help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pasqualini, C.
Right arrow Articles by Vernier, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pasqualini, C.
Right arrow Articles by Vernier, P.
Molecular Endocrinology 15 (6): 894-908
Copyright © 2001 by The Endocrine Society

Differential Subcellular Distribution and Transcriptional Activity of {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 Isoforms of the Rat Estrogen Receptor-{alpha}

Catherine Pasqualini1, Dominique Guivarc’h1, Jean-Vianney Barnier, Bernard Guibert, Jean-Didier Vincent and Philippe Vernier

Developpement, Evolution et Plasticité du System Nerveux Institut de Neurobiologie Alfred Fessard Centre Nationale de la Recherche Scientifique 91198 Gif-sur-Yvette cedex, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
{Sigma}E3, {Sigma}E4, and {Sigma}E3–4 are naturally occurring estrogen receptor (ER) isoforms, generated through differential splicing of the ER{alpha} primary transcript and abundantly expressed in embryonic rat pituitary. Studies in COS cells transfected with full-length ER{alpha} or its three splice variants fused to green fluorescent protein (GFP), revealed a different subcellular localization for each isoform. In the absence of estradiol, full-length ER{alpha}-GFP was predominantly nuclear, and {Sigma}E3-GFP and {Sigma}E4-GFP were present both in cytoplasm and nucleus, whereas {Sigma}E3–4-GFP was predominantly cytoplasmic. Upon hormone treatment, a dramatic redistribution of full-length ER{alpha}-GFP and {Sigma}E3-GFP, from a diffuse to punctate pattern, occurred within the nucleus. In contrast, the distribution of {Sigma}E4-GFP and {Sigma}E3–4-GFP was unaffected. Nuclear fractionation studies showed that full-length ER-{alpha} and {Sigma}E3 displayed the same hormone-induced ability to tether to nuclear matrix, whereas nuclear {Sigma}E4 appeared to remain loosely associated to functional nuclear constituents. When cotransfected with an estrogen-inducible reporter plasmid (VIT-TK-CAT) in ER-negative (CHO k1) and ER-positive pituitary (GH4 C1) cells, {Sigma}E3–4 exhibited a very weak estrogen-dependent transactivation activity, whereas {Sigma}E3 had an inhibitory effect on full-length ER action. Conversely, {Sigma}E4 displayed estrogen-independent transcriptional activity in ER-negative cells, and in ER-positive cells, enhanced the estrogen-induced gene expression as efficiently as full-length ER{alpha}. In a gel mobility shift assay, phosphorylated {Sigma}E4 was able to form a specific complex with a consensus ERE, while {Sigma}E3 and {Sigma}E3–4 never did bind by themselves. The observed inhibitory action of {Sigma}E3 on estrogen-dependent transcription would rather involve protein-protein interactions such as formation of heterodimers with full-length ER{alpha}, as suggested by immunoprecipitation followed by Western blotting. These data suggest that {Sigma}E3 and {Sigma}E4 may play a physiologically relevant role as negative or constitutively positive modulators of transcription, in the developing rat pituitary.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogens act in a variety of tissues to regulate target gene expression by modulating the activity of specific nuclear receptors. To date, two nuclear estrogen receptors (ER{alpha} and -ß) have been identified that are encoded by different genes (1, 2, 3). ERs belong to the large superfamily of nuclear receptors including steroid hormone, thyroid hormone, retinoic acid, and vitamin D3 receptors. In addition to these ligand-activated transcription factors, several orphan receptors have been isolated for which a physiological ligand is either unknown or unnecessary (4, 5, 6, 7). All members of the nuclear receptor superfamily share a characteristic modular structure with at least three structural and functional domains able to act relatively independently of each other: the ligand-binding domain located at the C-terminal half of the protein, the DNA-binding domain located centrally, and a variable transactivation domain located at the N-terminal end (8).

For both ER{alpha} and -ß, a number of variant transcripts have been described, particularly in cancer cell lines or tumors (see Refs. 9, 10 for reviews). While several of these transcripts, created by skipping internal exons, retain the same reading frame as the full-length transcript, the corresponding variant proteins have been rarely detected. In nontumoral tissue, only one ER{alpha} variant (TERP1; Refs. 11, 12, 13, 14) and one ERß variant (15) have been shown to be translated into functional proteins.

We have recently identified in the pituitary gland three naturally occurring ER{alpha} isoforms ({Sigma}E3, {Sigma}E4, and {Sigma}E3–4), the expression of which is specifically modulated during development (16). {Sigma}E3 harbors a deletion of exon 3 encoding the second zinc finger of the DNA-binding domain, {Sigma}E4 lacks exon 4 that encodes a nuclear localization signal (NLS) and part of the steroid binding domain, and {Sigma}E3–4 lacks both exons 3 and 4 (Fig. 1Go). At early stages of pituitary development in the rat, these spliced isoforms are expressed abundantly, at least 4 days earlier than full-length ER{alpha}. In addition, {Sigma}E3 and {Sigma}E4 are found essentially in the pituitary intermediate lobe and in the cytoplasm, in contrast to full-length ER{alpha} , which is mainly present in the nucleus (16).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Schematic Representation of the Structure of ER Isoforms and GFP Constructs Used in This Study

A, Schematic representation of the structure and the diverse functional domains (see text) of full-length ER{alpha} and its splice variants. {Sigma}E3, {Sigma}E4 and {Sigma}E3–4 isoforms are created by skipping of either exon 3, exon 4, or both exons 3 and 4 from the ER{alpha} primary transcript. Molecular masses of the resulting proteins are indicated in kilodaltons (kDa). B, Construction of ER-GFP and ER{Sigma}-GFP expression plasmids: pEGFPµ plasmid was generated from pEGFP-N1 (CLONTECH Laboratories, Inc.) by mutation of the GFP initiation methionine to a valine. The ER{alpha} and ER{Sigma} sequences were modified by mutation of the stop codon to a glycine codon and fused to the 5'-end of the mutated GFP of the pEGFPµ plasmid.

 
The localization of the unliganded nuclear receptors within the cell and the mechanism of their activation after hormone binding have been intensively debated. Contrary to the original proposal (17), ERs appear to be already located in the nucleus before hormone binding (18, 19), which, in fact, would mainly stabilize an active conformation of the receptor. Hormone binding would promote the dissociation of the receptor from chaperone proteins, ultimately triggering the tight binding of the dimerized receptor to cognate sites on estrogen-responsive genes (20, 21). Although full-length ER is located predominantly in the nucleus at steady state, it actually shuttles between the nucleus and the cytoplasm (22), involving an active and continuous relocation of the hormone-receptor complex (23). There is evidence that specific NLSs are responsible for nuclear targeting of proteins. This process includes two distinct steps: binding to the cytoplasmic side of the nuclear pore followed by energy-dependent transfer inside the nucleus (Ref. 24 , for review). ERs contain multiple NLS: an estrogen-inducible proto-NLS was found in the hormone binding domain, which, on its own, is not sufficient but which, in the presence of estrogen, can cooperate with three constitutive NLS (25). Although it probably involves interaction with NLS-binding proteins (26), the molecular mechanism of nuclear translocation of the receptors is still unknown.

The peculiar cellular localization of the {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 ER isoforms observed in fetal pituitary tissue, and the fact that they lack certain functional regions, prompted us to investigate whether they might play a specific regulatory function during pituitary development. Using transiently transfected cells, we first studied their precise subcellular distribution, in the presence or absence of hormone. Then, we examined the ability of these short isoforms to modulate transcription of estrogen-target genes, i.e. whether they are similarly activated by the hormone, whether they act as real transcription factors, and finally whether and how they affect the transcriptional activity of full-length ER{alpha}.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Subcellular Localization of ER{alpha} Isoforms in Transfected Cells
To observe the subcellular localization of the ER{alpha} and its isoforms in living cells, the C terminus of the four ER{alpha} isoforms was fused to green fluorescent protein (ERs-GFP; see Materials and Methods and Fig. 1BGo). COS-1 cells, transfected with the ERs-GFP expression vectors and treated or not with 17ß-estradiol (E2), were analyzed under a fluorescence microscope with a laser scanning confocal imaging system. To avoid problems that may be caused by overexpression of receptors (27), we selected cells expressing relatively low levels of GFP-tagged molecules. In these conditions (Fig. 2Go), full-length ER-GFP was essentially nuclear in the absence of hormone and appeared evenly distributed throughout the nucleus, excluding the nucleolus. In contrast, {Sigma}E3–4-GFP was present predominantly in cytoplasm, while {Sigma}E3-GFP and {Sigma}E4-GFP were observed both in cytoplasm and nucleus.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. In Vitro Subcellular Localization of ER{alpha} and Its Splice Isoforms in the Presence (E2), or Absence (0) of E2

COS-1 cells were transfected with plasmid encoding a GFP-tagged isoform of ER, cultured on glass coverslips for 30 h in DMEM without phenol red supplemented with 10% FCS twice stripped by charcoal/dextran, and finally treated or not with 1 nM E2 for 2 h. Confocal fluorescence microscopy images are presented. Bars =10 µm.

