help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García, A.
Right arrow Articles by Diéguez, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García, A.
Right arrow Articles by Diéguez, C.
Molecular Endocrinology 15 (9): 1484-1495
Copyright © 2001 by The Endocrine Society

Regulation of PIT-1 Expression By Ghrelin and GHRP-6 Through the GH Secretagogue Receptor

Angel García, Clara V. Alvarez, Roy G. Smith and Carlos Diéguez

Department of Physiology (A.G., C.V.A., C.D.), Faculty of Medicine, University of Santiago de Compostela, Spain; and Huffington Center on Aging and Department of Molecular and Cellular Biology (R.G.S.), Baylor College of Medicine, Houston, Texas 77030

Address all correspondence and requests for reprints to: Dr. Carlos Diéguez, Department of Physiology, Faculty of Medicine, University of Santiago de Compostela, c/San Francisco s/n, 15704 Santiago de Compostela, Spain.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GH secretagogues are an expanding class of synthetic peptide and nonpeptide molecules that stimulate the pituitary gland to secrete GH through their own specific receptor, the GH-secretagogue receptor. The cloning of the receptor for these nonclassical GH releasing molecules, together with the more recent characterization of an endogenous ligand, named ghrelin, have unambiguously demonstrated the existence of a physiological system that regulates GH secretion. Somatotroph cell-specific expression of the GH gene is dependent on a pituitary-specific transcription factor (Pit-1). This factor is transcribed in a highly restricted manner in the anterior pituitary gland. The present experiments sought to determine whether the synthetic hexapeptide GHRP-6, a reference GH secretagogue compound, as well as an endogenous ligand, ghrelin, regulate pit-1 expression. By a combination of Northern and Western blot analysis we found that GHRP-6 elicits a time- and dose-dependent activation of pit-1 expression in monolayer cultures of infant rat anterior pituitary cells. This effect was blocked by pretreatment with actinomycin D, but not by cycloheximide, suggesting that this action was due to direct transcriptional activation of pit-1. Using an established cell line (HEK293-GHS-R) that overexpresses the GH secretagogue receptor, we showed a marked stimulatory effect of GHRP-6 on the pit-1 -2,500 bp 5'-region driving luciferase expression. We truncated the responsive region to -231 bp, a sequence that contains two CREs, and found that both CREs are needed for GHRP-6-induced transcriptional activation in both HEK293-GHS-R cells and infant rat anterior pituitary primary cultures. The effect was dependent on PKC, MAPK kinase, and PKA activation. Increasing Pit-1 by coexpression of pCMV-pit-1 potentiated the GHRP-6 effect on the pit-1 promoter. Similarly, we showed that the endogenous GH secretagogue receptor ligand ghrelin exerts a similar effect on the pit-1 promoter. These data provide the first evidence that ghrelin, in addition to its previously reported GH-releasing activities, is also capable of regulating pit-1 transcription through the GH secretagogue receptor in the pituitary, thus giving new insights into the physiological role of the GH secretagogue receptor on somatotroph cell differentiation and function.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GH SECRETAGOGUES (GHS) are synthetic compounds developed to release GH in vitro (1). These compounds were predicted to mimic the effect of an endogenous factor that would activate a specific receptor in the pituitary and the hypothalamus (2, 3, 4). The cloning of the receptor for these nonclassical GH releasing compounds, together with the more recent characterization of endogenous ligands, ghrelin and des-Gln14-ghrelin (5, 6), have unambiguously demonstrated the existence of a physiological system that regulates GH secretion along with GHRH and somatostatin. Ghrelin and/or GHS administered alone or in combination with GHRH are potent and highly reproducible GH releasers in rats (7) and humans (8, 9) and are useful tools for the diagnosis of GH deficiency when tested in a variety of pathological conditions, both in children and in adults (10, 11). As therapeutic agents, they show clinical effectiveness in enhancing GH release. At present, they are being evaluated in long-term controlled clinical studies to assess their potential benefits in a variety of disease states such as idiopathic GH deficiency, catabolic states, obesity, osteoporosis, and heart failure (12). Furthermore, recent evidence indicates that by acting at a central level, ghrelin may play an important role in body weight homeostasis (13, 14).

The expression of the GH gene is restricted to somatotrophs and somatomammotrophs in the pituitary gland and is under complex transcriptional control. Pituitary-specific expression of the GH gene is dependent on a pituitary-specific transcription factor, GH factor-1, a homeodomain protein also known as pituitary-specific transcription factor-1 (Pit-1) (15, 16). This factor is transcribed in a highly restricted manner in the anterior pituitary (AP) gland. Pit-1 transcription is controlled by at least three primary signals: a cAMP-activated transcription factor, CREB (15, 16, 17), autoregulation by its own gene product (17, 18), and developmentally scheduled transcriptional activation by one or more other pituitary-specific transcription factors (19).

Data obtained using primary cultures of adult rat AP cells have shown that GHRH plays a stimulatory role on pit-1 mRNA levels while IGF-I exerts an inhibitory effect (20). Somewhat surprisingly it was found that GHRP-6, a reference GHS compound, was shown to be devoid of any effect on pit-1 mRNA levels in this experimental model. In addition to its effects on the rate of GH gene transcription, Pit-1 also appears to be involved in somatotroph cell proliferation. Because the effect of GHRP-6 on GH secretion is more prominent in infant rats than in adult rats, we assessed the effect of GHRP-6 on pit-1 expression in a monolayer culture of infant rat AP cells. Furthermore, we also characterized the effects of GHRP-6 on the pit-1 promoter using a stable cell line that overexpresses the GH secretagogue receptor (GHS-R). Finally, during these experiments the isolation and characterization of an endogenous ligand for the GHS-R, called ghrelin, was described (5); therefore, we also evaluated the effects of ghrelin on the pit-1 promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GHRP-6 Increases Pit-1 Expression in Pituitary Cells Derived from Infant Rats
We have previously shown the lack of an effect of GHRP-6 on pit-1 gene expression in cells cultured from adult male rat pituitary glands (20). We hypothesized that cells cultured from infant rat pituitaries would be more responsive. To test this notion, we examined the effect of 10-6 M GHRP-6 on Pit-1 protein levels in adenohypophyseal primary cultures of 2-wk-old male rats. We performed immunoprecipitation-Western analysis because Pit-1 levels were too low for detection by direct Western blots (data not shown). A marked increase in Pit-1 protein expression was observed after 1 h of GHRP-6 treatment, which was maintained for up to 12 h (Fig. 1AGo). As controls, we performed anti-GH and anti-PRL Western blots with the same lysates and found no significant differences. Because GHRH increases pit-1 expression, we decided to test whether pit-1 was also regulated by GHRP-6. Figure 1BGo shows the effect of a maximal dose of GHRP-6 on pit-1 mRNA levels. There is a marked increase in pit-1 expression 1–2 h after the addition of GHRP-6. The increase in pit-1 is dose dependent and 10-10 M GHRP-6 (Fig. 1CGo), a GHRP-6 dose that fails to stimulate GH secretion (21, 22, 23), also has no effect on pit-1 expression. We detected a significant increase in GH secretion in our cultures after 4 h of treatment with 10-6 M GHRP-6, without any effect on PRL secretion (Fig. 2Go). The stimulatory effect of GHRP-6 on pit-1 appears to be mediated through the GHS-R because the effect is antagonized by (D-Lys3)-GHRP-6 (21) (Fig. 1DGo).



View larger version (66K):
[in this window]
[in a new window]
 
Figure 1. GHRP-6 Increases Pit-1 Expression through a Specific Receptor in Cultures of AP Cells from Infant Rats

A, Immunoprecipitation-Western blot showing the GHRP-6 induction on the levels of Pit-1 starting after 1 h and lasting at least 12 h. Linear exposed autoradiographs from six different replicate experiments were quantified by densitometry and mean ± SEM are shown in the bar graphs, * P < 0.05. As control, 25 µg of total lysates were run on SDS-PAGE and treated with anti-GH and anti-PRL. There were no differences between lanes. B, Northern blot showing a transient increase in pit-1 mRNA expression after 0.5 h treatment with 10-6 M GHRP-6. The levels increased between 1 to 2 h of treatment, and basal levels were restored after 4 h. Pit-1-enhanced expression was correlated with an increase in GH and PRL mRNA expression. 18S rRNA is shown as a loading control. Quantitation was done as in panel A. *, P < 0.05; **, P < 0.01. C, Dose-response effect of GHRP-6 on pit-1, GH, and PRL mRNA expression. Cell dishes were treated during 90 min with vehicle or different doses of GHRP-6. Quantitation was done as in panel A. *, P < 0.05; **, P < 0.01. D, The effect of GHRP-6 is specific since can be blocked by increasing amounts of the D-Lys3-GHRP-6 GHS-R antagonist. All treatments were maintained during 90 min with vehicle, GHRP-6, or different doses of the antagonist. Quantitation was done as in panel A. *, P < 0.05; **, P < 0.01.

 


View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. GHRP-6 (10-6 M) Releases GH but not PRL after 4 h Treatment in the Media of Infant Rat AP Cultures

Mean ± SEM of three independent experiments are shown. In each experiment any treatment was made by six replicates. **, P < 0.01.

 
We tested the possibility that GHRP-6 mediated its activity at the transcriptional level. Pretreatment of the cells with cycloheximide not only increases the basal levels of pit-1 mRNA but potentiates the GHRP-6 effect (Fig. 3Go). After pretreatment of the cells with actinomycin D (Fig. 3Go), GHRP-6 is unable to induce pit-1 expression. Collectively, these results argue that induction of a protein intermediate is not needed for GHRP-6-mediated increases in pit-1 transcription. In contrast to the results with pit-1, cycloheximide suppresses the effect of GHRP-6 on GH and PRL expression (Fig. 3Go). Actinomycin D prevents GHRP-6 induced increases in GH and PRL expression. These results are consistent with GHRP-6 induction of Pit-1 being at least partially required for increasing GH and PRL expression.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 3. GHRP-6 Effect on pit-1 Expression Is a Direct Transcriptional Effect in AP Cultures of Infant Rats

Pretreatment (90 min) with 23 µg/ml cycloheximide (CHX) potentiates, while 5 µg/ml actinomycin-D (AcD) suppresses. GHRP-6 (10-6 M) was added after CHX or AcD for an additional 90 min.

 
Identification of 5'-Flanking Regions Necessary for GHRP-6 Induction of Pit-1 Expression
Pit-1 activates and maintains the transcription of GH, PRL, and ß-TSH genes (24, 25). In our studies we saw an increase in the GH and PRL gene expression after GHRP-6 treatment. This might be mediated by transcriptional activation of pit-1, although there was a consistent difference in the maximal effective doses for pit-1 (10-6 M) vs. GH or PRL (10-8 M) (see Fig. 1CGo). To further study the activity of GHRP-6 on the pit-1 promoter we exploited a HEK-293 cell line that stably expresses the GHS-R (HEK293-GHS-R). This cell line was transfected with a -2,500-bp fragment from the pit-1 promoter cloned upstream of the luciferase reporter gene. There was a dose-response (Fig. 4AGo) and time-dependent (Fig. 4BGo) effect of GHRP-6 on luciferase activity.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. GHRP-6 Activates the pit-1 Promoter in the HEK293-GHS-R Cell Line

A, Dose-response effect of 24 h treatment with GHRP-6 on -2500pit1-luc. B, The induction of the promoter is accumulated over time after treatment with 10-6 M GHRP-6. Data are mean ± SEM of six independent experiments, each done in triplicate. *, P < 0.05; **, P < 0.01.

 
The 5'-flanking region of pit-1 contains multiple consensus sequences for known transcription factors (Fig. 5AGo) (15, 16, 17, 26, 27, 28). We made progressive deletions of the 5'-region and studied the response to GHRP-6 in the HEK293-GHS-R. There were no significant differences between -2500pit1-luc,-959pit1-luc, -458pit1-luc, -378pit1-luc, and -231pit1-luc, but the response was lost when the -194pit1-luc and -92pit1-luc were tested (Fig. 5BGo). These results implicate CRE elements in GHRP-6 mediated activation of the pit-1 promoter. There are two CRE elements, proximal (-157/-150) and distal (-200/-193), and we investigated whether both were needed for activation by GHRP-6. When -231 mutP-CREpit1-luc is used, where four bases of the proximal CRE are mutated, the response to GHRP-6 is completely abolished (Fig. 5CGo). Similarly, using -231 mutD-CREpit1-luc, where four bases of the distal CRE are mutated, the response to GHRP-6 is also blocked (Fig. 5CGo). These data clearly demonstrate the importance of the proximal and distal CREs for mediating the action of GHRP-6 action on the pit-1 promoter. To investigate the potential significance of another important 5'-flanking region, the Pit-1 binding site, we cotransfected a Pit1 expression vector (pCMV-pit1) with p-231pit1-luc into the HEK293-GHS-R cells. In these transfected cells, pit-1 expression in response to GHRP-6 is potentiated by 40% (Fig. 5DGo).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. Two CRE Elements in the 5'-Region of the pit-1 Gene Are Responsible for the Induction After Treatment with GHRP-6

A, Consensus sequences found in the known pit-1 5'-region. AP-1, Response element for dimers of the activating protein-1 family (Jun, Fos); GRE, putative glucocorticoid response element; CRE, cAMP response element consensus; Pit-1, pit-1 autoregulatory element. B, Progressive deletions of the 5'-region of pit-1 were cotransfected with ß-gal in HEK293-GHS-R and incubated with vehicle or 10-6 M GHRP-6. To simplify the graphs, the controls transfected with each construct but treated with vehicle are all represented in a single 100% bar. C, Mutation of either the distal CRE (-231 mutD-CRE pit1-luc) maintaining the proximal CRE, or the proximal CRE (-231 mutP-CRE pit1-luc) maintaining the distal one abolishes the GHRP-6 and forskolin effect in HEK293-GHS-R. D, Coexpression of pit-1 (50 ng of pCMV-pit1) potentiates the GHRP-6 effect on the pit-1 promoter. E, Similar results as in panels B and C were obtained in infant rats AP cultures but not in adult rats. Progressive deletions of the 5'-region of pit-1 as well as CRE mutation constructs were cotransfected with ß-gal in cultures of AP cells from infant or adult rats and incubated with vehicle, 10-6 M GHRP-6 or 10-5 M forskolin. The vehicle controls are all represented in a single 100% bar.

 
The experiments conducted with the HEK293-GHS-R cells were repeated in a more physiologically relevant setting by using primary cultures of AP cells. These AP cell cultures constitute a mixed population of pituitary cells, and of course we have no control over which cells express the transfected DNA. However, when double immunofluorescence is used to localize GHS-R ligand binding and to localize GH in the cultured AP cells, the results show that GHS-R ligand binding occurs exclusively in GH containing cells (2). Therefore, GHS-R-mediated GHRP-6 activation of pit1-luc can only occur in somatotrophs or somatomammotrophs. In young rat AP cells transfected with p-231pit1-luc, GHRP-6 activates the pit1 promoter, and this induction is abolished if either of the CRE elements are mutated (Fig. 5EGo). When adult rat pituitary-cultures are transfected, GHRP-6 is unable to stimulate the pit-1 promoter in spite of the positive response with the control additive, forskolin (Fig. 5EGo).

Mechanism of Activation of pit-1 by GHRP-6
The G protein-coupled GHS-R transduces a signal leading to GH secretion through Ca2+/PKC (29, 30, 31). By contrast, our data indicate an effect on the pit-1 promoter that is mediated by a sequence initially described as a binding motif for the CREB transcription factor, which is dependent on cAMP and PKA for activation (32). However, later reports describe binding of activating protein-1 (AP-1) transcription factors to CREs (33, 34, 35) and that phosphorylation and activation of CREB is mediated not only through PKA, but also through calmodulin kinase, ERK, and p38 activation (reviewed in Ref. 36).

To clarify the signal transduction pathway leading to activation of the pit-1 promoter by GHRP-6, we investigated the effects of different protein kinase inhibitors in cells transfected with both the long 5'-region, -2500pit1-luc, or the minimal responsive region -231pit1-luc. As shown in Fig. 6Go, A and C, the PKC inhibitor GF109203X completely blocks the response to GHRP-6 without affecting forskolin induction of the pit-1 promoter in the HEK293-GHS-R cells. As control, we tested the specificity of the PKC inhibitor using 12-O-tetradecanoylphorbol 13-acetate (TPA) on the longer construct, because in contrast to -231pit1-luc, TPA activates -2500pit-1. Indeed, Fig. 6AGo shows that the response to TPA is blocked by GF109203X. The PKC inhibitor also abolishes the effect of GHRP-6 on the expression of pit-1 in primary pituitary cell cultures (Fig. 6BGo). To determine whether the stimulatory effects of GHRP-6 on -231pit-1 required an active adenylate cyclase-PKA pathway, we tested whether H89, a known blocker of PKA, would affect activation of -231pit-1. In the presence of H89, both forskolin and GHRP-6 fail to stimulate -231pit-1; hence, PKA activity is required for the GHRP-6 response (Fig. 6CGo). The MAPK pathway may also be involved in activation of CREB by forskolin (37, 38). Therefore, we tested the effect of the MAPK kinase (MEK) inhibitor PD98059 on -231pit1-luc (Fig. 6CGo). PD98059 reduces basal activity and inhibits GHRP-6 activation. The PI3K inhibitor, LY294002, in spite of significantly reducing the basal levels of transcription, has no effect on GHRP-6 stimulation of the pit-1 promoter.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. The Stimulatory Effect of GHRP-6 on the pit-1 Promoter Depends on PKC and MEK but Can Be Inhibited by Treatment with a PKA Inhibitor

A, -2500pit1-luc was transfected in HEK293-GHS-R, and cells were treated with vehicle (-), 10-6 M GHRP-6 (P), 10-6 M TPA (T), or 10-5 M forskolin (F) in the absence or presence of a PKC inhibitor, 10-6 M GF-109203X (GF). B, Northern blot showing the blockade of 10-6 M GHRP-6-induced pit-1 expression in the presence of 10-6 M GF-109203X (GF) in cultures of AP cells from infant rats. GHRP-6 was added for 90 min after a pretreatment with GF-109203X for an additional 90 min. C, -231pit1-luc was transfected in HEK293-GHS-R and cells were treated with saline, 10-6 M GHRP-6 (P), 10-5 M Forskolin (F) in the absence or presence of a PKC inhibitor, 10-6 M GF-109203X (GF), a PKA inhibitor, 10-5 M H89 (H), a MEK inhibitor, 5 x 10-5 M PD98059 (PD), or a PI3K inhibitor, 10-5 M LY294002 (LY) .**, P < 0.01 GHRP-6 or FK treatment vs. either vehicle or inhibitor control; *, P < 0.05 differences between vehicle and inhibitor basal levels.

 
Isolation of the first endogenous ligand, ghrelin, for the GHS-R was described while our experiments were in progress (5). We therefore wished to determine whether ghrelin had the same stimulatory effects on pit-1 expression as that of the synthetic ligand GHRP-6. It is evident from a comparison of Fig. 7AGo with Fig. 4AGo, that ghrelin and GHRP-6 have equivalent activity on -2500pit1-luc. Ghrelin and GHRP-6 also have similar activity on -231pit-luc (Fig. 7BGo). In addition, mutation of any of the CRE elements or deletion of the distal CRE abolished the stimulatory effect of ghrelin (Fig. 7CGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. The Endogenous Ligand Ghrelin and GHRP-6 Have a Similar Dose-Response on Activation of the pit-1 Promoter

A, -2500pit1-luc was transfected in HEK-293 GHS-R and cells treated with increasing concentrations of ghrelin during 24 h. This figure should be compared with Fig. 4AGo. B, -231pit1-luc was transfected into HEK293-GHS-R cells and treated with increasing concentrations of ghrelin or GHRP-6 for 24 h. C, Effect of ghrelin on the pit-1 promoter is exerted in the same CRE region as GHRP-6, because deletion and mutation of either the distal or proximal CRE elements on the promoter abolishes the stimulatory effect of ghrelin. This figure should be compared with Fig. 5CGo.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The only known significant in vitro biological effect of GHRP-6 on the pituitary gland described to date is the immediate release of GH and in some cases release of small amounts of PRL (reviewed in Refs. 2, 6 and 7). We now demonstrate that GHRP-6 increases the cellular amount of the Pit-1 transcription factor in infant-rat primary anterior pituitary (AP) cell cultures in a dose- and time-dependent fashion. The increase can be blocked by actinomycin D, but not by cycloheximide, which is consistent with a direct effect at the transcriptional level. The biological relevance is illustrated by experiments showing that the GHRP-6-induced increase in pit-1 mRNA in AP cells is associated with increasing amounts of Pit-1 protein. The results with the GHS-R antagonist, D-Lys3-GHRP-6, leads us to conclude the effect to be GHS-R mediated based on inhibition of the GHRP-6-induced increase in pit-1 mRNA. This result is particularly relevant because it has been suggested that the synthetic GHS could be acting on more than one receptor on the pituitary gland (39). A similar dose- and time-dependent increase of luciferase activity was established when GHRP-6 was evaluated after transfection of -2500pit-1-luc into HEK293-GHS-R.

We investigated which elements in the 5'-region of the rat pit-1 are involved in GHRP-6 induction. The GHS-R signal transduction has been characterized as involving the phospholipase C/IP3/diacylglycerol (DAG)/PKC pathway (29, 30, 31). As a result of sequential promoter deletion, we found that AP-1 response elements between -932 and -875 were not needed for pit-1 transcriptional induction by GHRP-6. The main 5'-flanking region needed for GHRP-6 activation was located around -200, which includes two CREs (26, 27, 28). Deleting the distal CRE suppressed GHRP-6 activation, suggesting that the important element was located between -200 and -193. Furthermore, we could abolish the response by mutating the distal CRE. However, when we mutated the proximal CRE but maintained the distal CRE, the response was also suppressed. The known data on the pit-1 5'-region stressed the importance of another element, the Pit-1 binding site. Indeed, when we expressed Pit-1 in HEK293-GHS-R cells, the GHRP-6 stimulation was potentiated. This demonstrated that both elements cooperate in the promoter activity.

The physiological relevance of the results obtained in the HEK-293 cells was confirmed by repeating the studies after transfection of the pit1-luc constructs into AP primary cultures. In AP cells from infant rats, GHRP-6 produced significant activation of luciferase activity, which was suppressed by mutation or deletion of either, or both, CREs. Curiously, GHRP-6 did not activate the pit-1 promoter in pituitary cells derived from adult rats (20). However, this age-dependence is not unique, because there are other examples in physiology of age-dependent differential regulation, such as the up-regulation of ß-adrenergic receptors in adult rats after denervation, which is absent in infant rats (40). The pituitaries of neonatal rats are also more responsive to GHRP-6 stimulation of GH release than those of adult rats (23), which might be explained by differences in receptor levels or by activation of different signal transduction pathways. For example, the concentration of GHRP-6 needed for inducing pit-1 in the AP cells is about 100-fold higher than in the HEK293-GHS-R cells. In the AP, the GHS-R concentration is approximately 100-fold lower than in the HEK293-GHS-R cells. In addition to differences in GHS-R concentrations, a developmentally regulated alteration in components of the GHS-R signal transduction pathway is an equally viable possibility for explaining the age-related differential response. For example, expression of different adenylate-cyclase isoforms and different activities of protein kinases have been described in the young vs. adult rat (41, 42).

The CRE is known to bind dimeric phosphorylated CREB transcription factors as well as heterodimers from the AP-1 family of transcription factors (33, 34, 35, 36). Although CREB was initially associated with cAMP-PKA signal transduction pathways, other pathways, such as CaM kinase, Ras-ERK, and p38, can also phosphorylate and activate CREB (reviewed in Ref. 43). AP-1 members are activated by a broad range of signal transduction pathways including PKC, Janus kinase-signal transducer and activator of transcription, ternary complex factor, and MAPKs (34). We show that pit-1 activation is dependent on PKC both in the HEK293-GHS-R cell line and in pituitary cells, which is consistent with activation of the Gq PLC/DAG/PKC pathway described previously (29, 30, 31). PKC has been shown to activate ERK resulting in CREB phosphorylation (Refs. 37 and 44 ; reviewed in Ref. 43). Consistent with GHRP-6 activating pit-1 through this pathway, the effect of GHRP-6 is suppressed by the MAPK pathway inhibitor PD98059. However, blocking PKA also suppresses the GHRP-6 effect. Two possible explanations are that activation of PKA through PKC-stimulated ERK leads to CREB phosphorylation and CRE activation, or that independent activation of CREB occurs through PKA together with PKC induction of AP-1 transcription factors. Either or both pathways could act on the two CRE regions. PKA activation by Gq/DAG/PKC/Ca2+ implies a specific adenylate cyclase subtype stimulated by PKC or CamK IV (45). However, no cAMP increase has been observed after GHRP-6 treatment, at least not in a short-term study (22, 30, 31, 46). Alternatively, basal cAMP production, which would be inhibited by H89, might play an important permissive role for GHRP-6 and ghrelin stimulation of pit-1 expression via the CRE. Extensive work will be needed to elucidate the intracellular protein cascades leading to activation of the pit-1 promoter.

In summary, we show that GHRP-6 and ghrelin induce activation of pit-1 in AP cells from infant rats. This effect is exerted directly on the pit-1 promoter and appears to be developmentally regulated, because it cannot be demonstrated in pituitary cells isolated from adult rats. Furthermore, the demonstration that the endogenous peptide, ghrelin, exerts a similar effect to GHRP-6 on the pit-1 promoter through the same CREs reinforces the physiological relevance of our results. Finally, these data provide the first evidence that ghrelin, in addition to its previous reported GH-releasing activities and inducer of hypothalamic gene expression (47, 48), also interacts with the GHS-R and activates gene transcription through the pit-1 promoter without requiring new protein synthesis. We have demonstrated a physiological effect of the ghrelin-GHS-R system in the regulation of somatotroph cell function, namely, activation of pit-1 expression. This observation provides a new insight into the molecular role of the GHS-R that has potential relevance to developmental biology.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
All culture media and restriction enzymes were obtained from Life Technologies, Inc. (Gaithersburg, MD). Tissue culture plasticware was from Nunc. GHRP-6 and ghrelin were obtained from Peninsula Laboratories, Inc. (Belmont, CA). (D-Lys3)-GHRP-6 was from Bachem (Torrance, CA). H89 and PD98059 were purchased from Calbiochem (La Jolla, CA). Cycloheximide, actinomycin D, GF109203X, LY294002, and all other reagents were obtained from Sigma (St. Louis, MO), unless otherwise specified. Random primed DNA labeling kit was from New England Biolabs, Inc. (Beverly, MA). Fugene was obtained from Roche Molecular Biochemicals (Indianapolis, IN) G418, Hybond-N+ nylon membranes, 125I, {alpha}32P-dCTP, and {gamma}32P-dATP were from Amersham Pharmacia Biotech (Arlington Heights, IL).

Culture Medium
Defined medium (serum-free) consisted of Ham‘s F12/DMEM/BGjb medium in a ratio of 6:3:1 (vol/vol/vol) supplemented with: (per liter) BSA (2 g), HEPES (2.38 g), hydrocortisone (143 µg), T3 (0.4 µg), transferrin (10 mg), glucagon (10 ng), epidermal growth factor (0.1 µg), and fibroblast growth factor (0.2 µg). Just before culturing the cells, the following were added: 2 mM glutamine, 100 IU/ml penicillin, 100 µg/ml streptomycin, 2.5 µg/ml amphotericin-B plus 2.5% FCS. The HEK293-GHS-R cell line was cultured in high-glucose DMEM plus 10% FCS, glutamine, and penicillin-streptomycin solution plus 500 µg/ml G-418.

Cell Culture
Rat anterior pituitary cells were cultured as previously described (49). Two-week-old (30–50 g) or adult (250 g) male Sprague Dawley rats were decapitated. The AP glands were removed, minced, and enzymatically dispersed using a solution of 0.4% (wt/vol) type IA collagenase, 0.2% (wt/vol) dispase, 0.1% (wt/vol) hyaluronidase, 0.01% (wt/vol) DNase I, and 10% (vol/vol) FCS in Earle‘s balanced salt solution (EBSS). The digest was placed in an incubator at 37 C for 1 h and mechanically dispersed at 15-min intervals. The dispersed cell suspension was centrifuged, and the pellet was washed with EBSS and finally resuspended in defined medium containing 2.5% FCS and antibiotics. Cells were plated and incubated at 37 C in a humidified atmosphere of 95% air-5% CO2 for a period of 4 d.

RIAs
GH and PRL levels were measured in the culture medium with a RIA using the NIDDK standards (49).

Immunoprecipitation and Western Blot Analysis
We used eight pituitaries per 60-mm dish. The day of the experiment all dishes were washed three times with EBSS, and serum-free defined medium was added. The cultures were treated progressively at the appropriate times, and 24 h later cells from all the dishes were harvested simultaneously. The dishes were washed three times in cold PBS, and cells were scraped in 100 µl of hot 1% SDS and boiled for 5 min at 95 C. After addition of 900 µl lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 5 mM EGTA, 1.5 mM MgCl2, 20 mM sodium pyrophosphate, 10 mM NaVO4, 4 mM PMSF, 50 µg/ml aprotinin), lysates were sonicated briefly and microfuged for 5 min at 14,000 x g at 4 C. Five hundred micrograms of total protein were immunoprecipitated overnight at 4 C with monoclonal anti-Pit-1 (Affinity Research, Mamhead, Exeter, UK). Thirty microliters of Gammabind (Amersham Pharmacia Biotech) were pipetted and end-to-end incubated during another 45 min. The beads were washed with HNTG buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol, 0.1% Triton X-100) and resuspended in 50 µl of protein sample buffer. Samples were resolved on by 12% SDS-PAGE and electrotransferred onto a nitrocellulose membrane (Schleicher & Schuell, Inc., Keene, NH). Immunodetection was carried out as previously described (50) with a chemiluminescent system (Tropix, Inc., Bedford, MA) using a polyclonal anti-Pit-1 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) at a dilution of 1:1000. For GH and PRL, 25 µg of total cell lysates were loaded by 15% SDS-PAGE and transferred as before. Rabbit anti-GH and anti-PRL (NIDDK) were used at 1:5,000 dilution.

Northern Blot Analysis
Culture and treatment of the AP cultures were as in the Western blot except that 10 pituitaries per 60-mm dish were used. The protocol was previously described by Carneiro et al. (50). Briefly, 10 µg of total RNA (51) were run on a 1.5% formaldehyde agarose gel, stained with ethidium bromide, and transferred to a nylon membrane. Pit-1 (20), GH (52), and PRL (53) cDNA probes were labeled with a32P-dCTP. An oligonucleotide for the 18S RNA (ACGGTATCTGATCGTCTTCGAACC) labeled with {gamma}32P-dATP was used as an internal control to ensure equal loading among lanes.

Transfections
HEK293-GHS-R is a cell line that stably expresses the human GHS-R [35S-MK0677 binding: Bmax = 500 fmol/mg, dissociation constant (Kd ) = 0.5 nM (3)]. Forty thousand cells per well were seeded in 24-well dishes and allowed to attach overnight. Transfections were carried out in complete medium during 4 h using 3 µl/well of Fugene and 1 µg/well of total DNA, 0.7 µg of the different pit-1 promoter-luc constructs, and 0.3 µg rous sarcoma virus-ß-galactosidase (pRSV-ß-gal). After washing with EBSS, DMEM + 0.1% BSA was added along with treatment for 24 h unless otherwise stated in the figure legends. Cells were lysed in 100 mM potassium phosphate, pH 7.8, 1 mM dithiothreitol by three freeze-thaw cycles. Luciferase activity was measured using a Nichols luminometer and ß-galactosidase activity was measured at {lambda}420 nm using o-nitrophenyl-ß-D-galactopyranoside as substrate. For transfection of primary cultures, pituitaries were dispersed slightly differently than described above using collagenase type IV instead of type IA (54); 250,000 cells were allowed to attached overnight in defined medium plus 10% FCS. Transfections were carried out in serum-free medium during 4 h using 3 µl/well of Fugene and 1 µg/well of total DNA, 0.5 µg of the different pit-1 promoter-luc constructs plus 0.5 µg pRSV-ß-gal; 1% FCS was added for the next 2 h. Finally, the dishes were washed and various treatments were applied in serum-free defined medium.

Plasmids
-2500Pit1-luc was obtained by cloning the 5'-region of the pit-1 gene (55) on the NheI site of the pGL3 basic vector (Promega Corp., Madison, WI). The AccI/SmaI fragment was cloned on the same vector to obtain the -959pit1-luc, and sequentially, PvuII/SacI fragment originated -458pit1-luc, NsiI/SacI fragment gave -378pit1-luc, PleI/SmaI gave -231pit1-luc, AatII/SacI fragment gave -194Pit1-luc, and the HpaI/SmaI fragment gave -92pit1-luc. To obtain both CRE mutations, we used overlapping PCR using specific oligos. For -231 mutD-CRE-pit1-luc, upper fragment A: 5'-GTACCGAGCTCTTACGCGTGCTAGCC-3' and B: 5'-GAAACTTTATTTGGGCTCAGTAAGTGGG-3' giving a 74-pb product; lower fragment C: 5'-CCCACTTACTGAGCCCAAATAAAGTTTC-3' and D: 5'-CCGGAATGCCAAGCTTACTTAGATCG-3' giving a 250-bp product. For -231 mutP-CRE-pit1-luc, upper fragment A: 5'-GTACCGAGCTCTTACGCGTGCTAGCC-3' and B: 5'-AACCTGGTTGTGGGCTATGAAGTGAGGA-3' giving a 209-pb product; lower fragment C: 5'-TCCTCACTTCATAGCCCACAACCAGGTT-3' and D: 5'-CCGGAATGCCAAGCTTACTTAGATCG-3' giving a 118-bp product. The AB and CD products for each construct were combined and PCR-mix was added for 2 cycles (94 C, 30 sec; 37 C, 60 sec; 72 C, 5 min), followed by the addition of A and D primers and another 20 cycles (94 C, 45 sec; 48 C, 45 sec; 72 C, 1 min). Nhe/HindIII fragments were cloned in pGL3basic. The new constructs were sequenced using an ALF-express (Amersham Pharmacia Biotech).

Statistical Analysis
Data are expressed as mean ± SEM. All the experiments were repeated at least three times in different weeks. For the transfections, each of the repeated experiments was done at least in triplicate per treatment. Transfection data are expressed as percentages over the basal transfected construct without treatment. Statistical analysis was carried out with the Mann-Whitney U test and the one-way ANOVA test. Significance is represented as follows: *, P < 0.05, ** P < 0.01.


    ACKNOWLEDGMENTS
 
We thank C. Caelles for very kindly providing the -2,500 region of Pit-1 promoter and the Pit1 expression vector, and L. Loidi for the sequencing facilities in her laboratory. Also thanks to M. Dosil and B. Faílde for technical support. We acknowledge Dr. Parlow from the NIDDK for the RIA reactives.


    FOOTNOTES
 
This work was supported by Fondo de Investigación Sanitaria, Spanish Ministry of Health (C.D., C.V.A.), and Xunta de Galicia (C.D.) grants.

Abbreviations: AP, Anterior pituitary; AP-1, activating protein-1 (family of transcription factors composed of Jun, Fos); CRE, cAMP response element; CREB, CRE binding protein; DAG, diacylglycerol; EBSS, Earle’s balanced salt solution; ß-Gal, ß-galactosidase; GHS, GH secretagogue; GHS-R, GHS receptor; MEK, MAPK kinase; Pit-1, pituitary-specific transcription factor; TPA, 12-O-tetradecanoylphorbol 13-acetate.

Received for publication July 25, 2000. Accepted for publication May 25, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Bowers CY, Momany F, Reynolds GA, Hong A 1984 On the in vitro and in vivo activity of a new synthetic hexapeptide that acts on the pituitary to specifically release growth hormone. Endocrinology 114:1537–1545[Abstract/Free Full Text]
  2. Smith RG, Van der Ploeg LHT, Howard AD, et al. 1997 Peptidomimetic regulation of growth hormone secretion. Endocr Rev 18:621–645[Abstract/Free Full Text]
  3. Feighner SD, Howard AD, Prendergast K, et al. 1998 Structural requirements for the activation of the human growth hormone secretagogue receptor by peptide and nonpeptide secretagogues. Mol Endocrinol 12:137–145[Abstract/Free Full Text]
  4. Howard AD, Feighner SD, Cully DF, et al. 1996 A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273:974–977[Abstract]
  5. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402:656–660[CrossRef][Medline]
  6. Hosoda H, Kojima M, Matsuo H, Kangawa K 2000 Purification and characterization of rat des-Gln14-Ghrelin, a second endogenous ligand for the growth hormone secretagogue receptor. J Biol Chem 275:21995–2000[Abstract/Free Full Text]
  7. Seoane LM, Tovar S, Baldelli R, et al. 2000 Ghrelin elicits a marked stimulatory effect on GH secretion in freely-moving rats. Eur J Endocrinol 143:R007–R009
  8. Takaya K, Ariyasu H, Kanamoto N, et al. 2000 Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 85:4908–4911[Abstract/Free Full Text]
  9. Peino R, Baldelli R, Rodriguez-Garcia J, et al. 2000 Ghrelin-induced growth hormone secretion in humans. Eur J Endocrinol 143:R011–R014
  10. Casanueva FF, Diéguez C 1999 Growth hormone secretagogues: physiological role and clinical utility. Trends Endocrinol Metab 10:30–38[CrossRef][Medline]
  11. Ghigo E, Arvat E, Muccioli G, Camanni F 1997 Growth hormone-releasing peptides. Eur J Endocrinol 136:445–460[Abstract/Free Full Text]
  12. Shimon I, Melmed S 1999 Potential applications of growth hormone secretagogues. In: Ghigo E, Boghen M, Casanueva FF, Diéguez C, eds. Growth hormone secretagogues. Basic findings and clinical implications. Amsterdam: Elsevier Science; 315–370
  13. Tschop M, Smiley DL, Heiman ML 2000 Ghrelin induces adiposity in rodents. Nature 407:908–913[CrossRef][Medline]
  14. Wren AM, Small CJ, Ward HL, et al. 2000 The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141:4325–4328[Abstract/Free Full Text]
  15. Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M, Karin M 1988 The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 55:505–518[CrossRef][Medline]
  16. Ingraham HA, Chen R, Mangalam HJ, et al. 1988 A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55:519–529[CrossRef][Medline]
  17. McCormick A, Brady H, Theill LE, Karin M 1990 Regulation of the pituitary-specific homeobox gene GHF1 by cell-autonomous and environmental cues. Nature 345:829–832[CrossRef][Medline]
  18. Chen C, Ingraham HA, Treacy MN, Albert VR, Wilson L, Rosenfeld MG 1990 Autoregulation of Pit-1 gene expression mediated by two cis-active promoter elements. Nature 346:583–586[CrossRef][Medline]
  19. DiMattia GE, Rhodes SJ, Krones A, et al. 1997 The Pit-1 gene is regulated by distinct early and late pituitary-specific enhancers. Dev Biol 182:180–190[CrossRef][Medline]
  20. Soto JL, Castrillo JL, Domínguez F, Diéguez C 1995 Regulation of GHF-1/Pit-1 messenger ribonucleic acid levels by growth hormone secretagogues in rat anterior pituitary cells in monolayer culture. Endocrinology 136:3863–3870[Abstract]
  21. Smith RG, Cheng K, Schoen WR, et al. 1993 A nonpeptidyl growth hormone secretagogue. Science 260:1640–1643[Abstract/Free Full Text]
  22. Cheng K, Chan WWS, Barreta A, Convey DM, Smith RG 1989 The synergistic effects of release and intracellular adenosine 3',5'-monophosphate accumulation in rat primary pituitary cell culture. Endocrinology 124:2791–2798[Abstract/Free Full Text]
  23. Locatelli V, Grilli R, Torsello A, Cella SG, Wehrenberg WB, Müller EE 1994 Growth hormone-releasing hexapeptide is a potent stimulator of growth hormone-releasing hormone-deprived infant rat. Pediatric Res 36:169–174[Medline]
  24. Castrillo JL, Theill LE, Karin M 1991 Function of the homeodomain protein GHF-1 in pituitary cell proliferation. Science 253:197–199[Abstract/Free Full Text]
  25. Li S, Crenshaw EB, Rawson EJ, Simmons DM, Swanson LW, Rosenfeld MG 1990 Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene pit-1. Nature 347:528–533[CrossRef][Medline]
  26. Sánchez-Pacheco A, Palomino T, Aranda A 1995 Retinoic acid induces expression of the transcription factor GHF-1/Pit-1 in pituitary prolactin and growth hormone-producing cell lines. Endocrinology 136:5391–5398[Abstract]
  27. Sánchez-Pacheco A, Palomino T, Aranda A 1995 Negative regulation of expression of the pituitary-specific transcription factor GHF-1/Pit-1 by thyroid hormones through interference with promotor enhancer elements. Mol Cell Biol 15:6322–6329[Abstract]
  28. Jong MTC, Raaka BM, Samuels HH 1994 A sequence in the rat Pit-1 gene promoter confers synergistic activation by glucocorticoids and protein kinase C. Mol Endocrinol 8:1320–1327[Abstract/Free Full Text]
  29. Mau SE, Witt MR, Bjerrum OJ, Saemark T, Vilhardt H 1995 Growth hormone releasing hexapeptide (GHRP-6) activates the inositol (1, 4, 5)-Triphosphate/diacylglycerol pathway in rat anterior pituitary cells. J Recep Signal Transduction Res 15:311–323[Medline]
  30. Adams EF, Lei T, Buchfelder M, Bowers CY, Fahlbusch R 1996 Protein kinase C-dependent growth hormone releasing peptides stimulate cyclic adenosine 3',5'-monophosphate production by human pituitary somatotropinomas expressing gsp oncogenes: evidence for cross-talk between transduction pathways. Mol Endocrinol 10:432–438[Abstract/Free Full Text]
  31. Cheng K, Chan WWS, Barreto A, Butler B, Smith RG 1991 Evidence for a role of protein kinase-C in His-D-Trp-Ala-Trp-D-Phe-Lys-NH2-induced growth hormone release from rat primary cells. Endocrinology 129:3337–3342[Abstract/Free Full Text]
  32. González GA, Yamamoto KK, Fischer WH, et al. 1989 A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequences. Nature 337:749–752[CrossRef][Medline]
  33. Hai T, Curran T 1991 Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc Natl Acad Sci USA 88:3720–3724[Abstract/Free Full Text]
  34. Karin M, Liu Z, Zandi E 1997 AP-1 function and regulation. Curr Opin Cell Biol 9:240–246[CrossRef][Medline]
  35. Roberson MS, Ban M, Zhang T, Mulvaney JM 2000 Role of cyclic AMP response element binding complex and activation of mitogen-activated protein kinases in synergistic activation of the glycoprotein hormone {alpha} subunit gene by epidermal growth factor and forskolin. Mol Cell Biol 20:3331–3344[Abstract/Free Full Text]
  36. De Cesare D, Fimia GM, Sassone-Corsi P 1999 Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci 24:281–285[CrossRef][Medline]
  37. Seternes OM, Johansen B, Moens U 1999 A dominant role for the Raf-MEK pathway in forskolin, 12-O-tetradecanoyls-phorbol acetate, and platelet-derived growth factor-induced CREB (cAMP-responsive element-binding protein) activation, uncoupled from serine 133 phosphorylation in NIH 3T3 cells. Mol Endocrinol 13:1071–1083[Abstract/Free Full Text]
  38. Roberson ED, English JD, Adams JP, Selcher JC, Kondratick C, Sweatt JD 1999 The mitogen-activated protein kinase cascade couples PKA and PKC to cAMP response element binding protein phosphorylation in area CA1 of hippocampus. J Neurosci 19:4337–4348[Abstract/Free Full Text]
  39. Ong H, McNicoll N, Escher E, et al. 1998 Identification of a pituitary growth hormone-releasing peptide (GHRP) receptor subtype by photoaffinity labeling. Endocrinology 139:432–435[Abstract/Free Full Text]
  40. Slotkin TA, Lorber BA, McCook EC, Barnes GA, Seidler FJ 1995 Neural input and the development of adrenergic intracellular signaling: neonatal denervation evokes neither receptor upregulation nor persistent supersensitivity of adenylate cyclase. Dev Brain Res 88:17–29[Medline]
  41. Chaundhry A, Granneman JG 1991 Developmental changes in adenylyl cyclase and GTP binding proteins in brown fat. Am J Physiol 261:R403–R411
  42. Emami S, Regnauld K, Ferrand N, et al. 1998 Stimulatory transducing systems in pancreatic islet cells. Ann NY Acad Sci 865:118–131[CrossRef][Medline]
  43. Shaywitz AJ, Greenberg ME 1999 CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68:824–861
  44. Xie H, Rothstein TL 1995 Protein kinase C mediates activation of nuclear camp response element-binding protein (CREB) in B lymphocytes stimulated through surface Ig. J Immnunol 154:1717–1723
  45. Kawabe J, Iwami G, Ebina T, et al. 1994 Differential activation of adenylyl cyclase by protein kinase C isoenzymes. J Biol Chem 270:16554–16558
  46. Wu D, Chen C, Zhang J, Bowers CY, Clarke IJ 1996 The effects of growth hormone-releasing peptide-6 (GHRP-6) and GHRP-2 on intracellular adenosine 3',5'-monophosphate (cAMP) levels and GH secretion in ovine and rat somatotrophs. J Endocrinol 148:197–205[Abstract/Free Full Text]
  47. Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H, Wakabayashi I 2000 Central effect of ghrelin, an endogenous growth hormone secretagogue, on hypothalamic peptide gene expression. Endocrinology 141:4797–800[Abstract/Free Full Text]
  48. Hewson AK, Dickson SL 2000 Systemic administration of ghrelin induces Fos and Egr-1 proteins in the hypothalamic arcuate nucleus of fasted and fed rats. J Neuroendocrinol 12:1047–1049[CrossRef][Medline]
  49. Diéguez C, Foord SM, Peters JR, Hall R, Scanlon MF 1985 The effects of thyroid hormone deprivation in vivo and in vitro on growth hormone (GH) responses to human pancreatic (tumor) GH-releasing factor (1–40) by dispersed rat anterior pituitary cells. Endocrinology 116:1066–1070[Abstract/Free Full Text]
  50. Carneiro C, Álvarez CV, Zalvide J, Vidal A, Domínguez F 1998 TGF-ß1 actions on FRTL-5 cells provide a model for the physiological regulation of thyroid growth. Oncogene 16:1455–1465[CrossRef][Medline]
  51. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thyocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  52. Seeburg PH, Shine J, Martial JA, Baxter JD, Goodman HM 1977 Nucleotide sequence and amplification in bacteria of structural gene for rat growth hormone. Nature 270:486–494[CrossRef][Medline]
  53. Coya R, Álvarez CV, Pérez F, Gianzo C, Diéguez C 1999 Regulation of in vitro prolactin secretion by TGF-ß1. J Neuroendocrinol 11:351–360[CrossRef][Medline]
  54. Colin IM, Bower-Dantoin AC, Sundaresan S, Kopp P, Jameson JL 1996 Sexually dimorphic transcriptional responses to gonadotropin-releasing hormone require chronic in vivo exposure to estradiol. Endocrinology 137:2300–2307[Abstract]
  55. Lew D, Brady H, Klausing K, et al. 1993 GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice. Genes Dev 7:683–693[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. Dominguez, R. Felix, and E. Monjaraz
Upregulation of voltage-gated Na+ channels by long-term activation of the ghrelin-growth hormone secretagogue receptor in clonal GC somatotropes
Am J Physiol Endocrinol Metab, May 1, 2009; 296(5): E1148 - E1156.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Peixoto, Y. Liu, S. Depauw, M.-P. Hildebrand, D. W. Boykin, C. Bailly, W. D. Wilson, and M.-H. David-Cordonnier
Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication
Nucleic Acids Res., June 1, 2008; 36(10): 3341 - 3353.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Palos, M. E. R. Garcia-Rendueles, D. Araujo-Vilar, M. J. Obregon, R. M. Calvo, J. Cameselle-Teijeiro, S. B. Bravo, O. Perez-Guerra, L. Loidi, B. Czarnocka, et al.
Pendred Syndrome in Two Galician Families: Insights into Clinical Phenotypes through Cellular, Genetic, and Molecular Studies
J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 267 - 277.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
M. G.-S. Frutos, L. Cacicedo, C. Fernandez, D. Vicent, B. Velasco, H. Zapatero, and F. Sanchez-Franco
Insights into a role of GH secretagogues in reversing the age-related decline in the GH/IGF-I axis
Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1140 - E1152.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. D. Kineman and R. M. Luque
Evidence that Ghrelin Is as Potent as Growth Hormone (GH)-Releasing Hormone (GHRH) in Releasing GH from Primary Pituitary Cell Cultures of a Nonhuman Primate (Papio anubis), Acting through Intracellular Signaling Pathways Distinct from GHRH
Endocrinology, September 1, 2007; 148(9): 4440 - 4449.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
M. C. French, R. P. Littlejohn, G. J. Greer, W. E. Bain, J. C. McEwan, and D. J. Tisdall
Growth hormone and ghrelin receptor genes are differentially expressed between genetically lean and fat selection lines of sheep
J Anim Sci, February 1, 2006; 84(2): 324 - 331.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
C. Klausen, T. Tsuchiya, J. P. Chang, and H. R. Habibi
PKC and ERK are differentially involved in gonadotropin-releasing hormone-induced growth hormone gene expression in the goldfish pituitary
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2005; 289(6): R1625 - R1633.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. B. Bravo, M. E.R. Garcia-Rendueles, R. Seoane, V. Dosil, J. Cameselle-Teijeiro, L. Lopez-Lazaro, J. Zalvide, F. Barreiro, C. M. Pombo, and C. V. Alvarez
Plitidepsin Has a Cytostatic Effect in Human Undifferentiated (Anaplastic) Thyroid Carcinoma
Clin. Cancer Res., November 1, 2005; 11(21): 7664 - 7673.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Luque, R. D. Kineman, S. Park, X.-D. Peng, F. Gracia-Navarro, J. P. Castano, and M. M. Malagon
Homologous and Heterologous Regulation of Pituitary Receptors for Ghrelin and Growth Hormone-Releasing Hormone
Endocrinology, July 1, 2004; 145(7): 3182 - 3189.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
W. Chowanadisai, S. L. Kelleher, and B. Lonnerdal
Maternal Zinc Deficiency Raises Plasma Prolactin Levels in Lactating Rats
J. Nutr., June 1, 2004; 134(6): 1314 - 1319.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. INUI, A. ASAKAWA, C. Y. BOWERS, G. MANTOVANI, A. LAVIANO, M. M. MEGUID, and M. FUJIMIYA
Ghrelin, appetite, and gastric motility: the emerging role of the stomach as an endocrine organ
FASEB J, March 1, 2004; 18(3): 439 - 456.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. E. Caminos, R. Nogueiras, M. Blanco, L. M. Seoane, S. Bravo, C. V. Alvarez, T. Garcia-Caballero, F. F. Casanueva, and C. Dieguez
Cellular Distribution and Regulation of Ghrelin Messenger Ribonucleic Acid in the Rat Pituitary Gland
Endocrinology, November 1, 2003; 144(11): 5089 - 5097.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. E. Caminos, M. Tena-Sempere, F. Gaytan, J. E. Sanchez-Criado, M. L. Barreiro, R. Nogueiras, F. F. Casanueva, E. Aguilar, and C. Dieguez
Expression of Ghrelin in the Cyclic and Pregnant Rat Ovary
Endocrinology, April 1, 2003; 144(4): 1594 - 1602.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. M. Seoane, M. Lopez, S. Tovar, F. F. Casanueva, R. Senaris, and C. Dieguez
Agouti-Related Peptide, Neuropeptide Y, and Somatostatin-Producing Neurons Are Targets for Ghrelin Actions in the Rat Hypothalamus
Endocrinology, February 1, 2003; 144(2): 544 - 551.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Chen
The Effect of Two-Day Treatment of Primary Cultured Ovine Somatotropes with GHRP-2 on Membrane Voltage-Gated K+ Currents
Endocrinology, July 1, 2002; 143(7): 2659 - 2663.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García, A.
Right arrow Articles by Diéguez, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García, A.
Right arrow Articles by Diéguez, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals