Molecular Endocrinology 15 (8): 1255-1263
Copyright © 2001 by The Endocrine Society
Heat Shock Interferes with Steroidogenesis by Reducing Transcription of the Steroidogenic Acute Regulatory Protein Gene
Bruce D. Murphy1,
Enzo Lalli1,
Lance P. Walsh,
Zhiming Liu2,
Jaemog Soh3,
Douglas M. Stocco and
Paolo Sassone-Corsi
Institut de Génétique et Biologie Moléculaire et
Cellulaire (B.D.M., E.L., P.S.-C.), Centre Nationale de la Recherche
Scientifique-INSERM-ULP, Illkirch C.U. de Strasbourg, France 67404;
Department of Cell Biology and Biochemistry (Z.L., J.S., L.P.W.,
D.M.S.), Texas Tech University Health Sciences Centre, Lubbock, Texas
79430; and Centre de recherche en reproduction animale (B.D.M.),
Université de Montréal, St-Hyacinthe, Québec, Canada
J2S 7C6
Address all correspondence and request for reprints to: Dr. Bruce D. Murphy,Centre de Recherche en Reproduction Animale, Universite de Montreal, 3200 Rue Sicotte, Quebec PQ Canada J2S 7C6. E-mail:
murphyb{at}medvet.umontreal.ca
 |
ABSTRACT
|
|---|
A key regulatory point in fine tuning of steroidogenesis is the
synthesis of steroidogenic acute regulatory protein, which transfers
cholesterol into mitochondria. Heat shock and toxic insults
reduce steroidogenic acute regulatory protein, severely compromising
steroid synthesis. As the molecular mechanisms for this reduction
remain elusive, we tested the hypothesis that heat shock directly
interferes with transcription of the steroidogenic acute regulatory
protein gene. We show that, in mouse MA-10 Leydig tumor cells, heat
shock caused drastic declines in (Bu)2cAMP-induced
progesterone accumulation and steroidogenic acute regulatory protein
transcript abundance. A proximal steroidogenic acute regulatory protein
promoter fragment (-85 to +39) is sufficient to direct both cAMP
inducibility and heat shock inhibition. Nuclear extracts from MA-10
cells displayed binding to this proximal promoter fragment as a low
mobility complex in gel shift experiments. This complex disappeared in
nuclear extracts taken at 5 and 10 min after initiation of heat shock
and reappeared in extracts taken at 2 and 8 h. Similar low-
mobility complexes formed on oligonucleotides representing the
overlapping subfragments of the minimal steroidogenic acute regulatory
protein promoter fragment sensitive to the heat shock effect. Extracts
from heat-shocked MA-10 cells displayed reduced complex formation to
each of the subfragments. We conclude that heat shock reduces
progesterone synthesis, steroidogenic acute regulatory protein mRNA
abundance, and steroidogenic acute regulatory protein promoter activity
and disrupts binding of nuclear proteins to the proximal region of the
steroidogenic acute regulatory protein promoter. Together these
observations provide strong evidence for a mechanism of transcriptional
inhibition in the down-regulation of steroidogenic acute regulatory
protein expression by heat shock.
 |
INTRODUCTION
|
|---|
CELLS RESPOND TO elevations in temperature,
to organic toxins, to mediators of inflammation such as eicosanoids and
cytokines, and to a number of environmental contaminants, including
heavy metals, by the activation of heat shock factors (reviewed in Ref.
1). This, in turn, results in rapid and transient
transcription of a family of genes encoding what are known as heat
shock proteins. Many of these proteins have constitutive functions in
cells, including those of the heat shock protein 90 (HSP-90) family,
which are components of steroid hormone receptor complexes
(2) and heat shock protein 70 (HSP-70), which appears to
be involved in intracellular protein translocation (3).
Most significantly, heat shock proteins ameliorate cellular
perturbation by reversing the deleterious effects of temperature
elevation on the synthesis, folding, and translocation of nascent
proteins (4).
Steroidogenic cells respond to heat shock (5, 6) as well
as to inhibitors of steroid synthesis such as PGF2
, ionomycin, and
TNF
(5) and to other cytokines (7) by
rapid elevation in HSP-70 synthesis, accompanied by reduction in
progesterone production. Reduction in HSP-70 expression by cognate
antisense oligonucleotides reverses both thermal and PGF2
-induced
inhibition of progesterone synthesis in rat luteal cells
(5), suggesting that HSP-70 mediates heat shock effects in
these cells. Heat shock impairment of steroid synthesis in ovarian
granulosa cells is also fully reversed by 5-cholestane-3ß,
22[R]-diol, which can permeate both cells and mitochondria
(8). This finding implicates the steroidogenic acute
regulatory protein (StAR), the protein responsible for transport of
cholesterol across mitochondrial membranes (Ref. 9 and
reviewed in Ref. 10) as the target of heat shock and other
insults (11) to steroidogenic cells. Indeed, the cAMP
induction of both StAR protein and progesterone synthesis in mouse
MA-10 Leydig tumor cells is gravely compromised by brief elevation of
temperature [10 min at 45 C (6)]. The synthesis of other
proteins essential to progesterone synthesis, cytochrome P450 side
chain cleavage (P450scc), and 3ß-hydroxysteroid dehydrogenase
(3ßHSD) is only slightly altered by temperature elevation
(6), further indicating that StAR is a principal target of
thermal elevation.
StAR expression is dramatically reduced during both natural and
PGF2
-induced luteal regression (11), as well as by
signals as diverse as lipopolysaccharide, TNF
, atrial natriuretic
peptide, TGFß, and interferon-
(Ref. 12 for review).
As luteal regression and heat shock appear to function by common
mechanisms (13), considerable physiological information
can be derived from understanding their mode of action. Recent
investigations addressing the means by which stimulatory ligands such
as LH and its intracellular signal, cAMP, direct StAR gene
transcription have shown that the region in the first 105 bp upstream
of the transcription start site confers cAMP sensitivity to the StAR
gene (14, 15). In the current investigation, we
demonstrate that heat shock interferes with StAR expression at the
transcriptional level. The heat shock effect acts on the minimal region
of the promoter responsible for basal and cAMP-inducible expression of
StAR.
 |
RESULTS
|
|---|
Heat Shock Reduces Steroidogenesis and StAR mRNA Abundance
MA-10 cells subjected for 10 min to 45 C heat shock had
compromised steroidogenic capability, as indicated by the drastic
reduction (>20-fold, P < 0.001) in progesterone
accumulation, following 3 or 6 h of
(Bu)2cAMP stimulation (Fig. 1
). As expected, treatment of MA-10 cells
with 1 mM (Bu)2cAMP
increased the accumulation of StAR, P450, and 3ßHSD transcripts at
all times tested (1, 3, and 6 h, P < 0.05) (Figs. 1
and 2
). Treatment at 45 C for 10 min
strikingly reduced StAR transcript induction in response to
(Bu)2cAMP at 1 and 3 h after the 2 h
recovery period (Figs. 1
and 2
). The capacity to accumulate StAR mRNA
appeared to be reconstituted at later times, as indicated by detectable
signals at 6 h after the 2 h postheat shock recovery period.
P450scc and 3ßHSD were reduced by heat shock, but displayed more
robust recoveries by 3 h. Transcript levels for these two genes in
control and heat-shocked cultures were similar after 6 h of
(Bu)2cAMP stimulation. Heat shock did not reduce
the abundance of transcripts for either of the mouse Niemann Pick
C-1 (NPC-1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes
(Fig. 2
).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1. Effect of Heat Shock Treatment on
Accumulation of Progesterone and mRNA for StAR, P450scc, and 3ßHSD
Cultures of MA-10 cells were exposed to 45 C for 10 min, and then
allowed to recover for 2 h, at which time the medium was replaced
and cultures stimulated with 1 mM (Bu)2cAMP.
Incubations were terminated at 0, 3, and 6 h after the end of the
recovery period. Control cultures received no heat shock, but were
likewise treated with cAMP for 0, 3, or 6 h. Progesterone values
represent the mean ± SEM of five replicate
experiments. The Northern blots shown are from a single experiment
repeated five times with similar results.
|
|

View larger version (79K):
[in this window]
[in a new window]
|
Figure 2. Specificity of Heat Shock Inhibition of StAR,
but Not Niemann-Pick C1 (NPC-1) nor GAPDH mRNA Abundance
MA-10 cells were subjected to heat shock and (Bu)2cAMP
stimulation as described in the legend to Fig. 1 . Consequent Northern
blots were probed with the homologous mouse StAR cDNA probe, as well as
the mouse NPC-1 and GAPDH probes.
|
|
Heat Shock Reduces Transcription by the StAR Promoter
To ascertain whether heat shock produces down-regulation of
StAR at the transcriptional level, we employed a series of five StAR
promoter constructs linked to the luciferase reporter gene in transient
transfection experiments. All of these constructs, when transfected
into MA-10 cells, displayed a detectable signal in the absence of
(Bu)2cAMP stimulation and showed significant
increases in response to incubation with 1 mM
(Bu)2cAMP (Fig. 3
).
ANOVA revealed no significant variation in mean fold increase in
promoter activity induced by (Bu)2cAMP among the
five constructs. Importantly, the 10 min treatment at 45 C reduced both
constitutive and (Bu)2cAMP induction of the
luciferase signal for each of the five constructs (P <
0.01). The mean inhibition of (Bu)2cAMP induction
of luciferase transcription ranged from 95 to 99% for the five
constructs. The promoter-less reporter plasmid, pGL2-basic, displayed
neither constitutive nor cAMP-inducible activity (not shown).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Heat Shock Interferes with Basal and
(Bu)2cAMP-Induced StAR Promoter Expression
MA-10 cells were transfected with five deletion constructs of the human
StAR promoter luciferase, beginning from -1.3 kb to -85 bp. Control
represents the luciferase activity of each StAR deletion construct in
nonstimulated cells. Cultures designated HS were subjected to the heat
shock experimental paradigm, 10 min at 45 C. Following 2 h
recovery, cultures designated dbcAMP were incubated with 1
mM (Bu)2cAMP for 6 h followed by
determination of luciferase activity. Results were corrected for
ß-galactosidase activity. Average control luciferase activity values
for each of five experiments were set to 1.0, and fold increase values
were calculated and presented as mean ± SEM of the
five replicates.
|
|
Heat Shock Interferes with Binding of Nuclear Proteins to the StAR
Promoter
To study the molecular events that are coupled to the
transcriptional inhibition elicited by heat shock, we undertook an
investigation of nuclear protein binding to the minimal promoter
fragment responsive to the treatment. EMSAs were performed on the
promoter element -85 to +39. Nuclear extracts from untreated MA-10
cells bound to this StAR promoter sequence, generating a low-mobility
complex (Fig. 4
). Complex formation was
drastically reduced in extracts from cells treated for 5 min at 45 C, a
reduction that was more pronounced in cells treated for 10 min. By
2 h, appearance of the low-mobility complex had partially
recovered, and recovery continued through 8 h after heat shock.
Conversely, nuclear extracts from heat-shocked MA-10 cells conserved
their capacity to bind a canonical cAMP response element (CRE) sequence
at all times after heat shock (Fig. 4
).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4. EMSA Showing the Effects of Temperature
Elevation to 45 C on Binding of Nuclear Extracts to the
32P-Labeled StAR Promoter Fragment Comprising Nucleotides
from -85 to +39 of the Human StAR Promoter (left)
The times at which cells were harvested after initiation of the 10-min
heat shock treatment are indicated. A low-mobility complex formed with
the CRE oligonucleotide (right), which served as a
control for binding activity of the nuclear extracts. In the
lower panel, results are expressed as the ratio of the
optical density between binding complexes for the two probes at each
time point.
|
|
We then wished to investigate in more detail the binding of nuclear
factors from heat-shocked MA-10 cells to the minimal StAR promoter
fragment sensitive to heat shock. To this purpose, the StAR promoter
sequence was subdivided into four overlapping oligonucleotide
sequences, designated O1O4 (Fig. 5
).
These oligonucleotides displayed similar formation of low-mobility
complexes with nuclear extracts from untreated MA-10 cells (Fig. 5
).
Nuclear extracts also formed a series of higher mobility complexes with
all of the oligonucleotides (Fig. 5
). As seen with the -85 to +39
fragment (Fig. 4
), formation of the lowest mobility complex in MA-10
nuclear extracts with each of the oligonucleotides was reduced in the
extracts of cells treated for 5 min at 45 C. Complex formation
recovered over the next 8 h (Fig. 5
). Inspection of autoradiograms
suggested that loss of the low-mobility complex was accompanied by
increases in binding in higher mobility bands, particularly for
oligonucleotide sequences O1 and O2. The oligonucleotide sequence
designated O3, which contains the TATA box and the proximal
steroidogenic factor 1 (SF-1) site (16), consistently
displayed the least binding to the low-mobility complex (Figs. 5
and 6
), and this was extinguished at 5 and 10
min after initiation of heat shock. Partial recovery of binding to all
four oligonucleotides in higher mobility complexes was observed for
extracts of cells at 8 h after heat shock (Fig. 5
).

View larger version (56K):
[in this window]
[in a new window]
|
Figure 5. EMSA Showing Binding of Nuclear Extracts from
MA-10 Cells to Four Overlapping Double-Stranded Oligonucleotides
(O1O4) from the Mouse StAR Promoter (-85/+14)
The alignment of these to the human StAR promoter fragment is depicted
in the lower panel. As above, 0 designates nuclear
extracts made from cells before heat shock, 5 and 10 min indicate the
periods during heat shock, and 2 h and 8 h are the recovery
period times following 10 min of heat shock.
|
|

View larger version (82K):
[in this window]
[in a new window]
|
Figure 6. EMSA Showing Specificity of Formation of
Complexes with MA-10 Nuclear Extracts and Four Overlapping Double-
Stranded Oligonucleotides (O1O4, Fig. 4 ) from the Mouse StAR Promoter
(-85/+14)
Extracts were incubated in the presence of each labeled probe and
previously titrated 50- fold excess concentrations of each unlabeled
oligonucleotide, as well as with 50-fold excess of the irrelevant
oligonucleotide, HST. It can be seen that formation of the low-
mobility complexes (arrows) is suppressed by the
corresponding unlabeled nucleotide.
|
|
To assess the specificity of oligonucleotide binding to MA-10 nuclear
complexes, we incubated each of the O1O4 double-stranded sequences
with cold oligonucleotides in an amount (50-fold) known to be in excess
by previous titration. The results at time 0 (before heat shock, Fig. 6
) indicate that each oligonucleotide interacts with at least two
complexes, as in Fig. 5
. Further, binding of each labeled sequence to
the low-mobility complex was specific, in that it was not altered by an
excess of an unrelated oligonucleotide, heat shock transcription factor
(HST). The low-mobility complex formed by nuclear extract
binding to O2 was displaced by an excess of cold O2, but not by any of
the other nucleotide sequences, indicating specificity of this binding.
Labeled O1 was readily displaced on the low-mobility band by an excess
of cognate oligonucleotide, and binding was reduced to a lesser degree
by incubation with O4. The low-mobility complex formed by nuclear
extract binding to O3 was the most readily reduced by heat shock (Fig. 5
) and appeared to be displaced, not only by an excess of unlabeled O3,
but also by other oligonucleotides, particularly O1 and O4. The binding
of O4 to the low-mobility complex was entirely displaced by excess O4,
and reduced by O1O3. Our principal focus was the low-mobility
complex, as it is similar to that which bound to the -85 to +39
promoter fragment (Fig. 4
), and complex formation was reversibly
altered by the heat shock treatment (Fig. 4
) in a manner reminiscent of
the effects on StAR message abundance (Fig. 1
). Fig. 6
reveals that the
higher mobility complexes that formed between the nuclear extract and
oligonucleotides O1O4 were displaced by HST. We further observed
high-mobility complex cross-displacement by O1O4, indicating that
oligonucleotide binding to the proteins in these bands was not specific
to the oligonucleotide sequence in question.
The same analysis was then performed employing labeled and unlabeled
probes and nuclear extracts taken at the same intervals after
initiation of heat shock as shown in Figs. 4
and 5
. As in Figs. 4
and 5
, binding to the lowest mobility complexes was compromised by heat
shock, and inhibition of complex formation by unlabeled probes
recapitulated the results at time 0 (data not shown). The most profound
suppression of complex formation and the least conspicuous recovery of
low-mobility complexes after heat shock occurred with sequence O3 (data
not shown). As above, partial recovery of low-mobility complex
formation occurred at 8 h for all four of the oligonucleotide
fragments. As with the CRE oligonucleotide described above,
high-mobility complex formation with labeled HST was not perturbed by
heat shock treatment (data not shown).
Heat Shock Effects Are Temperature and Cell Type Specific
Incubation of MA-10 cells for 10 min at 43 C in lieu of 45 C did
not reduce constitutive nor cAMP-induced activity of the 1.3-kb StAR
promoter-luciferase construct (Table 1
).
In addition, it had no effect on progesterone accumulation in response
to cAMP (Table 1
). Treatment of Y-1 mouse adrenal tumor cells for
6 h with (Bu)2cAMP resulted in modest StAR
promoter stimulation (Table 1
). Nonetheless, incubation of cells at 45
C for 10 min had no effect on the promoter activity of the 1.3-kb
construct and on the accumulation of 20
-dihydroprogesterone by
cultures (Table 1
) and produced only a mild reduction in StAR protein
at 6 h postrecovery (Fig. 7
).

View larger version (61K):
[in this window]
[in a new window]
|
Figure 7. Western Blot Showing StAR Protein Abundance
in Y-1 Mouse Adrenal Tumor Cells and MA-10 Leydig Cells Subjected to No
Temperature Elevations (Control) or 10 min at 45 C (Heat Shock)
Mitochondrial protein extracts were purified from cells harvested at 3
and 6 h after heat shock treatment and analyzed by Western blot.
|
|
 |
DISCUSSION
|
|---|
It has been shown that gonadal cells subjected to heat shock have
impaired steroidogenic capability in response to stimulatory ligands
and second messengers (6, 7, 8). In the present study, we
confirm that brief incubation at 45 C reduced the capacity of MA-10
cells to accumulate their principal steroid product, progesterone, in
response to cAMP stimulation. It has been shown that heat shock effects
on steroidogenesis can be entirely reversed by supplying cells with
soluble hydroxylated cholesterol, implicating StAR and the
mitochondrial transport of cholesterol as the key step impaired by heat
treatment (6, 7, 8). Herein we present evidence indicating
that heat shock impairs expression of the StAR protein by interference
with the transcription of the StAR gene.
Incubation of MA-10 cells at 45 C for 10 min reduced the abundance of
StAR mRNA in a pattern consistent with the known decrease in StAR
protein levels in these cells (6). In other cell systems,
it has been shown that the half-life of StAR transcripts is brief
(17). Likewise, the activity of StAR protein is rapid and
transient (reviewed in Ref. 10). The present investigation
shows that heat shock induces a transient reduction in the abundance of
transcripts for 3ßHSD and P450scc, in keeping with the modest
declines in enzyme protein abundance associated with this treatment
(6). As the half-life of enzyme activity for 3ßHSD and
P450scc is in the order of days (18, 19), it is unlikely
that the minor and transitory reduction in their abundance following
heat shock contributes to the loss of steroidogenic capacity. The
specificity of the heat shock is further demonstrated by the absence of
an effect on a constitutive protein, GAPDH, and on a protein believed
to be involved in intracellular organelle-related cholesterol transfer,
the NPC-1 protein (20).
Evidence for a transcriptional effect of heat shock on StAR expression
is provided by the sensitivity of basal and
(Bu)2cAMP-induced transcription of
StAR-luciferase to brief heat shock. All StAR promoter deletion
constructs tested here displayed increases in luciferase signal in
MA-10 cells in response to (Bu)2cAMP. The
magnitude of response was similar to their activity in BeWo cells
cotransfected with an SF-1 expression plasmid (21) and in
primary cultures of human theca and granulosa cells (15).
Similar results have been seen in homologous systems, i.e.
mouse StAR reporter deletion constructs in MA-10 cells
(14) and of bovine StAR constructs in primary cultures of
bovine theca cells (22). Suppression of cAMP effects by
heat shock was observed in all of the deletion constructs employed,
including the sequence that contains the 85 nucleotides (nt) upstream
of the transcription start site. This region is highly conserved in all
StAR genes known to date (12). MA-10 nuclear extracts
formed a low-mobility complex with this conserved region of the StAR
promoter in gel retardation experiments. Analysis of this region by
means of overlapping oligonucleotide fragments revealed that MA-10
nuclear extracts formed similarly migrating low-mobility complexes with
each of the fragments, in addition to the formation of one or more
higher mobility complexes. Heat shock disrupts the formation of
low-mobility complexes between MA-10 nuclear extracts and the StAR
promoter -85/+39 sequence. Changes occurred quickly, as reduction in
binding was seen as early as 5 min after the initiation of elevation of
temperature. Binding changes were transient and reversible, as
significant binding capability was recovered in extracts at 8 h
after heat shock. The mechanisms of alteration of nuclear protein
binding to DNA by heat shock are currently undefined. It has previously
been reported that transient heat shock denatures and aggregates
nuclear proteins (Ref. 23 and references therein). Indeed,
redistribution of nuclear kinases associated with transcription follows
heat shock in HeLa cells (24). It is therefore possible
that reversible redistribution of nuclear proteins acting on the StAR
promoter can explain the present observations.
The nature of the MA-10 nuclear proteins that bind to the -85/+39
fragment of the StAR promoter is not currently known. Nonetheless, this
region bears consensus sites that have been previously shown to bind a
number of protein factors. Oligonucleotide O3, used in the present
study, contains a sequence for binding to the orphan nuclear receptor
SF-1 (16), and has a TATA box sequence, known to bind the
transcription factors found in the multisubunit basal transcription
complexes (reviewed in Ref. 25). Nonetheless, this
reasoning does not account for the nearly identical binding patterns of
the remaining three oligonucleotide fragments (O1, O2, and O4). An
alternative explanation for these findings is that the low-mobility
complexes comprise a series of proteins distributed along the entire
-85 to +39 region of the promoter. Heat shock may then cause the
disassembly of the complex that binds this region, as well as of the
more mobile complexes that bind to the individual oligonucleotide
fragments that constitute this region of the promoter.
It has previously been shown that the StAR promoter is preferentially
active in MA-10 and Y-1 cells, compared with nonsteroidogenic cell
lines (14). In the current investigation, steroid and StAR
protein accumulation, as well as luciferase transcription driven by the
StAR promoter, appeared unaffected by heat shock treatment of Y-1
cells. This is in stark contrast to the results in MA-10 cells, and the
molecular reasons for this are currently obscure. It is known that heat
shock, as employed in the current experiment, causes elevation in
HSP-70 in MA-10 cells (6), but not in Y-1 cells (Liu, Z.,
and D. M. Stocco, unpublished observations). Further, HSP-70 may
be the mediator of heat shock effects on steroidogenesis in luteal
cells (5). Thus, the absence of heat shock protein
response may explain the insensitivity of Y-1 cells to thermal
elevation.
In summary, we have shown that heat shock interference with
steroidogenesis in MA-10 cells is due, at least in part, to
interference with transcription of StAR. The evidence for this
conclusion includes heat shock-induced reduction in StAR mRNA
expression, reduction in StAR promoter activity, and disruption of
binding of nuclear proteins to the proximal region of the StAR
promoter.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines, Cell Culture, and Pharmacological Treatments
The mouse MA-10 Leydig tumor cell line, a gift of Dr. Mario
Ascoli (26) was cultured in Waymouths MB/752 medium
supplemented with 15% horse serum according to procedures previously
described (6). The Y-1 mouse tumor adrenocortical cell
line (ATCC, Manassas, VA) was maintained in DMEM/Hams
F-10 medium (Sigma, St. Louis MO), supplemented with 15%
horse serum and 2.5% FCS as previously described
(27).
The experimental paradigm comprised a heat shock treatment for 10 min
in a water bath at 45 C, followed by a 2-h recovery period at 37 C and
stimulation for 6 h with (Bu)2cAMP (1
mM, Sigma, St. Louis MO). This treatment has
previously been shown to reduce the abundance of StAR protein
(6). The temperature dependence of the heat shock effect
was examined by employing 43 C instead of 45 C. In further experiments,
cultures were terminated at 0, 5, and 10 min and 2 and 8 h after
initiation of the 45 C heat treatment.
Plasmids and Transient Transfections
Reporter plasmids containing deletion constructs of the human
StAR promoter region comprising the 1.3-kb (-1,300 to +39)
HindIII fragment, and fragments spanning the regions from
-885 to +39, -235 to +39, -150 to +39, and -85 to + 39
(21) were the generous gift of Dr. J. F. Strauss III.
The promoter-less plasmid pGL2 basic (Promega Corp.,
Charbonnieres, France) was employed as negative control, and plasmid
pCH110 (Pharmacia Biotech, Lyon, France), which
constitutively expresses ß-galactosidase, was employed to determine
efficiency of transfection. MA-10 cells were seeded into six-well
culture plates and the lipofectamine reagent (Life Technologies, Inc., Pointoise, France) was employed for transfection as
previously described (9). In a typical experiment, 4 µg
pGL2-based StAR or promoter-less plasmid and 1 µg pCH110 were
transfected with 10 µl per well lipofectamine for 6 h under
serum- and antibiotic-free conditions, and then in medium containing
serum and antibiotics overnight. Treatments were initiated on the
following morning. The calcium phosphate transfection technique was
employed for overnight transfection of Y-1 cells, as described
previously (27). Luciferase and ß-galactosidase were
assessed by standard techniques (27), and results were
normalized for ß-galactosidase activity.
Northern Analysis
Total RNA was isolated from cells using the Trizol reagent
(Life Technologies, Inc.) according to the manufacturers
specifications. Aliquots of 15 µg total RNA were separated on 1%
agarose-formaldehyde gels, and then blotted overnight onto nylon
membranes, baked, and hybridized with cDNA probes. The bovine P450scc
cDNA (1.3 kb) was obtained from Dr. Michael Waterman (Vanderbilt
University, Nashville, TN). The mouse 3ß-HSD I cDNA was provided by
Dr. Anita Payne (Stanford University, Stanford, CA). Probes for the
Niemann-Pick C1 (0.8 kb) and GAPDH (0.8 kb) were generated from the
mouse liver by RT-PCR using primers designed from sequences deposited
in GenBank. The human 28S rRNA probe, obtained from Dr. G. Schultz
(University of Calgary, Calgary, Canada), was employed as a control for
loading and transfer. Estimates of mRNA abundance were made by
PhosphorImager (Amersham Pharmacia, Baie d\\'Urf|$$|Aae,
Canada) quantification as the dimensionless ratio between the mRNA of
interest and 28S rRNA.
Western Blots
The abundance of StAR protein was assessed in Y-1 and MA-10
cells harvested from culture using a polyclonal antibody according to
the procedures previously described (28).
Hormone Assays
Progesterone and 20
-dihydroprogesterone were assayed in the
culture medium by solid-phase RIA using kits from Diagnostic Products (Los Angeles, CA), according to the manufacturers
specifications.
EMSA
Nuclear extracts were prepared from MA-10 cells harvested before
and at 5 and 10; 2 and 8 h after the initiation of heat
shock. The extracts were prepared as previously described
(29).
Initial EMSA was performed using the most abbreviated StAR promoter
fragment described above (-85 to +39 nt), excised by restriction
digestion from pGL2 -85/+39 StAR luciferase plasmid. Subsequent
analyses employing double- stranded oligonucleotides (designated
oligonucleotides O1O4) comprised four overlapping stretches of the
corresponding region (-85/+14) of the mouse StAR promoter. The
sequences of the oligonucleotides (upper strand) used in this study
were:
Oligonucleotide O1: GACCCTCTGCACAATGACTGATGACTTT
Oligonucleotide O2:
Oligonucleotide O3 : GCACAGCCTTCCACGGGAAGCATTTAAG
Oligonucleotide O4:
TTAAGGCAGCGCACTTGATCTGCGCCACAGCTGCAGGACTCAGG.
A double-stranded oligonucleotide containing a canonical CRE sequence
present in the inducible cAMP early repressor promoter
(30) was employed to assess binding ability of nuclear
extracts. In the general scheme, nuclear extract (5 µg protein) was
incubated with 2 x 104 cpm labeled probe in
binding buffer (20 mM Tris-HCl, pH 7.5, 80 mM
KCl, 1 mM EDTA, 0.1 mM dithiothreitol, 0.1
mg/ml BSA, 2 mg poly dI-dC, 10% glycerol) for 20 min at room
temperature, before application to a 4% nondenaturing polyacrylamide
gel in 0.25x Tris-buffered EDTA. To establish the specificity
of binding of the nuclear extract to the double-stranded
oligonucleotides, an excess of each unlabeled oligonucleotide was
incubated with nuclear extract and with its
32P-labeled counterpart and with nuclear extract
in the presence of each of the other three oligonucleotides and an
irrelevant oligonucleotide sequence [HST (31)] known to
bind to MA-10 nuclear extracts. The experiments were then repeated
using nuclear extracts harvested at 5 and 10 min and 2 and 8 h
after initiation of 10-min heat shock as described above.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. J. F. Strauss III, M. Waterman, A. Payne, and
G. Schultz for the gift of reagents. The technical assistance of Maryam
Rastegar, Estelle Heitz, and Mira Dobias is greatly appreciated.
 |
FOOTNOTES
|
|---|
This work was supported by grants from Centre Nationale de la Recherche
Scientifique, INSERM, Center Hospitalier Universitaire Régional,
Fondation de la recherche médicale, Rh|$$|Axone-Poulenc Rorer, Inc. (Bioavenir, France) and Association pour la
recherche contre le cancer and by Canadian Institutes of Health
Research Grant MT-11018 to B.D.M.
1 These authors contributed equally to the work. 
2 Current address: Department of Biology, Eastern New Mexico
University, Portalis New Mexico. 
3 Current address: Hormone Research Center and Department of
Biology, College of Natural Sciences, Chonham National University,
Kwangju 500757 Korea. 
Abbreviations: CRE, cAMP response element; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; 3ßHSD, 3ß-hydroxysteroid
dehydrogenase; HSP-70, heat shock protein 70; HSP-90, heat shock
protein 90; HST, heat shock transcription factor; NPC-1, Niemann
Pick C-1; P450scc, cytochrome P450 side chain cleavage; SF-1;
steroidogenic factor 1; StAR, steroidogenic acute regulatory
protein.
Received for publication August 28, 2000.
Accepted for publication April 23, 2001.
 |
REFERENCES
|
|---|
-
Morimoto RI 1998 Regulation of the heat shock
transcriptional response: cross talk between a family of heat shock
factors, molecular chaperones and negative regulators. Genes Dev 12:37883796[Free Full Text]
-
Carson-Jurica MA, Schrader WT, OMalley BW 1990 Steroid
receptor family: structure and functions. Endocr Rev 11:201220[Abstract]
-
Jensen RE, Johnson AE 1999 Protein translocation: is
Hsp70 pulling my chain? Curr Biol 9:R779R782
-
Satyal SH, Chen D, Fox SG, Kramer JM, Morimoto RI 1998 Negative regulation of the heat shock transcriptional response by
HSBP1. Genes Dev 12:19621974[Abstract/Free Full Text]
-
Khanna A, Aten RF, Behrman HR 1995 Heat shock protein-70
induction mediates luteal regression in the rat. Mol Endocrinol
14311440
-
Liu Z, Stocco DM 1997 Heat shock-induced inhibition of
acute steroidogenesis in MA-10 cells is associated with inhibition of
the synthesis of the steroidogenic acute regulatory protein.
Endocrinology 138:27222728[Abstract/Free Full Text]
-
Kim AH, Khanna A, Aten RF, Olive DL, Behrman HR 1996 Cytokine induction of heat shock protein in human granulosa-luteal
cells. Mol Hum Reprod 2:549554[Abstract/Free Full Text]
-
Khanna A, Aten RF, Behrman HR 1994 Heat shock protein
induction blocks hormone-sensitive steroidogenesis in rat luteal cells.
Steroids 59:49[CrossRef][Medline]
-
Clark BJ, Wells J, King SR, Stocco DM 1994 The
purification, cloning, and expression of a novel luteinizing
hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor
cells. Characterization of the steroidogenic acute regulatory protein
(StAR). J Biol Chem 269:2831428322[Abstract/Free Full Text]
-
Stocco DM 2000 The role of the StAR protein in
steroidogenesis: challenges for the future. J Endocrinol 164:24753[Abstract]
-
Pescador N, Soumano K, Stocco DM, Price CA, Murphy BD 1996 Steroidogenic acute regulatory protein in bovine corpora lutea.
Biol Reprod 55:485491[Abstract]
-
Reinhart A, Williams SC, Stocco DM 1999 Transcriptional
regulation of the StAR gene. Mol Cell Endocrinol 151:161169[CrossRef][Medline]
-
Khanna A, Aten RF, Behrman HR 1995 Physiological and
pharmacological inhibitors of luteinizing hormone-dependent
steroidogenesis induce heat shock protein in rat luteal cells.
Endocrinology 136:17751781[Abstract]
-
Caron KM, Ikeda Y, Soo S-C, Stocco DM, Parker KL, Clark
BJ 1997 Characterization of the promoter region of the mouse gene
encoding the steroidogenic acute regulatory protein. Mol Endocrinol 11:138147[Abstract/Free Full Text]
-
Christenson LK, McAllister JM, Martin KO, Javitt NB, Osborne
TF, Strauss III JF 1998 Oxysterol regulation of steroidogenic
acute regulatory protein gene expression. J Biol Chem 273:3072930735[Abstract/Free Full Text]
-
Sugawara T, Kiriakidou M, McAllister JM, Kallen CB, Strauss
III JF 1997 Multiple steroidogenic factor 1 binding elements in
the human steroidogenic acute regulatory protein gene 5' flanking
region are required for maximal promoter activity and cyclic AMP
responsiveness. Biochemistry 36:72497255[CrossRef][Medline]
-
Pescador N, Houde A, Stocco DM, Murphy BD 1997 Follicle-stimulating hormone and intracellular second messengers
regulate steroidogenic acute regulatory protein messenger ribonucleic
acid in luteinized porcine granulosa cells. Biol Reprod 57:660668[Abstract]
-
Rybak SM, Ramachandran J 1982 Mechanism of induction of
-5-3 ß-hydroxysteroid dehydrogenase-isomerase activity in rat
adrenocortical cells by corticotropin. Endocrinology 111:427433[Abstract]
-
Anakwe OO, Payne AH 1987 Noncoordinate regulation of de
novo synthesis of cytochrome P-450 cholesterol side-chain cleavage
and cytochrome P-450 17
-hydroxylase/C1720 lyase in mouse
Leydig cell cultures: relation to steroid production. Mol Endocrinol 1:595603[Abstract]
-
Cruz JC, Sugii S, Yu C, Chang TY 2000 Role of
Niemann-Pick type C1 protein in intracellular trafficking of low
density lipoprotein-derived cholesterol. J Biol Chem 275:40134021[Abstract/Free Full Text]
-
Sugawara T, Holt JA, Kiriakidou M, Strauss III JF 1996 Steroidogenic factor 1-dependent promoter activity of the human
steroidogenic acute regulatory protein (StAR) gene. Biochemistry 35:90529059[CrossRef][Medline]
-
Ivell R, Tillmann G, Wang H, et al. 2000 Acute regulation
of the bovine gene for the steroidogenic acute regulatory protein in
ovarian theca and adrenocortical cells. J Mol Endocrinol 24:109118[Abstract]
-
Michels AA, Nguyen VT, Konings AWT, Kambinga HH, Bensaude
O 1995 Thermostability of a nuclear-targeted luciferase expressed
in mammalian cells. Destabilizing influence of the intranuclear
microenvironment. Eur J Biochem 234:382289[Medline]
-
Gerber DA, Souquere-Besse S, Puvion F, Dubois MF, Bensaude O,
Cochet C 2000 Heat-induced relocalization of protein kinase C2:
implication of CK2 in the context of cellular stress. J Biol Chem 275:2391923926[Abstract/Free Full Text]
-
Green MR 2000 TBP-associated factors
(TAFIIs): multiple, selective transcriptional
mediators in common complexes. Trends Biochem Sci 25:5963[CrossRef][Medline]
-
Ascoli M 1981 Characterization of several clonal lines of
cultured Leydig tumor cells: gonadotropin receptors and steroidogenic
responses. Endocrinology 108:8895[Abstract]
-
Lalli E, Melner MH, Stocco DM, Sassone-Corsi P 1998 DAX-1
blocks steroid production at multiple levels. Endocrinology 139:42374243[Abstract/Free Full Text]
-
Lin T, Hu J, Wang G, Stocco DM 1998 Interferon-
inhibits the steroidogenic acute regulatory protein messenger
ribonucleic acid expression and protein levels in primary cultures of
rat Leydig cells. Endocrinology 139:22172222[Abstract/Free Full Text]
-
Andrews NC, Faller DF 1991 A rapid micropreparation
technique for extraction of DNA-binding proteins from limiting numbers
of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
-
Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P 1993 Inducibility and negative autoregulation of CREM: an alternative
promoter directs the expression of ICER, and early response repressor.
Cell 75:875886[CrossRef][Medline]
-
Lalli E, Sassone-Corsi P 1995 Thyroid-stimulating hormone
(TSH)-directed induction of the CREM gene in the thyroid gland
participates in the long-term desensitization of the TSH receptor. Proc
Natl Acad Sci USA 92:96339637[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
H. Taira and M. M. Beck
Activity of Three-{beta}-Hydroxysteroid Dehydrogenase in Granulosa Cells Treated in Vitro with Luteinizing Hormone, Follicle-Stimulating Hormone, Prolactin, or a Combination.
Poult. Sci.,
October 1, 2006;
85(10):
1769 - 1774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Y. Gevry, E. Lalli, P. Sassone-Corsi, and B. D. Murphy
Regulation of Niemann-Pick C1 Gene Expression by the 3'5'-Cyclic Adenosine Monophosphate Pathway in Steroidogenic Cells
Mol. Endocrinol.,
April 1, 2003;
17(4):
704 - 715.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-H. Lue, B. L. Lasley, L. S. Laughlin, R. S. Swerdloff, A. P. S. Hikim, A. Leung, J. W. Overstreet, and C. Wang
Mild Testicular Hyperthermia Induces Profound Transitional Spermatogenic Suppression Through Increased Germ Cell Apoptosis in Adult Cynomolgus Monkeys (Macaca fascicularis)(
J Androl,
November 1, 2002;
23(6):
799 - 805.
[Abstract]
[Full Text]
[PDF]
|
 |
|