Molecular Endocrinology 15 (8): 1381-1395
Copyright © 2001 by The Endocrine Society
Multiple Promoters Exist in the Human GR Gene, One of Which Is Activated by Glucocorticoids
Mary B. Breslin1,
Chuan-Dong Geng and
Wayne V. Vedeckis
Department of Biochemistry and Molecular Biology and the Stanley S.
Scott Cancer Center, Louisiana State University Health Sciences
Center, New Orleans, Louisiana 70112
Address all correspondence and requests for reprints to: Wayne V. Vedeckis, Ph.D., Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, 533 Bolivar Street, New Orleans, Louisiana 70112.
 |
ABSTRACT
|
|---|
A new human GR gene sequence (hGR 1Ap/e), which is distinct from
the previously identified human GR promoter and coding sequences, has
been isolated and characterized. The hGR 1Ap/e sequence is
approximately 31 kbp upstream of the human GR coding sequence. This
sequence (2,056 bp) contains a novel promoter (the hGR 1A promoter;
1,075 bp) and untranslated exon sequence (hGR exon 1A sequence; 981
bp). Alternative splicing produces three different hGR 1A-containing
transcripts, 1A1, 1A2, and 1A3. GR transcripts containing exon 1A1,
1A2, 1B, and 1C are expressed at various levels in many cancer cell
lines, while the exon 1A3-containing GR transcript is expressed most
abundantly in blood cell cancer cell lines. Glucocorticoid hormone
treatment causes an up-regulation of exon 1A3-containing GR transcripts
in CEM-C7 T-lymphoblast cells and a down-regulation of exon
1A3-containing transcripts in IM-9 B-lymphoma cells. Deoxyribonuclease
I footprinting using CEM-C7 cell nuclear extract reveals four
footprints in the promoter region and two intraexonic footprints. Much
of the basal promoter-activating function is found in the +41/+269
sequence, which contains two deoxyribonuclease I footprints (FP5 and
FP6). When this sequence is cloned into the pXP-1 luciferase reporter
gene, hormone treatment causes a significant increase in luciferase
activity in Jurkat T cells that are cotransfected with a GR expression
vector. FP5 is an interferon regulatory factor-binding element, and it
contributes significantly to basal transcription rate, but it is not
activated by steroid. FP6 resembles a glucocorticoid response
element and can bind GRß. This novel hGR 1Ap/e sequence may have
future applications for the diagnosis, prognosis, and treatment of
T-cell leukemia and lymphoma.
 |
INTRODUCTION
|
|---|
THE EFFECTS OF glucocorticoids (GCs) are
mediated by the binding and activation of their intracellular receptor,
the GR, which is a member of the steroid receptor superfamily that
contains ligand-activated nuclear transcription factors. A cells
ability to respond to hormone treatment is determined by the number of
functional GR molecules within the cell (1), and the
steroid hormone itself can alter receptor protein levels. In most cells
tested to date, GR is down-regulated in response to hormone treatment
and the cells remain viable (reviewed in Ref. 2). In sharp
contrast, in immature T cells, immature thymocytes, and T lymphoblasts,
human (h)GR mRNA and protein are up-regulated by hormone treatment,
which is followed by apoptosis or programmed cell death. The CEM-C7
cell line [derived from a T-cell acute lymphoblastic leukemia (ALL)
pediatric patient] is a well established in vitro model
system for studying GC-mediated apoptosis in T cells (3, 4). In the GC-sensitive 6TG1.1 cell line, derived from CEM-C7
cells, the observed up-regulation of the GR mRNA is a tissue-specific,
primary transcriptional response (5). GC-treated CEM-C7
cells arrest in the G1 phase of the cell cycle
(6), and they then undergo apoptosis. A certain threshold
level of intracellular GR is needed for GC-mediated cell death
(7), suggesting that GC-mediated up-regulation of the GR
is required for hormone-induced apoptosis. The molecular mechanisms
that result in the cell type-specific autoregulation of GR mRNA and
protein levels (upward or downward) are not yet completely clear.
To date, only one promoter that controls the expression of the hGR gene
has been described (8). In mouse, three separate
5'-untranslated exon 1 regions were identified and designated exons 1A,
1B, and 1C (9). The mouse exon 1A-containing transcripts
are expressed selectively in T cells. Therefore, to gain a better
understanding of how the hGR gene is expressed and regulated in hormone
treated T cells, we sought to identify hGR transcripts that may be
expressed in a cell type-specific manner.
The current study shows that human GR mRNA transcripts can contain at
least five different 5'- untranslated exon 1 sequences. Exons 1B
and 1C share a high degree of homology with the corresponding mouse
exon 1B and 1C sequences. A novel exon 1A region contains three
separate alternative splice sites that give rise to three GR mRNA
transcripts containing exons 1A1, 1A2, or 1A3. Thus, at least five hGR
transcripts are expressed from three separate promoters. The exon
1A3-containing transcript is expressed at higher levels in cancer cell
lines of hematopoietic origin, and it is up-regulated by hormone in
CEM-C7 cells and down-regulated by hormone in IM-9 (B lymphoma) cells.
A -964 to +269 hGR 1A promoter/exon sequence confers GC-dependent
up-regulation of a reporter gene in T cells. Thus, the hGR 1A promoter
and exon region appear to contain sequences necessary for the cell
type-specific up-regulation of GR in T cells. An interferon
(IFN)-regulatory factor element (IRF-E) is important for the basal
expression of the exon 1A promoter in Jurkat T cells.
GCs are routinely used in the treatment of childhood leukemia and
lymphoma (reviewed in Ref. 10), and the lymphocytolytic
effects of the hormone correlate with initial GR concentration
(11, 12, 13, 14). Because GC-mediated up-regulation of the GR is
needed for apoptosis (7), the expression and up-regulation
of the exon 1A3-containing hGR transcript may be useful in the
future for the diagnosis, prognosis, and treatment of T-cell ALL.
 |
RESULTS
|
|---|
Multiple 5'-Untranslated Exons Exist for the Human GR mRNA
To identify alternatively spliced hGR transcripts, 5'-rapid
amplification of cDNA ends (RACE) was performed. A MOLT-4 human T-cell
leukemia cDNA library (CLONTECH Laboratories, Inc., Palo
Alto, CA) was screened using a 5'-adapter primer (AP-1; CLONTECH Laboratories, Inc.) and a 3' gene-specific primer within exon 2
of the human GR gene. A 300- to 400-bp smear was observed on a 1.2%
agarose gel (data not shown). The resulting PCR products were gel
purified and subcloned into the pCR2.1 vector, and 17 clones were
sequenced. Five clones, designated as exon 1C, are identical to the
previously characterized untranslated human GR exon 1 (Fig. 1
) (8). Eleven clones
corresponded to a new hGR exon 1 region and were designated exon 1B.
Exon 1B was present at position -1,111 to -1,035 bp in the published
hGR promoter region. Heterogeneity at the 5'-end of the exon 1B region
suggests that the exon 1B transcript may have multiple transcription
start sites (data not shown). One hGR clone (54 bp in length) that was
sequenced was novel, and it was designated exon 1A. In an alternative
approach, a human genomic bacterial artificial chromosome (BAC) library
was screened using PCR primers to the -2,101 to -1,783 bp hGR 1B
promoter region. Southern blot analysis identified two BAC clones that
contained the 54-bp exon 1A region (data not shown). Further sequence
information for the exon 1A region was obtained by direct sequencing of
the BAC clones. Additionally, the genomic organization of the hGR gene
was determined using pulsed field gel electrophoresis (data not shown).
The human exon 1A sequence is located approximately 25 kbp upstream of
the hGR exon 1B region (Fig. 1
). Exons 1A, 1B, and 1C are all spliced
to the same splice acceptor site on exon 2 reported previously
(15). There is an in-frame stop codon located three codons
upstream of the initiator methionine ATG codon in exon 2, indicating
that none of the 5'-exon 1 sequences will be translated into amino
acids in the hGR protein.