 
Upon E2 treatment, fluorescence became strictly restricted to the nucleus of COS-1 cells transfected with full-length ER-GFP and {Sigma}E3-GFP, and a dramatic redistribution of both isoforms from a diffuse to a hyperspeckled pattern occurred within the nuclei. By contrast, nuclear {Sigma}E4-GFP remained evenly distributed after hormone treatment, and {Sigma}E3–4-GFP remained cytoplasmic.

Estradiol Effect on the Association of ER{alpha} Isoforms with the Different Nuclear Constituents
It has been consistently shown that upon binding of an agonist ligand, ER{alpha} undergoes changes in its subnuclear distribution and becomes tightly associated with nuclear matrix (NM) (20, 27, 28, 29, 30). We thus qualitatively assessed whether the three deleted isoforms showed the same hormone-induced tethering to the NM.

To identify the subnuclear compartments in which liganded or unliganded ER isoforms would reside, serial extractions were performed on transfected COS-7 cells treated or not with E2 (1 nM). Cytosolic fractions, as well as nuclear fractions containing detergent-extractable proteins (Triton X-100-supernatant or nucleoplasm), DNase I-extractable proteins (DNase I supernatant or chromatin), and finally, proteins remaining after removal of DNA and its associated proteins (NM), were analyzed by Western blotting using a previously described anti-ER{alpha} antiserum (16). As shown in Fig. 3Go, LDH and histone, used as controls, were only detected in the cytosolic and chromatin fractions, respectively. Still, overexpression of proteins in transfected cells may lead to nuclear leakage, as well as nuclear contamination with perinuclear cytoplasm during cell fractionation procedures. This may account, for instance, for the presence of {Sigma}E3–4 in the nucleoplasm fraction. The distribution of the three other isoforms in the absence of hormone was nevertheless qualitatively similar to that described in our cytological study, with large amounts of full-length ER and {Sigma}E3 in the nucleoplasm, and {Sigma}E4 being located both in the nucleoplasm and the cytosol. The amount of full-length ER and {Sigma}E3 resistant to extractions was significantly increased after treatment of cells with E2 for 2 h, thus showing their tight association with the chromatin and NM fractions. By contrast, {Sigma}E3–4 distribution was almost unaffected, and the nuclear {Sigma}E4 remained fully soluble in Triton X-100 (nucleoplasm), being unassociated with chromatin or NM. Thus, for all ER{alpha} isoforms, the hormone effect on their subcellular distribution reflected the changes in their ability to tightly associate to the functional components of the nucleus.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Subcellular and Subnuclear Distribution of ER{alpha} Isoforms, in the Presence or Absence of E2

COS-7 cells transfected with an ER{alpha} isoform and treated (+) or not (-) with E2 were sequentially fractionated as described in Materials and Methods. Cyto., Cytosolic; Nucl., nuclear fractions; Triton X-100, detergent-extractable proteins (nucleoplasm); DNase 1, DNase 1-extractable proteins (DNA-associated proteins or chromatin); NM, nuclear matrix-bound proteins (i.e. those remaining after the removal of chromatin). Proteins from each fraction were analyzed by Western blotting, using 1) the anti-ER{alpha} polyclonal antiserum, 2) an anti-LDH antibody, and 3) an antipanhistone antibody. Note the highly increased association of full-length ER and {Sigma}E3 to chromatin and NM after ligand binding.

 
Transcriptional Activity of Alternatively Spliced Isoforms of ER{alpha}
To assess the biological activity of the alternatively spliced receptor forms, expression vectors containing one specific ER{alpha} isoform were coexpressed with an estrogen-inducible reporter plasmid (pVit-TK-CAT) in CHO k1 (ER{alpha}-negative) and GH4 C1 (ER{alpha}-positive) cells.

Transfection of CHO cells with full-length ER{alpha} and reporter plasmid resulted in an approximately 4-fold increase in chloramphenicol acetyltransferase (CAT) synthesis in response to E2 (Fig. 4AGo). Changes in gene expression were dependent on the expression of an exogenous ER{alpha} and not the result of an overall increase in basal transcription. Indeed, when CHO cells transfected with the reporter gene alone were treated with E2, in no instance was transcription of the pVit-TK-CAT target gene stimulated (Fig. 4AGo, lanes 1and 2).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 4. Transcriptional Activation of a CAT Reporter Gene Containing an ERE (Vit-TK-CAT; VTC) by the Different ER{alpha} Isoforms in the Presence or Absence of E2 (1 nM)

A, CHO (ER{alpha}-negative) cells were transfected with CAT plasmid alone (VTC), or together with an ER isoform encoding plasmid, combined or not with full-length ER{alpha} plasmid. B, GH4 (ER{alpha}-positive) cells were transfected with CAT reporter plasmid (VTC) alone or together with an ER isoform encoding plasmid. Because of the presence of endogenous active ERs, a CAT reporter plasmid containing no ERE was added as negative control (TC). CAT quantities (expressed as picograms CAT/µg total protein) produced 48 h after transfection are calculated as means (error bars, SD) from three to six independent experiments.

 
Regarding the effects of the ER short isoforms, we found that while {Sigma}E3 alone had no effect on estrogen-dependent transcription, a coexpression of {Sigma}E3 and full-length ER{alpha} resulted in a potent (~60%) inhibition of reporter gene transactivation in comparison to full-length ER{alpha} alone. Conversely, {Sigma}E4 strongly stimulated the transcription of the Vit-TK-CAT reporter gene, even in the absence of E2. {Sigma}E4 thus displayed estrogen-independent constitutive transcriptional activity that was approximately 110% of the activity of the full-length receptor with E2. Coexpression of full-length ER{alpha} and {Sigma}E4 resulted in the same increase in CAT quantity as in the absence of full-length ER, but E2 dependency was recovered. Expression of {Sigma}E3–4 did not significantly stimulate the transcription of the Vit-TK-CAT reporter gene in response to E2. Coexpression of full-length ER{alpha} and {Sigma}E3–4 yielded the same increase in CAT quantity as in the absence of {Sigma}E3–4.

As shown in Fig. 4BGo, transcription of the CAT target gene was stimulated approximately 4-fold when GH4 C1 cells transfected with the estrogen response element (ERE)-containing reporter plasmid alone were treated with E2, confirming the presence of active endogenous ERs. In the same conditions, the activity of the minimal TK-CAT promoter was not stimulated. GH4 C1 cells were used to further analyze the potential interactions between a distinct isoform and the endogenous ER activity. In these cells, overexpression of full-length ER{alpha} resulted in an approximately 7-fold increase in CAT quantity in response to E2. Expression of either {Sigma}E3 or {Sigma}E3–4 did not stimulate CAT synthesis (~3-fold or 5-fold, respectively) above the level obtained by the reporter plasmid alone (VTC) in response to E2. By contrast, expression of {Sigma}E4 resulted in an approximately 12-fold increase in CAT quantity in response to E2. Thus, in GH4 C1 cells, {Sigma}E4 appeared to be able to enhance CAT reporter gene expression at least as efficiently as full-length ER{alpha}.

Coimmunoprecipitation of Full-Length ER{alpha} and ER Isoforms
To investigate whether the effects of ER{alpha} isoforms on transcription could involve protein-protein interactions, a series of immunoprecipitations was performed in which the ability of the short variants to form heterodimers with full-length ER{alpha} was examined. To differentiate isoforms from full-length ER, we used a full-length ER{alpha} tagged with an hemagglutinin epitope (HA).

