help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, K.
Right arrow Articles by Brar, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, K.
Right arrow Articles by Brar, A. K.
Right arrowPubmed/NCBI databases
*OMIM
*Substance via MeSH
Molecular Endocrinology 15 (4): 638-653
Copyright © 2001 by The Endocrine Society

Identification of a Decidua-Specific Enhancer on the Human Prolactin Gene with Two Critical Activator Protein 1 (AP-1) Binding Sites

Kako Watanabe, Cherie A. Kessler, Cindy J. Bachurski, Yuki Kanda, Brian D. Richardson, Jerzy Stanek, Stuart Handwerger and Anoop K. Brar

Division of Endocrinology (K.W., C.A.K., Y.K., B.D.R., S.H., A.K.B.) and Pulmonary Biology (C.J.B.) Children’s Hospital Research Foundation Department of Pediatrics, and Department of Pathology (J.S.) University of Cincinnati College of Medicine Cincinnati, Ohio 45229-3039


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Deletion analysis of the human PRL promoter in endometrial stromal cells decidualized in vitro revealed a 536-bp enhancer located between nucleotide (nt) -2,040 to -1,505 in the 5'-flanking region. The 536-bp enhancer fragment ligated into a thymidine kinase (TK) promoter-luciferase reporter plasmid conferred enhancer activity in decidual-type cells but not nondecidual cells. DNase I footprint analysis of decidualized endometrial stromal cells revealed three protected regions, FP1–FP3. Transfection of overlapping 100-bp fragments of the 536-bp enhancer indicated that FP1 and FP3 each conferred enhancer activity. Gel shift assays indicated that both FP1 and FP3 bind activator protein 1 (AP-1), and JunD and Fra-2 are components of the AP-1 complex in decidual fibroblasts. Mutation of the AP-1 binding site in either FP1 or FP3 decreased enhancer activity by approximately 50%, while mutation of both sites almost completely abolished activity. Coexpression of the 536-bp enhancer and A-fos, a dominant negative to AP-1, decreased enhancer activity by approximately 70%. Conversely, coexpression of Fra-2 in combination with JunD or c-Jun and p300 increased enhancer activity 6- to 10-fold. Introduction of JunD and Fra-2 into nondecidual cells is sufficient to confer enhancer activity. JunD and Fra-2 protein expression was markedly increased in secretory phase endometrium and decidua of early pregnancy (high PRL content) compared with proliferative phase endometrium (no PRL). These investigations indicate that the 5'-flanking region of the human PRL gene contains a decidua-specific enhancer between nt -2,040/-1,505 and AP-1 binding sites within this enhancer region are critical for activity.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The expression of PRL in extrapituitary tissues, such as uterine decidua and lymphocytes, is regulated by a different promoter than the promoter that regulates pituitary PRL gene expression (1). The pituitary PRL promoter is located immediately upstream of the transcription initiation site in exon 1, while the promoter for PRL in extrapituitary tissues is located immediately upstream of exon 1a, which is 5.3 kb upstream of the same initiation site. At present, very little is known about the cis-acting elements on the decidual PRL promoter and the transcription factors that are important in the regulation of decidual PRL gene expression.

Transfection studies indicate that the decidual PRL promoter is transcriptionally active in decidualized endometrial stromal cells but not in undecidualized endometrial stromal cells, strongly suggesting that endometrial stromal cells must undergo decidualization before the PRL gene is expressed (2). Decidualization can be induced in vitro by incubating primary cultures of endometrial stromal cells with medroxyprogesterone acetate (MPA) in combination with estradiol or relaxin, or with high levels of cAMP in the absence of exogenous hormone. PRL gene expression can also be induced in primary cultures of human decidual fibroblasts (3) and in St-2 cells, a human endometrial fibroblast cell line that was immortalized by infection with simian 40 virus (4). MPA, alone or in combination with estradiol, was unable to induce PRL gene expression in the decidual fibroblast and St-2 cells, but potentiated the effect of cAMP on PRL expression in these cells. PRL gene expression has also been observed in the N5 endometrial cell line that was immortalized by transfection with an SV40 mutant and which expresses the PRL gene driven by the extrapituitary promoter (5). The N5 cells have phenotypic features of primary cultures of decidualized human endometrial stromal cells and secrete low levels of PRL and insulin-like growth factor binding protein-1 (IGFBP-1), both of which are markers of decidualized endometrial cells (6, 7).

To date, few studies have examined the molecular mechanisms involved in the induction of decidual PRL gene expression during endometrial stromal cell decidualization. Several studies have shown that the cAMP signal cascade is activated during in vitro decidualization (8, 9). Telgmann et al. (9) have demonstrated that activation of protein kinase A is required for induction of decidual PRL gene transcription. Within 12 h of treatment with 8-Br-cAMP, a weak induction of gene expression occurs that is mediated by an imperfect cAMP response element at position -12 relative to the transcription start site. A strong induction that is dependent on a region of the decidual PRL promoter at -332/-270 occurs after 12 h (9). More recently, CCAAT/enhancer binding proteins in endometrial stromal cell extracts have been shown to be important in transducing the cAMP signal to the decidual PRL promoter (10).

A few studies have been performed on PRL gene expression in the human B-lymphoblastoid cell line IM-9-B-3 (11) and the T-lymphoblastic Jurkat cell line (12). Both cell lines express a PRL mRNA that appears to be identical to that of the decidual PRL mRNA. Berwaer and co-workers (12) noted that the region of the promoter between nt -453 and -67 is critical for basal activity of the promoter in the Jurkat cell line. DNase I footprinting studies and further 5'- and 3'-deletion analyses identified transcription factor binding sites within an enhancer element localized at -375 to -212 bp, which contributed approximately 50% of the promoter activity in the lymphoid cells (12). The transcription factors that bind to this region of the promoter have not been characterized, and similar experiments were not subsequently performed in endometrial stromal cells. In addition, footprint analysis has not been performed using nuclear extracts from decidual cells.

In this study, we determined by deletion analysis that the 5'-flanking region of the human PRL gene between nt –2,040 and –1,505 acts as an enhancer of gene expression in decidualized endometrial stromal cells and fibroblasts, and in N5 endometrial cells. Using DNase I footprint analysis, gel mobility shift assays, and transient transfection assays, we found that JunD and Fra-2 bind two activator protein-1 (AP-1) response elements in the enhancer to activate transcription in decidua-type cells but not nondecidual cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Deletion Analysis of the Decidual PRL Promoter
To determine the location of putative cis-acting regulatory elements on the 5'- flanking region of the decidual PRL gene, a series of deletion constructs (nt -2,927 to +66) were transfected into primary cultures of endometrial stromal cells that had been decidualized in vitro by treatment with MPA and estradiol (Fig. 1Go). Transient transfection of expression vectors containing nt –2,927/+66 and nt –2,040/+66 of the 5'-flanking region coupled to a luciferase reporter gene resulted in increases in luciferase activity that were 20- and 23-fold greater than that of the expression vector without the promoter (pGL3E). Deletion of the 536 bp of the 5'-flanking region from nt –2,040 to –1,505 resulted in a 2.4-fold decrease in luciferase activity. Deletion of the promoter to nt -317 had no further effect. However, deletion from nt -317 to -6 resulted in a loss of luciferase expression to levels identical to that observed with pGL3E alone. Transient transfection of the same series of deletion constructs into N5 endometrial stromal cells and treated decidual fibroblast cells, both of which express PRL under control of the decidual type PRL promoter, resulted in a similar pattern of luciferase activity (data not shown). Taken together, these results indicate that two regulatory domains are present on the 5'-flanking region of the decidual PRL gene, one domain from nt -2,040 to -1,505 and another from nt -317 to -6. The location of the proximal regulatory region is similar to that observed previously by others (2).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Deletion Analysis of the 5'-Flanking Region of the Decidual PRL Gene

Plasmid constructs containing progressive deletions of the 5'-flanking region were transiently transfected into primary cultures of human endometrial stromal cells that had been decidualized in vitro by treatment with MPA and estradiol. Each bar represents the mean ± SE of triplicate culture wells. The relative luciferase activity in each well was determined by normalizing the luciferase activity to the activity of pSV-ß-galactosidase (Promega Corp.). The mean relative luciferase activities of the wells were then normalized to the mean activity of pGL3E, which was assigned a value of 1. Similar results were observed in five other experiments with decidualized endometrial stromal cells, decidual fibroblast cells treated with MPA, estradiol, and cAMP, and N5 endometrial cells.

 
Transfection of TK-Promoter Constructs
Experiments were next performed to determine whether the 536-bp enhancer region between nt –2,040/-1,505 is capable of enhancing the activity of a heterologous promoter. The 536-bp region was subcloned in the forward and reverse orientations into pGL3-TK (Fig. 2AGo). As shown in Fig. 2BGo, the 536-bp fragment significantly enhanced luciferase activity of the TK promoter in in vitro decidualized endometrial stromal cells and treated decidual fibroblasts as well as in N5 endometrial cells. In the endometrial stromal cells and decidual fibroblasts, the 536-bp fragment of the decidual PRL promoter enhanced TK promoter activity by 4.9- and 7.0-fold in the forward orientation and by 2.3- and 2.2-fold in the reverse orientation, respectively. In N5 cells, the 536-bp fragment enhanced TK promoter activity by 3.4-fold in the forward orientation and by 4.7-fold in the reverse orientation. The 536-bp fragment in either orientation did not, however, enhance TK promoter activity in nondecidual cells (HeLa, Jurkat, and BeWo cells).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 2. Effect of the Enhancer in the 5'-Flanking Region of the Decidual PRL Gene on Activity of the Heterologous TK Promoter in Decidual and Nondecidual Cells

A, Schematic representations of pGL3-TK containing the 536-bp enhancer fragment in the forward (536bp(+)-TK) or reverse (536bp(-)-TK) orientation. B, Transient transfections were performed with the three pGL3-TK expression plasmids in decidual cells (top panel) and nondecidual cells (bottom panel). The decidual cells were primary cultures of treated endometrial cells (ESC) and decidual fibroblasts (DF), and N5 endometrial cells (N5). The nondecidual cells were HeLa, Jurkat, and BeWo. The relative luciferase activity in each well was normalized to the relative activity of pGL3-TK, which was assigned a value of 1. Each bar represents the mean ± SE of three wells. Similar results were obtained in five other experiments. *, P < 0.001; **, P < 0.01; ***, P < 0.05 relative to the empty vector. 536(+)TK and 536 (-)TK refer to pGL3-TK containing the 536-bp enhancer fragment in the forward (+) and reverse (-) orientation, respectively.

 
DNase I Footprint Analysis of the Decidual PRL Enhancer
To characterize further the 536-bp enhancer, DNase I footprint analysis was performed using nuclear extracts from primary cultures of decidual-type cells, treated endometrial stromal cells (ESC), and decidual fibroblasts (DF), and N5 endometrial cells (N5) as well as nondecidual cells, Jurkat, GH3, and BeWo cells. As shown in Fig. 3AGo, three footprinted regions (FP1-FP3) at nt -1,727/-1,686 (FP1), nt 1,810/-1,783 (FP2) and nt -1,864/-1,843 (FP3) were detected using nuclear extracts from decidual-type cells (N5, ESC, and DF). In addition, FP1 was present in extracts of GH3 cells and FP-1 and FP3 were present in extracts of BeWo cells. Computer analysis revealed that FP1 contains several putative transcription factor-binding sites including sites for AP-1, a half-site for the glucocorticoid receptor (GR), and TRF, a cellular octamer binding protein (Fig. 3BGo). FP2 contains putative transcription factor binding sites for hepatocyte nuclear factor-3 (HNF-3) and a DNA-binding protein that recognizes the Y-box of major histocompatibility complex class ll genes (NF-Y). FP3 contains overlapping putative sites for AP-1, a GR half -site and upstream stimulatory factor (USF), a member of the c-myc-related family of DNA-binding proteins.



View larger version (76K):
[in this window]
[in a new window]
 
Figure 3. DNase I Footprint Analysis of the 5'-Flanking Region of the Decidual PRL Gene

A, DNase I analysis of nt -1,939 to -1,640 region of the 5'-flanking region. Experiments were performed using nuclear extracts from N5 endometrial cells (N5), Jurkat cells (Jur), in vitro decidualized endometrial stromal cells (ESC), GH3 cells (GH3), decidual fibroblasts treated with MPA, E2 and (Bu)2cAMP (DF), and BeWo cells (BeWo). On the left are shown a radiolabeled G/A ladder and BSA, which was used as a control. The bars on the right indicate the positions of the protected regions (FP1–FP3) on the promoter. B, DNA sequences and putative transcription factor binding sites present in the footprinted regions, FP1-FP3, of the 536-bp enhancer region of the decidual PRL gene. The abbreviations used represent TRF, a cellular octamer binding protein; AP-1, activator protein-1; GR, glucocorticoid receptor; HNF-3, hepatocyte nuclear factor-3; NF-Y, a sequence-specific DNA-binding protein that recognizes the Y-box of major histocompatibility complex class ll genes; and USF, human upstream stimulatory factor, a member of the c-myc-related family of DNA-binding proteins.

 
Functional Analysis of 100-bp Enhancer Fragments
To determine which nucleotides of the 536-bp enhancer are responsible for enhancer activity, overlapping 100-bp fragments of the –2,040/-1,505 region were subcloned into pGL3-TK (Fig. 4AGo). In transfection studies, three of the plasmids containing 100-bp fragments (-1,939/-1,840, -1,904/-1,805 and -1,704/-1,605) showed increased luciferase activity in in vitro decidualized endometrial stromal cells (Fig. 4BGo). The plasmids containing the -1,939/-1,840 and -1,904/-1,805 fragments, which overlap FP3 (Fig. 4AGo) enhanced promoter activity by 2- to 3-fold. The plasmid containing the -1,704/-1,605 fragment, which overlaps FP1, enhanced promoter activity by 4-fold. In contrast, fragment -1,739/--1,640, which overlaps FP1, had no effect on promoter activity. Individual fragments overlapping FP2 did not have enhancer activity. Similar results were obtained with the plasmids in treated decidual fibroblast cells and N5 cells (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Transfection Studies Using Overlapping 100-bp Fragments of the 536-bp Decidual PRL Enhancer Region

A, Schematic representation of overlapping 100-bp fragments of the enhancer in the 5'-flanking region of the decidual PRL gene between nt -2,040/-1,505. The relative positions of FP1–FP3 are indicated at the top. B, The 100-bp fragments were ligated into pGL3-TK (constructs shown schematically on the left) and transiently transfected in treated endometrial stromal cells as described in Materials and Methods. Each bar represents the mean ± SE relative luciferase activity of three wells (right panel). Similar results were obtained in five other experiments. **, P < 0.01; ***, P < 0.05, relative to the empty vector.

 
Gel Shift Assays
Since putative AP-1 binding sites are present in FP1 and FP3, and AP-1 transcription factors have been shown to be important in the regulation of other genes expressed in the decidua (13), we performed experiments to determine whether putative AP-1 binding sites in FP1 and FP3 are important for the regulation of decidual PRL gene expression. Gel shift assays were performed to determine whether AP-1 binds to FP1 and FP3. As shown in Fig. 5AGo, gel shift assays using radiolabeled oligonucleotides encoding FP1 or FP3 and a nuclear extract from treated decidual fibroblast cells revealed a major retarded complex that was competed by excess unlabeled FP1 or FP3, and by an oligonucleotide with the sequence of a consensus AP-1 binding site. Conversely, the binding of a labeled consensus AP-1 oligonucleotide probe to the decidual fibroblast cell nuclear extract was found to be competed by excess unlabeled FP1 and FP3 (Fig. 5BGo). However, the AP-1 probe was not competed by FP1 and FP3 oligonucleotides containing mutations in the AP-1 binding sites (FP1 AP-1 mut, AP-1 mut) (Fig. 5BGo). Similar results of gel shift analysis were obtained using FP1, FP3, or AP-1 as probes and competing with mutant FP1 and FP3 oligonucleotides using nuclear extracts of decidualized endometrial stromal cells and N5 cells (data not shown).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 5. Gel Shift Analysis of FP1 and FP3

A, Gel shift assays were performed using 5 µg nuclear extract from treated decidual fibroblast cells and radiolabeled oligonucleotide probes corresponding to the sequences of FP1 and FP3. Arrows indicate the specific retarded complex. Competition studies were performed using 100-fold excess of unlabeled FP1, FP3, or AP-1 oligonucleotides. B, Gel shift analysis using nuclear extract from treated decidual fibroblast cells and radiolabeled oligonucleotide probes corresponding to the sequences of AP-1 is shown. Competition studies were performed with AP-1, FP1, FP3, or mutants of the FP1 and FP3 oligonucleotides with nucleotide substitutions in the AP-1 binding sites that completely abolished AP-1 binding (FP1AP-1 mut and FP3AP-1 mut). Sequences of the oligonucleotides are detailed in Materials and Methods. Specific complexes are indicated with an arrow.

 
Analysis of AP-1 Binding Sites
To evaluate the functional significance of the two AP-1 binding sites in FP1 and FP3, pGL3-TK expression plasmids containing the 536-bp enhancer with mutations in the AP-1 binding sites were transfected into treated decidual fibroblast cells. The promoter activity of the mutant plasmids was compared with that of the pGL3-TK expression plasmid containing the wild-type enhancer (Fig. 6AGo). Mutation of the AP-1 binding site in FP1 (FP1 AP-1 mut) reduced enhancer activity by 51%, and mutation of the AP-1 binding site in FP3 (FP3 AP-1 mut) reduced luciferase activity by 44%. Mutation of both AP-1 binding sites (FP1 & 3 AP-1 mut) reduced enhancer activity by 98%. Coexpression of a dominant negative AP-1 plasmid, A-fos, with the 536-bp(+)pGL3-TK plasmid resulted in an approximately 70% decrease in expression of the enhancer (P < 0.01) (Fig. 6BGo). Expression of the vector alone [cytomegalovirus (pRc/CMV)] showed approximately 20–40% decrease in expression of the enhancer (P > 0.05).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 6. The Effect of AP-1 Binding Site Mutants in Transient Transfection Assays of the 536-bp Enhancer

A, Mutations of the AP-1 binding sites in FP1 and FP3 of the decidual PRL enhancer region markedly decrease enhancer activity. Treated decidual fibroblast cells were transfected with pGL3-TK expression plasmids containing the wild-type 536-bp enhancer (536bp(+)TK) or mutants of the enhancer with nucleotide substitutions in the AP-1 binding sites (black blocks) within FP1 (FP1AP1 mut), FP3 (FP3AP1 mut), or both sites (FP1&3AP1 mut). The sequences of the mutations are described in Materials and Methods. Each bar represents the mean of triplicate wells, and the bars enclose 1 SE. The results are expressed relative to the activity of empty vector pGL3-TK(TK), which has been assigned a value of 1. Similar results were observed in three other experiments. *, P < 0.001; **, P < 0.01 relative to the wild-type 536-bp enhancer (536bp(+)TK). B, Coexpression of a dominant negative AP-1 mutant. In transient transfection assays of treated decidual fibroblast cells, coexpression of pCMV/A-fos (3 µg) with 536bp(+)TK resulted in a 70% decrease in enhancer expression. Expression of the vector alone (pRc/CMV) showed approximately 40% decrease in expression of the enhancer. **, P < 0.01.

 
To determine which member(s) of the AP-1 transcription factor family in the decidua bind to the AP-1 sites in FP1 and FP3, supershift analyses were performed using antisera against c-Fos, c-Jun, Fos-B, JunB, and JunD. As shown in Fig. 7AGo, supershifted complexes were detected with the antiserum to JunD but not with the other antibodies using either labeled FP1 or labeled FP3 as probes and nuclear extracts from decidual fibroblasts. The complex formed between labeled FP1 or FP3 and the nuclear extracts was only partially supershifted by the JunD antiserum. However, as shown in Fig. 7BGo, the formation of the complex between JunD and the JunD antiserum was completely prevented by the addition of excess JunD protein. Since the complex was not completely supershifted upon incubation of extracts with JunD antiserum, additional supershift experiments were performed using Fra-1 and Fra-2 antiserum. These studies showed that Fra-2, but not Fra-1, also partially supershifted the complex using FP-1 as the probe and nuclear extracts from treated decidual fibroblasts (Fig. 7CGo). Addition of JunD and Fra-2 antisera together affected the majority of the AP-1-DNA complex. Similar results were obtained using FP-3 as probe (not shown).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 7. Supershift Analysis of AP-1 Binding Sites in FP1 and FP3

Panel A shows supershift analysis using nuclear extracts from treated decidual fibroblast cells that were incubated with antisera against c-Fos, c-Jun, FosB, JunB, or JunD before the addition of radiolabeled oligonucleotides encoding either FP1 or FP3. Competition studies were performed using 100-fold excess of the FP1 or FP3 oligonucleotide. Supershift complexes detected with JunD antisera are indicated with arrows. Panel B shows that excess JunD protein prevents formation of the JunD antiserum-nuclear extract complex. Supershift analysis of nuclear extracts from treated decidual fibroblasts with an antiserum to JunD was performed as shown in panel A. The formation of the supershifted complexes obtained with FP1 and FP3 was prevented with excess JunD protein. Specific complexes are indicated with arrows. The autoradiographs were overexposed to demonstrate the supershifted bands clearly. C, Supershift analysis of nuclear extracts from treated decidual fibroblasts with antiserum to Fra-1, Fra-2, and JunD, alone or in combination using FP1 as probe. A supershifted complex detected with JunD and Fra-2 antisera is indicated with an arrow. In addition, a reduction in the intensity of the complex was seen. Similar results were obtained using FP-3 as probe (not shown).

 
JunD was coexpressed with the 536 bp(+)pGL3-TK plasmid to determine whether increased expression of JunD could increase enhancer activity in treated decidual fibroblasts. As shown in Fig. 8AGo, cotransfection of JunD increased expression of the 536-bp enhancer approximately 50%. Coexpression of the coactivator, p300, increased JunD activation of the 536-bp enhancer by greater than 2-fold, compared with expression of the enhancer alone (P < 0.01). Coexpression of p300 with the enhancer in the absence of JunD did not stimulate enhancer activity.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 8. Effect of Coexpression of AP-1 Family Members, p300 and the 536-bp Enhancer

A, Coexpression of JunD and p300 with the enhancer in transient transfection assays in decidual fibroblasts. Coexpression of JunD with 536bp(+)-pGL3-TK resulted in a small increase in luciferase activity compared with transfection of the enhancer alone in treated decidual fibroblast cells. Coexpression of p300, JunD, and 536bp(+)-pGL3-TK resulted in a 2- to 3-fold increase in activity compared with transfection of the enhancer alone. There was no significant increase in luciferase activity upon coexpression of p300 and 536bp(+)-pGL3-TK, in the absence of JunD. Each bar represents the mean ± SE of triplicate wells. B, Effect of coexpression of Ap-1 family members (Fra-1, Fra-2, c-Fos, c-Jun, and JunB) with JunD, on JunD stimulation of 536bp(+)-pGL3-TK expression. Coexpression of JunD with either Fra-1 or Fra-2 augmented JunD stimulation of luciferase activity by approximately 2- and 3-fold, respectively. Moreover, coexpression of 536 bp(+)pGL3-TK with Jun D and either Fra-1 or Fra-2 increased enhancer activity approximately 6-fold and 10-fold, respectively, compared with cells transfected with 536 bp(+)pGL3-TK alone. In contrast, coexpression of JunD and other AP-1 family members (c-Fos, c-Jun, and JunB) suppressed luciferase expression levels equivalent to those of 536bp(+)-pGL3-TK expression alone. In addition, coexpression of Fra-2 and c-Jun (but not c-Fos) increased enhancer activity approximately 4-fold compared with Fra-2 alone. All experiments were performed in the presence of p300.

 
The effect of Ap-1 family members on JunD stimulation of 536 bp(+)pGL3-TK was determined by coexpression of JunD and either Fra-1, Fra-2, c-Fos, c-Jun, or JunB with the enhancer, in the presence of p300. Fra-1 and Fra-2 augmented the stimulation of 536 bp enhancer activity by JunD, while coexpression of Jun D with either c-Fos, c-Jun, or JunB resulted in luciferase activity levels equivalent to those in decidual fibroblasts transfected with 536 bp(+)pGL3-TK alone (Fig. 8BGo). Coexpression of 536 bp(+)pGL3-TK with Jun D and either Fra-1 or Fra-2 increased enhancer activity approximately 6-fold and 10-fold, respectively, compared with cells transfected with 536 bp(+)pGL3-TK alone. Furthermore, coexpression of 536 bp(+)pGL3-TK with Fra-2 and c-Jun (but not c-Fos), stimulated enhancer activity approximately 4-fold compared with Fra-2 alone.

Earlier studies showed that the activity of 536 bp(+)pGL3-TK is absent or very low in nondecidual cells (Fig. 2BGo) and untreated decidual fibroblasts (data not shown). However, the activity of 536 bp(+)pGL3-TK activity in HeLa cells is increased 8- to 12-fold provided the cells are cotransfected with Fra-2 in combination with either JunD or c-Jun (Fig. 9Go). Enhancer activity is also increased approximately 3- to 5-fold in untreated decidual fibroblasts, which, like nondecidual cells, do not express the enhancer.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 9. Coexpression of 536 bp(+)pGL3-TK, JunD and Fra-2 with p300 and AP-1 Family Members in Transient Transfection Assays of HeLa cells and Untreated Decidual Fibroblasts [DF(-)]

Coexpression of Hela cells and untreated decidual fibroblasts with JunD or Fra-2 gave a similar pattern of enhancer activity as seen in treated decidual fibroblasts (Fig. 8BGo).

 
Immunohistochemical Staining with JunD and Fra-2 Antiserum
To determine whether the expression of JunD and Fra-2 proteins is increased in vivo during decidualization when PRL expression is induced, immunohistochemical analysis was performed. Sections of human endometrium from the proliferative and secretory phases of the menstrual cycle, and human decidua from early pregnancy, were incubated with JunD and Fra-2 antiserum. A similar pattern of expression of JunD and Fra-2 proteins was detected. JunD and Fra-2 immunopositive cells (Fig. 10Go, A and D, respectively) were few and widely scattered in stroma and glands of proliferative phase endometrium, which does not express PRL (14). In contrast, JunD and Fra-2 immunopositive cells were abundant in stroma and glands of late secretory phase endometrium (Fig. 10Go, B and E, respectively) and decidua from early pregnancy (Fig. 10Go, C and F, respectively), when PRL is highly expressed (14).



View larger version (149K):
[in this window]
[in a new window]
 
Figure 10. Immunohistochemical Stain for JunD and Fra-2 in Human Endometrium and Decidua

In late proliferative endometrium, scattered JunD (panel A) and Fra-2 (panel D) immunoreactive cells were present in the stroma and the glands. A marked increase in immunoreactivity was seen in both cell types in late secretory endometrium with JunD (panel B) and Fra-2 (panel E) antiserum. The most prominent JunD (panel C) and Fra-2 (panel F) immuno-staining was seen in sections from early pregnancy decidua. Bar shown represents 200 µM.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
An enhancer of decidua-specific PRL gene expression was localized to nt -2,040 and -1,505 of the 5'-flanking region of the human PRL gene. Like other enhancers, the decidual PRL enhancer can activate a promoter when placed at 1000 or more bp from the transcription initiation site and can activate a promoter when placed in either the forward or reverse orientation relative to the promoter. The ability of the -2,040/-1,505 fragment to confer enhancer activity to the TK promoter was observed in endometrial stromal cells decidualized in vitro with MPA and estradiol, decidual fibroblast cells treated with MPA, estradiol, and cAMP, and N5 endometrial cells but was not observed in Jurkat, BeWo, or HeLa cells. These later findings strongly suggest that the activity of the enhancer is deciduas specific.

The 536-bp enhancer contains three regions protected by DNase I footprinting (FP1, -2, and -3). Transfection studies revealed that enhancer activity is localized to FP1 and FP3, both of which contain AP-1 binding sites. Mutation of either binding site decreased enhancer activity by about 50%, and mutations of both sites almost completely abolished enhancer activity, strongly suggesting that the two sites are critical for enhancer activity. In addition, expression of the enhancer region is decreased upon cotransfection of the 536-bp enhancer region and a dominant negative AP-1 mutant, A-fos, which antagonizes the DNA binding of Fos:Jun heterodimers (15).

The AP-1 complex is a heterodimer of Jun and Fos, members of the bZIP family of transcription factors. The Jun family consists of three proteins, c-Jun, JunD, and JunB, while the Fos family contains four proteins, c-Fos, FosB, Fra-1, and Fra-2 (16). Supershift experiments using nuclear extracts of decidual fibroblast cells demonstrated that AP-1 sites in both FP1 and FP3 bind JunD and Fra-2 but not c-Jun, c-Fos, FosB, JunB, or Fra-1. Furthermore, excess unlabeled JunD protein prevented the formation of the supershifted complex that was formed by the JunD antiserum and the complex formed by the interaction of FP1 and FP3 with nuclear extracts from decidual fibroblast cells. However, the complex formed between labeled FP1 and FP3 and the nuclear extracts was only partially supershifted even when both JunD and Fra-2 antisera were added, suggesting that additional transcription factor(s) other than JunD and Fra-2 may also bind the AP-1 site. Transfection of AP-1 family members with the 536-bp enhancer demonstrated that after coexpression of 536 bp(+)pGL3-TK with Fra-2 and Jun D or c-Jun, enhancer activity was stimulated approximately 6-fold and 10-fold respectively in treated decidual fibroblasts. While the supershift data did not suggest a role for Fra-1 or c-Jun in binding the retarded complex in decidual fibroblast nuclear extracts, the transfection data support a potential role for Fra-1 and c-Jun. Moreover, the PRL enhancer can be activated in nondecidual cells that do not express PRL, (e.g. HeLa cells), and in cells that express low levels of PRL (e.g. untreated decidual fibroblasts), provided JunD, Fra-2, Fra-1, or c-Jun levels are not limiting.

The role of additional transcription factors in activation of the decidual PRL enhancer cannot be excluded. Analysis of 100-bp enhancer fragments of the 536-bp enhancer demonstrated that plasmids containing the –1,704/-1,605 fragment, which overlaps FP1, enhanced luciferase activity by 4-fold. In contrast, fragment –1,739/--1,640, which overlaps FP1, had no effect on luciferase activity. Therefore the region between –1,640/--1,605, while not part of a footprinted region, is part of the –1,704/--1,605 fragment that enhances luciferase activity and may play a role in activation of the enhancer. The region between –1,640/-1,605 has putative binding sites for the SV40 transcriptional enhancer factor 1 or TEF-1 (-1,634/-1,626) and an erythroid-cell-specific nuclear factor or NF-E1.6 (-1,623/-1,116). The role of these transcription factors, and the region between -1,640/-1,605 of the enhancer is unclear at present and will be explored in future experiments.

Since JunD activation of the decidual PRL enhancer is stimulated by coexpression of the cellular coactivator p300, our studies suggest that this factor may be part of the AP-1 multiprotein complex in the 5'-flanking region of the decidual PRL gene. There is growing evidence that coactivators provide critical interaction points between nuclear receptors and signal transduction pathways. p300 is closely related to the cAMP-responsive elements binding protein coactivator protein (CBP) and, like CBP, is thought to serve as a macromolecular docking platform for transcription factors from several signal transduction cascades, including the glucocorticoid and progesterone receptors (17). Some coactivators, such as p300, have intrinsic histone acetyltransferase activity that has been proposed to loosen chromatin structure and facilitate the binding of transcription machinery components to DNA. By transducing nuclear receptor signaling, coactivators can also define the sensitivity of a cell to steroid hormones in a tissue-specific manner. Overexpression of p300 has been demonstrated to stimulate transcription through an AP-1 site in the collagenase promoter (18). These studies showed that p300 is a coactivator for cJun and JunB. We now report that p300 can act as a coactivator for JunD activation of the decidual PRL enhancer.

Several signaling pathways activate AP-1 complexes composed of a number of different family members (19). Moreover, there is accumulating evidence that AP-1 complex composition can play a role in selectively regulating gene expression during cell differentiation. For example, during normal bone development JunD/Fra-2 dimers predominate in AP-1 complexes in differentiated osteoblasts (20). Regulation of the murine laminin {alpha}3A promoter by a JunD/Fra-2 AP-1 complex, in combination with TGF-ß during wound healing, has also been reported in skin wound healing (21). Our studies support a role for a JunD/Fra-2 Ap-1 complex in regulation of the decidual PRL enhancer.

Previous studies have reported c-Fos and c-Jun expression in human proliferative and early to midsecretory endometrium, as well as in fibroblasts derived from human uterine endometrium (22). The expression of c-Fos and c-Jun in these cells is related to the estrogen receptor status and is partly mediated via the protein kinase C pathway. In our studies, coexpression of Fra-2 and c-Jun stimulated the PRL enhancer, suggesting that Fra-2 may also form heterodimers with c-Jun. This effect was not seen with c-Fos, which is closely related to Fra-2 in its biological and biochemical functions. Earlier studies have shown that a multiprotein complex including p300 and Fra-2/c-Jun heterodimers activates the mouse major histocompatibility class I enhancer (23). In chicken embryo fibroblasts the transcriptional activity of Fra-2/cJun heterodimers is enhanced by mitogen-activated protein kinase (24).

Hormonal induction of several members of the AP-1 family (JunD, JunB, and c-Jun but not FosB) also occurs in the rat uterus (25). There are, however, no previous studies showing similar changes in the human uterus or decidua. Our immunohistochemical analysis shows that the expression of JunD and Fra-2 is increased in endometrial stromal cells in secretory phase compared with proliferative phase, and that JunD is highly expressed in decidua of early pregnancy. PRL is not present in the endometrial stromal cells until the late secretory phase of the menstrual cycle and is induced to high levels in decidua of pregnancy (14), similar to the expression pattern of JunD and Fra-2. Our findings indicate a potential correlation between increased expression of JunD, Fra-2, and PRL. Future studies to colocalize expression of JunD, Fra-2, and PRL would confirm this observation. The expression of JunD and Fra-2 in endometrial glands, which do not express PRL, suggests that JunD and Fra-2 may be required but not sufficient for induction of decidual PRL gene expression.

AP-1 activity in endometrial adenocarcinoma cells is regulated by the progesterone receptor (PR) (26). Since the progesterone receptor plays a pivotal role in the induction of PRL gene expression during human endometrial cell differentiation, these findings and those of the present report suggest that the induction of decidual PRL gene expression during endometrial stromal cell differentiation may be regulated, at least in part, by the differential expression of AP-1 family members by progesterone and other factors.

In summary, we conclude that a decidua-specific enhancer in the 5'-flanking region of the human PRL gene is activated through two multiprotein AP-1 complexes that consist of JunD/Fra-2, and possibly, Fra-2/cJun and the cellular coactivator, p300.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Constructs and Oligonucleotides
A plasmid containing the 5'-flanking region of the decidual PRL gene was constructed by ligating a DNA fragment of the decidual PRL gene from nt -2,927 to +66 (relative to the decidual PRL initiation site) into pGL3-enhancer (pGL3E, Promega Corp., Madison, WI). The fragment was generated by ligating together two smaller (-2,927/-1,185 and –1,480/+66) fragments that were amplified by PCR from a human placental DNA library using primers encoding the decidual PRL gene, as previously described (2). The sequence of the –2,927/+66 fragment was determined before ligation into pGL3E to be certain that the sequence was identical to the published sequence (2). Plasmids containing smaller fragments of the 5'- flanking region were prepared in a similar manner using fragments of the -2,927/+66 region that were generated by digestion with mung bean nuclease and restriction enzymes. Thymidine kinase (TK) promoter reporter constructs were prepared using a luciferase (Luc) reporter gene in pGL3 basic (pGL3-TK), that was constructed using a 160-bp BglII–BamHI fragment of the TK-promoter that was excised from pBL-CAT-2 and inserted into the BglII site of pGL3-basic. A 536-bp fragment of the 5'- flanking region (nt –2,040/-1,505), which was excised from the decidual PRL -2,927/+66 pGL3E construct by digestion with StuI and PvuII, was ligated in either the plus or minus orientations into pGL3-TK at a XhoI site upstream of the TK promoter to generate 536(+)TK and 536(-)TK. Ten additional TK-Luc plasmids containing 100-bp fragments of the 5'-flanking region were generated with fragments encoding nt –2,038/-1,940, -2,004/-1,905, -1,939/-1,840, -1,904/-1,805, -1,839/-1,740, -1,804/-1,705, -1,739/-1,640, -1,704/-1,605, -1,639/-1,540, -1,604/-1,505. The ten 100-bp fragment TK reporter constructs were amplified from decidual PRL –2,927/+66 pGL3E by PCR, gel purified using the MERMAID kit (BIO 101, Inc., Vista, CA), and cloned into pCR 2.1 vector using the TA Cloning System (Invitrogen, San Diego, CA). After confirming the orientation of these fragments by sequencing with Sequenase Version 2.0 (Amersham Pharmacia Biotech, Arlington Heights, IL), the SacI–XhoI fragments were excised from pCR2.1 and ligated to the SacI-XhoI site of pGL3-TK. The 87-bp SacI–XhoI fragment from pCR2.1 has no transcriptional activity as verified by transient transfection assays.

For gel shift analysis, mutants of AP-1 consensus sites in footprinted regions of the 536-bp enhancer region (FP1 and FP3) were generated using mutated oligonucleotides and 536 bp (plus orientation or +) pGL3-TK plasmid with Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). The construction of all these plasmids was confirmed by sequencing. An oligonucleotide with the consensus AP-1 sequence (in bold) used in gel shift analysis, purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), has the following sequence: GCCGCAAGTGAGTCAGCGCGGG. The oligonucleotide for FP1 (nt –1,710/-1,687 of the 5'-flanking region of decidual PRL) and FP3 (nt –1,869/-1846) in which the AP-1 consensus site in shown in bold were as follows: TATAACATGATTCAGAATCACACG and AATTTTATGACACATGCAAGACTC, respectively. Bases within these oligonucleotides were changed in the AP-1 consensus site (CA to tg) to generate the mutants FP1AP-1 mut and FP3AP-1 mut as follows: TATAACATGATTtgGAATCACACG and AATTTTATGACAtgTGCAAGACTC, respectively. The expression vector for a dominant negative to AP-1, CMV500/A-Fos, and the control vector pRc/CMV was kindly provided by Charles Vinson (NIH, Bethesda, MD). The expression vectors for RSV-JunD, pRSVc-Jun, pRSVJunB, and pSVEc-fos were kindly provided by Moshe Yaniv (Paris, France). pCMV-Fra-2 was purchased from the American Type Culture Collection (Manassas, VA), and pRSV-Fra-1 was kindly provided by Michael Karin (La Jolla, CA).

Cell Culture
To prepare primary cultures of endometrial stromal cells (ESC), uterine endometrial tissue was obtained from women with normal menstrual cycles at the time of elective tubal ligation. Informed consent was obtained from patients, and the Institutional Review Boards of Children’s Hospital Medical Center and the University of Cincinnati approved the study. Proliferative or secretary phase endometrium was removed by suction biopsy and stromal cells were prepared as previously described (27). ESC were cultured in DMEM containing 2% FBS, 25 U/ml penicillin G, 25 µg/ml streptomycin, and 2.5 µg/ml Amphotericin (Life Technologies, Gaithersburg, MD).

To prepare the primary culture of decidual fibroblast cells, term human placenta from cesarean section or vaginal delivery after uncomplicated pregnancies were obtained with institutional Review Board approval from Children’s Hospital Medical Center, Cincinnati, OH. The isolation of cells from decidua parietalis tissue dissected from fetal membranes was begun within 1–2 h after delivery, and the decidual fibroblast cells were prepared as previously described (3). After three subpassages, cells were plated and cultured in RPMI 1640 medium containing 2% FBS. The N5 cell line, a human endometrial stromal cell clone immortalized by transfection with an origin-defective construct of the temperature- sensitive mutant of SV40 was kindly provided by Drs. C.A. Rinehart and D.G. Kaufman (University of North Carolina, Chapel Hill, NC)(28). The cells were cultured in 1:1 mixture of Ham’s F12 and Medium 199 supplemented with 2% FBS at 37 C as previously described (5). All other cells were obtained from the American Type Culture Collection. BeWo human choriocarcinoma cells (ATCC CCL-98) were grown in Ham’s F12-K supplemented with 15% FBS. HeLa human cervical carcinoma cells, Jurkat human T cell leukemia cells (ATCC TIB-152), and IM-9 human B cell lymphoblast cells (ATCC CCL-159) were grown in RPMI 1640 with 10% FBS.

Treatment for Decidualization
To induce decidualization of endometrial stromal cells, subconfluent cultures were grown in media containing 1 µM MPA and 10 nM estradiol-17 (estradiol) as previously described (27). The medium was changed every third day and experiments were performed on treatment day 14. To decidualize decidual fibroblast cells, the cultures after cell passage were maintained in media containing 1 µM MPA, 10 nM estradiol, and 50 nM (Bu)2cAMP for 12–15 days before performing experiments. All chemicals were purchased from Sigma (St. Louis, MO).

Transient Transfection
All DNA plasmids used in transient transfection studies were purified by QIAGEN plasmid Maxi kits (QIAGEN, Valencia, CA). The endometrial stromal cells, decidual fibroblast cells, and N5 cells were transfected with the luciferase-PRL promoter constructs at 90–100% confluency using the calcium phosphate precipitation method (5). BeWo and HeLa cells were transfected by the same method at 60–70% confluency. Cells cultured in six-well dishes were incubated for 4 h with 10 µg per well luciferase-PRL promoter constructs. After 4 h, the cells were rinsed with PBS, incubated in growth media, and harvested 48 h after transfection using lysis buffer (Tropix Inc., Bedford, MA). In experiments in which the AP-1 family of transcription factors (2 µg/six-well cluster) and p300 (1 µg/six-well cluster) were coexpressed with the 536 bp(+)pGL3-TK plasmid, the growth media were replaced with serum-free media for the last 24 h before harvesting. The cell lysate was centrifuged (12,000 x g for 5 min), and the supernatant was assayed for luciferase (Promega Corp.) or ß-galactosidase (Tropix, Inc.) using a Berthold 9501 luminometer (Berthold Systems, Inc., Pittsburgh, PA). All transfection results were normalized to ß-galactosidase activity resulting from cotransfection of 0.5 µg per well of pSV-ßgal (Promega Corp.). The values represent the mean ± SE of triplicate wells. All transfections were performed in at least three separate experiments. As controls, cells were transfected with the promoter-less luciferase vector (pGL3E or pGL3B).

DNase I Footprint Analysis
Nuclear extracts were prepared by the method of Bakke and Lund (29), and DNase I footprint analysis was performed as described by Brenowitz et al. (30). Protected regions were detected by comparing the digestion patterns to that of control reactions using BSA in place of nuclear extracts.

Gel Shift Assays
DNA fragments of the PRL promoter were prepared and labeled by PCR amplification. Nuclear extracts were incubated for 10 min at room temperature in 20 mM Tris buffer, pH 7.6, with 10% glycerol and 40 ng/ml poly [d(I-C)]. A 32P-labeled oligonucleotide probe was added and the incubation continued for 10 min. The mixture was electrophoresed on a 5% polyacrylamide gel in 0.5 x TBE (Tris-borate-EDTA). Where indicated, 100-fold molar excess competing nonlabeled oligonucleotides were added along with the probe to determine the specificity of binding. For supershift analysis, nuclear extracts were incubated with the appropriate antibody before addition of the radiolabeled probe. Antibodies to JunD, JunB, cJun, c-Fos, and FosB were purchased from Geneka Biotechnology, Inc. (Montreal, Canada) and antibodies to Fra-1 and Fra-2 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and used according to the instructions provided.

Immunohistochemical Analysis
Sections from human endometrium during the proliferative and secretory phases of the menstrual cycle and from decidua of early pregnancy were analyzed by immunohistochemistry for the presence of Jun D using an antirabbit polyclonal antibody (329) raised against the carboxy terminus of Jun D p39 (Santa Cruz Biotechnology, Inc.). This antibody does not cross-react with Jun B or c-Jun. The Fra-2 antibody (Q20) used is a polyclonal antibody raised against the amino terminus of Fra-2 of human origin (Santa Cruz Biotechnology, Inc.). This antibody is non-cross-reactive with Fra-1, c-Fos, and Fos B. Tissue sections were prepared and stained as previously described (31).

Statistical Analysis
Statistical differences between group means was determined by ANOVA with Bonferroni adjustment or a Student’s t test, depending on design. Differences were considered significant when P < 0.05. The data are presented as the mean ± SE.


    ACKNOWLEDGMENTS
 
We thank Dr. Stephen Glasser and Dr. Jeffrey Whitsett for their helpful suggestions, Charles Vinson for the expression plasmid CMV500/A-Fos, Moshe Yaniv for the expression plasmids for the AP-1 family, and Michael Karin for the expression plasmid for Fra-1.


    FOOTNOTES
 
Address requests for reprints to: Anoop K. Brar, Ph.D., Division of Endocrinology, Children’s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, Ohio 45229-3039. E-mail: anoop.brar{at}chmcc.org

This work was supported by NIH Grant HD-05201.

Received for publication January 11, 2000. Revision received December 14, 2000. Accepted for publication January 5, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. DiMattia GE, Gellersen B, Duckworth ML, Friesen HG 1990 Human prolactin gene expression. The use of an alternative noncoding exon in decidua and the IM-9-P3 lymphoblast cell line. J Biol Chem 265:16412–16421[Abstract/Free Full Text]
  2. Gellersen B, Kempf R, Telgmann R, DiMattia GE 1994 Nonpituitary human prolactin gene transcription is independent of Pit-1 and differentially controlled in lymphocytes and in endometrial stroma. Mol Endocrinol 8:356–373[Abstract/Free Full Text]
  3. Richards RG, Brar AK, Frank GR, Hartman SM, Jikihara H 1995 Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin- like growth factor binding protein-1 expression. Biol Reprod 52:609–615[Abstract]
  4. Brosens JJ, Takeda S, Acevedo CH, Lewis MP, Kirby PL, Symes EK, Krausz T, Purohit A, Gellersen B, White JO 1996 Human endometrial fibroblasts immortalized by simian virus 40 large T antigen differentiate in response to a decidualization stimulus. Endocrinology 137:2225–31[Abstract]
  5. Brar AK, Kanda Y, Kessler CA, Cedars MI, Handwerger S 1999 N5 endometrial stromal cell line: a model system to study decidual prolactin gene expression. In Vitro Cell Dev Biol Anim 35:150–4[Medline]
  6. Huang JR, Tseng L, Bischof P, Jänne OA 1987 Regulation of prolactin production by progestin, estrogen, and relaxin in human endometrial stromal cells. Endocrinology 121:2011–2017[Abstract/Free Full Text]
  7. Irwin JC, Kirk D, King RJ, Quigley MM, Gwatkin RB 1989 Hormonal regulation of human endometrial stromal cells in culture: an in vitro model for decidualization. Fertil Steril 52:761–768[Medline]
  8. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S 1997 Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine 6:301–307[Medline]
  9. Telgmann R, Maronde E, Tasken K, Gellersen B 1997 Activated protein kinase A is required for differentiation-dependent transcription of the decidual prolactin gene in human endometrial stromal cells. Endocrinology 138:929–37[Abstract/Free Full Text]
  10. Pohnke Y, Kempf R, Gellersen B 1999 CCAAT/enhancer-binding proteins are mediators in the protein kinase A-dependent activation of the decidual prolactin promoter. J Biol Chem 274:24808–24818[Abstract/Free Full Text]
  11. Gellersen B, DiMattia GE, Friesen HG, Bohnet HG 1989 Prolactin (PRL) mRNA from human decidua differs from pituitary PRL mRNA but resembles the IM-9-P3 lymphoblast PRL transcript. Mol Cell Endocrinol 64:127–130[CrossRef][Medline]
  12. Berwaer M, Martial JA, Davis JR 1994 Characterization of an up-stream promoter directing extrapituitary expression of the human prolactin gene. Mol Endocrinol 8:635–642[Abstract/Free Full Text]
  13. Lockwood CJ, Krikun G, Hausknecht VA, Papp C, Schatz F 1998 Matrix metalloproteinase and matrix metalloproteinase inhibitor expression in endometrial stromal cells during progestin-initiated decidualization and menstruation-related progestin withdrawal. Endocrinology 139:4607–4613[Abstract/Free Full Text]
  14. Maslar IA, Riddick DH 1979 Prolactin production by human endometrium during the normal menstrual cycle. Am J Obstet Gynecol 135:751–754[Medline]
  15. Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, Vinson C 1997 A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J Biol Chem 272:18586–18594[Abstract/Free Full Text]
  16. Angel P, Karin M 1991 The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072:129–157[Medline]
  17. Owen GI, Richer JK, Tung L, Takimoto G, Horwitz KB 1998 Progesterone regulates transcription of the p21 (WAF1) cyclin-dependent kinase inhibitor gene through SP1 and CBP/300. J Biol Chem 273:10696–10701[Abstract/Free Full Text]
  18. Lee JS, See RH, Deng T, Shi Y 1996 Adenovirus E1A downregulates cJun- and JunB-mediated transcription by targeting their coactivator p300. Mol Cell Biol 16:4312–4326[Abstract]
  19. Karin M, Liu Z, Zandi E 1997 AP-1 function and regulation. Curr Opin Cell Biol 9:240–246[CrossRef][Medline]
  20. McCabe LR, Banerjee C, Kundu R, Harrison RJ, Dobner PR, Stein JL, Lian JB, Stein GS 1996 Developmental expression and activities of specific fos and jun proteins are functionally related to osteoblast maturation: role of Fra- 2 and Jun D during differentiation. Endocrinology 137:4398–4408[Abstract]
  21. Virolle T, Monthouel MN, Djabari Z, Ortonne JP, Meneguzzi G, Aberdam D 1998 Three activator protein-1-binding sites bound by the Fra-2.JunD complex cooperate for the regulation of murine laminin {alpha}3A (lama3A) promoter activity by transforming growth factor-ß. J Biol Chem 273:17318–17325[Abstract/Free Full Text]
  22. Salmi A, Ammala M, Rutanen EM 1996 Proto-oncogenes c-jun and c-fos are down-regulated in human endometrium during pregnancy: relationship to oestrogen receptor status. Mol Hum Reprod 2:979–984[Abstract/Free Full Text]
  23. Brockmann D, Putzer BM, Lipinski KS, Schmucker U, Esche H 1999 A multiprotein complex consisting of the cellular coactivator p300, AP-1/ATF, as well as NF-{kappa}B is responsible for the activation of the mouse major histocompatibility class I (H-2K(b)) enhancer A. Gene Expr 8:1–18[Medline]
  24. Murakami M, Ui M, Iba H 1999 Fra-2-positive autoregulatory loop triggered by mitogen-activated protein kinase (MAPK) and Fra-2 phosphorylation sites by MAPK. Cell Growth Differ 10:333–342[Abstract/Free Full Text]
  25. Cicatiello L, Sica V, Bresciani F, Weisz A 1993 Identification of a specific pattern of "immediate-early" gene activation induced by estrogen during mitogenic stimulation of rat uterine cells. Receptor 3:17–30[Medline]
  26. Bamberger AM, Bamberger CM, Gellersen B, Schulte HM 1996 Modulation of AP-1 activity by the human progesterone receptor in endometrial adenocarcinoma cells. Proc Natl Acad Sci USA 93:6169–6174[Abstract/Free Full Text]
  27. Brar AK, Frank GR, Richards RG, Meyer AJ, Kessler CA, Cedars MI, Klein DJ, Handwerger S 1995 Laminin decreases PRL and IGFBP-1 expression during in vitro decidualization of human endometrial stromal cells. J Cell Physiol 163:30–37[CrossRef][Medline]
  28. Rinehart CA, Laundon CH, Mayben JP, Lyn-Cook BD, Kaufman DG 1993 Conditional immortalization of human endometrial stromal cells with a temperature-sensitive simian virus 40. Carcinogenesis 14:993–999[Abstract/Free Full Text]
  29. Bakke M, Lund J 1995 Mutually exclusive interactions of two nuclear orphan receptors determine activity of a cyclic adenosine 3',5'-monophosphate-responsive sequence in the bovine CYP17 gene. Mol Endocrinol 9:327–339[Abstract/Free Full Text]
  30. Brenowitz M, Senear DF, Shea MA, Ackers GK 1986 Quantitative DNase footprint titration: a method for studying protein-DNA interactions. Methods Enzymol 130:132–181[Medline]
  31. Shah M, Stanek J, Handwerger S 1998 Differential localization of heat shock proteins 90, 70, 60 and 27 in human decidua and placenta during pregnancy. Histochem J 30:509–518[CrossRef][Medline]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee
What Can We Learn from Rodents about Prolactin in Humans?
Endocr. Rev., February 1, 2008; 29(1): 1 - 41.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
W. Hipkaeo, T. Wakayama, M. Yamamoto, and S. Iseki
Expression and Localization of the Transcription Factor JunD in the Duct System of Mouse Submandibular Gland
J. Histochem. Cytochem., April 1, 2004; 52(4): 479 - 490.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J.-R. Landry and D. L. Mager
Functional Analysis of the Endogenous Retroviral Promoter of the Human Endothelin B Receptor Gene
J. Virol., July 1, 2003; 77(13): 7459 - 7466.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Y. H. Mak, J. J. Brosens, M. Christian, F. A. Hills, L. Chamley, L. Regan, and J. O. White
Regulated Expression of Signal Transducer and Activator of Transcription, Stat5, and its Enhancement of PRL Expression in Human Endometrial Stromal Cells in Vitro
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2581 - 2588.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watanabe, K.
Right arrow Articles by Brar, A. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watanabe, K.
Right arrow Articles by Brar, A. K.
Right arrowPubmed/NCBI databases
*OMIM
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals