Molecular Endocrinology 15 (5): 812-818
Copyright © 2001 by The Endocrine Society
Functions of the Upstream and Proximal Steroidogenic Factor 1 (SF-1)-Binding Sites in the CYP11A1 Promoter in Basal Transcription and Hormonal Response
Meng-Chun Hu,
Nai-Chi Hsu,
Chin-I Pai,
Chi-Kuang Leo Wang and
Bon-chu Chung
Institute of Molecular Biology Academia Sinica Nankang,
Taipei Taiwan 115, Republic of China
 |
ABSTRACT
|
|---|
The CYP11A1 gene encodes P450scc
(cholesterol side-chain cleavage enzyme), which catalyzes the first
step for the synthesis of steroids. Expression of CYP11A1
is controlled by transcription factor SF-1 (steroidogenic factor 1).
Two functional SF-1-binding sites, P and U,
located at -40 and -1,600 regions of the CYP11A1 gene,
have been identified, but their exact functions with respect to basal
activation vs. cAMP response have not been dissected. We
have addressed this question by examining the ability of the mutated
human CYP11A1 promoter to drive LacZ reporter
gene expression in transgenic mouse lines. The activity of the
mtP mutant promoter was greatly reduced, indicating the
importance of the P site. Mutation of the upstream
U site also resulted in reduced reporter gene expression,
but some residual activity remained. This residual reporter gene
activity was detected in the adrenal and gonad in a tissue-specific
manner. ACTH and hCG can stimulate LacZ gene expression in
the adrenals and testes of transgenic mice driven by the wild-type but
not the mtU promoter. These results indicate that the
upstream SF-1-binding site is required for hormonal stimulation. Our
experiments demonstrate the participation of both the proximal and the
upstream SF-1-binding sites in hormone-responsive transcription.
 |
INTRODUCTION
|
|---|
Steroids are circulating hormones secreted from endocrine glands
in minute amounts. The first and rate-limiting step for the synthesis
of steroids is catalyzed by cholesterol side-chain cleavage enzyme
(cytochrome P450scc), which is encoded by CYP11A1. The
expression of the CYP11A1 gene is tightly regulated for
proper steroid secretion (1, 2). CYP11A1 is mainly expressed
in the adrenal and gonads, as well as placenta during pregnancy (3). In
addition to these major endocrine glands, Cyp11a1 is also
expressed in the brain, producing neurosteroids (4, 5, 6). With the
exception of brain and placenta, which appear to have different control
mechanisms (3, 7), the adrenals and gonads share similar machinery for
the regulation of CYP11A1 gene expression (8).
The expression of CYP11A1 in the adrenal and gonads is
stimulated by pituitary hormone (2). ACTH secreted by pituitary
stimulates expression of CYP11A1 in the adrenal. Similarly,
gonadotropins secreted from the pituitary stimulate CYP11A1
gene expression in gonads. These pituitary hormones bind to the G
protein-coupled receptors located at the cell surface of the adrenal or
gonads and trigger the increase of intracellular cAMP. cAMP is the
intracellular messenger that transmits signals to the nucleus to
increase transcription of the CYP11A1 gene (9, 10). In
addition to this hormonal regulation, Cyp11a1 expression in
the adrenal and gonads is also regulated developmentally, starting at
embryonic day 11, and persists throughout life (11).
Mechanisms controlling CYP11A1 gene expression in the
adrenal and gonads have been dissected. Two sequences located at the
proximal (-40) and upstream (-1,600) regions of the human
CYP11A1 gene have been shown to bind transcription factor
SF-1 (steroidogenic factor 1), which triggers cAMP-dependent gene
expression in cell culture studies (12, 13, 14). SF-1 [also termed Ad4BP
or NR5A1 (15, 16)] is a transcriptional activator expressed in the
adrenal, gonads, pituitary gonadotropes, and ventromedial nucleus of
the hypothalamus (11, 17, 18). SF-1 controls expression of not only
steroidogenic genes (19), but also genes of secreted signaling
molecules such as gonadotropin (20), Müllerian inhibiting
substance (21, 22), and oxytocin (23).
Despite a great deal of in vitro studies, final proofs
showing that SF-1 can activate Cyp11a1 gene expression
in vivo is lacking. Generation of SF-1 null
mutation in mice results in the loss of adrenals and gonads (24), thus
precluding studies of Cyp11a1 gene expression due to the
lack of tissues in which Cyp11a1 is expressed. To alleviate
this problem, we have devised a transgenic mouse study employing
wild-type and mutant CYP11A1 promoters connected to a
LacZ reporter gene to address the function of SF-1-binding
sites in vivo.
Furthermore, the functions of the two SF-1-binding sites located at the
proximal and upstream regions of the CYP11A1 promoter have
not been dissected carefully. Earlier studies showed that both sites
are important for cAMP-dependent transcription in vitro
(12, 13, 14). The functional roles of these two sites in vivo
have not been addressed. We mutagenized these two sites individually
and were able to dissect the functions of these cis-acting
elements into basal transcriptional activation and cAMP response in our
transgenic mouse studies. The proximal SF-1-binding site was essential
for transcription. The upstream site, while contributing to some basal
transcription, appeared to function in the control of hormonal
response.
 |
RESULTS
|
|---|
Function of the Two SF-1-Binding Sites in Vitro
About 2 kb of the human CYP11A1 promoter have been
studied extensively. Of the six potential SF-1-binding sites (15), only
two sites, located at -40 and -1,600 (Fig. 1
), were functional in our earlier
experiments (14). To further explore the functions of these two sites,
we mutagenized both the upstream (U) and proximal
(P) SF-1-binding sites. Electrophoretic mobility shift assay
shows that both U and P form a complex with
proteins from mouse adrenocortical cell Y1 (Fig. 2
). This complex was competed away by
unlabeled wild-type P or U sequence, but not by a
nonspecific competitor (N.S.), nor by the mutated mtP or
mtU sequence. These data indicate that the mutated
mtU or mtP sequence can no longer bind to
SF-1.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 1. Maps of the Human CYP11A1 Promoter
and the Transgene Design
The 2.3k and 1.7k plasmids contain
2,300-bp and 1,700-bp 5'-sequence of the CYP11A1 gene
linked to a LacZ reporter gene, respectively.
Restriction sites for the ApaI and
HindIII are indicated. AdE represents an
adrenal-specific enhancer that is absent in the 1.7k
plasmid. The site that binds Sp1 family members is represented as an
oval shape. The cAMP-responsive region located between
-1,500 and -1,620 is indicated as cAMP. Two binding sites for SF-1
located at the proximal (-40) and upstream (-1,600) regions are shown
together with their sequences. Mutations (sequences shown in
lowercase) were introduced into the proximal, upstream,
and both SF-1-binding sites, to form mtP, mtU, and
mt2X, respectively. The lines in front of
the LacZ box indicate the transcription initiation sites of the
reporter gene.
|
|

View larger version (46K):
[in this window]
[in a new window]
|
Figure 2. Mutations of the SF-1-Binding Sites Abolish Their
Ability to Bind SF-1
The gels show the electrophoretic mobility shift assay using the
proximal (P) or the upstream (U) SF-1-binding site as the probe for
interaction with proteins in the nuclear extract from adrenocortical Y1
cells. Competitors are shown on top of each lane; -, no
competitor used; N.S., a nonspecific competitor oligo.
|
|
To test the function of both SF-1-binding sites, we transfected the
wild-type and mutated promoters into Y1 cells and scored reporter
ß-galactosidase (ß-gal) gene activity (Fig. 3
). We tested wild-type promoters of 2.3-
and 1.7-kb lengths, to determine whether the adrenal enhancer (AdE)
sequence that we previously identified at the 1.9-kb region functions
in this assay (25). There is no significant difference in transcription
driven by either 2.3- or 1.7-kb wild-type promoters. In addition, the
mutated mtU promoter has similar activity to the 2.3-kb
wild-type promoter. The mtP and mt2X (double
mutation) promoters, however, are inactive, showing ß-gal values
similar to that of the promoterless LacZ plasmid. This
result demonstrates that the proximal and upstream SF-1-binding sites
do not have the same function in gene activation.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 3. Assay of the Wild-Type and Mutated
CYP11A1 Promoter Function by Transfection
Plasmids containing the wild-type and mutated CYP11A1
promoter driving LacZ gene expression were transfected
into cultured Y1 cells together with an internal control plasmid
RSV-CAT. With the exception of the 1.7k clone, all
the plasmids contain 2.3 kb of the 5'-flanking sequence. The LacZ clone
contains only the reporter LacZ gene without any promoter sequence. The
mutant plasmids contain the 2.3-kb promoter with mutations at the
upstream (mtU), proximal (mtP), or both (mt2X) sites. ß-Galactosidase
activities were measured from each cell lysate, normalized against the
internal control and calibrated with that of the 2.3k
plasmid transfection. The mean data from eight independent experiments
are shown with error bars.
|
|
Function of the Two SF-1-Binding Sites in Transgenic Mice
To further investigate the control of the CYP11A1 gene
expression in vivo, we generated transgenic mouse lines
containing the LacZ gene under the control of different
lengths of wild-type or mutated promoter fragments. Expression of the
transgene varies a great deal among different transgenic mouse lines,
depending on the promoter strength, site of integration, and number of
transgene copies, as studied in detail previously (26). Even with such
variability, we found that the 2.3- and 1.7-kb fragments both direct
reporter gene expression in the adrenal, as shown by the presence of
many transgenic lines (represented by filled circles) that
express significant levels of ß-gal activities (Fig. 4
). LacZ gene expression
driven by the 1.7-kb promoter was also detected in the fetal adrenal
primordia, starting at embryonic day 11.5 (data not shown), similar to
the developmental regulation observed for the 4.4-kb promoter (26).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4. Analysis of the ß-Galactosidase Activity in
Transgenic Mouse Lines
Transgenic mouse lines carrying the human CYP11A1
promoter sequence joined to the LacZ gene were assayed.
ß-Galactosidase activity from homogenates of adrenal glands of each
mouse line was measured. Each circle represents an
individual transgenic line. Open and filled
circles represent the absence and presence of ß-galactosidase
activity, respectively.
|
|
Transgenic lines from both mtP and mtU constructs
have markedly reduced reporter gene expression in the adrenal compared
with those from the wild-type promoters (Fig. 4
). The double mutant,
mt2X, lost activity completely. None of the 16 transgenic
lines generated from this construct has any ß-gal activity above
background. These results show that mutations of both P and
U sites are deleterious in vivo, while the
P site appears to have a more severe effect when
mutated.
Some transgenic mice harboring the mtU promoter retain a low
level of ß-gal activity (Fig. 4
). Line U4 is the only one
among all mtU lines that still has appreciable amounts of
ß-gal activity in the adrenal. We examined whether expression of the
reporter gene in this line is tissue specific. Figure 5
shows that ß-gal activities from the
U4 line can be detected in male and female adrenals, ovary,
testis, and brain. Transgene expressions are absent in heart, kidney,
lung, liver, and spleen. This expression pattern is similar to that
from wild-type 1.7k mice (Fig. 5
and results for three other lines) and
the 2.3k mice (26). Generally, the expression of the reporter gene from
the mtU construct remains tissue specific. This result is
reasonable considering that sequences in the basal promoter including
the P site are still preserved.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 5. Retention of Tissue Specificity of Reporter Gene
Expression from the Mutated mtU Transgenic Line
ß-Galactosidase activities measured from various tissue homogenates
of transgenic mouse line U4 of the mtU
construct and line C43 of the 1.7k
construct are shown. Ovaries (O), testes (T), brain (B), heart (H),
kidney (K), liver (Li), lung (Lu), spleen (S), and male (Am) and female
(Af) adrenals were assayed. Tg, Transgenic mice; Non-Tg, nontransgenic
littermate.
|
|
We also tested hormonal regulation of the mutated promoter by injecting
hormones into transgenic mice. Previously we have shown that reporter
gene expressions directed by the 2.3k and 4.4k promoters are stimulated
by ACTH or human CG (hCG) injection in vivo (26, 31a). Figure 6
shows that
ß-gal expression from the adrenal of the mouse line containing the
1.7k construct is stimulated by ACTH, whereas that from the
mtU line can not respond to ACTH. ß-Gal activities from
the mtP adrenals are extremely low both before and after
ACTH stimulation. Similarly, in the testis, the 1.7k
construct can be stimulated by hCG injection, but the mtU
promoter cannot. These results show that mutation of the upstream
SF-1-binding site abolishes hormonal response in both adrenal and
testis.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 6. Hormonal Stimulation of Reporter Gene Expression in
Transgenic Mice
A, Effect of ACTH on adrenal gene expression. Female transgenic
mice from line C63 of construct
1.7k, line P62 of construct
mtP, and line U4 of construct
mtU were injected with ACTH or NaCl daily for 7 days.
Adrenal homogenates of these mice were then assayed for
ß-galactosidase activities. B, Effect of hCG on testis gene
expression. Male transgenic mice from line C43 of
construct 1.7k and line U4 of construct
mtU were injected with hCG or NaCl twice a day for 6
days. ß-Galactosidase activities of the testis homogenate were then
measured. The mean ß-galactosidase activities per tissue isolated
from three to seven mice are shown with error bars
representing standard errors.
|
|
 |
DISCUSSION
|
|---|
We have studied the function of both proximal and upstream
SF-1-binding sites in the human CYP11A1 promoter both
in vitro and in vivo. The proximal SF-1-binding
site is situated in the basal promoter region, with the TATA box on one
side and a sequence that can bind to Sp-1 family members on the other.
This core promoter region is essential for tissue-specific gene
expression in vitro, as shown previously (14, 27). Our
present study demonstrates that mutation of the proximal SF-1-binding
site results in almost complete loss of gene expression in transgenic
mice. This proximal SF-1-binding site is therefore required for the
core promoter function, both in vitro and in
vivo.
The function of the upstream SF-1-binding site in basal gene
expression, on the other hand, is less obvious. Mutation of this site
does not have a significant effect in vitro (Fig. 3
). Using
transgenic mice, we obtained a mouse line that still expresses the
reporter gene at a reasonable level, although the overall expression
levels in most mutant lines are low. It appears that a notable function
of this upstream SF-1-binding site is in the response to hormonal
stimulation. Mutation of this upstream site leads to loss of hormonal
response.
The upstream SF-1-binding site is located in the cAMP-responsive
region, which is a 100-bp fragment mediating hormonal stimulation of
gene expression in vitro (13, 14, 28). This region binds
proteins in the cAMP response element binding protein (CREB)/AP1
families in addition to SF-1 (12, 29). The involvement of SF-1 in cAMP
response was equivocal, as SF-1 phosphorylation has not been correlated
with cAMP response (30, 31), but mutation of the AF-2 activation domain
of SF-1 suppresses protein kinase A-dependent transactivation of gene
expression (32). The present result shows that the upstream
SF-1-binding site U is indeed important for hormonal
response in vivo. SF-1 is known to interact with proteins
like WT1 (33) and c-Jun for enhanced transcription (34, 35), and with
DAX-1 for reduced transcription (33). Therefore, SF-1 participates in
cAMP response probably through its interaction with proteins that bind
to the upstream cAMP-responsive sequence, rather than via its own
phosphorylation by cAMP-dependent protein kinase A.
In addition to the loss of hormonal response, we also noticed a
reduction of reporter gene expression in vivo upon mutation
of the upstream SF-1-binding site. Most mtU transgenic lines
(18 of 22) do not express the reporter gene. On the contrary, about
half of the wild-type transgenic lines (5 of 11 for the
2.3k- and 9 of 14 for the 1.7k-constructs)
express reporter gene well (Fig. 4
). This indicates that the upstream
SF-1-binding site still has a role in gene expression. Most of the
mtP lines do not express reporter gene, except one
transgenic line that has a slightly higher than background level of
reporter gene expression (Fig. 4
). These results show that, in
vivo, the proximal SF-1-binding site has a major activation
function. The upstream site also contributes to some extent.
Our data from transgenic mice do not completely agree with the
transfection data, which failed to identify function of the upstream
SF-1-binding site (Fig. 3
). There are also other reports showing that
in vivo results do not agree with in vitro data
(36, 37, 38). The reason for the discrepancy could be the use of a tumor
cell line that does not fully simulate the situation in
vivo. Another possibility is the difference of transgene structure
in transfection and transgenic mouse experiments. The transgenes are
integrated into the chromosomes of transgenic mice, whereas in
transient transfection experiments transgenes are assayed before
integration into the chromosome. The absence of chromatin structure in
the transiently transfected DNA might result in aberrant results. It is
therefore essential to verify the results obtained from cell culture by
in vivo experiments.
CYP11A1 gene expression in the adrenal and gonads is
stimulated by peptide hormones such as ACTH and gonadotropins. These
hormones stimulate CYP11A1 gene expression to maintain the
differentiated state of the tissue (1). They cannot induce
CYP11A1 gene expression, however, when the cells are not
steroidogenic. It appears that basal gene expression is required for
hormonal response. Without basal gene expression, as in the case of
proximal SF-1-site mutant, hormones can no longer stimulate
transcription. This proximal SF-1-binding site is a major regulator of
basal gene expression. The contribution of the upstream SF-1-binding
site to activate basal transcription, on the other hand, is less
prominent, thus manifesting its other function for hormonal response.
Therefore, the proximal site appears to control basal transcription,
whereas the importance of the upstream site lies mainly in hormonal
response. Although the upstream and proximal SF-1-binding sites of the
human CYP11A1 promoter are similarly involved in
transcriptional activation, their physiological roles may appear
different.
A few reports have documented the function of SF-1 in
vivo. One is the demonstration of the requirement of the
SF-1-binding site for the activity of the LH ß-subunit
promoter (20). The other is the use of a short, 180-bp Müllerian
inhibiting substance (Mis) promoter to show that the
SF-1-binding site is essential for gene activation (39). Both studies
reach the simple conclusion that SF-1 is indispensable for
transcription after studying two to six transgenic mouse lines. In a
more refined approach, which examined the function of the mutated
SF-1-binding site in the Mis promoter by the homologous
recombination (knock-in) procedure, SF-1 appears to act as a
quantitative regulator of Mis transcript levels (37). A
recent report also shows haploid insufficiency of mice with
heterozygous SF-1 function (40). Therefore, SF-1 does not act in an
all-or-none fashion; instead, it regulates transcription in a
quantitative manner. This is consistent with our data showing that
there may be a strength difference between the upstream and the
proximal SF-1-binding sites. The reason for our ability to distinguish
the variation in SF-1 action is probably due to the relatively large
number of transgenic mouse lines used in this study (1030 lines),
which allowed detailed analyses.
 |
MATERIALS AND METHODS
|
|---|
The proximal (P) and upstream (U)
SF-1-binding sites from pSCC2300 (31a) were mutated
separately using the Sculptor in vivo Mutagenesis System
(Amersham Pharmacia Biotech, Uppsala, Sweden). Mutant
oligos are mtP: AACTACCAGCTCACGGTGATACCAGAAGCTG; and
mtU: TGCCTCACTGATCATCGTGAGCCTGGAATG. The double mutant
(mt2X) was constructed by replacing the HindIII
to ApaI fragment of pmtP with that from
pmtU.
The conditions for gel shift experiments were like those previously
described (14), except that 10 µg of extract were used for each
reaction. Sequences of the sense strand of the oligos used in gel shift
are as follows: U, CTAGACAAGGTCATCAT; P,
TCGACTTCTGGTATGGCCTTGAGCTGGTAG; mtP,
CAGCTTCTGGTATCACCGTGAGCTGGTAGTT; mtU,
CATTCCAGGCTCACGGTGATCAGTGAGGCA; N.S.,
CTAGATTCATGACTGATGAGGTAGTGGT.
Transfections were performed using either supercoiled or linearized
plasmids. Cells were harvested 24 h after the addition of 1
mM 8-Br-cAMP, and ß-galactosidase activity was measured
by chemiluminescent detection as previously described (26, 35).
Injected DNA fragments consisted of the CYP11A1 promoter
linked to LacZ and SV40 polyA. Unless otherwise specified,
the length of the test promoter was 2.3 kb. Fifteen, 8, 22, and 16
transgenic founders were obtained from the 1.7k, mtP, mtU,
and mt2X constructs, respectively. The transgene copy
numbers in the genome of transgenic mice determined by Southern
blotting were mostly below 5, in a range of 130. All transgenic
founders and their offspring were of the FVB strain. Genomic DNA was
prepared from tails or placentas of embryos. Genotyping was performed
by PCR amplification of LacZ with primers 5'-Gal
(AGGCATTGGTCTGGACACCAGCAA) and 3'-Gal
(GATGAAACGCCGAGTTAACGCCAT), producing a 476-bp fragment.
Mice were housed under standard specific pathogen free
laboratory conditions. Five to seven female transgenic mice were
injected with ACTH as previously described (26). Six male transgenic
mice were injected with 10 IU hCG or saline (Sigma, St.
Louis, MO) ip twice a day for 6 days. ß-Galactosidase activities were
measured from adrenal or testis tissue homogenates according to a
method described previously (26).
Experimental Animals
All studies concerning the use of mice were conducted in accord
with the rules established by the Animal Committee at the Institute of
Molecular Biology, Academia Sinica.
 |
ACKNOWLEDGMENTS
|
|---|
We would like to thank Shu-Jan Chou for excellent technical
assistance and the Transgenic Core Facility at Academia Sinica for the
generation of transgenic mouse lines.
 |
FOOTNOTES
|
|---|
Address requests for reprints to: Please address all correspondence to: Dr. Bon-chu Chung, Institute of Molecular Biology, 48 Academia Sinica, Nankang, Taipei, 115 Taiwan. E-mail: mbchung{at}sinica.edu.tw
This work was supported by Grant NSC 892311-B-001114-B25 from the
National Science Council, and by Academia Sinica, Republic of
China.
Received for publication September 6, 2000.
Revision received February 19, 2001.
Accepted for publication February 21, 2001.
 |
REFERENCES
|
|---|
-
Chung B-c, Guo I-C, Chou S-J 1997 Transcriptional
regulation of the CYP11A1 and ferredoxin genes. Steroids 62:3742[CrossRef][Medline]
-
Miller WL 1988 Molecular biology of steroid hormone
synthesis. Endocr Rev 9:295318[Medline]
-
Guo I-C, Huang C, Chung B-c 1993 Differential regulation of
the CYP11A1 (P450scc) and ferredoxin genes in adrenal and
placental cells. DNA Cell Biol 12:849860[Medline]
-
Le Goascogne C, Robel P, Gouezou M, Sananes N, Baulieu EE,
Waterman M 1987 Neurosteroids: cytochrome P-450scc in rat brain.
Science 237:12121215[Abstract/Free Full Text]
-
Compagnone NA, Bulfone A, Rubenstein JL, Mellon SH 1995 Expression of the steroidogenic enzyme P450scc in the central and
peripheral nervous systems during rodent embryogenesis. Endocrinology 136:26892696[Abstract]
-
Kohchi C, Ukena K, Tsutsui K 1998 Age- and region-specific
expressions of the messenger RNAs encoding for steroidogenic enzymes
P450scc, P450c17 and 3ß-HSD in the postnatal rat brain. Brain Res 801:233238[CrossRef][Medline]
-
Zhang P, Rodriguez H, Mellon SH 1995 Transcriptional
regulation of P450scc gene expression in neural and steroidogenic
cells: implications for regulation of neurosteroidogenesis. Mol
Endocrinol 9:15711582[Abstract]
-
Mellon SH, Zhang P 1997 The testis and the adrenal are
(transcriptionally) the same. Steroids 62:4652[CrossRef][Medline]
-
Hu M-C, Guo I-C, Lin J-H, Chung B-c 1991 Regulated expression
of cytochrome P-450scc (cholesterol-side-chain cleavage enzyme) in
cultured cell lines detected by antibody against bacterially expressed
human protein. Biochem J 274:813817
-
Kramer RE, Rainey WE, Funkenstein B, Dee A, Simpson ER,
Waterman MR 1984 Induction of synthesis of mitochondrial steroidogenic
enzymes of bovine adrenocortical cells by analogs cyclic
AMP. J Biol Chem 259:707713[Abstract/Free Full Text]
-
Ikeda Y, Shen W-H, Ingraham HA, Parker KL 1994 Developmental
expression of mouse steroidogenic factor-1, an essential regulator of
the steroid hydroxylase. Mol Endocrinol 8:654662[Abstract]
-
Watanabe N, Inoue H, Fujii-Kuriyama Y 1994 Regulatory
mechanisms of cAMP-dependent and cell-specific expression of human
steroidogenic cytochrome P450scc (CYP11A1) gene. Eur J
Biochem 222:825834[Medline]
-
Takayama K, Morohashi K, Honda S, Hara N, Omura T 1994 Contribution of Ad4BP, a steroidogenic cell- specific transcription
factor, to regulation of the human CYP11A and bovine CYP11B genes
through their distal promoters. J Biochem 116:193203[Abstract/Free Full Text]
-
Guo I-C, Tsai H-M, Chung B-c 1994 Actions of two different
cAMP-responsive sequences and an adrenal enhancer of human
CYP11A1 (P450scc) gene in adrenal Y1 and placental JEG-3
cells. J Biol Chem 269:63626369[Abstract/Free Full Text]
-
Morohashi K-i, Honda S-i, Inomata Y, Handa H, Omura T 1992 A
common trans-acting factor, Ad4-binding protein, to the
promoters of steroidogenic P-450s. J Biol Chem 267:1791317919[Abstract/Free Full Text]
-
Nuclear-Receptors-Nomenclature-Committee 1999 A unified
nomenclature system for the nuclear receptor subfamily. Cell 97:120[CrossRef][Medline]
-
Ikeda Y, Luo X, Abbud R, Nilson JH, Parker KL 1995 The nuclear
receptor steroidogenic factor 1 is essential for the formation of the
ventromedial hypothalamic nucleus. Mol Endocrinol 9:478486[Abstract]
-
Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen W-H, Nachtigal MW,
Abud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic
factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:23022312[Abstract/Free Full Text]
-
Rice DA, Mouw AR, Bogerd AM, Parker KL 1991 A shared
promoter element regulates the expression of three steroidogenic
enzymes. Mol Endocrinol 5:15521561[Abstract]
-
Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site
is required for activity of the luteinizing hormone ß subunit
promoter in gonadotropes of transgenic mice. J Biol Chem 271:1078210785[Abstract/Free Full Text]
-
Shen W-H, Moore CCD, Ikeda Y, Parker KL, Ingraham HA 1994 Nuclear receptor steroidogenic factor 1 regulates the Müllerian
inhibiting substance gene: a link to the sex determination cascade.
Cell 77:651661[CrossRef][Medline]
-
Watanabe K, Clarke TR, Lane AH, Wang X, Donahoe PK 2000 Endogenous expression of Mullerian inhibiting substance in early
postnatal rat Sertoli cells requires multiple steroidogenic factor-1
and GATA-4-binding sites. Proc Natl Acad Sci USA 97:16241629[Abstract/Free Full Text]
-
Wehrenberg U, Ivell R, Jansen M, von Goedecke S, Walther N 1994 Two orphan receptors binding to a common site are involved in the
regulation of the oxytocin gene in the bovine ovary. Proc Natl Acad Sci
USA 91:14401444[Abstract/Free Full Text]
-
Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear
receptor is essential for adrenal and gonadal development and sexual
differentiation. Cell 77:481490[CrossRef][Medline]
-
Chou S-J, Lai K-N, Chung B-c 1996 Characterization of the
upstream of the human CYP11A1 gene for cell type-specific expression.
J Biol Chem 271:2212522129[Abstract/Free Full Text]
-
Hu M-C, Huang Y-Y, Hsu N-C, Li H, Chung B-c 1999 Tissue-specific, hormonal and developmental regulation of CYP11A1/LacZ
expression in transgenic mice leads to adrenocortical zone
characterization. Endocrinology 140:56095618[Abstract/Free Full Text]
-
Guo I-C, Chung B-c 1999 Cell-type specificity of human
CYP11A1 TATA box. J Steroid Biochem Mol Biol 69:329334[CrossRef][Medline]
-
Inoue H, Watanabe N, Higashi Y, Fujii-Kuriyama Y 1991 Structure of regulatory regions in the human cytochrome
P-450scc (desmolase) gene. Eur J Biochem 195:563569[Medline]
-
Chen C, Guo IC 2000 Effect of cAMP on protein binding
activities of three elements in upstream promoter of human
CYP11A1 gene. Life Sci 67:20452049[CrossRef][Medline]
-
Zhang P, Mellon SH 1996 The orphan nuclear receptor
steroidogenic factor-1 regulates the cyclic adenosine
3',5'-monophosphate-mediated transcriptional activation of rat
cytochrome P450c17 (17
-hydroxylase/c1720 lyase). Mol Endocrinol 10:147158[Abstract]
-
Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel
NL, Ingraham HA 1999 Phosphorylation of the nuclear receptor SF-1
modulates cofactor recruitment: integration of hormone signaling in
reproduction and stress. Mol Cell 3:521526[CrossRef][Medline]
-
Huang Y-Y, Hu M-C, Hsu N-C, Wang C-KL, Chung B-c, Action of
hormone responsive sequence in 2.3 kb promoter of
CYPIIAI. Mol Cell Endocrinol, in press
-
Jacob AL, Lund J 1998 Mutations in the activation function-2
core domain of steroidogenic factor-1 dominantly suppresses
PKA-dependent transactivation of the bovine CYP17 gene. J Biol
Chem 273:1339113394[Abstract/Free Full Text]
-
Nachtigal MW, Hirokawa Y, Enyeart VanHouten DL, Flanagan JN,
Hammer GD, Ingraham HA 1998 Wilms tumor 1 and Dax-1 modulate the
orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93:445454[CrossRef][Medline]
-
Li L-A, Lala D, Chung B-c 1998 Function of steroidogenic
factor 1 (SF1) ligand-binding domain in gene activation and interaction
with AP1. Bichem Biophys Res Commun 250:318320[CrossRef][Medline]
-
Li L-A, Chiang EF-L, Chen J-C, Hsu N-C, Chen Y-J, Chung B-c 1999 Function of steroidogenic factor 1 domains in nuclear
localization, transactivation, and interaction with TFIIB and c-Jun.
Mol Endocrinol 13:15881598[Abstract/Free Full Text]
-
Kendall SK, Gordon DF, Birkmeier TS, Petrey D, Sarapura
VD, OShea KS, Wood WM, Lloyd RV, Ridgway EC, Camper SA 1994 Enhancer-mediated high level expression of mouse pituitary glycoprotein
hormone
-subunit transgene in thyrotropes, gonadotropes, and
developing pituitary gland. Mol Endocrinol 8:14201433[Abstract]
-
Arango NA, Lovell-Badge R, Behringer RR 1999 Targeted
mutagenesis of the endogenous mouse Mis gene promoter: in
vivo definition of genetic pathways of vertebrate sexual
development. Cell 99:409419[CrossRef][Medline]
-
Crawford PA, Sadovsky Y, Woodson K, Lee SL, Milbrandt J 1995 Adrenocortical function and regulation of the steroid 21-hydroxylase
gene in NGFI-B-deficient mice. Mol Cell Biol 15:43314316[Abstract]
-
Giuili G, Shen WH, Ingraham HA 1997 The nuclear receptor SF-1
mediates sexually dimorphic expression of Mullerian inhibiting
substance, in vivo. Development 124:17991807[Abstract]
-
Bland ML, Jamieson CA, Akana SF, Bornstein SR, Eisenhofer G,
Dallman MF, Ingraham HA 2000 Haploinsufficiency of steroidogenic
factor-1 in mice disrupts adrenal development leading to an impaired
stress response. Proc Natl Acad Sci USA 97:1448814493[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M.-C. Shih, N.-C. Hsu, C.-C. Huang, T.-S. Wu, P.-Y. Lai, and B.-c. Chung
Mutation of Mouse Cyp11a1 Promoter Caused Tissue-Specific Reduction of Gene Expression and Blunted Stress Response without Affecting Reproduction
Mol. Endocrinol.,
April 1, 2008;
22(4):
915 - 923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sher, N. Yivgi-Ohana, and J. Orly
Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary
Mol. Endocrinol.,
April 1, 2007;
21(4):
948 - 962.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I.-C. Guo, C.-Y. Huang, C.-K. L. Wang, and B.-c. Chung
Activating Protein-1 Cooperates with Steroidogenic Factor-1 to Regulate 3',5'-Cyclic Adenosine 5'-Monophosphate-Dependent Human CYP11A1 Transcription in Vitro and in Vivo
Endocrinology,
April 1, 2007;
148(4):
1804 - 1812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al.
International Union of Pharmacology. LXVI. Orphan Nuclear Receptors
Pharmacol. Rev.,
December 1, 2006;
58(4):
798 - 836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-T. Hsu, Y.-C. Chang, Y.-N. Chiu, C.-L. Liu, K.-J. Chang, and I.-C. Guo
Leptin Interferes with Adrenocorticotropin/3',5'-Cyclic Adenosine Monophosphate (cAMP) Signaling, Possibly through a Janus Kinase 2-Phosphatidylinositol 3-Kinase/Akt-Phosphodiesterase 3-cAMP Pathway, to Down-Regulate Cholesterol Side-Chain Cleavage Cytochrome P450 Enzyme in Human Adrenocortical NCI-H295 Cell Line
J. Clin. Endocrinol. Metab.,
July 1, 2006;
91(7):
2761 - 2769.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tsuchiya, M. Nakajima, S. Takagi, M. Katoh, W. Zheng, C. R Jefcoate, and T. Yokoi
Binding of Steroidogenic Factor-1 to the Regulatory Region Might Not Be Critical for Transcriptional Regulation of the Human CYP1B1 Gene.
J. Biochem.,
March 1, 2006;
139(3):
527 - 534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Winnay and G. D. Hammer
Adrenocorticotropic Hormone-Mediated Signaling Cascades Coordinate a Cyclic Pattern of Steroidogenic Factor 1-Dependent Transcriptional Activation
Mol. Endocrinol.,
January 1, 2006;
20(1):
147 - 166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. N Kelly, T J. McKenna, and L. S Young
Coregulatory protein-orphan nuclear receptor interactions in the human adrenal cortex
J. Endocrinol.,
July 1, 2005;
186(1):
33 - 42.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Kim, J. C. Havelock, B. R. Carr, and G. R. Attia
The Orphan Nuclear Receptor, Liver Receptor Homolog-1, Regulates Cholesterol Side-Chain Cleavage Cytochrome P450 Enzyme in Human Granulosa Cells
J. Clin. Endocrinol. Metab.,
March 1, 2005;
90(3):
1678 - 1685.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Val, C. Aigueperse, B. Ragazzon, G. Veyssiere, A.-M. Lefrancois-Martinez, and A. Martinez
Adrenocorticotropin/3',5'-Cyclic AMP-Mediated Transcription of the Scavenger akr1-b7 Gene in Adrenocortical Cells Is Dependent on Three Functionally Distinct Steroidogenic Factor-1-Responsive Elements
Endocrinology,
February 1, 2004;
145(2):
508 - 518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Peng, J. W. Kim, W. E. Rainey, B. R. Carr, and G. R. Attia
The Role of the Orphan Nuclear Receptor, Liver Receptor Homologue-1, in the Regulation of Human Corpus Luteum 3{beta}-Hydroxysteroid Dehydrogenase Type II
J. Clin. Endocrinol. Metab.,
December 1, 2003;
88(12):
6020 - 6028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Gummow, J. N. Winnay, and G. D. Hammer
Convergence of Wnt Signaling and Steroidogenic Factor-1 (SF-1) on Transcription of the Rat Inhibin {alpha} Gene
J. Biol. Chem.,
July 11, 2003;
278(29):
26572 - 26579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Martinez, P. Val, I. Sahut-Barnola, C. Aigueperse, G. Veyssiere, and A.-M. Lefrancois-Martinez
Steroidogenic Factor-1 Controls the Aldose Reductase akr1b7 Gene Promoter in Transgenic Mice through an Atypical Binding Site
Endocrinology,
May 1, 2003;
144(5):
2111 - 2120.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Desclozeaux, I. N. Krylova, F. Horn, R. J. Fletterick, and H. A. Ingraham
Phosphorylation and Intramolecular Stabilization of the Ligand Binding Domain in the Nuclear Receptor Steroidogenic Factor 1
Mol. Cell. Biol.,
October 15, 2002;
22(20):
7193 - 7203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Gizard, B. Lavallee, F. DeWitte, E. Teissier, B. Staels, and D. W. Hum
The Transcriptional Regulating Protein of 132 kDa (TReP-132) Enhances P450scc Gene Transcription through Interaction with Steroidogenic Factor-1 in Human Adrenal Cells
J. Biol. Chem.,
October 11, 2002;
277(42):
39144 - 39155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. von Hofsten, J. Karlsson, I. Jones, and P.-E. Olsson
Expression and Regulation of Fushi Tarazu Factor-1 and Steroidogenic Genes During Reproduction in Arctic Char (Salvelinus alpinus)
Biol Reprod,
October 1, 2002;
67(4):
1297 - 1304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Doi, H. Takemori, X.-z. Lin, N. Horike, Y. Katoh, and M. Okamoto
Salt-inducible Kinase Represses cAMP-dependent Protein Kinase-mediated Activation of Human Cholesterol Side Chain Cleavage Cytochrome P450 Promoter through the CREB Basic Leucine Zipper Domain
J. Biol. Chem.,
May 3, 2002;
277(18):
15629 - 15637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. Babu, D. L. Bavers, F. Beuschlein, S. Shah, B. Jeffs, J. L. Jameson, and G. D. Hammer
Interaction Between Dax-1 and Steroidogenic Factor-1 in Vivo: Increased Adrenal Responsiveness to ACTH in the Absence of Dax-1
Endocrinology,
February 1, 2002;
143(2):
665 - 673.
[Abstract]
[Full Text]
[PDF]
|
 |
|