COS-7 cells were transfected with plasmids encoding HA-tagged full-length ER alone or together with a plasmid encoding one isoform. Western blots prepared from aliquots of cell extracts were used to confirm that the proteins were expressed at equal levels. Blots were reacted either with a monoclonal antibody against HA (data not shown) or with the anti-ER{alpha} antiserum (Fig. 5AGo). The remainder of the extracts were immunoprecipitated with the anti-HA monoclonal antibody, and Western blots of the immunoprecipitated proteins were probed with the anti-ER{alpha} polyclonal antiserum. The data presented in Fig. 5BGo demonstrate that {Sigma}E3 was efficiently coimmunoprecipitated with the HA-tagged full-length ER{alpha}, in the presence or absence of hormone. In contrast, {Sigma}E4 and {Sigma}E3–4 were unable to form stable complexes with full-length ER{alpha}.



View larger version (80K):
[in this window]
[in a new window]
 
Figure 5. Coimmunoprecipitation of Full-Length ER{alpha} and Its Isoforms

COS-7 cells were transfected with expression plasmids encoding full-length HA-tagged ER{alpha} alone (HA-ER f.l.), or together with individual ER isoforms, and cultures were treated (+) or not (-) with 1 nM E2. Upper panel, Western blot analysis of protein extracts from transfected COS-7 cells. Blots were reacted with antiserum directed against ER{alpha}, which recognizes the HA-tagged full-length receptor as well as the truncated isoforms. Note that each isoform is expressed in about equal amounts. Ctl, Control, extracts from COS-7 cells transfected with the empty expression vector. Lower panel, Extracts were immunoprecipitated as described in Materials and Methods using a monoclonal antibody against the HA tag. Immunoprecipitates were then subjected to Western blot analysis using anti-ER{alpha} polyclonal antiserum. Molecular masses (in kilodaltons) are indicated on the right. These immunoblots are representative of three independent experiments. Note that in vivo {Sigma}E3 heterodimerizes with full-length ER{alpha}, in contrast to the other splice variants.

 
Gel Mobility Shift Assays and DNA Binding of ER{alpha} Isoforms
To investigate whether the inhibition or estrogen-independent activation of transcription observed for ER{alpha} isoforms is exerted at the level of DNA binding, a series of gel mobility shift assays were carried out. The ERE oligonucleotide used in these assays contained the 13-bp palindromic sequence identified in the Xenopus vitellogenin (Vit) A2 promoter (31). The ER{alpha} isoforms were produced in COS-7 cells, and reliability of their expression at equal levels was probed by Western blotting. As determined by SDS-PAGE, the apparent molecular mass of full-length ER{alpha}, {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 was 67, 61, 53, and 45 kDa, respectively, close to those predicted from DNA sequences.

Aliquots of WCEs containing individual receptors, prepared from cells treated or not with forskolin/IBMX (isobutylmethylxanthine), were incubated with a 32P-labeled double-stranded ERE oligonucleotide and assayed by electrophoresis on a nondenaturing polyacrylamide gel. As expected, specific ER-ERE complexes were formed with full-length ER{alpha} (in the basal, or phosphorylated state), and the intensity of the band increased with the amount of WCE (Fig. 6AGo, lanes 3 to 6). It may be noticed that more than one complex has formed. However, the lower band (marked with an asterisk) is likely to be nonspecific, being present also in the control lane, which contains extracts from COS-7 cells transfected with the empty expression vector.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 6. Electrophoretic Gel Mobility Shift Assays (EMSA), Showing {Sigma}E4 Binding to a Consensus ERE in Vitro

WCEs were prepared from COS-7 cells transfected with expression plasmids encoding full-length ER-{alpha} (ER f.l.) or {Sigma}E4 and treated 15 min with forskolin-IBMX before harvesting. Aliquots of cell extracts containing the indicated receptors were incubated with a 32P-labeled consensus ERE probe and subjected to EMSA on a 5% polyacrylamide gel as detailed in Materials and Methods. A, The amount of complex formed with the ERE increases with increasing amounts of WCEs loaded on the gel (from 2.5 to 20 µg total protein), both for WCEs containing full-length ER{alpha}, as for {Sigma}E4. B, A fixed amount (20 µg total protein) of WCEs containing either receptor was incubated with 32P-labeled ERE in the presence of anti-ER{alpha} antiserum (Ab; in micrograms), or of an approximately 50-fold excess of unlabeled ERE (ERE competitor). Note that full-length ER{alpha}, but not {Sigma}E4, shows a supershift in the presence of antibody. Arrows indicate the specific complexes formed in the presence of full-length ER{alpha} or {Sigma}E4. Asterisks mark a complex formed between 32P-labeled ERE and an unknown protein present in WCEs. On both gels, a free probe was loaded on lane 1, and an extract of cells transfected with an empty expression vector on lane 2 (controls). In this figure, two autoradiograms are shown of a 12-h exposure at -70 C with an intensifying screen, and both are representative of three independent experiments.

 
When prepared from cells that were not previously treated by forskolin/IBMX, {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 isoforms were unable to form any specific complex with the consensus ERE sequence (data not shown). By contrast, after a general activation via a cAMP-dependent phosphorylation, {Sigma}E4 formed a specific complex with the labeled ERE (Fig. 6Go, A and B), the intensity of which increased with the amount of WCE (Fig. 6AGo, lanes 7 to 10). The formation of this complex could be competitively inhibited by an excess of unlabeled ERE (Fig. 6Go B, compare lanes 6 and 10), and its intensity progressively diminished when an increasing amount of anti-ER{alpha} antiserum was added (Fig. 6BGo, lanes 6 to 9), whereas an anti-BSA (control-) antiserum had no effect (data not shown). This complex was remarkably smaller than that formed between full-length ER{alpha} and the ERE probe, and it also behaved very differently in the presence of anti-ER{alpha} antibody (Fig. 6BGo, compare lanes 3, 4, 6, and 8). Indeed, with this antiserum directed against the carboxy terminus of ER{alpha}, a supershift was observed for the full-length ER-ERE complex, but not for the {Sigma}E4-ERE complex.

Forskolin-Induced Change in {Sigma}E4-GFP Subcellular Localization
Since {Sigma}E4 expressed in COS cells that were treated with forskolin/IBMX was able to bind a consensus ERE, we tested whether the same treatment could also promote specific morphological changes in the nucleus, suggestive of an activated state for {Sigma}E4, and its tethering to NM.

COS-1 cells transfected with expression plasmids encoding the GFP-tagged ERs, and treated or not with forskolin/IBMX for 15 min, were analyzed under confocal fluorescence microscopy. The distribution of full-length ER-GFP, {Sigma}E3-GFP, or {Sigma}E3–4-GFP was totally unaffected by this treatment (data not shown). On the contrary, as shown in Fig. 7Go, unlike E2 treatment (see Fig. 2Go), forskolin/IBMX treatment appeared to change the diffuse nucleoplasmic pattern of {Sigma}E4-GFP distribution (left image) into a partially speckled one and may even induce the complete disappearance of {Sigma}E4-GFP from the cytoplasm (right image).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 7. Forskolin-Induced Changes in {Sigma}E4-GFP Intranuclear Distribution

COS-1 cells were electroporated with an expression plasmid encoding {Sigma}E4-GFP, cultured on glass coverslips for 30 h in DMEM without phenol red supplemented with 10% FCS twice stripped with charcoal/dextran, and finally treated (Fk) or not (0) with forskolin/IBMX for 15 min. For comparison, transfected cells expressing full-length ER-GFP and treated with E2 are also shown. Cells were analyzed under confocal fluorescence microscopy. Bars = 10 µm. Unlike E2 treatment (compare Fig. 2Go), Fk treatment appears to change the diffuse nucleoplasmic pattern of {Sigma}E4-GFP distribution (left panel) into a (more or less pronounced) speckled pattern (central and right panels), suggestive of a phosphorylation-induced tighter association of {Sigma}E4 with the nucleus.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We previously identified three short isoforms of ER{alpha} mRNA and the corresponding proteins that are expressed in the developing rat pituitary (16). The truncated ER{alpha} proteins, lacking certain functional regions, appeared to be localized differentially within the pituitary cells. Here, to characterize their functional properties, we used transiently transfected cells to examine their precise subcellular distribution, as well as their respective ability to modulate gene transcription, in comparison to full-length ER{alpha}.

ERs are known to undergo a continuous nucleocytoplasmic shuttling (22, 32, 33). Nevertheless, at any given time, a major fraction of the protein is present in the nucleus even in the absence of hormone (18, 19). The unliganded receptor with a sedimentation coefficient of 9S is loosely associated to nuclear components, and hormone binding causes activation of the receptor, i.e. a biochemical transformation to a complex with a sedimentation coefficient of 5S that associates more tightly with the nucleus (20, 28, 34). Recently, using GFP tagging, two groups provided visual descriptions of the unoccupied and the ligand-bound ER. The majority of unliganded GFP-ER appears to be evenly distributed throughout the nucleus. Addition of E2 dramatically changes the diffuse nucleoplasmic pattern of GFP-ER{alpha} to a punctate or hyperspeckled pattern (27, 30). This early intranuclear redistribution of GFP-ER{alpha} corresponds to the formation of NM-bound foci of ER{alpha}. These foci are probably similar to the so-called matrix-attachment regions (MARs) that involve 1–4% of the genomic DNA, occur at DNase hypersensitive sites near active genes, and contain many transcription factors (35, 36). The NM-bound foci are quite numerous as compared with real sites of transcription starts, and most of the receptor attachment sites are not actively involved in transcription (27, 37). In fact, it is possible that both constitutive and regulatory MARs exist, and that only the latter are transiently attached to transcriptionally active genes and involved in their regulation (38). The formation of these NM-bound foci of ER{alpha} is not sufficient for transcription to occur, as both agonist and antagonist ligands may elicit such an event (27). Nevertheless, this early intranuclear redistribution of the receptor and association with NM is a mandatory step to transcription activation that, provided it is induced by an agonist, enables ERs to additionally recruit coactivators and finally trigger transcription (27).

In full agreement with these results, our present studies in COS cells transfected with full-length ER{alpha}, fused or not to GFP, showed that, in the absence of ligand, the protein was predominantly present in the nucleus and exhibited a diffuse nucleoplasmic pattern. In a nuclear fractionation study, unliganded full-length ER{alpha} was found most prominently in the Triton X-100 extract. After E2 treatment, receptor distribution was restricted to the nucleus where it displayed a characteristic speckled pattern, and a substantial amount of this protein was strongly associated with chromatin and NM. It has been pointed out by Stenoien et al. (27) that transient expression of ERs in heterologous cells may lead to saturation of the intracellular transport mechanisms, and hence to a misrepresentation of soluble vs. NM-bound forms of ER. While this may explain why even after ligand binding, a certain amount of full-length ER{alpha} remained in the Triton X-100 soluble fraction, our observations concerning the ligand-induced changes in compartmentalization are in agreement with those described for cells naturally expressing ERs.

In addition, our present study on ER{alpha} variants revealed marked differences between full-length receptor and its isoforms with regard to their subcellular localization, solubility partitioning, activation, and biological actions.

{Sigma}E3: An Inhibitor of Estrogen-Target Gene Transcription
In the absence of ligand, the {Sigma}E3 protein was present both in the cytoplasm and the nucleus of transfected cells, as determined either by fluorescence studies employing GFP tagging or by Western blot analysis of subcellular/subnuclear fractions. This isoform retains the ligand binding domain and the NLSs, allowing for hormone binding and translocation to the nucleus. Accordingly, we observed that E2 treatment clearly altered the partitioning of {Sigma}E3 between cytosol and nucleus, and its intranuclear distribution: in the presence of hormone, {Sigma}E3 was found exclusively in the nucleus, showed a punctate distribution, and was found tightly associated with chromatin and NM, like full-length ER{alpha}. Yet, {Sigma}E3 lacks the second zinc finger of the DNA-binding domain, and, as anticipated, our current gel mobility shift assay data show that this protein was unable to bind to a canonical ERE in vitro or to activate transcription of a CAT reporter gene containing an ERE in vivo. In fact, when cotransfected with full-length ER{alpha}, {Sigma}E3 repressed the estrogen-dependent increase in CAT synthesis induced by full-length ER{alpha} in vivo. Thus, in agreement with previous results obtained in the MCF-7 breast cancer cell line (39), {Sigma}E3 inhibits transcriptional activation by full-length ER{alpha} in a dominant negative fashion. This finding is probably related to the fact that {Sigma}E3 inhibits full-length ER binding to a canonical ERE in vitro, as demonstrated by Wang and Miksicek (39).

The {Sigma}E3 isoform is thus likely to modulate the activity of full-length ER{alpha} by protein-protein interactions. For this inhibition, at least two mechanisms that are not mutually exclusive seem possible. First, {Sigma}E3, which still contains a strong hormone-inducible dimerization motif within the ligand-binding domain, could form inactive heterodimers with full-length ER{alpha}. In support of this model, we showed herein that {Sigma}E3, in the presence or absence of E2, can be coimmunoprecipitated with full-length ER-HA, implying a direct physical association between {Sigma}E3 and full-length ER{alpha}. Such heterodimers could then sterically hinder binding of functional receptors. A second mechanism would involve interactions of {Sigma}E3, as a homo- or heterodimer, with a limiting factor required either for receptor function or transcriptional activation. This type of factor, which interact both with enhancer binding proteins and basal transcription factors, can, under some circumstances, be readily depleted via binding to other transcription factors. In this respect, Bollig and Miksicek (40) showed that in the presence of E2, {Sigma}E3 can bind the nuclear receptor coactivator SRC-1, as does full-length ER{alpha}. The coactivators are limiting factors for which {Sigma}E3 and full-length ER-{alpha} are probably competing. Such interaction with an adaptor molecule may also account for the tight association of {Sigma}E3 with chromatin or NM that we observed upon addition of E2.

It has been shown that the amount of {Sigma}E3 transcript is dramatically reduced in primary breast cancers and cancer cell lines, while transfection of {Sigma}E3 into MCF-7 cells leads to a suppression of the transformed phenotype (41). In the light of these latter results and our data, it seems likely that {Sigma}E3 expression in normal tissue may provide a means of decreasing or blocking estrogen responsiveness.

{Sigma}E4: An Estrogen-Independent Activator of Transcription
The {Sigma}E4 isoform lacks amino acids 255–366, corresponding mainly to the hinge region that contains a constitutive NLS. Yet, the present study shows that, in the absence of hormone, a certain amount of this protein was found in the nucleus of transiently transfected COS cells. Lacking also the first 48 amino acids of the ligand binding domain, {Sigma}E4 was expected to be insensitive to estrogens. Accordingly, E2 promoted no change in the subcellular distribution of {Sigma}E4: it was unable to induce a speckled nuclear distribution pattern for {Sigma}E4-GFP, or a tight association of {Sigma}E4 to NM.

Nevertheless, {Sigma}E4 has an intact DNA-binding domain. Since the DNA-binding domain alone was shown to be sufficient for transcriptional activity, at least for certain nuclear receptors (42, 43), it has been suggested that {Sigma}E4 might play a role as constitutively active or estrogen-independent transcription factor. In support of this hypothesis, we showed that this protein indeed retained some activity as a transcription factor, and that this activity was independent of the hormonal ligand: {Sigma}E4 protein exhibited an estrogen-independent transactivation capacity when expressed in an ER-deficient cell line and enhanced estrogen-dependent transcription activity when transfected into cells naturally expressing full-length ER. Thus, {Sigma}E4 is an effective transcriptional activator of estrogen target genes. Since it failed to coimmunoprecipitate with full-length ER{alpha}, a heterodimerization with full-length ER{alpha} will not be involved in this ligand-independent transcriptional activation. In fact, {Sigma}E4 was able, by its own, to bind a consensus ERE in vitro, as it formed a complex with the ERE probe in a gel mobility shift assay. This complex was clearly different from that formed between full-length ER{alpha} and the ERE probe. First, it was of an obviously smaller size. Second, anti-ER{alpha} antiserum did not retard its migration, but inhibited its formation in a dose-dependent manner. According to a recent study from Tyulmenkov and Klinge (44), who compared the impact of various ER{alpha} and ERß antibodies on the interaction of ERs with a consensus ERE, both supershift and inhibition of ER-ERE interaction with a specific antibody are equally reliable as means of detecting an ER isoform in a gel mobility shift assay. Therefore, the observed differences between {Sigma}E4-ERE and full-length ER{alpha}-ERE complexes are suggestive of a difference in the action mechanism of these two protein isoforms. In the classical model, the ERs bind, in response to their ligand (E2), as homodimers to specific estrogen response elements (EREs) within target genes. In fact, we and others have shown that formation of ER homodimers is not the only way for ER to regulate gene transcription. Heterodimers could also be formed and modulate transcription. For instance, heterodimeric complexes can form between ER{alpha} and ERß in vitro, with retained DNA-binding ability and specificity (45). {Sigma}E3 and full-length ER{alpha} were herein shown to form inactive heterodimers. Furthermore, some other nuclear receptors, such as orphan receptors of the Nur type, have been shown to bind DNA as monomers (46). This may also be the case for {Sigma}E4, which lacks sequences involved in dimerization (47) and was shown here to form a complex with the consensus ERE much smaller than the one formed between full-length ER{alpha} and ERE. {Sigma}E4 appears not to require E2 to activate transcription of a reporter gene but needs to be phosphorylated to bind a consensus ERE in vitro. In support of this idea, a partially speckled pattern of {Sigma}E4-GFP distribution was observed in the nucleus, after treatment of the transfected cells with forskolin/IBMX. In fact, many studies have shown that, in addition to the conventional hormone-dependent regulation of ER activity, there is substantial cross-talk between signal transduction pathways and steroid receptors. In a number of cases, a modulation of kinase/phosphatase activity in cells leads to activation of steroid receptors in the absence of hormone (48). Thus, an altered phosphorylation of the receptor and/or associated proteins is likely to be a key event in the ligand-independent activation of ERs.

Transcriptional regulation by ERs involves two activation functions (AFs) that reside on opposite ends of the receptors. AF-1 is located at the amino terminus and is constitutively active, whereas AF-2 is situated at the carboxy-terminal end of the ligand- binding domain (49, 50) and is strictly hormone regulated. Although both AF-1 and AF-2 are required to achieve maximal transcriptional activity, the two transactivating regions may either function independently or cooperate, depending on the target gene promoter and the presence of tissue-specific factors (51). When steroid receptors, including ERs, are activated by nonsteroid agents such as growth factors, protein kinase A, phorbol ester, and dopamine (for reviews, see Refs. 52, 53), which all induce protein phosphorylation, their AF-1 domain appears to be the phosphorylation target. Moreover, it has been shown that the MAP kinase-mediated phosphorylation of the AF-1 domain of ERß and of SF-1 promotes ligand-independent recruitment of nuclear receptor coactivators (54, 55). In the case of {Sigma}E4, it seems possible that phosphorylation of its AF-1 domain would allow for a recruitment of specific coactivators, and a functional interaction with the transcription machinery, independently of the ligand.

{Sigma}E3–4: A Silent Variant
The third ER isoform that we had detected in the developing pituitary, {Sigma}E3–4, appeared to have no biological activity: In transfected cells, it was found predominantly in the cytoplasm, it exhibited no real ability to enter the nucleus and to associate tightly with NM upon ligand binding, nor did it bind a consensus ERE in vitro, dimerize with full-length ER{alpha}, or modulate transcription of estrogen-dependent genes.

Conclusions
In summary, our results demonstrate that {Sigma}E3 and {Sigma}E4, two alternatively spliced isoforms of ER{alpha} mRNA, may antagonize, or mimic, respectively, the function of the full-length gene product. The functional properties of these variants, as well as their expression time course and relative abundance, suggest that they may well play a physiological role as negative and positive regulators of transcription in the pituitary, at least before birth. The strong expression of {Sigma}E3, which antagonizes full-length ER{alpha}, in male embryos during the critical period of development (16), could represent for the pituitary an additional protection mechanism against the potentially deleterious effects of maternal estrogens. Conversely, the {Sigma}E4 isoform, which is early and abundantly expressed in the female embryonic pituitary (16), could represent a hormone-independent, phosphorylation-activated transcription factor, allowing for some intrinsic ER activity regardless of the circulating estrogen levels. The coordinated action during development of differentially active transcription factors created from a single ER gene probably contributes to the differentiation of pituitary cells first in the absence, and then in the presence, of high concentrations of estrogens.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction of the ER Expression Plasmids
RNAs from pituitary gland of male or female rat were extracted in Trizol reagent (Life Technologies, Inc., Gaithersburg, MD) and used for reverse transcription with a mix of oligo-dT and random nonamers using Superscript (Life Technologies, Inc.) according to the manufacturer’s protocol. Sense oligonucleotide (GTCTGGTCCTGTGAAGGCCTGCA) and antisense oligonucleotide (TGACGTAGCCAGCAACATGTCAAAG) located upstream exon 3 and downstream exon 6 of the ER-{alpha} mRNA, respectively, were used as primers for Taq polymerase (Promega Corp., Madison, WI). PCR products corresponding to the three short isoforms deleted from exon 3 (SE3), exon 4 (SE4), and both exons 3 and 4 (SE3–4), respectively, described by Pasqualini et al. (16) were separated on agarose gel, cloned in pCRII by the TA cloning method (Invitrogen, San Diego, CA) and sequenced for verification.

The coding sequence of the ER{alpha} (gift of Professor Muramatsu) in pUC118 (56) was subcloned in pCDNA3 (Invitrogen). To obtain the complete sequence of the ER{alpha} isoforms, the corresponding PCR products inserted in pCRII and ER{alpha} in pCDNA3 were digested with BsmI and BglI and separated on agarose gel. The isoform-specific fragments and the remaining ER{alpha} sequence in pCDNA3 were ligated together to form {Sigma}ER-pCDNA3 plasmids. All the constructs were checked by full-length sequencing.

Generation of ER-GFP Fusion Plasmid
The plasmid pEGFP-N1 (CLONTECH Laboratories, Inc., Palo Alto, CA) was modified by mutation of the translation start codon of the GFP to a valine codon, to generate pEGFPµ plasmid. To fuse the C terminus of the various ER{alpha} sequences to the mutated EGFP, the {Sigma}ER-pCDNA3 and ER{alpha}-pCDNA3 plasmids were modified by mutation of the stop codon to a glycine codon and digested by EcoRI and KpnI. The fragments coding for full-length ER{alpha} and {Sigma}ERs were isolated on agarose gel and subcloned in pEGFPµ in the Bsm and BglII sites to generate the ER-pEGFP and {Sigma}ER-pEGFP fusion plasmids (Fig. 1BGo). The integrity of the fusion was checked by DNA sequencing and direct observation of the fluorescence in transfected cells. Functionality of full-length ER-GFP as a ligand-dependent transcription factor was assayed on an ERE-containing reporter gene in transient transfections experiments using CHOk1 cells, as described in Transcriptional Activity. The activity of full-length ER-GFP was 130 ± 15% that of the native receptor.

Subcellular Localization of GFP-Tagged ER Isoforms in Transfected Cells
COS-1 cells were grown in DMEM (Life Technologies, Inc.) supplemented with 10% FCS. Twenty four hours before transfections, DMEM without phenol red was supplemented with 10% twice charcoal/dextran-stripped FCS. Cells were transfected with 8 µg expression vector ERs-pEGFP, using an electroporator (Bio-Rad Laboratories, Inc., Hercules, CA), and plated on glass coverslips for 30 h in serum-free medium. They were then treated or not with E2 (1 nM) for 2 h. Cells were washed twice in ice-cold PBS and fixed for 30 min at 4 C in PBS-paraformaldehyde 3%. Before mounting in Mowiol (Polysciences, Inc., Warrington, PA), coverglasses were washed twice for 5 min with PBS and cells were observed under a fluorescence microscope, with a laser scanning confocal imaging system.

Sequential Fractionation of the Nuclear Constituents
Forty-eight hours after electroporation, COS-7 cells transfected with individual isoform and treated or not with 1 nM E2 as described above, were washed twice with ice-cold PBS, scraped into PBS, and pelleted by centrifugation at 700 x g for 5 min at 4 C. They were then gently resuspended in 5 vol. of lysis buffer (Tris, pH 7.5, 10 mM NP-40 0.05%, 3 mM MgCl2, 100 mM NaCl, 1 mM EGTA, aprotinin, 20 µg/ml, 1 mM orthovanadate, 1 mM 4-[2-aminoethyl]-benzenosulfonyl fluoride (AEBSF), and leupeptin, 10 µg/ml) and centrifuged at 350 x g for 5 min at 4 C: the supernatant, corresponding to the cytosol, was collected. It represented approximately 80% of the total cell proteins, as assayed using the Coomassie assay reagent (Pierce Chemical Co., Bezons, France).

The crude nuclear pellet was washed once in lysis buffer and twice in ice-cold CSK buffer (10 mM piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.8, 300 mM sucrose, 3 mM MgCl2, 100 mM NaCl, 1 mM EGTA, aprotinin, 20 µg/ml, 1 mM orthovanadate, 1 mM AEBSF, and leupeptin, 10 µg/ml) by gentle resuspension in 5 vol buffer and centrifugation at 350 x g for 5 min at 4 C. Nuclei were then resuspended in CSK buffer containing 1 M sucrose and centrifuged at 1,200 x g for 10 min at 4 C. From this purified nuclei pellet, soluble proteins (nucleoplasm; ~20% of nuclear proteins) were extracted by treatment for 5 min at 4 C with CSK buffer containing 0.5% Triton X-100, followed by a centrifugation at 700 x g for 5 min at 4 C. Chromatin was then digested with DNase I (700 U/ml) in CSK buffer containing 50 mM NaCl, for 60 min at 4 C. The (digested) chromatin-associated proteins were eluted by slowly adding ammonium sulfate in CSK buffer to a final concentration of 0.25 M. The NM (~20% of nuclear proteins) was pelleted at 1,000 x g for 5 min and the chromatin fraction (~ 60% of nuclear proteins) was recovered in the supernatant. All four fractions (cytosol, Triton X-100-soluble fraction, i.e. nucleoplasm-, DNase I supernatant, i.e.chromatin- and NM), were prepared in Laemmli buffer and subjected to SDS-PAGE and Western blot analysis.

Western Blot Analysis of ER Isoforms in Transfected COS Cells
Quantitation of Expression Level of ER Isoforms.
Extracts (5 or 8 µg protein) prepared from COS-1 cells transfected with expression plasmids encoding individual isoforms were compared with a scale of extracts (5–30 µg protein) from ER{alpha}-naturally expressing GH4C1 cells. All the extracts were thus loaded and run on a 10% SDS-PAGE. Corresponding blots were reacted with a previously described (16) antiserum directed against ER{alpha} (1:1,000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), followed by an HRP-coupled secondary antibody (The Jackson Laboratory, Bar Harbor, ME) and enhanced chemiluminescence detection (ECL, Amersham Pharmacia Biotech, Arlington Heights, IL). As shown in Fig. 8Go, the level of ER isoforms expression in transfected COS cells is between 1.5 and 3 times that found in GH4C1 cells which naturally express ER{alpha}.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. Comparison of the Level of ERs Expression in Transfected COS-1 Cells vs. that of Naturally ER{alpha} Expressing GH4C1 Cells

Fixed amounts of protein extracts prepared from COS-1 cells transfected with expression plasmids encoding individual ER isoforms (5 or 8 µg of total protein), and varying amounts of GH4C1 cell extracts (5–30 µg of total protein), were subjected to Western blot analysis. Blots were reacted with antiserum directed against ER{alpha}. ER isoform expression in transfected COS-1 cells is slightly higher, but of about the same order as ER expression in GH4C1 cells.

 
Subcellular and Subnuclear Distribution of ER Isoforms.
Ten micrograms of protein of each fraction were loaded and run on a 10% SDS-PAGE and transferred onto nitrocellulose membrane. Blots were incubated with an antiserum directed against ER{alpha} (1:1,000; Santa Cruz Biotechnology, Inc.), and also with an antibody directed against LDH (1:500; Roche Molecular Biochemicals, Indianapolis, IN), or pan-Histone (1:100; Roche Molecular Biochemicals). They were subsequently reacted with the appropriate HRP-coupled secondary antibody and revealed by chemiluminescence.

Transcriptional Activity
ER-negative CHO k1 cells were grown in DMEM/F12 (1:1) medium supplemented with 10% FCS. Twenty-four hours before transfection, cells were plated in phenol red-free DMEM/F12 medium supplemented with 10% of twice charcoal-stripped FCS.

ER-positive GH4 C1 cells were maintained in MEM supplemented with 2.5% FCS and 10% horse serum. Twenty-four hours before transfection, cells were grown in phenol red-free DMEM supplemented with 2.5 and 10% twice charcoal-stripped FCS and horse serum, respectively, containing RU 58668 (50 nM), an ER antagonist.

Transcriptional effects of individual isoforms were tested using an artificial promoter containing consensus Vit EREs inserted upstream of the thymidine kinase (TK) promoter which drives the expression of the CAT reporter gene. Cells were cotransfected with 10 µg expression vector encoding the different forms of ER{alpha} and 10 µg of the CAT reporter plasmid, pVit-TK-CAT (VTC), with or without (10 µg) full-length ER, by electroporation. Estradiol (1 nM) was added immediately after transfection. Twelve hours (for GH4 C1 line), or 48 h (for CHO k1 line) thereafter, cells were harvested, and CAT quantity was measured in cell extracts. The CAT assays were performed by a colorimetric enzyme immunoassay (CAT-ELISA kit, Roche Molecular Biochemicals, Meylan, France) and were all normalized to protein concentration. In some experiments, CAT values were also standardized to the ß-galactosidase (expression driven by the Rous sarcoma virus promoter) activity, without any qualitative difference.

Immunoprecipitation
COS-7 cells were transiently transfected with an expression plasmid encoding a full-length ER{alpha} tagged with a HA epitope (~68 kDa; HA-ER f.l.) alone or together with expression vector encoding the different (nontagged) isoforms of ER{alpha} and grown for 48 h in a medium containing or not E2. Functionality of HA-ER{alpha} as a ligand dependent-transcription factor was assayed using CHOk1 cells, as described above (see Transcriptional Activity). The activity of HA-ER{alpha} was found to be 135 ± 20% that of the native receptor. To determine whether all isoforms were expressed at equal levels in the cells, aliquots of the cellular extracts were analyzed by Western blotting. Blots were reacted either with a monoclonal antibody directed against HA epitope (12CA5, Roche Molecular Biochemicals), or with the antiserum directed against ER{alpha} (Santa Cruz Biotechnology, Inc.).

The remainder of the cell extracts (containing 200–400 µg total protein) were incubated with 4 µl monoclonal antibody directed against HA epitope and 20 µl pansorbin for 2 h at 4 C. After four washes with cell lysis buffer, immunoprecipitates were pelleted by centrifugation, released into 15 µl SDS loading buffer by boiling for 5 min, and subjected to electrophoresis on a 12% acrylamide gel. Blots were reacted with an antiserum directed against ER{alpha}, followed by the appropriate horseradish peroxidase-coupled secondary antibody and enhanced chemiluminescence revelation.

Gel Mobility Shift Assays for in Vitro DNA Binding
Preparation of WCEs.
WCEs were prepared from COS-7 cells transfected with expression vectors encoding individual isoforms of ER{alpha}. Forty-eight hours after electroporation, cells were lysed at 4 C in 500 µl of lysis buffer [20 mM HEPES (pH 7.9), 50 mM NaCl, 5 mM MgCl2, 12% glycerol, 0.2 mM EDTA, 0.1% NP-40, 5 mM DTT, 1 mM AEBSF, 0.5 µg/ml leupeptin, 1 µg/ml chymostatin, 1 µg/ml pepstatin, 1 µg/ml aprotinin]. Extracts were then centrifuged at 15,000 x g for 10 min at 4 C, and supernatants were collected, aliquoted, and stored at -70 C. In some experiments, 15 min before lysis and preparation of WCEs, the cells were treated with forskolin (10 µM) and IBMX (1 µM) to activate the PKA pathway via an increase in intracellular cAMP levels.

To determine whether the isoforms of ER{alpha} are faithfully and equally produced by COS-7 cells, aliquots of extracts were analyzed by Western blotting using a polyclonal anti-ER{alpha} antiserum.

DNA Probe.
A synthetic oligonucleotide (27-mer) containing a 13-bp perfect palindromic ERE and corresponding to the Vit A2 ERE: 5'-GATCCTAGAGGTCACAGTGACCTACGA -3' was mixed with an equal molar quantity of the complementary strand and annealed in water by heating at 95 C and cooling slowly to room temperature (4 h). Fifty nanograms of this 27-bp double-stranded fragment was end-labeled with 200 µCi [{gamma}-32P]-dATP using 5–8 U T4 PNK in 20 µl. The radiolabeled DNA was purified on a S200 column (Pharmacia Biotech).

In Vitro DNA Binding.
In vitro DNA binding was performed as previously described (57). Briefly, aliquots of WCEs containing the receptors were incubated with 1 µg poly(dI.dC) in a reaction buffer (final concentration,10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 80 mM KCl, 5% glycerol) at 4 C for 20 min. Purified 32P-labeled double-stranded ERE oligonucleotide probe (5 x 104 cpm) was added, and the reaction was performed at room temperature for 30 min. (For competition experiments, ~50-fold excess radioinert oligonucleotides were added before radiolabeled probe.) The resulting 20 µl reaction mixture was analyzed on a 5–6% nondenaturing polyacrylamide gel. Electrophoresis was carried out at 150 V in 0.5 x Tris-borate-EDTA (TBE) for 2 h. The gel was dried and exposed for autoradiography.

Forskolin-Induced Change in {Sigma}E4-GFP Subcellular Localization
COS-1 cells were electroporated with 8 µg expression plasmid encoding the GFP-tagged ERs, cultured on glass coverslips for 30 h in DMEM without phenol red, supplemented with 10% FCS that had been twice stripped by charcoal/dextran. They were finally treated or not (0) either with estradiol (E2) for 2 h, or with forskolin-IBMX (Fk) for 15 min. Cells were washed in ice-cold PBS and fixed for 30 min at 4 C in PBS- 3% PFA. Coverslips were then washed twice for 5 min with PBS, mounted in Mowiol, and analyzed under confocal fluorescence microscopy.


    ACKNOWLEDGMENTS
 
The authors wish to thank Nicole Faucon-Biguet and Véronique Albanese for fruitful discussion and advice about electrophoretic mobility shift assay (EMSA) studies, Jean-Richard Prat and Spencer Brown for helping in confocal microscopy use, Ysander von Boxberg for careful reading of the manuscript, Odile Frain for valuable technical assistance, and Lydie Collet and Marielle Serrier-Rimard for the figures.


    FOOTNOTES
 
Address requests for reprints to: C. Pasqualini, DEPSN, UPR 2197, Institut de Neurobiologie Alfred Fessard, C.N.R.S., Avenue de la Terrasse, 91198 Gif-sur-Yvette Cedex, France. E-mail: Catherine.Pasqualini{at}iaf.cnrs-gif.fr

Work in our laboratory was supported by Centre National de la Recherche Scientifique, University Paris-Sud, and ARC.

1 Both authors contributed equally to this work. Back

Received for publication July 17, 2000. Revision received February 26, 2001. Accepted for publication February 27, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P 1986 Human estrogen receptor cDNA: sequence, expression and homology to v-erbA. Nature 320:134–139[CrossRef][Medline]
  2. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JÅ 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  3. Mosselman S, Polman J, Dijkema R 1996 ER ß: identification and characterization of a novel human receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  4. Laudet V, Hänni C, Coll J, Catzeflis F, Stehelin D 1992 Evolution of the nuclear receptor gene superfamily. EMBO J 11:1003–1013[Medline]
  5. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  6. Escriva H, Safi R, Hänni C, Langlois M-C, Saumitou-Laprade P, Stehelin D, Capron A, Pierce R, Laudet V 1997 Ligand-binding was acquired during evolution of nuclear receptors. Proc Natl Acad Sci USA 94:6803–6808[Abstract/Free Full Text]
  7. Di Croce L, Okret S, Kersten S, Gustafsson J-Å, Parker M, Wahli W, Beato M 1999 Steroid and nuclear receptors. EMBO J 18:6201–6210[CrossRef][Medline]
  8. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  9. Fuqua SA, Allred DC, Auchus RJ 1993 Expression of estrogen receptor variants. J Cell Biochem Suppl 17G:194–197
  10. Pfeffer U, Fecarotta E, Arena G, Forlani A, Vidali G 1996 Alternative splicing of the estrogen receptor primary transcript normally occurs in estrogen receptor positive tissues and cell lines. J Steroid Biochem Mol Biol 56:99–105[CrossRef][Medline]
  11. Friend KE, Ang LW, Shupnik MA 1995 Estrogen regulates the expression of several different estrogen receptor mRNA isoforms in rat pituitary. Proc Natl Acad Sci USA 92: 4367–4371
  12. Demay F, Tiffoche C, Thieulant ML 1996 Sex- and cell-specific expression of an estrogen receptor isoform in the pituitary gland. Neuroendocrinology 63:522–529[Medline]
  13. Friend KE, Resnick EM, Ang LW, Shupnik MA 1997 Specific modulation of estrogen receptor mRNA isoforms in rat pituitary throughout the estrous cycle and in response to steroid hormones. Mol Cell Endocrinol 131:147–155[CrossRef][Medline]
  14. Schreihofer DA, Resnick EM, Soh AY, Shupnik MA 1999 Transcriptional regulation by a naturally occurring truncated rat estrogen receptor (ER), truncated ER product-1 (TERP-1). Mol Endocrinol 13:320–329[Abstract/Free Full Text]
  15. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA 1998 Identification of estrogen receptor ß2, a functional variant of estrogen receptor ß expressed in normal rat tissues. Endocrinology 139:1082–1092[Abstract/Free Full Text]
  16. Pasqualini C, Guivarc’h D, Von Boxberg Y, Nothias F, Vincent J-D, Vernier P 1999 Stage- and region-specific expression of estrogen receptor {alpha} isoforms during ontogeny of the pituitary gland. Endocrinology 140:2781–2789[Abstract/Free Full Text]
  17. Jensen EV, Suzuki T, Kawashima T, Stumpf WE, Jungblut PW, DeSombre ER 1968 A two-step mechanism for the interaction of estradiol with rat uterus. Proc Natl Acad Sci USA 59:632–636[Free Full Text]
  18. King WJ, Greene GL 1984 Monoclonal antibodies localize oestrogen receptor in the nuclei of target cells. Nature 307:745–747[CrossRef][Medline]
  19. Welshons WV, Lieberman ME, Gorski J 1984 Nuclear localization of unoccupied oestrogen receptors. Nature 307:747–749[CrossRef][Medline]
  20. Press MF, Xu SH, Wang JD, Greene GL 1989 Subcellular distribution of estrogen receptor and progesterone receptor with and without specific ligand. Am J Pathol 135:857–864[Abstract]
  21. Picard D, Kumar V, Chambon P, Yamamoto KR 1990 Signal transduction by steroid hormones: nuclear localization is differentially regulated in estrogen and progesterone receptors. Cell Regul 1:291–299[Medline]
  22. Dauvois S, White M, Parker MG 1993 The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. J Cell Sci 106:1377–1388[Abstract]
  23. Guiochon-Mantel A, Lescop P, Christin-Maitre S, Loosfelt H, Perrot-Applanat M, Milgrom E 1991 Nucleocytoplasmic shuttling of the progesterone receptor. EMBO J 10:3851–3859[Medline]
  24. Garcia-Bustos J, Heitman J, Hall MN 1991 Nuclear protein localization. Biochim Biophys Acta 1071:83–101[Medline]
  25. Ylikomi T, Bocquel MT, Berry M, Gronemeyer H, Chambon P 1992 Cooperation of protosignals for nuclear accumulation of estrogen and progesterone receptors. EMBO J 11:3681–3694[Medline]
  26. Adam S, Gerace L 1991 Cytosolic proteins that specifically bind nuclear location signals are receptors for nuclear import. Cell 66:837–847[CrossRef][Medline]
  27. Stenoien DL, Mancini MG, Patel K, Allegretto EA, Smith CL, Mancini MA 2000 Subnuclear trafficking of estrogen receptor-{alpha} and steroid receptor coactivator-1. Mol Endocrinol 14:518–534[Abstract/Free Full Text]
  28. Greene GL, Press MF 1986 Structure and dynamics of the estrogen receptor. J Steroid Biochem 24:1–7[CrossRef][Medline]
  29. Barrack ER 1987 Steroid hormone receptor localization in the nuclear matrix: interaction with acceptor sites. J Steroid Biochem 27:115–121[CrossRef][Medline]
  30. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct visualization of the human estrogen receptor {alpha} reveals a role for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471–486[Abstract/Free Full Text]
  31. Klein-Hitpass L, Ryffel GU, Heitlinger E, Cato ACB 1988 A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor. Nucleic Acids Res 16:647–663[Abstract/Free Full Text]
  32. Chandran UR, De Franco DB 1992 Internuclear migration of chicken progesterone receptor, but not simian virus-40 large tumor antigen, in transient heterokaryons. Mol Endocrinol 6:837–844[Abstract/Free Full Text]
  33. Madan AP, De Franco DB 1993 Bidirectional transport of glucocorticoid receptors across the nuclear envelope. Proc Natl Acad Sci USA 90:3588–3592[Abstract/Free Full Text]
  34. Jensen EV 1991 Overview of the nuclear receptor family. In: Parker MG (ed) Nuclear Hormone Receptors: Molecular Mechanisms, Cellular Functions, Clinical Abnormalities. Academic Press, San Diego, pp 1–13
  35. Guo B, Odgren PR, van Wijnen AJ, Last TJ, Nickerson J, Penman S, Lian JB, Stein JL, Stein GS 1995 The nuclear matrix protein NMP-1 is the transcription factor YY1. Proc Natl Acad Sci USA 92:10526–10530[Abstract/Free Full Text]
  36. Merriman HL, van Wijnen AJ, Hiebert S, Bidwell JP, Fey EG, Lian JB, Stein JL, Stein GS 1995 The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/Runt domain transcription factor family: interactions with the osteocalcin gene promoter. Biochemistry 34:13125–13132[CrossRef][Medline]
  37. Grande MA, van der Kraan I, de Jong L, van Driel R 1997 Nuclear distribution of transcription factors in relation to sites of transcription and RNA polymerase II. J Cell Sci 110:1781–1791[Abstract]
  38. Bode J, Schlake T, Rios-Ramirez M, Mielke C, Stengert M, Kay V, Klehr-Wirth D 1995 Scaffold/matrix-attached regions: structural properties creating transcriptionally active loci. Int Rev Cytol 162A:389–454
  39. Wang Y, Miksicek RJ 1991 Identification of a dominant negative form of the human estrogen receptor. Mol Endocrinol 5:1707–1715[Abstract/Free Full Text]
  40. Bollig A, Miksicek RJ 2000 An estrogen receptor-{alpha} splicing variant mediates both positive and negative effects on gene transcription. Mol Endocrinol 14:634–649[Abstract/Free Full Text]
  41. Erenburg I, Schachter B, Mira y Lopez R, Ossowski L 1997 Loss of an estrogen receptor isoform (ER{alpha}{Delta}3) in breast cancer and the consequences of its reexpression: interference with estrogen-stimulated properties of malignant transformation. Mol Endocrinol 11:2004–2015[Abstract/Free Full Text]
  42. Godowski PJ, Rusconi S, Miesfeld R, Yamamoto KR 1987 Glucocorticoid receptor mutants that are constitutive activators of transcriptional enhancement. Nature 325:365–368[CrossRef][Medline]
  43. Hollenberg SM, Giguere V, Segui P, Evans RM 1987 Colocalization of DNA binding and transcriptional activation functions in the human glucocorticoid receptor. Cell 49:39–46[CrossRef][Medline]
  44. Tyulmenkov VV, Klinge CM 2000 Selectivity of antibodies to estrogen receptors {alpha} and ß (ER{alpha} and ERß) for detecting DNA-bound ER{alpha} and ERß in vitro. Steroids 65:505–512[CrossRef][Medline]
  45. Petersson K, Grandien K, Kuiper GGJM, Gustafsson J-A 1997 Mouse estrogen receptor ß forms estrogen response element binding heterodimers with estrogen receptor {alpha}. Mol Endocrinol 11:1486–1496[Abstract/Free Full Text]
  46. Wilson TE, Fahrner TJ, Milbrandt J 1993 The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 13:5794–5804[Abstract/Free Full Text]
  47. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P 1987 Functional domains of the human estrogen receptor. Cell 51:941–951[CrossRef][Medline]
  48. Denner LA, Weigel NL, Maxwell BL, Schrader WT, O’Malley BW 1990 Regulation of progesterone receptor-mediated transcription by phosphorylation. Science 250:1740–1743[Abstract/Free Full Text]
  49. Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P1989 The human estrogen receptor has two independent nonacidic transcription activation functions. Cell 59:477–487
  50. Lees JA, Fawell SE, Parker MG 1989 Identification of two transactivation domains in the mouse estrogen receptor. Nucleic Acids Res 17:5477–5488[Abstract/Free Full Text]
  51. Tzukerman MT, Esty A, Santiso-Mere D, Danielan P, Parker MG, Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol Endocrinol 8:21–30[Abstract/Free Full Text]
  52. Weigel NL, Zhang Y 1998 Ligand-independent activation of steroid hormone receptors J Mol Med 76:469–479[CrossRef][Medline]
  53. Robyr D, Wolffe AP, Wahli W 2000 Nuclear receptor coregulators in action: diversity for shared tasks. Mol Endocrinol 14:329–347[Free Full Text]
  54. Tremblay A, Tremblay GB, Labrie F, Giguère V 1999 Ligand-independent recruitment of SRC-1 to estrogen receptor ß through phosphorylation of activation function AF-1. Mol Cell 3:513–519[CrossRef][Medline]
  55. Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA 1999 Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress. Mol Cell 3:521–526[CrossRef][Medline]
  56. Koike S, Sakai M, Muramatsu M 1987 Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res 15:2499–2513[Abstract/Free Full Text]
  57. Lees JA, Fawell SE, Parker MG 1989 Identification of constitutive and steroid-dependent transactivation domains in the mouse oestrogen receptor. J Steroid Biochem 34:33–39[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
O. V. Glinskii, T. W. Abraha, J. R. Turk, L. J. Rubin, V. H. Huxley, and V. V. Glinsky
Microvascular network remodeling in dura mater of ovariectomized pigs: role for angiopoietin-1 in estrogen-dependent control of vascular stability
Am J Physiol Heart Circ Physiol, August 1, 2007; 293(2): H1131 - H1137.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
U. Ohnemus, M. Uenalan, J. Inzunza, J.-A. Gustafsson, and R. Paus
The Hair Follicle as an Estrogen Target and Source
Endocr. Rev., October 1, 2006; 27(6): 677 - 706.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Peterfy, J. Phan, and K. Reue
Alternatively Spliced Lipin Isoforms Exhibit Distinct Expression Pattern, Subcellular Localization, and Role in Adipogenesis
J. Biol. Chem., September 23, 2005; 280(38): 32883 - 32889.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Takahashi, M. Ohmichi, J. Kawagoe, C. Ohshima, M. Doshida, T. Ohta, M. Saitoh, A. Mori-Abe, B. Du, H. Igarashi, et al.
Growth Factors Change Nuclear Distribution of Estrogen Receptor-{alpha} via Mitogen-Activated Protein Kinase or Phosphatidylinositol 3-Kinase Cascade in a Human Breast Cancer Cell Line
Endocrinology, September 1, 2005; 146(9): 4082 - 4089.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J Varayoud, J G Ramos, L Monje, V Bosquiazzo, M Munoz-de-Toro, and E H Luque
The estrogen receptor {alpha} {Sigma}3 mRNA splicing variant is differentially regulated by estrogen and progesterone in the rat uterus
J. Endocrinol., July 1, 2005; 186(1): 51 - 60.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. S. Nair, S. K. Mishra, Z. Yang, S. Balasenthil, R. Kumar, and R. K. Vadlamudi
Potential Role of a Novel Transcriptional Coactivator PELP1 in Histone H1 Displacement in Cancer Cells
Cancer Res., September 15, 2004; 64(18): 6416 - 6423.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
C. Stirone, S. P. Duckles, and D. N. Krause
Multiple forms of estrogen receptor-alpha in cerebral blood vessels: regulation by estrogen
Am J Physiol Endocrinol Metab, January 1, 2003; 284(1): E184 - E192.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K.-i. Matsuda, I. Ochiai, M. Nishi, and M. Kawata
Colocalization and Ligand-Dependent Discrete Distribution of the Estrogen Receptor (ER){alpha} and ER{beta}
Mol. Endocrinol., October 1, 2002; 16(10): 2215 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. P. Stabile, A. L. G. Davis, C. T. Gubish, T. M. Hopkins, J. D. Luketich, N. Christie, S. Finkelstein, and J. M. Siegfried
Human Non-Small Cell Lung Tumors and Cells Derived from Normal Lung Express Both Estrogen Receptor {alpha} and {beta} and Show Biological Responses to Estrogen
Cancer Res., April 1, 2002; 62(7): 2141 - 2150.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pasqualini, C.
Right arrow Articles by Vernier, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pasqualini, C.
Right arrow Articles by Vernier, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals