Molecular Endocrinology 15 (9): 1484-1495
Copyright © 2001 by The Endocrine Society
Regulation of PIT-1 Expression By Ghrelin and GHRP-6 Through the GH Secretagogue Receptor
Angel García,
Clara V. Alvarez,
Roy G. Smith and
Carlos Diéguez
Department of Physiology (A.G., C.V.A., C.D.), Faculty of Medicine,
University of Santiago de Compostela, Spain; and Huffington Center on
Aging and Department of Molecular and Cellular Biology (R.G.S.), Baylor
College of Medicine, Houston, Texas 77030
Address all correspondence and requests for reprints to: Dr. Carlos Diéguez, Department of Physiology, Faculty of Medicine, University of Santiago de Compostela, c/San Francisco s/n, 15704 Santiago de Compostela, Spain.
 |
ABSTRACT
|
|---|
GH secretagogues are an expanding class of synthetic peptide and
nonpeptide molecules that stimulate the pituitary gland to secrete GH
through their own specific receptor, the GH-secretagogue receptor. The
cloning of the receptor for these nonclassical GH releasing molecules,
together with the more recent characterization of an endogenous ligand,
named ghrelin, have unambiguously demonstrated the existence of a
physiological system that regulates GH secretion. Somatotroph
cell-specific expression of the GH gene is dependent on a
pituitary-specific transcription factor (Pit-1). This factor is
transcribed in a highly restricted manner in the anterior pituitary
gland. The present experiments sought to determine whether the
synthetic hexapeptide GHRP-6, a reference GH secretagogue compound, as
well as an endogenous ligand, ghrelin, regulate pit-1
expression. By a combination of Northern and Western blot analysis we
found that GHRP-6 elicits a time- and dose-dependent activation of
pit-1 expression in monolayer cultures of infant rat
anterior pituitary cells. This effect was blocked by pretreatment with
actinomycin D, but not by cycloheximide, suggesting that this action
was due to direct transcriptional activation of pit-1.
Using an established cell line (HEK293-GHS-R) that overexpresses the GH
secretagogue receptor, we showed a marked stimulatory effect of GHRP-6
on the pit-1 -2,500 bp 5'-region driving luciferase
expression. We truncated the responsive region to -231 bp, a sequence
that contains two CREs, and found that both CREs are needed for
GHRP-6-induced transcriptional activation in both HEK293-GHS-R cells
and infant rat anterior pituitary primary cultures. The effect was
dependent on PKC, MAPK kinase, and PKA activation. Increasing Pit-1 by
coexpression of pCMV-pit-1 potentiated the GHRP-6 effect
on the pit-1 promoter. Similarly, we showed that the
endogenous GH secretagogue receptor ligand ghrelin exerts a similar
effect on the pit-1 promoter. These data provide the
first evidence that ghrelin, in addition to its previously reported
GH-releasing activities, is also capable of regulating
pit-1 transcription through the GH secretagogue receptor
in the pituitary, thus giving new insights into the physiological role
of the GH secretagogue receptor on somatotroph cell differentiation and
function.
 |
INTRODUCTION
|
|---|
GH SECRETAGOGUES (GHS) are synthetic
compounds developed to release GH in vitro (1).
These compounds were predicted to mimic the effect of an endogenous
factor that would activate a specific receptor in the pituitary and the
hypothalamus (2, 3, 4). The cloning of the receptor for these
nonclassical GH releasing compounds, together with the more recent
characterization of endogenous ligands, ghrelin and des-Gln14-ghrelin
(5, 6), have unambiguously demonstrated the existence of a
physiological system that regulates GH secretion along with GHRH and
somatostatin. Ghrelin and/or GHS administered alone or in combination
with GHRH are potent and highly reproducible GH releasers in rats
(7) and humans (8, 9) and are useful tools
for the diagnosis of GH deficiency when tested in a variety of
pathological conditions, both in children and in adults (10, 11). As therapeutic agents, they show clinical effectiveness in
enhancing GH release. At present, they are being evaluated in long-term
controlled clinical studies to assess their potential benefits in a
variety of disease states such as idiopathic GH deficiency, catabolic
states, obesity, osteoporosis, and heart failure (12).
Furthermore, recent evidence indicates that by acting at a central
level, ghrelin may play an important role in body weight homeostasis
(13, 14).
The expression of the GH gene is restricted to somatotrophs and
somatomammotrophs in the pituitary gland and is under complex
transcriptional control. Pituitary-specific expression of the GH gene
is dependent on a pituitary-specific transcription factor, GH factor-1,
a homeodomain protein also known as pituitary-specific transcription
factor-1 (Pit-1) (15, 16). This factor is transcribed in a
highly restricted manner in the anterior pituitary (AP) gland.
Pit-1 transcription is controlled by at least three
primary signals: a cAMP-activated transcription factor, CREB
(15, 16, 17), autoregulation by its own gene product
(17, 18), and developmentally scheduled
transcriptional activation by one or more other pituitary-specific
transcription factors (19).
Data obtained using primary cultures of adult rat AP cells have shown
that GHRH plays a stimulatory role on pit-1 mRNA levels
while IGF-I exerts an inhibitory effect (20). Somewhat
surprisingly it was found that GHRP-6, a reference GHS compound, was
shown to be devoid of any effect on pit-1 mRNA levels in
this experimental model. In addition to its effects on the rate of GH
gene transcription, Pit-1 also appears to be involved in somatotroph
cell proliferation. Because the effect of GHRP-6 on GH secretion is
more prominent in infant rats than in adult rats, we assessed the
effect of GHRP-6 on pit-1 expression in a monolayer culture
of infant rat AP cells. Furthermore, we also characterized the effects
of GHRP-6 on the pit-1 promoter using a stable cell line
that overexpresses the GH secretagogue receptor (GHS-R). Finally,
during these experiments the isolation and characterization of an
endogenous ligand for the GHS-R, called ghrelin, was described
(5); therefore, we also evaluated the effects of ghrelin
on the pit-1 promoter.
 |
RESULTS
|
|---|
GHRP-6 Increases Pit-1 Expression in Pituitary Cells
Derived from Infant Rats
We have previously shown the lack of an effect of GHRP-6 on
pit-1 gene expression in cells cultured from adult male rat
pituitary glands (20). We hypothesized that cells cultured
from infant rat pituitaries would be more responsive. To test this
notion, we examined the effect of 10-6
M GHRP-6 on Pit-1 protein levels in
adenohypophyseal primary cultures of 2-wk-old male rats. We performed
immunoprecipitation-Western analysis because Pit-1 levels were too low
for detection by direct Western blots (data not shown). A marked
increase in Pit-1 protein expression was observed after 1 h of
GHRP-6 treatment, which was maintained for up to 12 h (Fig. 1A
). As controls, we performed anti-GH
and anti-PRL Western blots with the same lysates and found no
significant differences. Because GHRH increases pit-1
expression, we decided to test whether pit-1 was also
regulated by GHRP-6. Figure 1B
shows the effect of a maximal dose of
GHRP-6 on pit-1 mRNA levels. There is a marked increase in
pit-1 expression 12 h after the addition of GHRP-6. The
increase in pit-1 is dose dependent and
10-10 M GHRP-6 (Fig. 1C
),
a GHRP-6 dose that fails to stimulate GH secretion
(21, 22, 23), also has no effect on pit-1
expression. We detected a significant increase in GH secretion in our
cultures after 4 h of treatment with 10-6
M GHRP-6, without any effect on PRL secretion
(Fig. 2
). The stimulatory effect of
GHRP-6 on pit-1 appears to be mediated through the GHS-R
because the effect is antagonized by
(D-Lys3)-GHRP-6
(21) (Fig. 1D
).

View larger version (66K):
[in this window]
[in a new window]
|
Figure 1. GHRP-6 Increases Pit-1 Expression through a
Specific Receptor in Cultures of AP Cells from Infant Rats
A, Immunoprecipitation-Western blot showing the GHRP-6 induction on the
levels of Pit-1 starting after 1 h and lasting at least 12 h.
Linear exposed autoradiographs from six different replicate experiments
were quantified by densitometry and mean ± SEM are
shown in the bar graphs, * P <
0.05. As control, 25 µg of total lysates were run on SDS-PAGE and
treated with anti-GH and anti-PRL. There were no differences between
lanes. B, Northern blot showing a transient increase in
pit-1 mRNA expression after 0.5 h treatment with
10-6 M GHRP-6. The levels increased between 1
to 2 h of treatment, and basal levels were restored after 4
h. Pit-1-enhanced expression was correlated with an
increase in GH and PRL mRNA expression.
18S rRNA is shown as a loading control. Quantitation was done as in
panel A. *, P < 0.05; **, P <
0.01. C, Dose-response effect of GHRP-6 on pit-1,
GH, and PRL mRNA expression. Cell dishes
were treated during 90 min with vehicle or different doses of GHRP-6.
Quantitation was done as in panel A. *, P < 0.05;
**, P < 0.01. D, The effect of GHRP-6 is specific
since can be blocked by increasing amounts of the
D-Lys3-GHRP-6 GHS-R antagonist. All treatments
were maintained during 90 min with vehicle, GHRP-6, or different doses
of the antagonist. Quantitation was done as in panel A. *,
P < 0.05; **, P < 0.01.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 2. GHRP-6 (10-6 M) Releases
GH but not PRL after 4 h Treatment in the Media of Infant Rat AP
Cultures
Mean ± SEM of three independent experiments are
shown. In each experiment any treatment was made by six replicates. **,
P < 0.01.
|
|
We tested the possibility that GHRP-6 mediated its activity at
the transcriptional level. Pretreatment of the cells with cycloheximide
not only increases the basal levels of pit-1 mRNA but
potentiates the GHRP-6 effect (Fig. 3
).
After pretreatment of the cells with actinomycin D (Fig. 3
), GHRP-6 is
unable to induce pit-1 expression. Collectively, these
results argue that induction of a protein intermediate is not needed
for GHRP-6-mediated increases in pit-1 transcription. In
contrast to the results with pit-1, cycloheximide suppresses
the effect of GHRP-6 on GH and PRL expression
(Fig. 3
). Actinomycin D prevents GHRP-6 induced increases in
GH and PRL expression. These results are
consistent with GHRP-6 induction of Pit-1 being at least
partially required for increasing GH and PRL
expression.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 3. GHRP-6 Effect on pit-1 Expression Is
a Direct Transcriptional Effect in AP Cultures of Infant Rats
Pretreatment (90 min) with 23 µg/ml cycloheximide (CHX) potentiates,
while 5 µg/ml actinomycin-D (AcD) suppresses. GHRP-6
(10-6 M) was added after CHX or AcD for an
additional 90 min.
|
|
Identification of 5'-Flanking Regions Necessary for GHRP-6
Induction of Pit-1 Expression
Pit-1 activates and maintains the transcription of GH,
PRL, and ß-TSH genes (24, 25). In our
studies we saw an increase in the GH and PRL gene
expression after GHRP-6 treatment. This might be mediated by
transcriptional activation of pit-1, although there was a
consistent difference in the maximal effective doses for
pit-1 (10-6 M)
vs. GH or PRL
(10-8 M) (see Fig. 1C
). To further study the activity of GHRP-6 on the pit-1
promoter we exploited a HEK-293 cell line that stably expresses the
GHS-R (HEK293-GHS-R). This cell line was transfected with a
-2,500-bp fragment from the pit-1 promoter cloned
upstream of the luciferase reporter gene. There was a dose-response
(Fig. 4A
) and time-dependent (Fig. 4B
)
effect of GHRP-6 on luciferase activity.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 4. GHRP-6 Activates the pit-1 Promoter
in the HEK293-GHS-R Cell Line
A, Dose-response effect of 24 h treatment with GHRP-6 on
-2500pit1-luc. B, The induction of the promoter is
accumulated over time after treatment with 10-6
M GHRP-6. Data are mean ± SEM of six
independent experiments, each done in triplicate. *,
P < 0.05; **, P < 0.01.
|
|
The 5'-flanking region of pit-1 contains multiple consensus
sequences for known transcription factors (Fig. 5A
) (15, 16, 17, 26, 27, 28). We
made progressive deletions of the 5'-region and studied the response to
GHRP-6 in the HEK293-GHS-R. There were no significant differences
between -2500pit1-luc,-959pit1-luc,
-458pit1-luc, -378pit1-luc, and
-231pit1-luc, but the response was lost when the
-194pit1-luc and -92pit1-luc were tested (Fig. 5B
). These results implicate CRE elements in GHRP-6 mediated activation
of the pit-1 promoter. There are two CRE elements, proximal
(-157/-150) and distal (-200/-193), and we investigated whether
both were needed for activation by GHRP-6. When -231
mutP-CREpit1-luc is used, where four bases of the proximal CRE are
mutated, the response to GHRP-6 is completely abolished (Fig. 5C
).
Similarly, using -231 mutD-CREpit1-luc, where four bases of
the distal CRE are mutated, the response to GHRP-6 is also blocked
(Fig. 5C
). These data clearly demonstrate the importance of the
proximal and distal CREs for mediating the action of GHRP-6 action on
the pit-1 promoter. To investigate the potential
significance of another important 5'-flanking region, the Pit-1 binding
site, we cotransfected a Pit1 expression vector (pCMV-pit1)
with p-231pit1-luc into the HEK293-GHS-R cells. In these
transfected cells, pit-1 expression in response to GHRP-6 is
potentiated by 40% (Fig. 5D
).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 5. Two CRE Elements in the 5'-Region of the
pit-1 Gene Are Responsible for the Induction After
Treatment with GHRP-6
A, Consensus sequences found in the known pit-1
5'-region. AP-1, Response element for dimers of the activating
protein-1 family (Jun, Fos); GRE, putative glucocorticoid response
element; CRE, cAMP response element consensus; Pit-1,
pit-1 autoregulatory element. B, Progressive deletions
of the 5'-region of pit-1 were cotransfected with
ß-gal in HEK293-GHS-R and incubated with vehicle or 10-6
M GHRP-6. To simplify the graphs, the controls transfected
with each construct but treated with vehicle are all represented in a
single 100% bar. C, Mutation of either the distal CRE (-231
mutD-CRE pit1-luc) maintaining the proximal CRE, or the
proximal CRE (-231 mutP-CRE pit1-luc) maintaining the
distal one abolishes the GHRP-6 and forskolin effect in HEK293-GHS-R.
D, Coexpression of pit-1 (50 ng of
pCMV-pit1) potentiates the GHRP-6 effect on the
pit-1 promoter. E, Similar results as in panels B and C
were obtained in infant rats AP cultures but not in adult rats.
Progressive deletions of the 5'-region of pit-1 as
well as CRE mutation constructs were cotransfected with ß-gal in
cultures of AP cells from infant or adult rats and incubated with
vehicle, 10-6 M GHRP-6 or 10-5
M forskolin. The vehicle controls are all represented in a
single 100% bar.
|
|
The experiments conducted with the HEK293-GHS-R cells were
repeated in a more physiologically relevant setting by using primary
cultures of AP cells. These AP cell cultures constitute a mixed
population of pituitary cells, and of course we have no control over
which cells express the transfected DNA. However, when double
immunofluorescence is used to localize GHS-R ligand binding and to
localize GH in the cultured AP cells, the results show that GHS-R
ligand binding occurs exclusively in GH containing cells
(2). Therefore, GHS-R-mediated GHRP-6 activation of
pit1-luc can only occur in somatotrophs or
somatomammotrophs. In young rat AP cells transfected with
p-231pit1-luc, GHRP-6 activates the pit1
promoter, and this induction is abolished if either of the CRE elements
are mutated (Fig. 5E
). When adult rat pituitary-cultures are
transfected, GHRP-6 is unable to stimulate the pit-1
promoter in spite of the positive response with the control additive,
forskolin (Fig. 5E
).
Mechanism of Activation of pit-1 by GHRP-6
The G protein-coupled GHS-R transduces a signal leading to GH
secretion through Ca2+/PKC (29, 30, 31).
By contrast, our data indicate an effect on the pit-1
promoter that is mediated by a sequence initially described as a
binding motif for the CREB transcription factor, which is dependent on
cAMP and PKA for activation (32). However, later reports
describe binding of activating protein-1 (AP-1) transcription
factors to CREs (33, 34, 35) and that phosphorylation and
activation of CREB is mediated not only through PKA, but also through
calmodulin kinase, ERK, and p38 activation (reviewed in Ref.
36).
To clarify the signal transduction pathway leading to activation of the
pit-1 promoter by GHRP-6, we investigated the effects of
different protein kinase inhibitors in cells transfected with both the
long 5'-region, -2500pit1-luc, or the minimal responsive
region -231pit1-luc. As shown in Fig. 6
, A and C, the PKC inhibitor GF109203X
completely blocks the response to GHRP-6 without affecting forskolin
induction of the pit-1 promoter in the HEK293-GHS-R cells.
As control, we tested the specificity of the PKC inhibitor using
12-O-tetradecanoylphorbol 13-acetate (TPA) on the longer construct,
because in contrast to -231pit1-luc, TPA activates
-2500pit-1. Indeed, Fig. 6A
shows that the response to TPA
is blocked by GF109203X. The PKC inhibitor also abolishes the effect of
GHRP-6 on the expression of pit-1 in primary pituitary cell
cultures (Fig. 6B
). To determine whether the stimulatory effects of
GHRP-6 on -231pit-1 required an active adenylate
cyclase-PKA pathway, we tested whether H89, a known blocker of PKA,
would affect activation of -231pit-1. In the presence of
H89, both forskolin and GHRP-6 fail to stimulate -231pit-1;
hence, PKA activity is required for the GHRP-6 response (Fig. 6C
). The
MAPK pathway may also be involved in activation of CREB by forskolin
(37, 38). Therefore, we tested the effect of the MAPK
kinase (MEK) inhibitor PD98059 on -231pit1-luc (Fig. 6C
).
PD98059 reduces basal activity and inhibits GHRP-6 activation. The PI3K
inhibitor, LY294002, in spite of significantly reducing the basal
levels of transcription, has no effect on GHRP-6 stimulation of the
pit-1 promoter.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6. The Stimulatory Effect of GHRP-6 on the
pit-1 Promoter Depends on PKC and MEK but Can Be
Inhibited by Treatment with a PKA Inhibitor
A, -2500pit1-luc was transfected in HEK293-GHS-R, and
cells were treated with vehicle (-), 10-6 M
GHRP-6 (P), 10-6 M TPA (T), or
10-5 M forskolin (F) in the absence or
presence of a PKC inhibitor, 10-6 M GF-109203X
(GF). B, Northern blot showing the blockade of 10-6
M GHRP-6-induced pit-1 expression in the
presence of 10-6 M GF-109203X (GF) in cultures
of AP cells from infant rats. GHRP-6 was added for 90 min after a
pretreatment with GF-109203X for an additional 90 min. C,
-231pit1-luc was transfected in HEK293-GHS-R and cells
were treated with saline, 10-6 M GHRP-6 (P),
10-5 M Forskolin (F) in the absence or
presence of a PKC inhibitor, 10-6 M GF-109203X
(GF), a PKA inhibitor, 10-5 M H89 (H), a MEK
inhibitor, 5 x 10-5 M PD98059 (PD), or a
PI3K inhibitor, 10-5 M LY294002 (LY) .**,
P < 0.01 GHRP-6 or FK treatment vs.
either vehicle or inhibitor control; *, P < 0.05
differences between vehicle and inhibitor basal levels.
|
|
Isolation of the first endogenous ligand, ghrelin, for the GHS-R was
described while our experiments were in progress (5). We
therefore wished to determine whether ghrelin had the same stimulatory
effects on pit-1 expression as that of the synthetic ligand
GHRP-6. It is evident from a comparison of Fig. 7A
with Fig. 4A
, that ghrelin and GHRP-6
have equivalent activity on -2500pit1-luc. Ghrelin and
GHRP-6 also have similar activity on -231pit-luc (Fig. 7B
).
In addition, mutation of any of the CRE elements or deletion of the
distal CRE abolished the stimulatory effect of ghrelin (Fig. 7C
).

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7. The Endogenous Ligand Ghrelin and GHRP-6 Have a
Similar Dose-Response on Activation of the pit-1
Promoter
A, -2500pit1-luc was transfected in HEK-293 GHS-R and
cells treated with increasing concentrations of ghrelin during 24
h. This figure should be compared with Fig. 4A . B,
-231pit1-luc was transfected into HEK293-GHS-R cells
and treated with increasing concentrations of ghrelin or GHRP-6 for
24 h. C, Effect of ghrelin on the pit-1 promoter is
exerted in the same CRE region as GHRP-6, because deletion and mutation
of either the distal or proximal CRE elements on the promoter abolishes
the stimulatory effect of ghrelin. This figure should be compared with
Fig. 5C .
|
|
 |
DISCUSSION
|
|---|
The only known significant in vitro biological effect
of GHRP-6 on the pituitary gland described to date is the immediate
release of GH and in some cases release of small amounts of PRL
(reviewed in Refs. 2, 6 and 7). We now
demonstrate that GHRP-6 increases the cellular amount of the Pit-1
transcription factor in infant-rat primary anterior pituitary (AP) cell
cultures in a dose- and time-dependent fashion. The increase can be
blocked by actinomycin D, but not by cycloheximide, which is consistent
with a direct effect at the transcriptional level. The biological
relevance is illustrated by experiments showing that the
GHRP-6-induced increase in pit-1 mRNA in AP cells is
associated with increasing amounts of Pit-1 protein. The results with
the GHS-R antagonist,
D-Lys3-GHRP-6, leads us to
conclude the effect to be GHS-R mediated based on inhibition of the
GHRP-6-induced increase in pit-1 mRNA. This result is particularly
relevant because it has been suggested that the synthetic GHS could be
acting on more than one receptor on the pituitary gland
(39). A similar dose- and time-dependent increase of
luciferase activity was established when GHRP-6 was evaluated after
transfection of -2500pit-1-luc into HEK293-GHS-R.
We investigated which elements in the 5'-region of the rat
pit-1 are involved in GHRP-6 induction. The GHS-R
signal transduction has been characterized as involving the
phospholipase C/IP3/diacylglycerol (DAG)/PKC
pathway (29, 30, 31). As a result of sequential promoter
deletion, we found that AP-1 response elements between -932 and
-875 were not needed for pit-1 transcriptional induction by
GHRP-6. The main 5'-flanking region needed for GHRP-6 activation was
located around -200, which includes two CREs (26, 27, 28).
Deleting the distal CRE suppressed GHRP-6 activation, suggesting that
the important element was located between -200 and -193. Furthermore,
we could abolish the response by mutating the distal CRE. However, when
we mutated the proximal CRE but maintained the distal CRE, the response
was also suppressed. The known data on the pit-1 5'-region
stressed the importance of another element, the Pit-1 binding site.
Indeed, when we expressed Pit-1 in HEK293-GHS-R cells, the GHRP-6
stimulation was potentiated. This demonstrated that both elements
cooperate in the promoter activity.
The physiological relevance of the results obtained in the HEK-293
cells was confirmed by repeating the studies after transfection of the
pit1-luc constructs into AP primary cultures. In AP cells
from infant rats, GHRP-6 produced significant activation of luciferase
activity, which was suppressed by mutation or deletion of either, or
both, CREs. Curiously, GHRP-6 did not activate the pit-1
promoter in pituitary cells derived from adult rats (20).
However, this age-dependence is not unique, because there are other
examples in physiology of age-dependent differential regulation, such
as the up-regulation of ß-adrenergic receptors in adult rats after
denervation, which is absent in infant rats (40). The
pituitaries of neonatal rats are also more responsive to GHRP-6
stimulation of GH release than those of adult rats (23),
which might be explained by differences in receptor levels or by
activation of different signal transduction pathways. For example, the
concentration of GHRP-6 needed for inducing pit-1 in the AP
cells is about 100-fold higher than in the HEK293-GHS-R cells. In the
AP, the GHS-R concentration is approximately 100-fold lower than in the
HEK293-GHS-R cells. In addition to differences in GHS-R concentrations,
a developmentally regulated alteration in components of the GHS-R
signal transduction pathway is an equally viable possibility for
explaining the age-related differential response. For example,
expression of different adenylate-cyclase isoforms and different
activities of protein kinases have been described in the young
vs. adult rat (41, 42).
The CRE is known to bind dimeric phosphorylated CREB transcription
factors as well as heterodimers from the AP-1 family of transcription
factors (33, 34, 35, 36). Although CREB was initially associated
with cAMP-PKA signal transduction pathways, other pathways, such as CaM
kinase, Ras-ERK, and p38, can also phosphorylate and activate CREB
(reviewed in Ref. 43). AP-1 members are activated by a
broad range of signal transduction pathways including PKC, Janus
kinase-signal transducer and activator of transcription, ternary
complex factor, and MAPKs (34). We show that
pit-1 activation is dependent on PKC both in the
HEK293-GHS-R cell line and in pituitary cells, which is consistent with
activation of the Gq PLC/DAG/PKC pathway described previously
(29, 30, 31). PKC has been shown to activate ERK resulting in
CREB phosphorylation (Refs. 37 and 44 ;
reviewed in Ref. 43). Consistent with GHRP-6 activating
pit-1 through this pathway, the effect of GHRP-6 is
suppressed by the MAPK pathway inhibitor PD98059. However, blocking PKA
also suppresses the GHRP-6 effect. Two possible explanations are that
activation of PKA through PKC-stimulated ERK leads to CREB
phosphorylation and CRE activation, or that independent activation of
CREB occurs through PKA together with PKC induction of AP-1
transcription factors. Either or both pathways could act on the two CRE
regions. PKA activation by Gq/DAG/PKC/Ca2+
implies a specific adenylate cyclase subtype stimulated by PKC or CamK
IV (45). However, no cAMP increase has been observed after
GHRP-6 treatment, at least not in a short-term study (22, 30, 31, 46). Alternatively, basal cAMP production, which would be
inhibited by H89, might play an important permissive role for GHRP-6
and ghrelin stimulation of pit-1 expression via the CRE.
Extensive work will be needed to elucidate the intracellular protein
cascades leading to activation of the pit-1 promoter.
In summary, we show that GHRP-6 and ghrelin induce activation of
pit-1 in AP cells from infant rats. This effect is exerted
directly on the pit-1 promoter and appears to be
developmentally regulated, because it cannot be demonstrated in
pituitary cells isolated from adult rats. Furthermore, the
demonstration that the endogenous peptide, ghrelin, exerts a similar
effect to GHRP-6 on the pit-1 promoter through the same CREs
reinforces the physiological relevance of our results. Finally, these
data provide the first evidence that ghrelin, in addition to its
previous reported GH-releasing activities and inducer of hypothalamic
gene expression (47, 48), also interacts with the GHS-R
and activates gene transcription through the pit-1 promoter
without requiring new protein synthesis. We have demonstrated a
physiological effect of the ghrelin-GHS-R system in the regulation of
somatotroph cell function, namely, activation of pit-1
expression. This observation provides a new insight into the molecular
role of the GHS-R that has potential relevance to developmental
biology.
 |
MATERIALS AND METHODS
|
|---|
All culture media and restriction enzymes were obtained from
Life Technologies, Inc. (Gaithersburg, MD). Tissue culture
plasticware was from Nunc. GHRP-6 and ghrelin were obtained from
Peninsula Laboratories, Inc. (Belmont, CA).
(D-Lys3)-GHRP-6 was from
Bachem (Torrance, CA). H89 and PD98059 were purchased from
Calbiochem (La Jolla, CA). Cycloheximide, actinomycin D,
GF109203X, LY294002, and all other reagents were obtained from
Sigma (St. Louis, MO), unless otherwise specified. Random
primed DNA labeling kit was from New England Biolabs, Inc.
(Beverly, MA). Fugene was obtained from Roche Molecular Biochemicals (Indianapolis, IN) G418, Hybond-N+ nylon membranes,
125I,
32P-dCTP, and
32P-dATP were from Amersham Pharmacia Biotech (Arlington Heights, IL).
Culture Medium
Defined medium (serum-free) consisted of
Hams F12/DMEM/BGjb medium in a ratio of 6:3:1 (vol/vol/vol)
supplemented with: (per liter) BSA (2 g), HEPES (2.38 g),
hydrocortisone (143 µg), T3 (0.4 µg),
transferrin (10 mg), glucagon (10 ng), epidermal growth factor (0.1
µg), and fibroblast growth factor (0.2 µg). Just before culturing
the cells, the following were added: 2 mM glutamine, 100
IU/ml penicillin, 100 µg/ml streptomycin, 2.5 µg/ml amphotericin-B
plus 2.5% FCS. The HEK293-GHS-R cell line was cultured in high-glucose
DMEM plus 10% FCS, glutamine, and penicillin-streptomycin solution
plus 500 µg/ml G-418.
Cell Culture
Rat anterior pituitary cells were cultured as previously
described (49). Two-week-old (3050 g) or adult (250 g)
male Sprague Dawley rats were decapitated. The AP glands were removed,
minced, and enzymatically dispersed using a solution of 0.4% (wt/vol)
type IA collagenase, 0.2% (wt/vol) dispase, 0.1% (wt/vol)
hyaluronidase, 0.01% (wt/vol) DNase I, and 10% (vol/vol) FCS in
Earles balanced salt solution (EBSS). The digest was placed in an
incubator at 37 C for 1 h and mechanically dispersed at 15-min
intervals. The dispersed cell suspension was centrifuged, and the
pellet was washed with EBSS and finally resuspended in defined medium
containing 2.5% FCS and antibiotics. Cells were plated and incubated
at 37 C in a humidified atmosphere of 95% air-5%
CO2 for a period of 4 d.
RIAs
GH and PRL levels were measured in the culture medium with a RIA
using the NIDDK standards (49).
Immunoprecipitation and Western Blot Analysis
We used eight pituitaries per 60-mm dish. The day of the
experiment all dishes were washed three times with EBSS, and serum-free
defined medium was added. The cultures were treated progressively at
the appropriate times, and 24 h later cells from all the dishes
were harvested simultaneously. The dishes were washed three times in
cold PBS, and cells were scraped in 100 µl of hot 1% SDS and boiled
for 5 min at 95 C. After addition of 900 µl lysis buffer (50
mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol,
1% Triton X-100, 5 mM EGTA, 1.5 mM
MgCl2, 20 mM sodium pyrophosphate, 10
mM NaVO4, 4 mM PMSF, 50
µg/ml aprotinin), lysates were sonicated briefly and microfuged for 5
min at 14,000 x g at 4 C. Five hundred micrograms of
total protein were immunoprecipitated overnight at 4 C with monoclonal
anti-Pit-1 (Affinity Research, Mamhead, Exeter, UK). Thirty
microliters of Gammabind (Amersham Pharmacia Biotech) were
pipetted and end-to-end incubated during another 45 min. The beads were
washed with HNTG buffer (20 mM HEPES, pH 7.5, 150
mM NaCl, 10% glycerol, 0.1% Triton X-100) and
resuspended in 50 µl of protein sample buffer. Samples were resolved
on by 12% SDS-PAGE and electrotransferred onto a nitrocellulose
membrane (Schleicher & Schuell, Inc., Keene, NH).
Immunodetection was carried out as previously described
(50) with a chemiluminescent system (Tropix, Inc.,
Bedford, MA) using a polyclonal anti-Pit-1 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at a dilution of 1:1000.
For GH and PRL, 25 µg of total cell lysates were loaded by 15%
SDS-PAGE and transferred as before. Rabbit anti-GH and anti-PRL (NIDDK)
were used at 1:5,000 dilution.
Northern Blot Analysis
Culture and treatment of the AP cultures were as in the Western
blot except that 10 pituitaries per 60-mm dish were used. The protocol
was previously described by Carneiro et al.
(50). Briefly, 10 µg of total RNA (51) were
run on a 1.5% formaldehyde agarose gel, stained with ethidium bromide,
and transferred to a nylon membrane. Pit-1
(20), GH (52), and PRL
(53) cDNA probes were labeled with
a32P-dCTP. An oligonucleotide for the 18S RNA
(ACGGTATCTGATCGTCTTCGAACC) labeled with
32P-dATP was used as an internal control to
ensure equal loading among lanes.
Transfections
HEK293-GHS-R is a cell line that stably expresses the human
GHS-R [35S-MK0677 binding:
Bmax = 500 fmol/mg, dissociation constant
(Kd ) = 0.5 nM
(3)]. Forty thousand cells per well were seeded in
24-well dishes and allowed to attach overnight. Transfections were
carried out in complete medium during 4 h using 3 µl/well of
Fugene and 1 µg/well of total DNA, 0.7 µg of the different
pit-1 promoter-luc constructs, and 0.3 µg rous sarcoma
virus-ß-galactosidase (pRSV-ß-gal). After washing with EBSS, DMEM +
0.1% BSA was added along with treatment for 24 h unless otherwise
stated in the figure legends. Cells were lysed in 100
mM potassium phosphate, pH 7.8, 1
mM dithiothreitol by three freeze-thaw cycles.
Luciferase activity was measured using a Nichols luminometer and
ß-galactosidase activity was measured at
420
nm using o-nitrophenyl-ß-D-galactopyranoside
as substrate. For transfection of primary cultures, pituitaries
were dispersed slightly differently than described above using
collagenase type IV instead of type IA (54); 250,000 cells
were allowed to attached overnight in defined medium plus 10% FCS.
Transfections were carried out in serum-free medium during 4 h
using 3 µl/well of Fugene and 1 µg/well of total DNA, 0.5 µg of
the different pit-1 promoter-luc constructs plus 0.5 µg
pRSV-ß-gal; 1% FCS was added for the next 2 h.
Finally, the dishes were washed and various treatments were applied in
serum-free defined medium.
Plasmids
-2500Pit1-luc was obtained by cloning the 5'-region of the
pit-1 gene (55) on the NheI site of
the pGL3 basic vector (Promega Corp., Madison, WI). The
AccI/SmaI fragment was cloned on the same vector
to obtain the -959pit1-luc, and sequentially,
PvuII/SacI fragment originated
-458pit1-luc, NsiI/SacI fragment gave
-378pit1-luc, PleI/SmaI gave
-231pit1-luc, AatII/SacI fragment gave
-194Pit1-luc, and the HpaI/SmaI
fragment gave -92pit1-luc. To obtain both CRE mutations, we
used overlapping PCR using specific oligos. For -231
mutD-CRE-pit1-luc, upper fragment A:
5'-GTACCGAGCTCTTACGCGTGCTAGCC-3' and B:
5'-GAAACTTTATTTGGGCTCAGTAAGTGGG-3' giving a 74-pb product; lower
fragment C: 5'-CCCACTTACTGAGCCCAAATAAAGTTTC-3' and D:
5'-CCGGAATGCCAAGCTTACTTAGATCG-3' giving a 250-bp product. For
-231 mutP-CRE-pit1-luc, upper fragment A:
5'-GTACCGAGCTCTTACGCGTGCTAGCC-3' and B:
5'-AACCTGGTTGTGGGCTATGAAGTGAGGA-3' giving a 209-pb product;
lower fragment C: 5'-TCCTCACTTCATAGCCCACAACCAGGTT-3' and D:
5'-CCGGAATGCCAAGCTTACTTAGATCG-3' giving a 118-bp product. The AB and CD
products for each construct were combined and PCR-mix was added for 2
cycles (94 C, 30 sec; 37 C, 60 sec; 72 C, 5 min), followed by the
addition of A and D primers and another 20 cycles (94 C, 45 sec; 48 C,
45 sec; 72 C, 1 min). Nhe/HindIII fragments were cloned in
pGL3basic. The new constructs were sequenced using an ALF-express
(Amersham Pharmacia Biotech).
Statistical Analysis
Data are expressed as mean ± SEM. All the
experiments were repeated at least three times in different weeks. For
the transfections, each of the repeated experiments was done at least
in triplicate per treatment. Transfection data are expressed as
percentages over the basal transfected construct without
treatment. Statistical analysis was carried out with the
Mann-Whitney U test and the one-way ANOVA test. Significance
is represented as follows: *, P < 0.05, **
P < 0.01.
 |
ACKNOWLEDGMENTS
|
|---|
We thank C. Caelles for very kindly providing the -2,500 region
of Pit-1 promoter and the Pit1 expression vector, and L. Loidi for the
sequencing facilities in her laboratory. Also thanks to M. Dosil and B.
Faílde for technical support. We acknowledge Dr. Parlow from
the NIDDK for the RIA reactives.
 |
FOOTNOTES
|
|---|
This work was supported by Fondo de Investigación Sanitaria,
Spanish Ministry of Health (C.D., C.V.A.), and Xunta de Galicia (C.D.)
grants.
Abbreviations: AP, Anterior pituitary; AP-1, activating
protein-1 (family of transcription factors composed of Jun, Fos); CRE,
cAMP response element; CREB, CRE binding protein; DAG, diacylglycerol;
EBSS, Earles balanced salt solution; ß-Gal, ß-galactosidase; GHS,
GH secretagogue; GHS-R, GHS receptor; MEK, MAPK kinase; Pit-1,
pituitary-specific transcription factor; TPA, 12-O-tetradecanoylphorbol
13-acetate.
Received for publication July 25, 2000.
Accepted for publication May 25, 2001.
 |
REFERENCES
|
|---|
-
Bowers CY, Momany F, Reynolds GA, Hong A 1984 On the
in vitro and in vivo activity of a new synthetic
hexapeptide that acts on the pituitary to specifically release growth
hormone. Endocrinology 114:15371545[Abstract/Free Full Text]
-
Smith RG, Van der Ploeg LHT, Howard AD, et al. 1997 Peptidomimetic regulation of growth hormone secretion. Endocr Rev 18:621645[Abstract/Free Full Text]
-
Feighner SD, Howard AD, Prendergast K, et al. 1998 Structural
requirements for the activation of the human growth hormone
secretagogue receptor by peptide and nonpeptide secretagogues. Mol
Endocrinol 12:137145[Abstract/Free Full Text]
-
Howard AD, Feighner SD, Cully DF, et al. 1996 A receptor in
pituitary and hypothalamus that functions in growth hormone release.
Science 273:974977[Abstract]
-
Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from
stomach. Nature 402:656660[CrossRef][Medline]
-
Hosoda H, Kojima M, Matsuo H, Kangawa K 2000 Purification and
characterization of rat des-Gln14-Ghrelin, a second endogenous ligand
for the growth hormone secretagogue receptor. J Biol Chem 275:219952000[Abstract/Free Full Text]
-
Seoane LM, Tovar S, Baldelli R, et al. 2000 Ghrelin elicits a
marked stimulatory effect on GH secretion in freely-moving rats. Eur J
Endocrinol 143:R007R009
-
Takaya K, Ariyasu H, Kanamoto N, et al. 2000 Ghrelin strongly
stimulates growth hormone release in humans. J Clin Endocrinol
Metab 85:49084911[Abstract/Free Full Text]
-
Peino R, Baldelli R, Rodriguez-Garcia J, et al. 2000 Ghrelin-induced growth hormone secretion in humans. Eur J
Endocrinol 143:R011R014
-
Casanueva FF, Diéguez C 1999 Growth hormone
secretagogues: physiological role and clinical utility. Trends
Endocrinol Metab 10:3038[CrossRef][Medline]
-
Ghigo E, Arvat E, Muccioli G, Camanni F 1997 Growth
hormone-releasing peptides. Eur J Endocrinol 136:445460[Abstract/Free Full Text]
-
Shimon I, Melmed S 1999 Potential applications of growth
hormone secretagogues. In: Ghigo E, Boghen M, Casanueva FF,
Diéguez C, eds. Growth hormone secretagogues. Basic findings and
clinical implications. Amsterdam: Elsevier Science; 315370
-
Tschop M, Smiley DL, Heiman ML 2000 Ghrelin induces adiposity
in rodents. Nature 407:908913[CrossRef][Medline]
-
Wren AM, Small CJ, Ward HL, et al. 2000 The novel hypothalamic
peptide ghrelin stimulates food intake and growth hormone secretion.
Endocrinology 141:43254328[Abstract/Free Full Text]
-
Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M,
Karin M 1988 The pituitary-specific transcription factor GHF-1 is a
homeobox-containing protein. Cell 55:505518[CrossRef][Medline]
-
Ingraham HA, Chen R, Mangalam HJ, et al. 1988 A
tissue-specific transcription factor containing a homeodomain specifies
a pituitary phenotype. Cell 55:519529[CrossRef][Medline]
-
McCormick A, Brady H, Theill LE, Karin M 1990 Regulation of
the pituitary-specific homeobox gene GHF1 by cell-autonomous and
environmental cues. Nature 345:829832[CrossRef][Medline]
-
Chen C, Ingraham HA, Treacy MN, Albert VR, Wilson L, Rosenfeld
MG 1990 Autoregulation of Pit-1 gene expression mediated by two
cis-active promoter elements. Nature 346:583586[CrossRef][Medline]
-
DiMattia GE, Rhodes SJ, Krones A, et al. 1997 The Pit-1 gene
is regulated by distinct early and late pituitary-specific enhancers.
Dev Biol 182:180190[CrossRef][Medline]
-
Soto JL, Castrillo JL, Domínguez F, Diéguez C 1995 Regulation of GHF-1/Pit-1 messenger ribonucleic acid levels by
growth hormone secretagogues in rat anterior pituitary cells in
monolayer culture. Endocrinology 136:38633870[Abstract]
-
Smith RG, Cheng K, Schoen WR, et al. 1993 A nonpeptidyl growth
hormone secretagogue. Science 260:16401643[Abstract/Free Full Text]
-
Cheng K, Chan WWS, Barreta A, Convey DM, Smith RG 1989 The
synergistic effects of release and intracellular adenosine
3',5'-monophosphate accumulation in rat primary pituitary cell culture.
Endocrinology 124:27912798[Abstract/Free Full Text]
-
Locatelli V, Grilli R, Torsello A, Cella SG, Wehrenberg WB,
Müller EE 1994 Growth hormone-releasing hexapeptide is a potent
stimulator of growth hormone-releasing hormone-deprived infant rat.
Pediatric Res 36:169174[Medline]
-
Castrillo JL, Theill LE, Karin M 1991 Function of the
homeodomain protein GHF-1 in pituitary cell proliferation. Science 253:197199[Abstract/Free Full Text]
-
Li S, Crenshaw EB, Rawson EJ, Simmons DM, Swanson LW,
Rosenfeld MG 1990 Dwarf locus mutants lacking three pituitary cell
types result from mutations in the POU-domain gene pit-1. Nature 347:528533[CrossRef][Medline]
-
Sánchez-Pacheco A, Palomino T, Aranda A 1995 Retinoic
acid induces expression of the transcription factor GHF-1/Pit-1 in
pituitary prolactin and growth hormone-producing cell lines.
Endocrinology 136:53915398[Abstract]
-
Sánchez-Pacheco A, Palomino T, Aranda A 1995 Negative
regulation of expression of the pituitary-specific transcription factor
GHF-1/Pit-1 by thyroid hormones through interference with promotor
enhancer elements. Mol Cell Biol 15:63226329[Abstract]
-
Jong MTC, Raaka BM, Samuels HH 1994 A sequence in the rat
Pit-1 gene promoter confers synergistic activation by glucocorticoids
and protein kinase C. Mol Endocrinol 8:13201327[Abstract/Free Full Text]
-
Mau SE, Witt MR, Bjerrum OJ, Saemark T, Vilhardt H 1995 Growth
hormone releasing hexapeptide (GHRP-6) activates the inositol (1, 4,
5)-Triphosphate/diacylglycerol pathway in rat anterior pituitary cells.
J Recep Signal Transduction Res 15:311323[Medline]
-
Adams EF, Lei T, Buchfelder M, Bowers CY, Fahlbusch R 1996 Protein kinase C-dependent growth hormone releasing peptides stimulate
cyclic adenosine 3',5'-monophosphate production by human pituitary
somatotropinomas expressing gsp oncogenes: evidence for cross-talk
between transduction pathways. Mol Endocrinol 10:432438[Abstract/Free Full Text]
-
Cheng K, Chan WWS, Barreto A, Butler B, Smith RG 1991 Evidence
for a role of protein kinase-C in
His-D-Trp-Ala-Trp-D-Phe-Lys-NH2-induced
growth hormone release from rat primary cells. Endocrinology 129:33373342[Abstract/Free Full Text]
-
González GA, Yamamoto KK, Fischer WH, et al. 1989 A
cluster of phosphorylation sites on the cyclic AMP-regulated
nuclear factor CREB predicted by its sequences. Nature 337:749752[CrossRef][Medline]
-
Hai T, Curran T 1991 Cross-family dimerization of
transcription factors Fos/Jun and ATF/CREB alters DNA binding
specificity. Proc Natl Acad Sci USA 88:37203724[Abstract/Free Full Text]
-
Karin M, Liu Z, Zandi E 1997 AP-1 function and regulation.
Curr Opin Cell Biol 9:240246[CrossRef][Medline]
-
Roberson MS, Ban M, Zhang T, Mulvaney JM 2000 Role of cyclic
AMP response element binding complex and activation of
mitogen-activated protein kinases in synergistic activation of the
glycoprotein hormone
subunit gene by epidermal growth factor and
forskolin. Mol Cell Biol 20:33313344[Abstract/Free Full Text]
-
De Cesare D, Fimia GM, Sassone-Corsi P 1999 Signaling routes
to CREM and CREB: plasticity in transcriptional activation. Trends
Biochem Sci 24:281285[CrossRef][Medline]
-
Seternes OM, Johansen B, Moens U 1999 A dominant role for the
Raf-MEK pathway in forskolin, 12-O-tetradecanoyls-phorbol
acetate, and platelet-derived growth factor-induced CREB
(cAMP-responsive element-binding protein) activation, uncoupled from
serine 133 phosphorylation in NIH 3T3 cells. Mol Endocrinol 13:10711083[Abstract/Free Full Text]
-
Roberson ED, English JD, Adams JP, Selcher JC, Kondratick C,
Sweatt JD 1999 The mitogen-activated protein kinase cascade couples PKA
and PKC to cAMP response element binding protein phosphorylation in
area CA1 of hippocampus. J Neurosci 19:43374348[Abstract/Free Full Text]
-
Ong H, McNicoll N, Escher E, et al. 1998 Identification of a
pituitary growth hormone-releasing peptide (GHRP) receptor subtype by
photoaffinity labeling. Endocrinology 139:432435[Abstract/Free Full Text]
-
Slotkin TA, Lorber BA, McCook EC, Barnes GA, Seidler FJ 1995 Neural input and the development of adrenergic intracellular signaling:
neonatal denervation evokes neither receptor upregulation nor
persistent supersensitivity of adenylate cyclase. Dev Brain Res 88:1729[Medline]
-
Chaundhry A, Granneman JG 1991 Developmental changes in
adenylyl cyclase and GTP binding proteins in brown fat. Am J
Physiol 261:R403R411
-
Emami S, Regnauld K, Ferrand N, et al. 1998 Stimulatory
transducing systems in pancreatic islet cells. Ann NY Acad Sci 865:118131[CrossRef][Medline]
-
Shaywitz AJ, Greenberg ME 1999 CREB: a stimulus-induced
transcription factor activated by a diverse array of extracellular
signals. Annu Rev Biochem 68:824861
-
Xie H, Rothstein TL 1995 Protein kinase C mediates activation
of nuclear camp response element-binding protein (CREB) in B
lymphocytes stimulated through surface Ig. J Immnunol 154:17171723
-
Kawabe J, Iwami G, Ebina T, et al. 1994 Differential
activation of adenylyl cyclase by protein kinase C isoenzymes. J
Biol Chem 270:1655416558
-
Wu D, Chen C, Zhang J, Bowers CY, Clarke IJ 1996 The effects
of growth hormone-releasing peptide-6 (GHRP-6) and GHRP-2 on
intracellular adenosine 3',5'-monophosphate (cAMP) levels and GH
secretion in ovine and rat somatotrophs. J Endocrinol 148:197205[Abstract/Free Full Text]
-
Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H,
Wakabayashi I 2000 Central effect of ghrelin, an endogenous growth
hormone secretagogue, on hypothalamic peptide gene expression.
Endocrinology 141:4797800[Abstract/Free Full Text]
-
Hewson AK, Dickson SL 2000 Systemic administration of ghrelin
induces Fos and Egr-1 proteins in the hypothalamic arcuate nucleus of
fasted and fed rats. J Neuroendocrinol 12:10471049[CrossRef][Medline]
-
Diéguez C, Foord SM, Peters JR, Hall R, Scanlon MF 1985 The effects of thyroid hormone deprivation in vivo and
in vitro on growth hormone (GH) responses to human
pancreatic (tumor) GH-releasing factor (140) by dispersed rat
anterior pituitary cells. Endocrinology 116:10661070[Abstract/Free Full Text]
-
Carneiro C, Álvarez CV, Zalvide J, Vidal A,
Domínguez F 1998 TGF-ß1 actions on FRTL-5 cells provide a
model for the physiological regulation of thyroid growth. Oncogene 16:14551465[CrossRef][Medline]
-
Chomczynski P, Sacchi N 1987 Single-step method of RNA
isolation by acid guanidinium thyocyanate-phenol-chloroform extraction.
Anal Biochem 162:156159[Medline]
-
Seeburg PH, Shine J, Martial JA, Baxter JD, Goodman HM 1977 Nucleotide sequence and amplification in bacteria of structural gene
for rat growth hormone. Nature 270:486494[CrossRef][Medline]
-
Coya R, Álvarez CV, Pérez F, Gianzo C,
Diéguez C 1999 Regulation of in vitro prolactin
secretion by TGF-ß1. J Neuroendocrinol 11:351360[CrossRef][Medline]
-
Colin IM, Bower-Dantoin AC, Sundaresan S, Kopp P, Jameson JL 1996 Sexually dimorphic transcriptional responses to
gonadotropin-releasing hormone require chronic in vivo
exposure to estradiol. Endocrinology 137:23002307[Abstract]
-
Lew D, Brady H, Klausing K, et al. 1993 GHF-1-promoter-targeted immortalization of a somatotropic progenitor
cell results in dwarfism in transgenic mice. Genes Dev 7:683693[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
B. Dominguez, R. Felix, and E. Monjaraz
Upregulation of voltage-gated Na+ channels by long-term activation of the ghrelin-growth hormone secretagogue receptor in clonal GC somatotropes
Am J Physiol Endocrinol Metab,
May 1, 2009;
296(5):
E1148 - E1156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Peixoto, Y. Liu, S. Depauw, M.-P. Hildebrand, D. W. Boykin, C. Bailly, W. D. Wilson, and M.-H. David-Cordonnier
Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication
Nucleic Acids Res.,
June 1, 2008;
36(10):
3341 - 3353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Palos, M. E. R. Garcia-Rendueles, D. Araujo-Vilar, M. J. Obregon, R. M. Calvo, J. Cameselle-Teijeiro, S. B. Bravo, O. Perez-Guerra, L. Loidi, B. Czarnocka, et al.
Pendred Syndrome in Two Galician Families: Insights into Clinical Phenotypes through Cellular, Genetic, and Molecular Studies
J. Clin. Endocrinol. Metab.,
January 1, 2008;
93(1):
267 - 277.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G.-S. Frutos, L. Cacicedo, C. Fernandez, D. Vicent, B. Velasco, H. Zapatero, and F. Sanchez-Franco
Insights into a role of GH secretagogues in reversing the age-related decline in the GH/IGF-I axis
Am J Physiol Endocrinol Metab,
November 1, 2007;
293(5):
E1140 - E1152.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Kineman and R. M. Luque
Evidence that Ghrelin Is as Potent as Growth Hormone (GH)-Releasing Hormone (GHRH) in Releasing GH from Primary Pituitary Cell Cultures of a Nonhuman Primate (Papio anubis), Acting through Intracellular Signaling Pathways Distinct from GHRH
Endocrinology,
September 1, 2007;
148(9):
4440 - 4449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. French, R. P. Littlejohn, G. J. Greer, W. E. Bain, J. C. McEwan, and D. J. Tisdall
Growth hormone and ghrelin receptor genes are differentially expressed between genetically lean and fat selection lines of sheep
J Anim Sci,
February 1, 2006;
84(2):
324 - 331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Klausen, T. Tsuchiya, J. P. Chang, and H. R. Habibi
PKC and ERK are differentially involved in gonadotropin-releasing hormone-induced growth hormone gene expression in the goldfish pituitary
Am J Physiol Regulatory Integrative Comp Physiol,
December 1, 2005;
289(6):
R1625 - R1633.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Bravo, M. E.R. Garcia-Rendueles, R. Seoane, V. Dosil, J. Cameselle-Teijeiro, L. Lopez-Lazaro, J. Zalvide, F. Barreiro, C. M. Pombo, and C. V. Alvarez
Plitidepsin Has a Cytostatic Effect in Human Undifferentiated (Anaplastic) Thyroid Carcinoma
Clin. Cancer Res.,
November 1, 2005;
11(21):
7664 - 7673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Luque, R. D. Kineman, S. Park, X.-D. Peng, F. Gracia-Navarro, J. P. Castano, and M. M. Malagon
Homologous and Heterologous Regulation of Pituitary Receptors for Ghrelin and Growth Hormone-Releasing Hormone
Endocrinology,
July 1, 2004;
145(7):
3182 - 3189.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chowanadisai, S. L. Kelleher, and B. Lonnerdal
Maternal Zinc Deficiency Raises Plasma Prolactin Levels in Lactating Rats
J. Nutr.,
June 1, 2004;
134(6):
1314 - 1319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. INUI, A. ASAKAWA, C. Y. BOWERS, G. MANTOVANI, A. LAVIANO, M. M. MEGUID, and M. FUJIMIYA
Ghrelin, appetite, and gastric motility: the emerging role of the stomach as an endocrine organ
FASEB J,
March 1, 2004;
18(3):
439 - 456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Caminos, R. Nogueiras, M. Blanco, L. M. Seoane, S. Bravo, C. V. Alvarez, T. Garcia-Caballero, F. F. Casanueva, and C. Dieguez
Cellular Distribution and Regulation of Ghrelin Messenger Ribonucleic Acid in the Rat Pituitary Gland
Endocrinology,
November 1, 2003;
144(11):
5089 - 5097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Caminos, M. Tena-Sempere, F. Gaytan, J. E. Sanchez-Criado, M. L. Barreiro, R. Nogueiras, F. F. Casanueva, E. Aguilar, and C. Dieguez
Expression of Ghrelin in the Cyclic and Pregnant Rat Ovary
Endocrinology,
April 1, 2003;
144(4):
1594 - 1602.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Seoane, M. Lopez, S. Tovar, F. F. Casanueva, R. Senaris, and C. Dieguez
Agouti-Related Peptide, Neuropeptide Y, and Somatostatin-Producing Neurons Are Targets for Ghrelin Actions in the Rat Hypothalamus
Endocrinology,
February 1, 2003;
144(2):
544 - 551.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Chen
The Effect of Two-Day Treatment of Primary Cultured Ovine Somatotropes with GHRP-2 on Membrane Voltage-Gated K+ Currents
Endocrinology,
July 1, 2002;
143(7):
2659 - 2663.
[Abstract]
[Full Text]
[PDF]
|
 |
|