help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CHORIONIC GONADOTROPIN
Molecular Endocrinology 15 (5): 812-818
Copyright © 2001 by The Endocrine Society

Functions of the Upstream and Proximal Steroidogenic Factor 1 (SF-1)-Binding Sites in the CYP11A1 Promoter in Basal Transcription and Hormonal Response

Meng-Chun Hu, Nai-Chi Hsu, Chin-I Pai, Chi-Kuang Leo Wang and Bon-chu Chung

Institute of Molecular Biology Academia Sinica Nankang, Taipei Taiwan 115, Republic of China


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The CYP11A1 gene encodes P450scc (cholesterol side-chain cleavage enzyme), which catalyzes the first step for the synthesis of steroids. Expression of CYP11A1 is controlled by transcription factor SF-1 (steroidogenic factor 1). Two functional SF-1-binding sites, P and U, located at -40 and -1,600 regions of the CYP11A1 gene, have been identified, but their exact functions with respect to basal activation vs. cAMP response have not been dissected. We have addressed this question by examining the ability of the mutated human CYP11A1 promoter to drive LacZ reporter gene expression in transgenic mouse lines. The activity of the mtP mutant promoter was greatly reduced, indicating the importance of the P site. Mutation of the upstream U site also resulted in reduced reporter gene expression, but some residual activity remained. This residual reporter gene activity was detected in the adrenal and gonad in a tissue-specific manner. ACTH and hCG can stimulate LacZ gene expression in the adrenals and testes of transgenic mice driven by the wild-type but not the mtU promoter. These results indicate that the upstream SF-1-binding site is required for hormonal stimulation. Our experiments demonstrate the participation of both the proximal and the upstream SF-1-binding sites in hormone-responsive transcription.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroids are circulating hormones secreted from endocrine glands in minute amounts. The first and rate-limiting step for the synthesis of steroids is catalyzed by cholesterol side-chain cleavage enzyme (cytochrome P450scc), which is encoded by CYP11A1. The expression of the CYP11A1 gene is tightly regulated for proper steroid secretion (1, 2). CYP11A1 is mainly expressed in the adrenal and gonads, as well as placenta during pregnancy (3). In addition to these major endocrine glands, Cyp11a1 is also expressed in the brain, producing neurosteroids (4, 5, 6). With the exception of brain and placenta, which appear to have different control mechanisms (3, 7), the adrenals and gonads share similar machinery for the regulation of CYP11A1 gene expression (8).

The expression of CYP11A1 in the adrenal and gonads is stimulated by pituitary hormone (2). ACTH secreted by pituitary stimulates expression of CYP11A1 in the adrenal. Similarly, gonadotropins secreted from the pituitary stimulate CYP11A1 gene expression in gonads. These pituitary hormones bind to the G protein-coupled receptors located at the cell surface of the adrenal or gonads and trigger the increase of intracellular cAMP. cAMP is the intracellular messenger that transmits signals to the nucleus to increase transcription of the CYP11A1 gene (9, 10). In addition to this hormonal regulation, Cyp11a1 expression in the adrenal and gonads is also regulated developmentally, starting at embryonic day 11, and persists throughout life (11).

Mechanisms controlling CYP11A1 gene expression in the adrenal and gonads have been dissected. Two sequences located at the proximal (-40) and upstream (-1,600) regions of the human CYP11A1 gene have been shown to bind transcription factor SF-1 (steroidogenic factor 1), which triggers cAMP-dependent gene expression in cell culture studies (12, 13, 14). SF-1 [also termed Ad4BP or NR5A1 (15, 16)] is a transcriptional activator expressed in the adrenal, gonads, pituitary gonadotropes, and ventromedial nucleus of the hypothalamus (11, 17, 18). SF-1 controls expression of not only steroidogenic genes (19), but also genes of secreted signaling molecules such as gonadotropin (20), Müllerian inhibiting substance (21, 22), and oxytocin (23).

Despite a great deal of in vitro studies, final proofs showing that SF-1 can activate Cyp11a1 gene expression in vivo is lacking. Generation of SF-1 null mutation in mice results in the loss of adrenals and gonads (24), thus precluding studies of Cyp11a1 gene expression due to the lack of tissues in which Cyp11a1 is expressed. To alleviate this problem, we have devised a transgenic mouse study employing wild-type and mutant CYP11A1 promoters connected to a LacZ reporter gene to address the function of SF-1-binding sites in vivo.

Furthermore, the functions of the two SF-1-binding sites located at the proximal and upstream regions of the CYP11A1 promoter have not been dissected carefully. Earlier studies showed that both sites are important for cAMP-dependent transcription in vitro (12, 13, 14). The functional roles of these two sites in vivo have not been addressed. We mutagenized these two sites individually and were able to dissect the functions of these cis-acting elements into basal transcriptional activation and cAMP response in our transgenic mouse studies. The proximal SF-1-binding site was essential for transcription. The upstream site, while contributing to some basal transcription, appeared to function in the control of hormonal response.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Function of the Two SF-1-Binding Sites in Vitro
About 2 kb of the human CYP11A1 promoter have been studied extensively. Of the six potential SF-1-binding sites (15), only two sites, located at -40 and -1,600 (Fig. 1Go), were functional in our earlier experiments (14). To further explore the functions of these two sites, we mutagenized both the upstream (U) and proximal (P) SF-1-binding sites. Electrophoretic mobility shift assay shows that both U and P form a complex with proteins from mouse adrenocortical cell Y1 (Fig. 2Go). This complex was competed away by unlabeled wild-type P or U sequence, but not by a nonspecific competitor (N.S.), nor by the mutated mtP or mtU sequence. These data indicate that the mutated mtU or mtP sequence can no longer bind to SF-1.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Maps of the Human CYP11A1 Promoter and the Transgene Design

The 2.3k and 1.7k plasmids contain 2,300-bp and 1,700-bp 5'-sequence of the CYP11A1 gene linked to a LacZ reporter gene, respectively. Restriction sites for the ApaI and HindIII are indicated. AdE represents an adrenal-specific enhancer that is absent in the 1.7k plasmid. The site that binds Sp1 family members is represented as an oval shape. The cAMP-responsive region located between -1,500 and -1,620 is indicated as cAMP. Two binding sites for SF-1 located at the proximal (-40) and upstream (-1,600) regions are shown together with their sequences. Mutations (sequences shown in lowercase) were introduced into the proximal, upstream, and both SF-1-binding sites, to form mtP, mtU, and mt2X, respectively. The lines in front of the LacZ box indicate the transcription initiation sites of the reporter gene.

 


View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. Mutations of the SF-1-Binding Sites Abolish Their Ability to Bind SF-1

The gels show the electrophoretic mobility shift assay using the proximal (P) or the upstream (U) SF-1-binding site as the probe for interaction with proteins in the nuclear extract from adrenocortical Y1 cells. Competitors are shown on top of each lane; -, no competitor used; N.S., a nonspecific competitor oligo.

 
To test the function of both SF-1-binding sites, we transfected the wild-type and mutated promoters into Y1 cells and scored reporter ß-galactosidase (ß-gal) gene activity (Fig. 3Go). We tested wild-type promoters of 2.3- and 1.7-kb lengths, to determine whether the adrenal enhancer (AdE) sequence that we previously identified at the 1.9-kb region functions in this assay (25). There is no significant difference in transcription driven by either 2.3- or 1.7-kb wild-type promoters. In addition, the mutated mtU promoter has similar activity to the 2.3-kb wild-type promoter. The mtP and mt2X (double mutation) promoters, however, are inactive, showing ß-gal values similar to that of the promoterless LacZ plasmid. This result demonstrates that the proximal and upstream SF-1-binding sites do not have the same function in gene activation.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. Assay of the Wild-Type and Mutated CYP11A1 Promoter Function by Transfection

Plasmids containing the wild-type and mutated CYP11A1 promoter driving LacZ gene expression were transfected into cultured Y1 cells together with an internal control plasmid RSV-CAT. With the exception of the 1.7k clone, all the plasmids contain 2.3 kb of the 5'-flanking sequence. The LacZ clone contains only the reporter LacZ gene without any promoter sequence. The mutant plasmids contain the 2.3-kb promoter with mutations at the upstream (mtU), proximal (mtP), or both (mt2X) sites. ß-Galactosidase activities were measured from each cell lysate, normalized against the internal control and calibrated with that of the 2.3k plasmid transfection. The mean data from eight independent experiments are shown with error bars.

 
Function of the Two SF-1-Binding Sites in Transgenic Mice
To further investigate the control of the CYP11A1 gene expression in vivo, we generated transgenic mouse lines containing the LacZ gene under the control of different lengths of wild-type or mutated promoter fragments. Expression of the transgene varies a great deal among different transgenic mouse lines, depending on the promoter strength, site of integration, and number of transgene copies, as studied in detail previously (26). Even with such variability, we found that the 2.3- and 1.7-kb fragments both direct reporter gene expression in the adrenal, as shown by the presence of many transgenic lines (represented by filled circles) that express significant levels of ß-gal activities (Fig. 4Go). LacZ gene expression driven by the 1.7-kb promoter was also detected in the fetal adrenal primordia, starting at embryonic day 11.5 (data not shown), similar to the developmental regulation observed for the 4.4-kb promoter (26).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Analysis of the ß-Galactosidase Activity in Transgenic Mouse Lines

Transgenic mouse lines carrying the human CYP11A1 promoter sequence joined to the LacZ gene were assayed. ß-Galactosidase activity from homogenates of adrenal glands of each mouse line was measured. Each circle represents an individual transgenic line. Open and filled circles represent the absence and presence of ß-galactosidase activity, respectively.

 
Transgenic lines from both mtP and mtU constructs have markedly reduced reporter gene expression in the adrenal compared with those from the wild-type promoters (Fig. 4Go). The double mutant, mt2X, lost activity completely. None of the 16 transgenic lines generated from this construct has any ß-gal activity above background. These results show that mutations of both P and U sites are deleterious in vivo, while the P site appears to have a more severe effect when mutated.

Some transgenic mice harboring the mtU promoter retain a low level of ß-gal activity (Fig. 4Go). Line U4 is the only one among all mtU lines that still has appreciable amounts of ß-gal activity in the adrenal. We examined whether expression of the reporter gene in this line is tissue specific. Figure 5Go shows that ß-gal activities from the U4 line can be detected in male and female adrenals, ovary, testis, and brain. Transgene expressions are absent in heart, kidney, lung, liver, and spleen. This expression pattern is similar to that from wild-type 1.7k mice (Fig. 5Go and results for three other lines) and the 2.3k mice (26). Generally, the expression of the reporter gene from the mtU construct remains tissue specific. This result is reasonable considering that sequences in the basal promoter including the P site are still preserved.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 5. Retention of Tissue Specificity of Reporter Gene Expression from the Mutated mtU Transgenic Line

ß-Galactosidase activities measured from various tissue homogenates of transgenic mouse line U4 of the mtU construct and line C43 of the 1.7k construct are shown. Ovaries (O), testes (T), brain (B), heart (H), kidney (K), liver (Li), lung (Lu), spleen (S), and male (Am) and female (Af) adrenals were assayed. Tg, Transgenic mice; Non-Tg, nontransgenic littermate.

 
We also tested hormonal regulation of the mutated promoter by injecting hormones into transgenic mice. Previously we have shown that reporter gene expressions directed by the 2.3k and 4.4k promoters are stimulated by ACTH or human CG (hCG) injection in vivo (26, 31a). Figure 6Go shows that ß-gal expression from the adrenal of the mouse line containing the 1.7k construct is stimulated by ACTH, whereas that from the mtU line can not respond to ACTH. ß-Gal activities from the mtP adrenals are extremely low both before and after ACTH stimulation. Similarly, in the testis, the 1.7k construct can be stimulated by hCG injection, but the mtU promoter cannot. These results show that mutation of the upstream SF-1-binding site abolishes hormonal response in both adrenal and testis.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. Hormonal Stimulation of Reporter Gene Expression in Transgenic Mice

A, Effect of ACTH on adrenal gene expression. Female transgenic mice from line C63 of construct 1.7k, line P62 of construct mtP, and line U4 of construct mtU were injected with ACTH or NaCl daily for 7 days. Adrenal homogenates of these mice were then assayed for ß-galactosidase activities. B, Effect of hCG on testis gene expression. Male transgenic mice from line C43 of construct 1.7k and line U4 of construct mtU were injected with hCG or NaCl twice a day for 6 days. ß-Galactosidase activities of the testis homogenate were then measured. The mean ß-galactosidase activities per tissue isolated from three to seven mice are shown with error bars representing standard errors.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have studied the function of both proximal and upstream SF-1-binding sites in the human CYP11A1 promoter both in vitro and in vivo. The proximal SF-1-binding site is situated in the basal promoter region, with the TATA box on one side and a sequence that can bind to Sp-1 family members on the other. This core promoter region is essential for tissue-specific gene expression in vitro, as shown previously (14, 27). Our present study demonstrates that mutation of the proximal SF-1-binding site results in almost complete loss of gene expression in transgenic mice. This proximal SF-1-binding site is therefore required for the core promoter function, both in vitro and in vivo.

The function of the upstream SF-1-binding site in basal gene expression, on the other hand, is less obvious. Mutation of this site does not have a significant effect in vitro (Fig. 3Go). Using transgenic mice, we obtained a mouse line that still expresses the reporter gene at a reasonable level, although the overall expression levels in most mutant lines are low. It appears that a notable function of this upstream SF-1-binding site is in the response to hormonal stimulation. Mutation of this upstream site leads to loss of hormonal response.

The upstream SF-1-binding site is located in the cAMP-responsive region, which is a 100-bp fragment mediating hormonal stimulation of gene expression in vitro (13, 14, 28). This region binds proteins in the cAMP response element binding protein (CREB)/AP1 families in addition to SF-1 (12, 29). The involvement of SF-1 in cAMP response was equivocal, as SF-1 phosphorylation has not been correlated with cAMP response (30, 31), but mutation of the AF-2 activation domain of SF-1 suppresses protein kinase A-dependent transactivation of gene expression (32). The present result shows that the upstream SF-1-binding site U is indeed important for hormonal response in vivo. SF-1 is known to interact with proteins like WT1 (33) and c-Jun for enhanced transcription (34, 35), and with DAX-1 for reduced transcription (33). Therefore, SF-1 participates in cAMP response probably through its interaction with proteins that bind to the upstream cAMP-responsive sequence, rather than via its own phosphorylation by cAMP-dependent protein kinase A.

In addition to the loss of hormonal response, we also noticed a reduction of reporter gene expression in vivo upon mutation of the upstream SF-1-binding site. Most mtU transgenic lines (18 of 22) do not express the reporter gene. On the contrary, about half of the wild-type transgenic lines (5 of 11 for the 2.3k- and 9 of 14 for the 1.7k-constructs) express reporter gene well (Fig. 4Go). This indicates that the upstream SF-1-binding site still has a role in gene expression. Most of the mtP lines do not express reporter gene, except one transgenic line that has a slightly higher than background level of reporter gene expression (Fig. 4Go). These results show that, in vivo, the proximal SF-1-binding site has a major activation function. The upstream site also contributes to some extent.

Our data from transgenic mice do not completely agree with the transfection data, which failed to identify function of the upstream SF-1-binding site (Fig. 3Go). There are also other reports showing that in vivo results do not agree with in vitro data (36, 37, 38). The reason for the discrepancy could be the use of a tumor cell line that does not fully simulate the situation in vivo. Another possibility is the difference of transgene structure in transfection and transgenic mouse experiments. The transgenes are integrated into the chromosomes of transgenic mice, whereas in transient transfection experiments transgenes are assayed before integration into the chromosome. The absence of chromatin structure in the transiently transfected DNA might result in aberrant results. It is therefore essential to verify the results obtained from cell culture by in vivo experiments.

CYP11A1 gene expression in the adrenal and gonads is stimulated by peptide hormones such as ACTH and gonadotropins. These hormones stimulate CYP11A1 gene expression to maintain the differentiated state of the tissue (1). They cannot induce CYP11A1 gene expression, however, when the cells are not steroidogenic. It appears that basal gene expression is required for hormonal response. Without basal gene expression, as in the case of proximal SF-1-site mutant, hormones can no longer stimulate transcription. This proximal SF-1-binding site is a major regulator of basal gene expression. The contribution of the upstream SF-1-binding site to activate basal transcription, on the other hand, is less prominent, thus manifesting its other function for hormonal response. Therefore, the proximal site appears to control basal transcription, whereas the importance of the upstream site lies mainly in hormonal response. Although the upstream and proximal SF-1-binding sites of the human CYP11A1 promoter are similarly involved in transcriptional activation, their physiological roles may appear different.

A few reports have documented the function of SF-1 in vivo. One is the demonstration of the requirement of the SF-1-binding site for the activity of the LH ß-subunit promoter (20). The other is the use of a short, 180-bp Müllerian inhibiting substance (Mis) promoter to show that the SF-1-binding site is essential for gene activation (39). Both studies reach the simple conclusion that SF-1 is indispensable for transcription after studying two to six transgenic mouse lines. In a more refined approach, which examined the function of the mutated SF-1-binding site in the Mis promoter by the homologous recombination (knock-in) procedure, SF-1 appears to act as a quantitative regulator of Mis transcript levels (37). A recent report also shows haploid insufficiency of mice with heterozygous SF-1 function (40). Therefore, SF-1 does not act in an all-or-none fashion; instead, it regulates transcription in a quantitative manner. This is consistent with our data showing that there may be a strength difference between the upstream and the proximal SF-1-binding sites. The reason for our ability to distinguish the variation in SF-1 action is probably due to the relatively large number of transgenic mouse lines used in this study (10–30 lines), which allowed detailed analyses.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The proximal (P) and upstream (U) SF-1-binding sites from pSCC2300 (31a) were mutated separately using the Sculptor in vivo Mutagenesis System (Amersham Pharmacia Biotech, Uppsala, Sweden). Mutant oligos are mtP: AACTACCAGCTCACGGTGATACCAGAAGCTG; and mtU: TGCCTCACTGATCATCGTGAGCCTGGAATG. The double mutant (mt2X) was constructed by replacing the HindIII to ApaI fragment of pmtP with that from pmtU.