View larger version (11K):
[in this window]
[in a new window]
|
Figure 1. Diagram of the hGR Gene Structure and Organization
Untranslated exons 1A, 1B, or 1C are spliced to the same splice
acceptor site in exon 2. Promoters 1B and 1C are GC rich and are
present in previously published sequences. The hGR 1A promoter and exon
are novel, and they are located approximately 27 kbp upstream of the
start site for transcription for exon 1C. The numbering system is based
upon that found in Ref. 8 .
|
|
Three Untranslated Exons Derive from Alternative Splicing in the
New hGR Sequence
Currently, 2,056 bp of new sequence, which contains the original
3' 54 bp of exon 1A, have been studied (Fig. 2
). This sequence is designated the hGR
1A promoter and exon (hGR 1Ap/e) sequence. Various 5'-PCR primers were
designed to determine the approximate transcription start site for the
exon 1A transcript. PCR primers to the +56 bp and +126 bp regions
resulted in products of expected size while the primers at positions
-272 and -72 bp gave no product (data not shown). This mapped the
transcription start site approximately 1 kbp upstream of the exon 1A
splice site. Primer extension using a primer to the +84/+103 bp site in
the exon 1A region showed multiple transcription start sites in this
region (data not shown) and revealed that the strongest transcription
start site (indicated +1; Fig. 2
) was located 981 bp upstream of the
exon 1A splice donor site. Other primer extension stops were located at
-10 bp, +29 bp, and +40 bp. Surprisingly, RT-PCR primers to the +56
and +126 bp regions resulted in the amplification of three products,
one of the expected size and two that were smaller (Fig. 3A
). To determine whether these were
specific or nonspecific PCR products, they were subcloned and
sequenced. Two additional splice sites were present in the exon 1A
region resulting in the formation of three distinct hGR transcripts:
exon 1A1, spliced at position +212; exon 1A2, spliced at position +308;
and, exon 1A3 (originally identified in the 5'-RACE experiment),
spliced at position +981 (Fig. 3B
). RT-PCR using an exon 1A3-specific
upstream primer and downstream primers for each of the separate exons
29 of the hGR coding sequence indicated that all nine coding
sequences are present in transcripts containing the untranslated exon
1A3 (data not shown).

View larger version (62K):
[in this window]
[in a new window]
|
Figure 2. Sequence of hGR 1Ap/e. 2056 Nucleotides of the
Coding Strand
The putative CAP site (bold, underlined) is labeled +1.
There are 981 nucleotides of exon 1A and 1,075 nucleotides of 1A
promoter sequence depicted. FP1-FP6 (boxes) refer to
putative transcription factor binding sites as determined by DNase I
footprinting. The bold, vertical arrows and the
bolded letters indicate the three alternative exon 1A
splice donor sites, SD1 (exon 1A1; 212 nucleotides), SD2 (exon 1A2; 308
nucleotides), and SD3 (exon 1A3; 981 nucleotides). Dashed
arrows lie below sequences that were used for PCR and for
primer extension analysis.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Figure 3. Alternative Splicing of Exon 1A Occurs to Give Rise
to Three Different 5'-Untranslated Regions
A, RT-PCR amplification was performed on RNA extracted from CEM-C7
T-lymphoblast cells as described in Materials and
Methods and Results. Three distinct products
were visualized upon agarose gel electrophoresis. B, Diagram of
alternative splicing of the exon 1A-containing transcript.
Transcription is presumably controlled by the same hGR 1A promoter
using the same initiation site for transcription. Three alternative
splice donor sites are used as indicated. All three untranslated exon
1A sequences are spliced to the same splice acceptor site in exon 2, as
determined by direct sequencing. The initiator methionine ATG codon is
found in exon 2, and an in-frame stop codon occurs three codons
upstream of the ATG. The numbers above the top bar refer
to positions that were used for analysis of hGR promoter activity.
|
|
Cancer Cells from the Hematopoietic Lineage Express hGR 1A3
Transcripts at Higher Levels Than Other Cancer Cell Lines
To determine the significance of these multiple hGR transcripts,
RT-PCR was performed with exon 1A1, 1A2, 1A3, 1B, and 1C specific
primer sets to determine the expression pattern for the various hGR
transcripts in a variety of cancer cell lines originating from
various tissues. Nonquantitative RT-PCR indicated that the 1A3
containing hGR transcript was expressed at high levels in cell lines
from the hematopoietic lineage (data not shown). To allow an estimation
of the relative levels of each transcript in the various cell lines,
QuantumRNA 18S internal control primers (Ambion, Inc., Austin, TX) were used. In a pilot experiment, exon 1B and
1C transcripts were detected in all cell lines tested (Fig. 4
). Exon 1A1 and 1A2-containing
transcripts were low or not detected in IM-9 (B-cell lymphoma), HL-60
(promyelocytic leukemia), 7860 (renal carcinoma cells), WI-38 (normal
human diploid fibroblasts), and human adult brain tissue (Fig. 4
). They
were present in varying levels in the other cell lines tested (Jurkat
T-cell ALL; HeLa S3 cervical carcinoma; HepG2
hepatocarcinoma; MCF-C7 breast cancer; SJSA osteosarcoma; H1299 lung
cancer). Most notably, the expression of exon 1A3 transcripts was
highest in cells of hematopoietic origin (Fig. 4
), i.e. in
CEM-C7, IM-9, HL-60, and (to a much lesser extent) Jurkat cells (Fig. 4
). Jurkat cells are known to lack functional GR. Whether or not this
is partly due to low GR protein levels resulting from low levels of
expression of various GR transcripts (including 1A3) requires further
study. Expression of the 1A3-containing transcripts was also detected
in human adult brain tissue.

View larger version (98K):
[in this window]
[in a new window]
|
Figure 4. Cell-Type Selective Expression of the hGR
Transcripts
Quantitative RT-PCR was performed using primers specific for the hGR
transcripts containing exon 1A1, 1A2, 1A3, 1B, or 1C, as described in
Materials and Methods and Results. Human
cell lines tested were: IM-9 (B-cell lymphoma); CEM-C7 (T-cell acute
lymphoblastic leukemia, ALL); Jurkat (T-cell ALL); HL-60 (acute myeloid
leukemia, AML-M2); HeLa S3 (cervical carcinoma); HepG2
(hepatocarcinoma); MCF-7 (breast carcinoma); 7860 (kidney carcinoma);
SJSA (osteosarcoma); H1299 (lung carcinoma); and WI-38 (normal human
diploid fibroblast). Adult brain RNA was also analyzed. 18S rRNA was
used as an internal control.
|
|
Quantitative RT-PCR was performed repeatedly on five different cell
lines, three of the hematopoietic lineage (IM-9, CEM-C7, Jurkat) and
two that were nonhematopoietic (HeLa, WI-38). 1A1, 1A2, 1B, and 1C
transcripts were seen at various levels in these cell lines, while the
hematopoietic cells showed a higher level of exon 1A3-containing
transcripts than nonhematopoietic cells (Fig. 5
).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 5. Quantitation of the Expression of hGR 1A1, 1A2,
1A3, 1B, and 1C Transcripts in Various Cancer Cell Lines
Quantitative RT-PCR was performed on four different samples of the five
cell lines listed. Values obtained upon densitometry for these
transcripts were normalized to the respective 18S rRNA value in the
same sample. For each of the four experiments, the individual
measurement of a transcript in a cell line (e.g.
1A3/18S, CEM-C7 cell) was divided by the IM-9 value for the same
transcript (1A3/18S, IM-9 cells). These ratios were multiplied by 100
to give the percent value, with IM-9 cells equal to 100%. The four
individual percent values for each transcript in each cell line were
then averaged to obtain the mean, and the SEM was
calculated.
|
|
Glucocorticoid Hormone Regulates Exon 1A-Containing hGR
Transcripts
Using an hGR probe to coding sequences, it was shown that the hGR
mRNA is up-regulated in CEM-C7 cells and down-regulated in IM-9 cells
(5). Thus, these two cell lines were chosen for the study
of hormonal regulation of the various hGR transcripts.
To quantify the individual hGR transcripts, the QuantumRNA
18S RT-PCR system was used as described above. Exon 1A3-containing
transcripts were up-regulated 2.5-fold (P < 0.05) in 1
µM dexamethasone (Dex)-treated CEM-C7 cells and
down-regulated 69% (P < 0.05) by hormone-treatment in
IM-9 cells (Fig. 6
). Exon 1B-containing
transcripts were slightly up-regulated 1.4-fold (P <
0.05) in CEM-C7 cells and were unchanged in IM-9 cells (Fig. 6
). The
expression level of the exon 1C-containing transcript did not change in
hormone-treated CEM-C7 or IM-9 cells (Fig. 6
). Exon 1A1 and
1A2-containing transcripts were up-regulated approximately 2.1-fold and
3-fold, respectively, by hormone in CEM-C7 cells (Fig. 3A
and data not
shown). The basal expression levels of exon 1A1- and 1A2-containing
transcripts in IM-9 cells were too low (Fig. 4
) to accurately determine
whether they are also down-regulated by hormone treatment. From these
studies, it appears that the exon 1A-containing transcripts are the
major hormone-responsive (both up-regulated and down-regulated) hGR
mRNA species.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 6. Identification of hGR Transcripts That Are
Hormone-Regulated
CEM-C7 cells and IM-9 lymphoblasts were treated for 24 h with
ethanol vehicle alone or with 1 µM Dex. Total RNA was
extracted and was analyzed using quantitative RT-PCR. The signal, as
determined by densitometric scanning, for the hormone-treated sample
was then compared with that of the ethanol vehicle control and
expressed as a percentage of the control value. The dashed
line represents the level of each transcript in the
non-hormone-treated sample in each cell line, and it was set at 100%
to allow comparison of the effects of hormone treatment. The data are
from three separate experiments and represent the mean ± the
SEM. *, P < 0.05 for the
hormone-treated sample vs. the respective ethanol
control value.
|
|
The hGR 1Ap/e Sequence Has Promoter Activity
hGR 1Ap/e fragments were cloned in front of the luciferase
reporter gene to determine whether any sequences confer basal promoter
activity and respond to hormone treatment. Because CEM-C7 cells show
very low transient transfection efficiencies, Jurkat cells were chosen.
However, Jurkat cells lack functional hGR protein; therefore, an
hGR cDNA expression plasmid was cotransfected along with the various
hGR 1Ap/e-luciferase constructs. The -964/+269 bp hGR 1Ap/e fragment
was able to drive the expression of the luciferase gene, while, as
expected for an authentic promoter, luciferase activity was
undetectable when the promoter region was cloned in the opposite
orientation, +269/-964 bp, with respect to the luciferase gene (Fig. 7A
). Hormone treatment of the -964/+269
bp hGR 1Ap/e-luciferase construct resulted in an approximately 2-fold
increase in the measured luciferase activity (Fig. 7B
) in CEM-C7 cells.
This induction was dependent on the cotransfection of the hGR
expression plasmid (data not shown). This stimulatory response is
specific for T cells, as no increase in luciferase activity was
observed when IM-9 cells were transfected with the -964/+269 reporter
construct and then treated with Dex (Fig. 7B
), even though IM-9 cells
have sufficient endogenous GR to down-regulate endogenous GR 1A3
transcripts (Fig. 6
). Further deletions to yield the -301/+269 bp and
+41/+269 bp constructs showed no change in overall basal activity in
CEM-C7 cells, and they were still hormone-responsive (Fig. 7
, A and B).
A deletion yielding the -619/+178 bp construct only retained 35% of
the full-length basal promoter activity and no longer was induced by
hormone treatment. A smaller deletion construct (+179/+269) had a very
low level of basal activity (
15% of full-length activity; Fig. 7A
)
but still was induced by hormone (data not shown). Thus, the region
between +41/+178 bp is critical for basal activity of hGR 1Ap/e, and
the region between +179/+269 contains the hormone-responsive
cis-acting elements.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 7. Deletion Analysis of the Basal and Hormone-Induced
Activity of the hGR 1A Promoter
Deletions were performed on the hGR promoter region linked to a
luciferase reporter gene in the pXP-1 expression vector. The various
constructs were cotransfected into Jurkat cells with a
ß-galactosidase construct driven by a constitutive promoter
[cytomegalovirus (CMV)] to normalize for transfection efficiency. A,
Basal promoter activity. The relative light units are the normalized
value for the basal hGR 1A promoter constructs. Shown are the means and
SEMs from the results of four separate experiments, except
for the +179/+269 construct, which is the average of two experiments.
*, P < 0.05 for the deletion constructs
vs. the -964/+269 full length promoter value. B,
Hormone-induced promoter activity. The experiments were performed as
described in panel A, except that a constitutive GR expression vector
was also cotransfected to reconstitute functional GR activity in the
Jurkat cells. The hormone-treated pXP-1 vector control, normalized
luciferase activity, was divided by the value for the ethanol-treated
vector alone control and the value set at 100%. The other normalized
values for the hGR 1A promoter constructs are then expressed as a
percentage of the pXP-1 value. Shown are the means and SEMs
of the means from four separate experiments. *, P
< 0.05 for an increase in activity for the hormone-treated sample
vs. the respective ethanol control value. IM-9 cells
were treated in the same manner, except the constitutive hGR expression
plasmid was not cotransfected because these cells contain functional,
endogenous GR protein.
|
|
To assay for enhancer activity, the +41/+269 and +179/+269 regions were
cloned in both orientations into the pTAL plasmid, which contains a
heterologous, TATA-box containing promoter. The +41/+269 element
increased promoter activity in the 3' to 5' direction but not in the
normal orientation (Fig. 8
). The
+179/+269 fragment demonstrated enhancer activity and increased
transcription in both orientations. Unfortunately, Dex treatment of the
pTAL plasmid backbone alone caused an inhibition of luciferase
expression, so that the hormone responsiveness of these two hGR 1A
elements could not be accurately tested using this heterologous
promoter.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 8. Assay for Enhancer Activity of the hGR 1A Sequence
Two hGR 1A sequences were cloned into the heterologous expression
plasmid pTAL in the normal 5'- to 3'-orientation (+41/+269; +179/+269)
or in the reversed orientation (+269/+41; +269/+179). These were
transfected into Jurkat cells and luciferase activity was assayed as
described in the legend to Fig. 7 and in Materials and
Methods. *, P < 0.05; **,
P < 0.01, compared with the pTAL plasmid alone.
|
|
At Least Six DNase I Footprints Occur in the hGR 1Ap/e Sequence,
One of Which is an IRF-E
Four DNase I footprints (FP1FP4) were observed upstream of
position +1 (Fig. 2
; data not shown). Because the deletion experiments
indicated that the +41/+269 bp exon 1A fragment was important for both
basal and hormone-induced gene expression, nuclear extracts from
ethanol (control) or Dex-treated CEM-C7 cells were used to footprint
this region. Both the coding and noncoding strands were analyzed. The
protected patterns were identical using either control or Dex-treated
extracts. Two separate protected sites or footprints were consistently
observed in the +41/+269 bp exon 1A region, FP5 at position +102 to
+125 bp, and FP6, which was quite extensive (Fig. 9A
).

View larger version (76K):
[in this window]
[in a new window]
|
Figure 9. Protein Binding Regions of the hGR Exon 1A Region
A, DNase I footprinting was performed on the +41/+269 fragment of the
hGR 1Ap/e sequence in the presence of 0, 30, or 60 µg of CEM-C7 cell
nuclear protein. Two footprints were revealed, FP5 (+102/+125) and FP6.
B, EMSA using a consensus IRF-E. A consensus IRF-E oligonucleotide was
32P-labeled and mixed with nuclear extracts obtained from
CEM-C7 cells that were treated for 24 h with 1 µM
Dex. Gel shift analysis was performed on the complex formed. Antibodies
to IRF-1 or IRF-2 were added as indicated. Arrows
indicate the supershifted complexes seen with the IRF-1 and IRF-2
antibodies, respectively. Fifty-, 100-, or 1,000-fold excess of
unlabeled consensus IRF-E or FP5 was added in competition experiments.
The dark band at the bottom of the gel is the major
DNA-protein complex. The rightmost lane is an
overexposure of the second lane to more clearly show the IRF-1
supershifted complex. C, The same experiment was performed as in panel
B except that a 32P-labeled FP5 oligonucleotide was used
instead of the consensus IRF-E sequence.
|
|
Computer analysis (16) of the FP5 region revealed a high
degree of homology to the consensus IRF-E. To identify the proteins
that specifically interacted with FP5, EMSAs were performed using
ethanol (control) or Dex-treated CEM-C7 nuclear extracts with
oligonucleotides from FP5 (+100 to +130 bp) and a consensus IRF-E.
Similar results were observed with the control and hormone-treated
nuclear extracts. EMSAs using the consensus IRF-E oligonucleotide
yielded a single major protein-DNA complex (Fig. 9B
). At least four
distinct complexes, the major band of which comigrated to the same
location as the consensus IRF-E complex, were observed with the FP5
oligonucleotide (Fig. 9
, B and C). Addition of either an IFN-regulatory
factor-1 (IRF-1) antibody or an IRF-2 antibody to the binding reaction
resulted in a supershift complex using both the consensus IRF-E and FP5
oligonucleotides and CEM C7 cell nuclear extract (Fig. 9
, B and C).
Competition with unlabeled FP5 or the consensus IRF-E gave similar
competition patterns, and a decrease in binding was seen with as little
as a 50-fold excess of unlabeled oligonucleotide (Fig. 9
, B and C).
When the IRF-E was deleted from the competing FP5 oligonucleotide, it
no longer was an effective competitor (data not shown). Therefore, FP5
in hGR exon 1A has all of the characteristics of an authentic
IRF-E.
The IRF-E Contributes to Basal Promoter Activity but Not to Hormone
Responsiveness
In vitro site-directed deletion was performed to
determine the overall contribution of the IRF-E (FP5) to basal or
hormone-induced activity. Deletion of FP5 (TTCACTTCT) resulted in an
approximately 55% decrease in basal activity of the full-length
promoter (Fig. 10A
). However, the FP5
deletion promoter construct was still responsive to hormone (Fig. 10B
).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 10. Deletion Mutagenesis of FP5
In vitro mutagenesis was performed on the -964/+269 hGR
1Ap/e sequence cloned into the pXP-1 luciferase reporter gene to delete
the core sequence (5'-TTCACTTCA-3') of the IRF-E in FP5. The undeleted
and deleted hGR 1Ap/e constructs were then cotransfected with a
constitutive hGR cDNA expression vector and a ß-galactosidase
normalization vector into Jurkat cells as described in the legend to
Fig. 8 . Shown are the mean and the SEM for three separate
experiments. A, Effect of FP5 deletion on basal promoter activity. *,
P < 0.05 for a decrease in activity for the
deletion construct vs. the -964/+269 full length
promoter value. B, Effect of FP5 deletion on hormone-induced hGR 1Ap/e
promoter activity. The open bar is the value obtained in
the absence of hormone, and it is set at 100%, even though the
absolute activity of the FP5-deleted construct was considerably lower
(see panel A) than for the undeleted construct. Shown are the mean and
the SEM for three separate experiments. *,
P < 0.05 for an increase in activity for the
hormone-treated sample vs. the respective ethanol
control value.
|
|
FP6 Resembles a Glucocorticoid Response Element (GRE)
EMSAs were performed using the FP6 oligonucleotide. Numerous
protein-DNA complexes were observed (Fig. 11
), consistent with the extensive
DNase I footprint that was seen (Fig. 9A
). Competition assays using 50-
or 1,000-fold molar excess of an unlabeled consensus GRE effectively
competed away these complexes, suggesting that FP 6 bound the GR. The
cognate FP6 oligonucleotide effectively competed the binding (data
not shown), while the deletion of the sequences AGAAAA and TCTTCT from
FP6 diminished its ability to compete out some of the bands, even at a
1,000-fold molar excess (Fig. 11
). No supershift occurred using a GR
antibody, while a supershifted complex was obtained using a GRß
antibody. The ability of an anti-GRß antibody to supershift one of
these bands indicates that FP6 is a putative GRE. There are two reasons
why the anti-GR
antibody did not cause a supershift. First, this
antibody does not cause a good supershift even when a consensus GRE is
used, indicating that this antibody does not function well in this
assay. This is the most likely explanation. Second, it is possible that
GRß binds more avidly to the noncanonical FP6 GRE than does GR
. We
are not aware of any report of a GRß-specific GRE.

View larger version (79K):
[in this window]
[in a new window]
|
Figure 11. EMSA of FP6
Radiolabeled FP6 was incubated with nuclear extract of CEM-C7 cells
that had been treated with 1 µM Dex for 24 h. A
complex EMSA is obtained. Addition of a GR antibody did not cause a
clear supershift, while addition of a GRß antibody caused a distinct
supershift (SS) with a concomitant loss of a lower band (S). A 50-fold
or 1,000-fold excess of unlabeled consensus GRE was added as indicated.
A 50- or 1,000-fold excess of unlabeled FP6 completely eliminated the
shifted bands (data not shown), while an FP6 oligonucleotide from which
the putative GRE was deleted did not compete as effectively for all of
the bands.
|
|
 |
DISCUSSION
|
|---|
In most cell types tested to date, GR mRNA and protein are
down-regulated by GCs. Conversely, treatment of immature T lymphocytes
and thymocytes and T lymphoblasts with hormone results in an
up-regulation of GR mRNA and protein, and these cells undergo
programmed cell death or apoptosis. GR up-regulation in T lymphoblasts
is essential for hormone-mediated apoptosis (7).
Therefore, we examined the regulation of the hGR gene in T cells to
determine the molecular mechanisms involved in the cell type-
specific expression and up-regulation of GR in these cells.
At least three separate promoters were identified for the mouse GR gene
(9). All three mouse GR transcripts encoded an identical
protein product and only differed in their 5'-exon 1 untranslated
regions, designated exons 1A, 1B, and 1C. More recent studies indicate
that there are at least five mouse GR untranslated exon 1 sequences
arising from at least four separate promoters (17, 18),
and the rat GR gene codes for at least 11 alternative first exons
arising from multiple promoters (19). Thus, multiple
promoters and untranslated first exons for the GR gene appear to be
common.
The hGR gene contains at least three promoters whose utilization gives
rise to at least five separate transcripts containing different
5'-untranslated first exons. The human exon 1A region utilizes three
separate splice donor sites (1A1, 1A2, and 1A3) located within
approximately 1 kbp of sequence. 1B- and 1C-containing transcripts were
detected in all cell types tested, consistent with the fact that the GR
is ubiquitously expressed. This also agrees with the fact that the
proximal GR promoter/exon region (1B and 1C) is very GC rich, contains
a CpG island characteristic of housekeeping genes, lacks TATA boxes and
CAAT boxes, and has numerous Sp1-binding sites
(20). There are 3 YY1 sites, four Sp1 sites, and
one unidentified footprint upstream of the exon 1B transcription start
site, and the hGR promoter 1B sequence can drive transcription in the
absence of the promoter 1C sequence (Ref. 21 and Nunez,
B. S., and W. V. Vedeckis, in preparation). Thus, there
appear to be at least two constitutive hGR promoters that occur in a
region proximal to the hGR-coding exons. In contrast, exon
1A3-containing transcripts were expressed at highest levels in cancer
cells of hematopoietic origin. Exon 1A1 and 1A2 transcripts have a
broader expression pattern, even though they presumably share a common
promoter with exon 1A3, suggesting that tissue-specific alternative
splicing and not promoter usage may result in the relative abundance of
the hGR exon 1A3 transcript in blood cells. Further analysis of the
tissue-specific splicing of these various transcripts is needed to
resolve these questions.
The exon 1A1-, 1A2-, and 1A3 (but not exon 1B or 1C)-containing
transcripts were up-regulated by hormone in CEM-C7 cells, and exon
1A3-containing transcripts were down-regulated in IM-9 cells, while
transcripts with exon 1B or 1C were not. The absence of down-regulation
for the 1B- and 1C-containing transcripts was surprising, because an
internal control region (coding for amino acids 550697) is clearly
involved in GC-mediated down-regulation in transfection experiments
(22). One possibility is that exon 1 sequences may also
contribute to hormone-mediated down-regulation. The cDNA construct used
in Ref. 22 began at exon 2; i.e. it lacked any
exon 1 sequences. Perhaps under normal in vivo circumstances
exon 1B and exon 1C inhibit hormone-mediated GR down-regulation caused
by the intragenic hGR DNA sequences, and that this inhibition is lost
when an exon 29 cDNA construct is used. Our results suggest that the
exon 1A3-containing transcript is the down-regulated species of hGR
mRNA in B cells. However, when the -964/+269 hGR 1Ap/e sequence was
placed into a luciferase expression vector, no hormone-mediated
decrease in luciferase expression occurred in IM-9 cells. Thus, both
exon 1A3 sequences and the intragenic GR cDNA control region may
normally be required in vivo for hormone-mediated
down-regulation.
The -964 to +269 bp hGR 1Ap/e fragment has basal promoter activity and
is affected by hormone treatment in Jurkat T cells. Four of the six
DNase I footprints identified to date are located in the promoter
region (FP1FP4), while two are intraexonic (FR5, FP6). Visual
inspection reveals that FP4 contains a TATA box-like sequence at
position -60, and FP2 contains a sequence resembling a CAAT box at
position -195.
The intraexonic location of FP5 and FP6 was surprising. The fact that
the +41/+269 fragment conferred basal activity and hormone inducibility
to the pXP-1 luciferase expression vector may mean that a cryptic
promoter in the vector can be activated by this intraexonic piece of
DNA. The +179/+269 sequence demonstrates enhancer activity. Internal
control regions for eukaryotic genes have recently become better
characterized. For example, a downstream promoter element, or DPE, has
been identified in many TATA-less promoters (23), although
this sequence does not occur in hGR 1Ap/e. Also, ER factor-1 regulates
ER transcription by binding to an intraexonic element in the ER gene
that codes for an untranslated exon 1 (24). The FP5 and
FP6 intraexonic sequences in hGR 1Ap/e may be additional examples of
this gene- regulatory mechanism.
FP5 is an IRF-1 binding site that can bind IRF-1 and IRF-2, both of
which are transcription factors that were identified based on their
ability to regulate the expression of the IFN-ß gene in response to
IFNs (25, 26). IRF-1 and IRF-2 bind the same DNA site
(26, 27, 28); IRF-1 is an activator of type 1 IFNs and
IFN-inducible genes, whereas IRF-2 represses the effect of IRF-1
(29, 30). However, IRF-2, also known as histone nuclear
factor M, does play a positive role in the cell cycle regulation of the
human histone H4 gene FO108
(31), and IRF-2 directs muscle cell-specific expression of
vascular adhesion molecule-1 in the absence of cytokine stimulation
(32). The roles of IRF-1 and IRF-2 in regulating in
vivo expression of exon 1A-containing transcripts of the hGR are
under current investigation.
Computer analysis suggested that FP6 contains an apparent half-GRE, and
this sequence can bind GRß. However, studies to determine regions of
the hGR 1Ap/e sequence that confer hormone responsiveness have not yet
yielded clear-cut results. For example, deletion of 6 or 12 nucleotides
of the apparent GRE in FP6 did not completely abolish Dex
responsiveness (our unpublished observations). There is a broad
region of DNase I protection in the FP6 footprint, so other
transcription factors may also bind this sequence. Computer analysis of
the +41/+269 region revealed that there are four additional potential
half-GRE binding sites, but these have not yet been characterized.
Because of the complexity of the +41/+269 sequence, a detailed analysis
of the regions of the exon 1A sequence that contribute to the hormonal
activation of GR 1A promoter and GR up-regulation is required and
ongoing. Finally, FP3 resembles a nuclear factor-
B binding site, and
preliminary studies show that the nuclear factor-
B can bind to this
sequence (Geng, C.-D., and W. V. Vedeckis, unpublished
observations).
During the course of these studies, two reports appeared for the mouse
GR gene that are similar to ours for the hGR gene (17, 18). These studies detected mouse GR transcripts 1A and 1B, plus
two new transcripts, 1D and 1E. Thus, there are four mouse GR
transcripts, 1B, 1C, 1D, and 1E, that originate in the proximal
promoter, while the exon 1A transcript originates far upstream, as
originally shown by Strähle et al. (9).
The 1A transcript was expressed at high levels in mouse S49 lymphoma
cells that were enriched in the membrane-associated GR believed to be
involved in hormone-mediated apoptosis (17). Computer
comparison of the hGR 1Ap/e sequence with the mouse 1A sequence
indicated 60.6% sequence identity in the promoter region and 61.6%
identity for exon 1A (data not shown). The 100 bp between +104 and +203
in hGR 1Ap/e [which contains the IRF-E (FP5) and FP6] is 73.5%
identical to the corresponding region in the mouse 1A sequence (data
not shown). Positions +111 to +122 in the minus strand of FP5 of the
hGR 1Ap/e sequence contain a perfect direct repeat, AAGTGA, of an IRF-E
sequence (26, 27), and, except for a transition in one
nucleotide, this is completely conserved in the mouse 1A sequence.
Although Chen et al. (17, 18) did not study the
hormonal regulation of any of the transcripts in their studies, it is
likely that the mouse 1A transcript will also be selectively
up-regulated by glucocorticoids in mouse T-cell leukemia and lymphoma
as well.
Autoinduction of GR levels is essential for apoptosis in human T
lymphoblasts (7), and this effect appears to be mediated
specifically via the exon 1A hGR transcript. Thus, the present findings
may have clinical relevance for T-cell ALL patients. RT-PCR of the exon
1A3-containing GR transcripts may help in diagnosing elevated blast
levels in peripheral blood leukocytes at initial presentation and early
relapse. Ex vivo challenge of peripheral blood leukocytes
with Dex may be useful for prognosis, e.g. if T-cell ALL
blasts show up-regulation of exon 1A3-containing transcripts,
this would indicate a hormonally responsive phenotype. Determining
transcriptional activators of the hGR 1Ap/e sequence may elucidate
signal transduction pathways leading to new therapeutic approaches for
up-regulating GR levels by treatment with biological response modifiers
(such as IFNs, cytokines, lymphokines, etc.) that could lead to
increased steroid sensitivity. Further detailed studies are required to
analyze the possible clinical applications of the hGR 1Ap/e
sequence.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
Human CEM-C7 ALL cells (a kind gift from Dr. E. Brad Thompson,
University of Texas Medical Branch, Galveston, TX) were grown in RPMI
1640 (Life Technologies, Inc., Gaithersburg, MD)
supplemented with 10% dialyzed, heat-inactivated FBS (Life Technologies, Inc.). Human Jurkat ALL cells (ATCC,
Manassas, VA) were grown in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% FBS (Life Technologies, Inc.). Cells were treated with either 1 µM Dex
(Sigma, St. Louis, MO) or ethanol (0.01% vehicle
alone).
5'-RACE
A MOLT-4 (human T-cell ALL) Marathon ready double-strand cDNA
library (CLONTECH Laboratories, Inc.) was used in the
5'-RACE reaction. 5'-RACE was performed using a 5'-AP-1 primer
(CLONTECH Laboratories, Inc.)
(5'-CCATCCTAATACGACTCACTATAGGGC-3') and two separate 3'-primers to exon
2 of the human GR gene, exon 2 primer no. 1 (5'-
GGGTTTTATAGAAGTCCATCACATCTCC-3'), and exon 2 primer no. 2
(5'-CGACAGCCAGTGAGGGTGAAGACG-3'). All custom-made oligonucleotide
primers were obtained from Sigma Genosys (The Woodlands, TX). A control
5'-RACE reaction was performed with the 5'-AP-1 primer and a
3'-glyceraldehyde-3-phosphate dehydrogenase primer (5'-
GACCACAGTCCATGACATCACT-3'). The RACE reaction contained 0.5 ng MOLT-4
cDNA library, 10 µM each of the 5'- and 3'-primers, 0.2
mM deoxynucleoside triphosphates (CLONTECH Laboratories, Inc.), 1X Advantage Taq PCR buffer
(CLONTECH Laboratories, Inc.), and 1X Advantage
Taq DNA polymerase (CLONTECH Laboratories, Inc.) in a 50-µl reaction. The PCR reaction was performed in a
9600 Thermocycler (Perkin-Elmer Corp., Norwalk, CT) with
an initial denaturation of 94 C for 1 min, five cycles of 94 C for 10
sec, 72 C for 3 min; five cycles of 94 C for 10 sec, 70 C for 3 min,
and 25 cycles of 94 C for 10 sec, 68 C for 3 min. The PCR products were
analyzed on a 1.2% agarose/1x Tris-borate-EDTA gel containing
0.1 µg/ml ethidium bromide. The band of interest was excised from the
gel and purified using the GENECLEAN III kit (BIO 101, Vista, CA). The
gel-purified DNA was ligated into the pCR2.1 TA cloning vector
(Invitrogen, Carlsbad, CA). Clones were sequenced using
the 3'-exon 2 human GR gene primers (nos. 1 and 2) using a
Thermosequenase Kit (Amersham Pharmacia Biotech, Arlington
Heights, IL).
RT-PCR
Total RNA was collected from 24 h ethanol (control) or 1
µM Dex-treated cells using TriReagent (Molecular Research Center, Inc., Cincinnati, OH). For RT-PCR, 1 µg total
RNA was reverse transcribed using a random hexamer primer (RT-for-PCR
kit, CLONTECH Laboratories, Inc.), and the resulting cDNA
was diluted to 100 µl final volume. PCRs were carried out in the
linear range of amplification for each primer set, exon 1A1/exon 2 (30
cycles), exon 1A2/exon 2 (34 cycles), exon 1A3/exon 2 (29 cycles), exon
1B/exon 2 (27 cycles), and exon 1C/exon 2 (25 cycles), using the
same reaction conditions described for 5'-RACE. PCR was performed in a
25 µl reaction volume with an initial denaturation step of 94 C for 2
min followed by 94 C for 30 sec, 68 C for 30 sec, and 72 C for 30 sec
with the exception of the exon 1A1/exon 2 and exon 1A2/exon 2 primer
sets, for which the annealing temperature was 64 C for 30 sec.
QuantumRNA 18S internal control primers (1:9
primer-competitor ratio) (Ambion, Inc.) were included in
each reaction to normalize the data. Primer sets used for RT-PCR were:
exon 1A3, 5'-GCTTCATTAAAGTGTCTGAGAAGG-3'; exon 1B,
5'-GCAACTTCTCTCCCAGTGGCG-3'; and exon 1C, 5'-CTTAAATAGGGCTCTCCCCC-3'.
The 3'-primer for all of the primer sets was hGR exon 2 primer no. 2.
Primers to determine the 5'-end of the exon 1A transcripts were: GR
1Ap/e, -272 bp 5'-GGTAACCAAGGCATCACACT-3'; GR 1Ap/e, -72 bp
5'-GATGACACAGACTAATAACCAATG-3'; GR 1Ap/e, +56 bp
5'-TTGCTCCCTCTCGCCCTCATTC-3'; GR 1Ap/e, +126 bp
5'-CTGGGGAAATTGCAACACGC-3'; GR 1Ap/e, +222 bp
5'-CTTTCAAGCCCTGCAGGACC-3'; GR 1Ap/e, +455 bp
5'-TCTGCCTGGGGGAATATCTGC-3'; and GR 1Ap/e, +955/+981 bp
5'-GCTTCATTAAAGTGTCTGAGAAGGAAG-3'. The downstream primer used was the
hGR exon 2 primer no. 2. RT-PCR for the exon 1A splice variants, exon
1A1 and 1A2, was performed using a 5'-upstream primer in the exon 1A
region common to all three splice variants and a 3'-primer that spans
the specific exon 1A1 or 1A2/exon 2 splice junction. The RT-PCR primers
for the exon 1A1 splice variant were 5'-primer +56 bp and downstream
primer 5'-GTGAATATCAACTTCTAAGGTCCAGTG-3'. RT-PCR primers for the exon
1A2 splice variant were 5'-primer +126 bp and downstream primer 5'
GTGAATATCAACTCTTTCTGTTTC 3'.
DNA Constructs
The -964 to +269 hGR 1A promoter/exon region was amplified
using the 5'-PCR primer, 5'-CCAGCAGTTTTATAGAAGCTAACAC-3', and the
3'-PCR primer, 5'-GCTTCCGTTGGACACATGCG-3'. The resulting PCR product
was subcloned into the pCR II TA TOPO cloning vector
(Invitrogen). The -964/+269 hGR 1A p/e fragment was
liberated from the pCR II TOPO vector using EcoRI, Klenow
treated, and subcloned into the 5' to 3' or 3' to 5' orientation with
respect to the luciferase gene in the pGL3 Basic vector (Promega Corp.). The pGL3 Basic vector was prepared by XbaI
digestion and Klenow treatment to create flush ends. The -964/+269 or
+269/-964 hGR 1A p/e constructs were liberated from the pGL3 Basic
vector by NheI followed by Klenow treatment and
HindIII digestion and ligation into the
SmaI/HindIII digested pXP-1 luciferase vector
(ATCC). Deletion constructs of the pXP-1 -964/+269 hGR 1A
p/e region were created by restriction endonuclease digestion at
various sites. BglII digestion of the pXP-1 -964/+269
construct results in the liberation of a -964/-619 and a -618/+178
fragment. The pXP-1 +179/+269 hGR 1A p/e fragment and -618/+178
BglII inserts were gel purified and re-ligated to create the
pXP-1 -618/+178 and +179/+269 constructs. The -301/+269 hGR 1A p/e
construct was created by digesting the pXP-1 -964/+269 1A
promoter/exon construct with BamHI/SacI. The
resulting pXP-1 -301/+269 vector fragment was gel purified and
subsequently treated with T4 DNA polymerase (NEB)
to create blunt ends before re-ligation. The pXP-1 plasmid containing
the -964/+269 fragment was digested with KpnI and the pXP-1
plasmid containing the +41/+269 1A fragment was gel purified and
religated to create the pXP-1 +41/+269 construct. The -964/+41 GR 1A
p/e pXP-1 construct was generated by double-digestion of the pXP-1
plasmid containing the -964/+269/fragment with
KpnI/HindIII. The resulting -964/+41 GR 1Ap/e
pXP-1 construct was gel purified and treated with
T4 DNA polymerase (Life Technologies, Inc.) before subsequent re-ligation. The pTAL plasmid
(CLONTECH Laboratories, Inc.) was digested with
SmaI and phosphatase-treated. The +41/+269 and +179/+269
fragments were prepared as described above, Klenow treated, and
blunt-end ligated into the SmaI-cleaved pTAL. Orientation
was confirmed by DNA sequencing.
Transient Transfections
Jurkat and IM-9 cells were seeded at 2 x
106 cells/ml in six-well culture dishes.
Transient transfections into Jurkat cells were performed using 2.5 µg
DNA (1 µg luciferase construct in either the pXP-1 or pGL3 Basic
vector, 1 µg pCYGR human GR expression plasmid (a kind gift from Dr.
Jawed Alam, Alton Ochsner Medical Foundation, New Orleans, LA), and 0.5
µg pCMV-ß-galactosidase plasmid), 6 µl Plus reagent, and 6 µl
lipofectamine reagent (Lipofectamine-Plus reagent, catalogue no.
10964013, Life Technologies, Inc.) according to the
manufacturers instructions. Transfections into IM-9 cells were
performed with 2 µg DNA (1.5 µg luciferase construct in the pGL3
Basic vector, 0.5 µg pCMV-ß-galactosidase vector), 6 µl Plus
reagent, and 6 µl lipofectamine reagent. Twenty-four hours post
transfection the cells were treated with either 0.01% ethanol
(control) or 1 µM Dex. Forty-eight hours post
transfection the cells were assayed for luciferase and
ß-galactosidase activities in a Dynatech ML 2250 luminometer as
previously described (21).
DNase I Footprint Analysis
DNase I footprint analysis was performed as previously described
(21) except that the DNase I concentration for the zero
protein control was 11 ng/µl. The nuclear extracts used for
footprinting were prepared as described elsewhere (33).
Briefly, nuclear extracts were prepared from 1 liter CEM-C7 cell
cultures treated for 24 h with 0.01% ethanol (control) or 1
µM Dex. The DNA fragment used in the footprinting
reaction was the pGL3 basic vector containing the+41/+269 hGR 1Ap/e
fragment. Both the coding and noncoding strands were labeled by
digestion with the restriction endonuclease BamHI (followed
by a subsequent HindIII digestion) or HindIII
(followed by a subsequent BamHI digestion) and filled-in
using the Klenow fragment of DNA polymerase (New England Biolabs, Inc., Beverly, MA).
EMSAs
The nuclear extract used for EMSAs was the same as used in DNase
I footprint analysis. EMSAs were performed as previously described
(21). Supershift assays using either the IRF-1 antibody
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA; catalogue
no. sc 497) or IRF-2 antibody (Santa Cruz Biotechnology, Inc., Cat. No. sc 498) were performed by adding 4 µg of the
antibody to the binding reaction 1 h before the addition of the
labeled oligonucleotide. The reaction was then incubated at room
temperature for an additional 15 min before resolving on a gel. The
consensus IFR-E oligonucleotide (catalogue no. sc 2575) and consensus
GRE oligonucleotide (catalogue no. sc 2545) was purchased from
Santa Cruz Biotechnology, Inc. Oligonucleotides for exon
1A FP5 were 5'-GTAGAGGCGAATCACTTTCACTTCTGCTGGG-3' and
5'-CCCAGCAGAAGTGAAAGTGATTCGCCTCTAC-3' and exon 1A FP6
5'-GAGAAGGAGAAAACTTAGATCTTCTGATACCAA- 3' and
5'-TTGGTATCAGAAGATCTAAGTTTTCTCCTTCTC-3'. Anti-GR antibodies used were
GR
-specific (Santa Cruz Biotechnology, Inc., catalogue
no. sc-1002) and GRß-specific (Affinity BioReagents, Inc. Golden, CO; catalogue no. PA3514).
In Vitro Site-Directed Mutagenesis
Site-directed mutagenesis was performed using the MutaGene
in vitro Mutagenesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA). Twelve picomoles of the FP5 deletion
oligonucleotide (5'-GCAATTTCCCCAGCAGTGATTCGCCTCTA- CTC-3') was used in
the mutagenesis reaction.
Note Added in Proof
The GenBank accession number for the hGR 1Ap/e sequence is
AF395116.
 |
ACKNOWLEDGMENTS
|
|---|
We are thankful to Dr. Margaret DeAngelis and Dr. Mark A. Batzer
(Department of Pathology, Louisiana State University Health Sciences
Center, New Orleans, LA) for assistance in the BAC screening, and to
Joelle Finley for maintaining the cell cultures.
 |
FOOTNOTES
|
|---|
This work was supported by NIH Grant DK-47211 (to W.V.V.) and a grant
from the Louisiana State University School of Medicine Institutional
Research Enhancement Fund.
1 Present Address: Research Institute for Children, Childrens
Hospital, 520 Elmwood Park Boulevard, Suite 160, Harahan, Louisiana
70123. 
Abbreviations: ALL, acute lymphoblastic leukemia; BAC,
bacterial artificial chromosome; CMV, cytomegalovirus; Dex,
dexamethasone; GC, glucocorticoid; GRE, glucocorticoid response
element; IFN, interferon; IRF-1, IFN-regulatory factor-1; IRF-E,
IFN-regulatory factor element; RACE, 5'-rapid amplification of cDNA
ends.
Received for publication June 5, 2000.
Accepted for publication May 30, 2001.
 |
REFERENCES
|
|---|
-
Vanderbilt JN, Miesfeld R, Maler BA, Yamamoto KR 1987 Intracellular receptor concentration limits glucocorticoid-dependent
enhancer activity. Mol Endocrinol 1:6874[Abstract/Free Full Text]
-
Burnstein KL, Bellingham DL, Jewell CM, Powell-Oliver FE,
Cidlowski JA 1991 Autoregulation of glucocorticoid receptor gene
expression. Steroids 56:5258[CrossRef][Medline]
-
Norman MR, Thompson EB 1977 Characterization of a
glucocorticoid-sensitive human lymphoid cell line. Cancer Res 37:37853791[Abstract/Free Full Text]
-
Harmon JM, Thompson EB 1981 Isolation and characterization of
dexamethasone-resistant mutants from human lymphoid cell line CEM-C7.
Mol Cell Biol 1:512521[Abstract/Free Full Text]
-
Denton RR, Eisen LP, Elsasser MS, Harmon JM 1993 Differential
autoregulation of the glucocorticoid receptor expression in human T-
and B-cell lines. Endocrinology 133:248256[Abstract/Free Full Text]
-
Harmon JM, Norman MR, Fowlkes BJ, Thompson EB 1979 Dexamethasone induces irreversible G1 arrest and death of a human
lymphoid cell line. J Cell Physiol 98:267278[CrossRef][Medline]
-
Ramdas J, Liu W, Harmon JM 1999 Glucocorticoid- induced
cell death requires autoinduction of glucocorticoid receptor expression
in human leukemic T cells. Cancer Res 59:13781385[Abstract/Free Full Text]
-
Zong J, Ashraf J, Thompson EB 1990 The promoter and first,
untranslated exon of the human glucocorticoid receptor gene are GC rich
but lack consensus glucocorticoid receptor element sites. Mol Cell Biol 10:55805585[Abstract/Free Full Text]
-
Strähle U, Schmidt A, Kelsey G, et al. 1992 At least
three promoters direct expression of the mouse glucocorticoid receptor
gene. Proc Natl Acad Sci USA 89:67316735[Abstract/Free Full Text]
-
Gaynon PS, Lustig RH 1995 The use of glucocorticoids in acute
lymphoblastic leukemia of children. J Pediat Hematol/Oncol 17:112[Medline]
-
Bloomfield CD, Peterson BA, Zaleskas J, et al. 1980 In
vitro glucocorticoid studies for predicting response to
glucocorticoid therapy in adults with malignant lymphoma. Lancet 1:19521956
-
Pui CH, Ochs J, Kalwinsky DK, Costlow ME 1984 Impact of
treatment efficacy on the prognostic value of glucocorticoid receptor
levels in childhood acute lymphoblastic leukemia. Leuk Res 8:345350[CrossRef][Medline]
-
Pui CH, Dahl GV, Rivera G, Murphy SB, Costlow ME 1984 The
relationship of blast cell glucocorticoid receptor levels to response
to single agent steroid trial and remission response in children with
acute lymphoblastic leukemia. Leuk Res 8:579585[CrossRef][Medline]
-
Pui CH, Costlow ME 1986 Sequential studies of lymphoblast
glucocorticoid receptor levels at diagnosis and relapse in childhood
leukemia: an update. Leuk Res 10:227229[CrossRef][Medline]
-
Encio IJ, Detera-Wadleigh SD 1991 The genomic structure of the
human glucocorticoid receptor. J Biol Chem 266:71827188[Abstract/Free Full Text]
-
Prestridge DS 1991 SIGNAL SCAN: a computer program that scans
DNA sequences for eukaryotic transcriptional elements. CABIOS 7:203206[Abstract/Free Full Text]
-
Chen F, Watson CS, Gametchu B 1999 Multiple glucocorticoid
receptor transcripts in membrane glucocorticoid receptor-enriched S-49
mouse lymphoma cells. J Cell Biochem 74:418429[CrossRef][Medline]
-
Chen F, Watson CS, Gametchu B 1999 Association of the
glucocorticoid receptor alternatively-spliced transcript 1A with the
presence of the high molecular weight membrane glucocorticoid receptor
in mouse lymphoma cells. J Cell Biochem 74:430446[CrossRef][Medline]
-
McCormick JA, Lyons V, Jacobson MD, et al. 2000 5'-Heterogeneity of the glucocorticoid receptor messenger RNA is tissue
specific: differential regulation of variant transcripts by early-life
events. Mol Endocrinol 14:506517[Abstract/Free Full Text]
-
Nobukuni Y, Smith CL, Hager GL, Detera-Wadleigh SD 1995 Characterization of the human glucocorticoid promoter. Biochemistry 34:82078214[CrossRef][Medline]
-
Breslin MB, Vedeckis WV 1998 The human glucocorticoid receptor
promoter upstream sequences contain binding sites for the ubiquitous
transcription factor Yin Yang 1. J Steroid Biochem Mol Biol 67:369381[CrossRef][Medline]
-
Burnstein KL, Jewell CM, Sar M, Cidlowski JA 1994 Intragenic
sequences of the human glucocorticoid receptor complementary DNA
mediate hormone-inducible receptor messenger RNA down-regulation
through multiple mechanisms. Mol Endocrinol 8:17641773[Abstract/Free Full Text]
-
Burke TW, Willy PJ, Kutach AK, Butler JE, Kadonaga JT 1998 The
DPE, a conserved downstream core promoter element that is functionally
analogous to the TATA box. Cold Spring Harbor Symp Quant Biol 63:7582[CrossRef][Medline]
-
deConinck EC, McPherson LA, Weigel RJ 1995 Transcriptional
regulation of estrogen receptor in breast carcinomas. Mol Cell Biol 15:21912196[Abstract]
-
Miyamoto M, Fujita T, Kimura Y, et al. 1988 Regulated
expression of a gene encoding a nuclear factor, IRF-1, that
specifically binds to IFN-ß gene regulatory elements. Cell 54:903913[CrossRef][Medline]
-
Harada H, Fujita T, Miyamoto M, et al. 1989 Structurally
similar but functionally distinct factors, IRF-1 and IRF-2, bind to the
same regulatory elements of IFN and IFN-inducible genes. Cell 58:729739[CrossRef][Medline]
-
Naf D, Hardin SE, Weissmann C 1991 Multimerization of AAGTGA
and GAAAGT generates sequences that mediate virus inducibility by
mimicking an interferon promoter element. Proc Natl Acad Sci USA 88:13691373[Abstract/Free Full Text]
-
Tanaka N, Kawakami T, Taniguchi T 1993 Recognition DNA
sequences of interferon regulatory factor-1 (IRF-1) and IRF-2,
regulators of cell growth and the interferon system. Mol Cell Biol 13:45314538[Abstract/Free Full Text]
-
Fujita T, Reis L, Watanabe N, Kimura Y, Taniguchi T, Vilcek J 1989 Induction of the endogenous IFN-
and IFN-ß genes by a
regulatory transcription factor, IRF-1. Nature 270272
-
Harada H, Willison K, Sakakibara J, Miyamoto M, Fujita T,
Taniguchi T 1990 Absence of type I IFN system in EC cells:
transcriptional activator (IRF-1) and repressor (IRF-2) genes are
developmentally regulated. Cell 63 63:303312
-
Vaughan PS, Aziz F, Vanwijnen AJ, et al. 1995 Activation of a
cell-cycle regulated histone gene by the oncogenic transcription factor
IRF-2. Nature 377:362365[CrossRef][Medline]
-
Jesse TL, LaChance R, Iademarco MF, Dean DC 1998 Interferon
regulatory factor-2 is a transcriptional activator in muscle where it
regulates expression of vascular cell adhesion molecule-1. J Cell
Biol 140:12651276[Abstract/Free Full Text]
-
Digman JD, Lebovitz RM, Roeder RG 1983 Accurate transcription
initiation by RNA polymerase II in a soluble extract from isolated
mammalian nuclei. Nucleic Acids Res 11:14751489[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
C. C. Chung, L. Shimmin, S. Natarajan, C. L. Hanis, E. Boerwinkle, and J. E. Hixson
Glucocorticoid Receptor Gene Variant in the 3' Untranslated Region Is Associated with Multiple Measures of Blood Pressure
J. Clin. Endocrinol. Metab.,
January 1, 2009;
94(1):
268 - 276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. F. Johnson, N. Rennie, V. Murphy, T. Zakar, V. Clifton, and R. Smith
Expression of Glucocorticoid Receptor Messenger Ribonucleic Acid Transcripts in the Human Placenta at Term
J. Clin. Endocrinol. Metab.,
December 1, 2008;
93(12):
4887 - 4893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-d. Geng, J. R. Schwartz, and W. V. Vedeckis
A Conserved Molecular Mechanism Is Responsible for the Auto-Up-Regulation of Glucocorticoid Receptor Gene Promoters
Mol. Endocrinol.,
December 1, 2008;
22(12):
2624 - 2642.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Tompkins, T. L. Sit, and A. D. Wallace
Unique Transcription Start Sites and Distinct Promoter Regions Differentiate the Pregnane X Receptor (PXR) Isoforms PXR 1 and PXR 2
Drug Metab. Dispos.,
May 1, 2008;
36(5):
923 - 929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Meyers, J. Taverna, J. Chaves, A. Makkinje, and A. Lerner
Phosphodiesterase 4 Inhibitors Augment Levels of Glucocorticoid Receptor in B Cell Chronic Lymphocytic Leukemia but Not in Normal Circulating Hematopoietic Cells
Clin. Cancer Res.,
August 15, 2007;
13(16):
4920 - 4927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Presul, S. Schmidt, R. Kofler, and A. Helmberg
Identification, tissue expression, and glucocorticoid responsiveness of alternative first exons of the human glucocorticoid receptor
J. Mol. Endocrinol.,
January 1, 2007;
38(1):
79 - 90.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Russcher, V. A S H Dalm, F. H de Jong, A. O Brinkmann, L. J Hofland, S. W J Lamberts, and J. W Koper
Associations between promoter usage and alternative splicing of the glucocorticoid receptor gene
J. Mol. Endocrinol.,
January 1, 2007;
38(1):
91 - 98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Sanchez-Vega, N. Krett, S. T. Rosen, and V. Gandhi
Glucocorticoid receptor transcriptional isoforms and resistance in multiple myeloma cells
Mol. Cancer Ther.,
December 1, 2006;
5(12):
3062 - 3070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. J. E. Tissing, J. P. P. Meijerink, B. Brinkhof, M. J. C. Broekhuis, R. X. Menezes, M. L. den Boer, and R. Pieters
Glucocorticoid-induced glucocorticoid-receptor expression and promoter usage is not linked to glucocorticoid resistance in childhood ALL
Blood,
August 1, 2006;
108(3):
1045 - 1049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. V. Sionov, O. Cohen, S. Kfir, Y. Zilberman, and E. Yefenof
Role of mitochondrial glucocorticoid receptor in glucocorticoid-induced apoptosis
J. Exp. Med.,
January 23, 2006;
203(1):
189 - 201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-d. Geng and W. V. Vedeckis
c-Myb and Members of the c-Ets Family of Transcription Factors Act as Molecular Switches to Mediate Opposite Steroid Regulation of the Human Glucocorticoid Receptor 1A Promoter
J. Biol. Chem.,
December 30, 2005;
280(52):
43264 - 43271.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. P. Chrousos and T. Kino
Intracellular Glucocorticoid Signaling: A Formerly Simple System Turns Stochastic
Sci. Signal.,
October 4, 2005;
2005(304):
pe48 - pe48.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D Turner and C. P Muller
Structure of the glucocorticoid receptor (NR3C1) gene 5' untranslated region: identification, and tissue distribution of multiple new human exon 1
J. Mol. Endocrinol.,
October 1, 2005;
35(2):
283 - 292.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Russcher, E. F. C. van Rossum, F. H. de Jong, A. O. Brinkmann, S. W. J. Lamberts, and J. W. Koper
Increased Expression of the Glucocorticoid Receptor-A Translational Isoform as a Result of the ER22/23EK Polymorphism
Mol. Endocrinol.,
July 1, 2005;
19(7):
1687 - 1696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. S. Nunez, C.-d. Geng, K. B. Pedersen, C. D. Millro-Macklin, and W. V. Vedeckis
Interaction between the Interferon Signaling Pathway and the Human Glucocorticoid Receptor Gene 1A Promoter
Endocrinology,
March 1, 2005;
146(3):
1449 - 1457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. I Freeman, H. L Munn, V. Lyons, A. Dammermann, J. R Seckl, and K. E Chapman
Glucocorticoid down-regulation of rat glucocorticoid receptor does not involve differential promoter regulation
J. Endocrinol.,
November 1, 2004;
183(2):
365 - 374.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Necela and J. A. Cidlowski
Mechanisms of Glucocorticoid Receptor Action in Noninflammatory and Inflammatory Cells
Proceedings of the ATS,
November 1, 2004;
1(3):
239 - 246.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Purton, J. A. Monk, D. R. Liddicoat, K. Kyparissoudis, S. Sakkal, S. J. Richardson, D. I. Godfrey, and T. J. Cole
Expression of the Glucocorticoid Receptor from the 1A Promoter Correlates with T Lymphocyte Sensitivity to Glucocorticoid-Induced Cell Death
J. Immunol.,
September 15, 2004;
173(6):
3816 - 3824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Larj and E. R. Bleecker
Therapeutic Responses in Asthma and COPD: Corticosteroids
Chest,
August 1, 2004;
126(2_suppl_1):
138S - 149S.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-d. Geng and W. V. Vedeckis
Steroid-Responsive Sequences in the Human Glucocorticoid Receptor Gene 1A Promoter
Mol. Endocrinol.,
April 1, 2004;
18(4):
912 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wust, E. F. C. van Rossum, I. S. Federenko, J. W. Koper, R. Kumsta, and D. H. Hellhammer
Common Polymorphisms in the Glucocorticoid Receptor Gene Are Associated with Adrenocortical Responses to Psychosocial Stress
J. Clin. Endocrinol. Metab.,
February 1, 2004;
89(2):
565 - 573.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Stevens, D. W. Ray, E. Zeggini, S. John, H. L. Richards, C. E. M. Griffiths, and R. Donn
Glucocorticoid Sensitivity Is Determined by a Specific Glucocorticoid Receptor Haplotype
J. Clin. Endocrinol. Metab.,
February 1, 2004;
89(2):
892 - 897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Zhang, P. Haws, and Q. Wu
Multiple Variable First Exons: A Mechanism for Cell- and Tissue-Specific Gene Regulation
Genome Res.,
January 1, 2004;
14(1):
79 - 89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Li, J. R. Dedman, and M. A. Kaetzel
Intron Disruption of the Annexin IV Gene Reveals Novel Transcripts
J. Biol. Chem.,
October 31, 2003;
278(44):
43276 - 43283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sathiyaa and M. M. Vijayan
Autoregulation of glucocorticoid receptor by cortisol in rainbow trout hepatocytes
Am J Physiol Cell Physiol,
June 1, 2003;
284(6):
C1508 - C1515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Yudt and J. A. Cidlowski
The Glucocorticoid Receptor: Coding a Diversity of Proteins and Responses through a Single Gene
Mol. Endocrinol.,
August 1, 2002;
16(8):
1719 - 1726.
[Abstract]
[Full Text]
[PDF]
|
 |
|