zandi E 1997 AP-1 function and regulation.
Curr Opin Cell Biol 9:240246[CrossRef][Medline]
-
McCabe LR, Banerjee C, Kundu R, Harrison RJ, Dobner PR, Stein
JL, Lian JB, Stein GS 1996 Developmental expression and activities of
specific fos and jun proteins are functionally related to osteoblast
maturation: role of Fra- 2 and Jun D during differentiation.
Endocrinology 137:43984408[Abstract]
-
Virolle T, Monthouel MN, Djabari Z, Ortonne JP, Meneguzzi G,
Aberdam D 1998 Three activator protein-1-binding sites bound by the
Fra-2.JunD complex cooperate for the regulation of murine laminin
3A
(lama3A) promoter activity by transforming growth factor-ß. J
Biol Chem 273:1731817325[Abstract/Free Full Text]
-
Salmi A, Ammala M, Rutanen EM 1996 Proto-oncogenes c-jun and
c-fos are down-regulated in human endometrium during pregnancy:
relationship to oestrogen receptor status. Mol Hum Reprod 2:979984[Abstract/Free Full Text]
-
Brockmann D, Putzer BM, Lipinski KS, Schmucker U, Esche H 1999 A multiprotein complex consisting of the cellular coactivator p300,
AP-1/ATF, as well as NF-
B is responsible for the activation of the
mouse major histocompatibility class I (H-2K(b)) enhancer A. Gene Expr 8:118[Medline]
-
Murakami M, Ui M, Iba H 1999 Fra-2-positive autoregulatory
loop triggered by mitogen-activated protein kinase (MAPK) and Fra-2
phosphorylation sites by MAPK. Cell Growth Differ 10:333342[Abstract/Free Full Text]
-
Cicatiello L, Sica V, Bresciani F, Weisz A 1993 Identification
of a specific pattern of "immediate-early" gene activation induced
by estrogen during mitogenic stimulation of rat uterine cells. Receptor 3:1730[Medline]
-
Bamberger AM, Bamberger CM, Gellersen B, Schulte HM 1996 Modulation of AP-1 activity by the human progesterone receptor in
endometrial adenocarcinoma cells. Proc Natl Acad Sci USA 93:61696174[Abstract/Free Full Text]
-
Brar AK, Frank GR, Richards RG, Meyer AJ, Kessler CA, Cedars
MI, Klein DJ, Handwerger S 1995 Laminin decreases PRL and IGFBP-1
expression during in vitro decidualization of human
endometrial stromal cells. J Cell Physiol 163:3037[CrossRef][Medline]
-
Rinehart CA, Laundon CH, Mayben JP, Lyn-Cook BD, Kaufman DG 1993 Conditional immortalization of human endometrial stromal cells
with a temperature-sensitive simian virus 40. Carcinogenesis 14:993999[Abstract/Free Full Text]
-
Bakke M, Lund J 1995 Mutually exclusive interactions of two
nuclear orphan receptors determine activity of a cyclic adenosine
3',5'-monophosphate-responsive sequence in the bovine CYP17 gene. Mol
Endocrinol 9:327339[Abstract/Free Full Text]
-
Brenowitz M, Senear DF, Shea MA, Ackers GK 1986 Quantitative
DNase footprint titration: a method for studying protein-DNA
interactions. Methods Enzymol 130:132181[Medline]
-
Shah M, Stanek J, Handwerger S 1998 Differential localization
of heat shock proteins 90, 70, 60 and 27 in human decidua and placenta
during pregnancy. Histochem J 30:509518[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee
What Can We Learn from Rodents about Prolactin in Humans?
Endocr. Rev.,
February 1, 2008;
29(1):
1 - 41.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Hipkaeo, T. Wakayama, M. Yamamoto, and S. Iseki
Expression and Localization of the Transcription Factor JunD in the Duct System of Mouse Submandibular Gland
J. Histochem. Cytochem.,
April 1, 2004;
52(4):
479 - 490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-R. Landry and D. L. Mager
Functional Analysis of the Endogenous Retroviral Promoter of the Human Endothelin B Receptor Gene
J. Virol.,
July 1, 2003;
77(13):
7459 - 7466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Y. H. Mak, J. J. Brosens, M. Christian, F. A. Hills, L. Chamley, L. Regan, and J. O. White
Regulated Expression of Signal Transducer and Activator of Transcription, Stat5, and its Enhancement of PRL Expression in Human Endometrial Stromal Cells in Vitro
J. Clin. Endocrinol. Metab.,
June 1, 2002;
87(6):
2581 - 2588.
[Abstract]
[Full Text]
[PDF]
|
 |
|