The conditions for gel shift experiments were like those previously described (14), except that 10 µg of extract were used for each reaction. Sequences of the sense strand of the oligos used in gel shift are as follows: U, CTAGACAAGGTCATCAT; P, TCGACTTCTGGTATGGCCTTGAGCTGGTAG; mtP, CAGCTTCTGGTATCACCGTGAGCTGGTAGTT; mtU, CATTCCAGGCTCACGGTGATCAGTGAGGCA; N.S., CTAGATTCATGACTGATGAGGTAGTGGT.

Transfections were performed using either supercoiled or linearized plasmids. Cells were harvested 24 h after the addition of 1 mM 8-Br-cAMP, and ß-galactosidase activity was measured by chemiluminescent detection as previously described (26, 35). Injected DNA fragments consisted of the CYP11A1 promoter linked to LacZ and SV40 polyA. Unless otherwise specified, the length of the test promoter was 2.3 kb. Fifteen, 8, 22, and 16 transgenic founders were obtained from the 1.7k, mtP, mtU, and mt2X constructs, respectively. The transgene copy numbers in the genome of transgenic mice determined by Southern blotting were mostly below 5, in a range of 1–30. All transgenic founders and their offspring were of the FVB strain. Genomic DNA was prepared from tails or placentas of embryos. Genotyping was performed by PCR amplification of LacZ with primers 5'-Gal (AGGCATTGGTCTGGACACCAGCAA) and 3'-Gal (GATGAAACGCCGAGTTAACGCCAT), producing a 476-bp fragment.

Mice were housed under standard specific pathogen free laboratory conditions. Five to seven female transgenic mice were injected with ACTH as previously described (26). Six male transgenic mice were injected with 10 IU hCG or saline (Sigma, St. Louis, MO) ip twice a day for 6 days. ß-Galactosidase activities were measured from adrenal or testis tissue homogenates according to a method described previously (26).

Experimental Animals
All studies concerning the use of mice were conducted in accord with the rules established by the Animal Committee at the Institute of Molecular Biology, Academia Sinica.


    ACKNOWLEDGMENTS
 
We would like to thank Shu-Jan Chou for excellent technical assistance and the Transgenic Core Facility at Academia Sinica for the generation of transgenic mouse lines.


    FOOTNOTES
 
Address requests for reprints to: Please address all correspondence to: Dr. Bon-chu Chung, Institute of Molecular Biology, 48 Academia Sinica, Nankang, Taipei, 115 Taiwan. E-mail: mbchung{at}sinica.edu.tw

This work was supported by Grant NSC 89–2311-B-001–114-B25 from the National Science Council, and by Academia Sinica, Republic of China.

Received for publication September 6, 2000. Revision received February 19, 2001. Accepted for publication February 21, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chung B-c, Guo I-C, Chou S-J 1997 Transcriptional regulation of the CYP11A1 and ferredoxin genes. Steroids 62:37–42[CrossRef][Medline]
  2. Miller WL 1988 Molecular biology of steroid hormone synthesis. Endocr Rev 9:295–318[Abstract/Free Full Text]
  3. Guo I-C, Huang C, Chung B-c 1993 Differential regulation of the CYP11A1 (P450scc) and ferredoxin genes in adrenal and placental cells. DNA Cell Biol 12:849–860[Medline]
  4. Le Goascogne C, Robel P, Gouezou M, Sananes N, Baulieu EE, Waterman M 1987 Neurosteroids: cytochrome P-450scc in rat brain. Science 237:1212–1215[Abstract/Free Full Text]
  5. Compagnone NA, Bulfone A, Rubenstein JL, Mellon SH 1995 Expression of the steroidogenic enzyme P450scc in the central and peripheral nervous systems during rodent embryogenesis. Endocrinology 136:2689–2696[Abstract]
  6. Kohchi C, Ukena K, Tsutsui K 1998 Age- and region-specific expressions of the messenger RNAs encoding for steroidogenic enzymes P450scc, P450c17 and 3ß-HSD in the postnatal rat brain. Brain Res 801:233–238[CrossRef][Medline]
  7. Zhang P, Rodriguez H, Mellon SH 1995 Transcriptional regulation of P450scc gene expression in neural and steroidogenic cells: implications for regulation of neurosteroidogenesis. Mol Endocrinol 9:1571–1582[Abstract/Free Full Text]
  8. Mellon SH, Zhang P 1997 The testis and the adrenal are (transcriptionally) the same. Steroids 62:46–52[CrossRef][Medline]
  9. Hu M-C, Guo I-C, Lin J-H, Chung B-c 1991 Regulated expression of cytochrome P-450scc (cholesterol-side-chain cleavage enzyme) in cultured cell lines detected by antibody against bacterially expressed human protein. Biochem J 274:813–817
  10. Kramer RE, Rainey WE, Funkenstein B, Dee A, Simpson ER, Waterman MR 1984 Induction of synthesis of mitochondrial steroidogenic enzymes of bovine adrenocortical cells by analogs cyclic AMP. J Biol Chem 259:707–713[Abstract/Free Full Text]
  11. Ikeda Y, Shen W-H, Ingraham HA, Parker KL 1994 Developmental expression of mouse steroidogenic factor-1, an essential regulator of the steroid hydroxylase. Mol Endocrinol 8:654–662[Abstract/Free Full Text]
  12. Watanabe N, Inoue H, Fujii-Kuriyama Y 1994 Regulatory mechanisms of cAMP-dependent and cell-specific expression of human steroidogenic cytochrome P450scc (CYP11A1) gene. Eur J Biochem 222:825–834[Medline]
  13. Takayama K, Morohashi K, Honda S, Hara N, Omura T 1994 Contribution of Ad4BP, a steroidogenic cell- specific transcription factor, to regulation of the human CYP11A and bovine CYP11B genes through their distal promoters. J Biochem 116:193–203[Abstract/Free Full Text]
  14. Guo I-C, Tsai H-M, Chung B-c 1994 Actions of two different cAMP-responsive sequences and an adrenal enhancer of human CYP11A1 (P450scc) gene in adrenal Y1 and placental JEG-3 cells. J Biol Chem 269:6362–6369[Abstract/Free Full Text]
  15. Morohashi K-i, Honda S-i, Inomata Y, Handa H, Omura T 1992 A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s. J Biol Chem 267:17913–17919[Abstract/Free Full Text]
  16. Nuclear-Receptors-Nomenclature-Committee 1999 A unified nomenclature system for the nuclear receptor subfamily. Cell 97:1–20[CrossRef][Medline]
  17. Ikeda Y, Luo X, Abbud R, Nilson JH, Parker KL 1995 The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol Endocrinol 9:478–486[Abstract/Free Full Text]
  18. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen W-H, Nachtigal MW, Abud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–2312[Abstract/Free Full Text]
  19. Rice DA, Mouw AR, Bogerd AM, Parker KL 1991 A shared promoter element regulates the expression of three steroidogenic enzymes. Mol Endocrinol 5:1552–1561[Abstract/Free Full Text]
  20. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone ß subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10785[Abstract/Free Full Text]
  21. Shen W-H, Moore CCD, Ikeda Y, Parker KL, Ingraham HA 1994 Nuclear receptor steroidogenic factor 1 regulates the Müllerian inhibiting substance gene: a link to the sex determination cascade. Cell 77:651–661[CrossRef][Medline]
  22. Watanabe K, Clarke TR, Lane AH, Wang X, Donahoe PK 2000 Endogenous expression of Mullerian inhibiting substance in early postnatal rat Sertoli cells requires multiple steroidogenic factor-1 and GATA-4-binding sites. Proc Natl Acad Sci USA 97:1624–1629[Abstract/Free Full Text]
  23. Wehrenberg U, Ivell R, Jansen M, von Goedecke S, Walther N 1994 Two orphan receptors binding to a common site are involved in the regulation of the oxytocin gene in the bovine ovary. Proc Natl Acad Sci USA 91:1440–1444[Abstract/Free Full Text]
  24. Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490[CrossRef][Medline]
  25. Chou S-J, Lai K-N, Chung B-c 1996 Characterization of the upstream of the human CYP11A1 gene for cell type-specific expression. J Biol Chem 271:22125–22129[Abstract/Free Full Text]
  26. Hu M-C, Huang Y-Y, Hsu N-C, Li H, Chung B-c 1999 Tissue-specific, hormonal and developmental regulation of CYP11A1/LacZ expression in transgenic mice leads to adrenocortical zone characterization. Endocrinology 140:5609–5618[Abstract/Free Full Text]
  27. Guo I-C, Chung B-c 1999 Cell-type specificity of human CYP11A1 TATA box. J Steroid Biochem Mol Biol 69:329–334[CrossRef][Medline]
  28. Inoue H, Watanabe N, Higashi Y, Fujii-Kuriyama Y 1991 Structure of regulatory regions in the human cytochrome P-450scc (desmolase) gene. Eur J Biochem 195:563–569[Medline]
  29. Chen C, Guo IC 2000 Effect of cAMP on protein binding activities of three elements in upstream promoter of human CYP11A1 gene. Life Sci 67:2045–2049[CrossRef][Medline]
  30. Zhang P, Mellon SH 1996 The orphan nuclear receptor steroidogenic factor-1 regulates the cyclic adenosine 3',5'-monophosphate-mediated transcriptional activation of rat cytochrome P450c17 (17 {alpha}-hydroxylase/c17–20 lyase). Mol Endocrinol 10:147–158[Abstract/Free Full Text]
  31. Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA 1999 Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress. Mol Cell 3:521–526[CrossRef][Medline]
  32. Huang Y-Y, Hu M-C, Hsu N-C, Wang C-KL, Chung B-c, Action of hormone responsive sequence in 2.3 kb promoter of CYPIIAI. Mol Cell Endocrinol, in press
  33. Jacob AL, Lund J 1998 Mutations in the activation function-2 core domain of steroidogenic factor-1 dominantly suppresses PKA-dependent transactivation of the bovine CYP17 gene. J Biol Chem 273:13391–13394[Abstract/Free Full Text]
  34. Nachtigal MW, Hirokawa Y, Enyeart VanHouten DL, Flanagan JN, Hammer GD, Ingraham HA 1998 Wilms’ tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93:445–454[CrossRef][Medline]
  35. Li L-A, Lala D, Chung B-c 1998 Function of steroidogenic factor 1 (SF1) ligand-binding domain in gene activation and interaction with AP1. Bichem Biophys Res Commun 250:318–320[CrossRef][Medline]
  36. Li L-A, Chiang EF-L, Chen J-C, Hsu N-C, Chen Y-J, Chung B-c 1999 Function of steroidogenic factor 1 domains in nuclear localization, transactivation, and interaction with TFIIB and c-Jun. Mol Endocrinol 13:1588–1598[Abstract/Free Full Text]
  37. Kendall SK, Gordon DF, Birkmeier TS, Petrey D, Sarapura VD, O’Shea KS, Wood WM, Lloyd RV, Ridgway EC, Camper SA 1994 Enhancer-mediated high level expression of mouse pituitary glycoprotein hormone {alpha}-subunit transgene in thyrotropes, gonadotropes, and developing pituitary gland. Mol Endocrinol 8:1420–1433[Abstract/Free Full Text]
  38. Arango NA, Lovell-Badge R, Behringer RR 1999 Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development. Cell 99:409–419[CrossRef][Medline]
  39. Crawford PA, Sadovsky Y, Woodson K, Lee SL, Milbrandt J 1995 Adrenocortical function and regulation of the steroid 21-hydroxylase gene in NGFI-B-deficient mice. Mol Cell Biol 15:4331–4316[Abstract]
  40. Giuili G, Shen WH, Ingraham HA 1997 The nuclear receptor SF-1 mediates sexually dimorphic expression of Mullerian inhibiting substance, in vivo. Development 124:1799–1807[Abstract]
  41. Bland ML, Jamieson CA, Akana SF, Bornstein SR, Eisenhofer G, Dallman MF, Ingraham HA 2000 Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal development leading to an impaired stress response. Proc Natl Acad Sci USA 97:14488–14493[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
M.-C. Shih, N.-C. Hsu, C.-C. Huang, T.-S. Wu, P.-Y. Lai, and B.-c. Chung
Mutation of Mouse Cyp11a1 Promoter Caused Tissue-Specific Reduction of Gene Expression and Blunted Stress Response without Affecting Reproduction
Mol. Endocrinol., April 1, 2008; 22(4): 915 - 923.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Sher, N. Yivgi-Ohana, and J. Orly
Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary
Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I.-C. Guo, C.-Y. Huang, C.-K. L. Wang, and B.-c. Chung
Activating Protein-1 Cooperates with Steroidogenic Factor-1 to Regulate 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Human CYP11A1 Transcription in Vitro and in Vivo
Endocrinology, April 1, 2007; 148(4): 1804 - 1812.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al.
International Union of Pharmacology. LXVI. Orphan Nuclear Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H.-T. Hsu, Y.-C. Chang, Y.-N. Chiu, C.-L. Liu, K.-J. Chang, and I.-C. Guo
Leptin Interferes with Adrenocorticotropin/3',5'-Cyclic Adenosine Monophosphate (cAMP) Signaling, Possibly through a Janus Kinase 2-Phosphatidylinositol 3-Kinase/Akt-Phosphodiesterase 3-cAMP Pathway, to Down-Regulate Cholesterol Side-Chain Cleavage Cytochrome P450 Enzyme in Human Adrenocortical NCI-H295 Cell Line
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2761 - 2769.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Tsuchiya, M. Nakajima, S. Takagi, M. Katoh, W. Zheng, C. R Jefcoate, and T. Yokoi
Binding of Steroidogenic Factor-1 to the Regulatory Region Might Not Be Critical for Transcriptional Regulation of the Human CYP1B1 Gene.
J. Biochem., March 1, 2006; 139(3): 527 - 534.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. N. Winnay and G. D. Hammer
Adrenocorticotropic Hormone-Mediated Signaling Cascades Coordinate a Cyclic Pattern of Steroidogenic Factor 1-Dependent Transcriptional Activation
Mol. Endocrinol., January 1, 2006; 20(1): 147 - 166.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. N Kelly, T J. McKenna, and L. S Young
Coregulatory protein-orphan nuclear receptor interactions in the human adrenal cortex
J. Endocrinol., July 1, 2005; 186(1): 33 - 42.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. W. Kim, J. C. Havelock, B. R. Carr, and G. R. Attia
The Orphan Nuclear Receptor, Liver Receptor Homolog-1, Regulates Cholesterol Side-Chain Cleavage Cytochrome P450 Enzyme in Human Granulosa Cells
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1678 - 1685.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Val, C. Aigueperse, B. Ragazzon, G. Veyssiere, A.-M. Lefrancois-Martinez, and A. Martinez
Adrenocorticotropin/3',5'-Cyclic AMP-Mediated Transcription of the Scavenger akr1-b7 Gene in Adrenocortical Cells Is Dependent on Three Functionally Distinct Steroidogenic Factor-1-Responsive Elements
Endocrinology, February 1, 2004; 145(2): 508 - 518.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Peng, J. W. Kim, W. E. Rainey, B. R. Carr, and G. R. Attia
The Role of the Orphan Nuclear Receptor, Liver Receptor Homologue-1, in the Regulation of Human Corpus Luteum 3{beta}-Hydroxysteroid Dehydrogenase Type II
J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6020 - 6028.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. M. Gummow, J. N. Winnay, and G. D. Hammer
Convergence of Wnt Signaling and Steroidogenic Factor-1 (SF-1) on Transcription of the Rat Inhibin {alpha} Gene
J. Biol. Chem., July 11, 2003; 278(29): 26572 - 26579.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Martinez, P. Val, I. Sahut-Barnola, C. Aigueperse, G. Veyssiere, and A.-M. Lefrancois-Martinez
Steroidogenic Factor-1 Controls the Aldose Reductase akr1b7 Gene Promoter in Transgenic Mice through an Atypical Binding Site
Endocrinology, May 1, 2003; 144(5): 2111 - 2120.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Desclozeaux, I. N. Krylova, F. Horn, R. J. Fletterick, and H. A. Ingraham
Phosphorylation and Intramolecular Stabilization of the Ligand Binding Domain in the Nuclear Receptor Steroidogenic Factor 1
Mol. Cell. Biol., October 15, 2002; 22(20): 7193 - 7203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Gizard, B. Lavallee, F. DeWitte, E. Teissier, B. Staels, and D. W. Hum
The Transcriptional Regulating Protein of 132 kDa (TReP-132) Enhances P450scc Gene Transcription through Interaction with Steroidogenic Factor-1 in Human Adrenal Cells
J. Biol. Chem., October 11, 2002; 277(42): 39144 - 39155.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. von Hofsten, J. Karlsson, I. Jones, and P.-E. Olsson
Expression and Regulation of Fushi Tarazu Factor-1 and Steroidogenic Genes During Reproduction in Arctic Char (Salvelinus alpinus)
Biol Reprod, October 1, 2002; 67(4): 1297 - 1304.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Doi, H. Takemori, X.-z. Lin, N. Horike, Y. Katoh, and M. Okamoto
Salt-inducible Kinase Represses cAMP-dependent Protein Kinase-mediated Activation of Human Cholesterol Side Chain Cleavage Cytochrome P450 Promoter through the CREB Basic Leucine Zipper Domain
J. Biol. Chem., May 3, 2002; 277(18): 15629 - 15637.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. S. Babu, D. L. Bavers, F. Beuschlein, S. Shah, B. Jeffs, J. L. Jameson, and G. D. Hammer
Interaction Between Dax-1 and Steroidogenic Factor-1 in Vivo: Increased Adrenal Responsiveness to ACTH in the Absence of Dax-1
Endocrinology, February 1, 2002; 143(2): 665 - 673.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CHORIONIC GONADOTROPIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals