help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zennaro, M.-C.
Right arrow Articles by Lombès, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zennaro, M.-C.
Right arrow Articles by Lombès, M.
Molecular Endocrinology 15 (9): 1586-1598
Copyright © 2001 by The Endocrine Society

A New Human MR Splice Variant Is a Ligand-Independent Transactivator Modulating Corticosteroid Action

Maria-Christina Zennaro, Anny Souque, Say Viengchareun, Elodie Poisson and Marc Lombès

INSERM U 478, Faculté de Médecine Xavier Bichat, 75870 Paris Cedex 18, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Aldosterone effects are mediated by the MR, which possesses the same affinity for mineralocorticoids and glucocorticoids. In addition to the existence of mechanisms regulating intracellular hormone availability, we searched for human MR splice variants involved in tissue-specific corticosteroid function. We have identified a new human MR isoform, hMR{Delta}5,6, resulting from an alternative splicing event skipping exons 5 and 6 of the human MR gene. hMR{Delta}5,6 mRNAs are expressed in several human tissues at different levels compared with wild-type human MR, as shown by real time PCR. Introduction of a premature stop codon results in a 75-kDa protein lacking the entire hinge region and ligand binding domain. Interestingly, hMR{Delta}5,6 is still capable of binding to DNA and acts as a ligand-independent transactivator, with maximal transcriptional induction corresponding to approximately 30–40% of aldosterone-activated wild-type human MR. Coexpression of hMR{Delta}5,6 with human MR or human GR increases their transactivation potential at high doses of hormone. Finally, hMR{Delta}5,6 is able to recruit the coactivators, steroid receptor coactivator 1, receptor interacting protein 140, and transcription intermediary factor 1{alpha}, which enhance its transcriptional activity. Ligand-independent transactivation and enhancement of both wild-type MR and GR activities by hMR{Delta}5,6 suggests that this new variant might play a role in modulating corticosteroid effects in target tissues.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE MR is a member of the nuclear receptor superfamily, which acts as a ligand-dependent transcription factor, mediating aldosterone effects on a variety of target tissues, such as the distal parts of the nephron, the distal colon, the cardiovascular and central nervous systems, and brown adipose tissue. Members of the superfamily all share a common modular structure (1). In particular, the MR is composed of an amino-terminal region, which harbors a ligand- independent transactivation function (AF1), a centrally located, highly conserved DNA binding domain, a proline-rich hinge region, and a complex C-terminal domain responsible for ligand binding and ligand-dependent transactivation (AF2) (2). Transcriptional activation occurs via binding to glucocorticoid response elements (GREs), which consist of an inverted hexameric palindrome separated by three nucleotides. Although it has been shown that MR is able to bind to (3) and to activate transcription from the GRE of the mouse mammary tumor virus promoter-long terminal repeat (2), no specific mineralocorticoid response element has been identified so far on aldosterone target genes. Nuclear receptors activate transcription by stabilizing the transcriptional preinitiation complex through direct interactions with general transcription factors (4). Furthermore, it has been shown recently that recruitment of transcriptional coactivators is necessary to obtain maximal transactivation (5). Such coactivators seem to be important in bridging the receptor activation domains with the basal transcriptional machinery; in addition, they contain an intrinsic histone acetyltransferase activity, which allows remodeling of the chromatin structure for better accessibility of the transcription machinery to DNA.

We have previously shown that the human MR (hMR) gene is composed of 10 exons (6). Alternative transcription of two 5'-untranslated exons generates two mRNA isoforms, hMR{alpha} and hMRß, which are coexpressed in aldosterone target tissues (6, 7). hMR gene expression is controlled by two different promoters, which differ by their basal activity as well as their hormonal regulation (8). Recent experiments in transgenic mice have shown a distinct tissue-specific utilization and activity of the two hMR-regulatory regions in vivo (9).

Mineralocorticoids are mainly implicated in the maintenance of water and salt homeostasis by regulating vectorial sodium transport in tight epithelia, thus regulating blood pressure (10). Recently, several other effects have been described, including a role for aldosterone in the development of cardiac fibrosis (11, 12, 13) and the differentiation of brown adipose tissue (14). Given the pleiotropic effects mediated by MR and the fact that the receptor possesses the same affinity for glucocorticoids as for mineralocorticoids, the mechanisms mediating cellular specificity become fundamental for the final transcriptional response. In epithelial target tissues, specificity is acquired by the presence of an enzyme, 11ß-hydroxysteroid dehydrogenase type II (11HSD2), which converts glucocorticoids (circulating at ~1,000- fold higher levels than mineralocorticoids) into inactive 11-dehydro cogeners (15, 16). In nonepithelial tissues, such as the brain, the heart, and brown adipose tissue, 11HSD2 activity appears insufficient to allow for receptor selectivity, and it has been postulated that MR might function as a high-affinity GR (17). Nevertheless, specific aldosterone effects have also been demonstrated in these tissues, indicating that other mechanisms may exist regulating either hormonal access to the receptor or the receptor response to a given hormone. In this context it has been shown that MR can discriminate aldosterone from glucocorticoids independently of 11HSD2 in terms of transcriptional response, due to differences in the association/dissociation kinetics (18, 19). In addition, heterodimerization between MR and GR, which could indeed modulate the response to one or the other corticosteroid hormones in target cells, has recently been reported (20, 21). Finally, the existence of receptor splice variants seems to play a major role in modulating receptor function. It has been shown that a binding-incompetent 3'-splice variant of the human GR, hGRß, acts as a dominant negative regulator not only of GR, but also of MR function (22).

We have previously hypothesized the existence of other human MR (hMR) transcripts, expressed in heart and epidermis (7). Given the involvement of aldosterone in cardiovascular disease, we have searched for new cardiac hMR isoforms, which could eventually modulate hMR activity and hence aldosterone effects in the heart. In this paper we describe a new hMR splice variant, hMR{Delta}5,6, which lacks exons 5 and 6 of the hMR gene, resulting in a protein deleted of the entire hinge region and ligand-binding domain. hMR{Delta}5,6 is widely expressed in human tissues and acts as a ligand-independent transcription factor, capable of modulating hMR and hGR function. Finally, we show that hMR{Delta}5,6 interacts with different coactivators, which are able to enhance its transcriptional potential.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
An Alternative Splicing Event Generates an hMR Variant Lacking the Hinge Region and the Entire Ligand-Binding Domain
By subsequent rounds of PCR we have isolated three different clones from a human heart cDNA library. Two of them, clones 9C-10B and 6D-5A, are partial clones identical to the wild-type hMR, although clone 9C-10B ends at an internal polyadenylation site at position 3,655 of the published hMR cDNA sequence. Restriction enzyme and sequence analysis of a third clone, 10A-6H, revealed an hMR variant of 3,150 bp corresponding to the hMR nucleotide sequence 9 to 3,654, but lacking nucleotides 2,237 to 2,732 (Fig. 1Go, numbering based on the nucleotide sequence published in Ref. 2). The clone contains 212 nucleotides of the 5-untranslated exon 1{alpha} and 477 nucleotides of 3'-untranslated region. Comparison with the genomic sequence (6) showed that the deleted fragment corresponds to exons 5 and 6, indicating that the mRNA variant is generated by an alternative splicing event. Deletion of the two exons introduces a frame-shift in the hMR sequence, resulting in a premature termination codon 107 bp downstream of the exon 4/intron D boundary (Fig. 2Go, A and B). The new mRNA codes for a protein of 706 residues with a predicted size of 75 kDa, which possesses the entire amino-terminal part of the receptor and the DNA-binding domain, but has lost the hinge region and the ligand-binding domain. Instead, it contains 35 additional residues without homology to any other known sequence. In vitro transcription/translation analyses confirmed that a protein with the expected molecular mass is generated from this transcript (Fig. 3Go). No specific binding of tritiated aldosterone or dexamethasone was detected, confirming the absence of a competent ligand-binding pocket (data not shown). Some differences in the sequence between hMR{Delta}5,6 and the wild-type hMR have been detected: at nucleotide position 221 (corresponding to the first noncoding nucleotide of exon 2), G is changed to C in hMR{Delta}5,6. An A-to-G transition at positon 760 changes amino acid 180 from Ile to Val, while a C-to-T transition at nucleotide position 944 changes codon 241 from Ala to Val. Finally, a silent C-to-T transition was found at nucleotide position 1,719 (499 Asp/Asp). Substitution of Val 241 for an Ala should not have a major influence on protein structure, since the two residues have similar properties and are located outside the putative hMR AF-1, which has been mapped between positions 328 and 382 (23). These nucleotide changes correspond to common polymorphisms found in the normal population. In particular, C221C and T1719 have frequencies of 39% and 15%, respectively (24), and the Val241 mutation was reported to have heterozygosity and homozygosity frequencies of 48% and 38%, respectively (25), while it was not detected in another study (24).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. An Alternative Splicing Event Generates a New hMR Isoform

A, Schematic representation of the hMR gene. Numbering represents exons, the arrowhead indicates the transcription initiation site, whereas the TGA indicates the end of the coding region. Alternative transcription of the two 5'-untranslated exons 1{alpha} and 1ß generates two hMR mRNAs, hMR{alpha} and hMRß. An alternative splicing event, skipping exons 5 and 6 (dotted line), gives origin to a new hMR variant, hMR{Delta}5,6. B, Sequence alignment of wild-type hMR and hMR{Delta}5,6 between exons 4 and 7. hMR{Delta}5,6 contains an internal deletion from nucleotides 2,237–2,732, corresponding to the entire exons 5 and 6. This deletion introduces a frameshift in the coding sequence, with a new termination codon ending transcription at nucleotide position 2836. Numbering corresponds to the published hMR sequence (2 ).

 


View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. hMR{Delta}5,6 Codes for a Protein Lacking the Hinge Region and Ligand Binding Domain

A, Predicted protein structure of hMR{Delta}5,6. Numbering indicates residues flanking functional hMR domains. A and B, Amino-terminal region; C, DBD; D, hinge region; E, ligand binding domain. B, Amino acid alignment between the wild type hMR and hMR{Delta}5,6. Limits of the DBD and the hinge region are indicated.

 


View larger version (80K):
[in this window]
[in a new window]
 
Figure 3. A 75-kDa Protein Is Generated from hMR{Delta}5,6

SDS-PAGE of in vitro translated hMR{Delta}5,6. One microgram of a recombinant pcDNA3-hMR or pCMV6-hMR{Delta}5,6 was transcribed and translated in vitro in the presence of [35S]-methionine; 1 and 10 µl, respectively, were used for SDS-PAGE analysis. MW, Molecular weight markers.

 
hMR{Delta}5,6 Is Differentially Expressed among Tissues
To test the tissue-specific distribution of hMR{Delta}5,6, we performed RT-PCR analysis on RNAs extracted from different human tissues and two human immortalized cell lines using sense and antisense primers located in exons 4 (S2136) and 7 (A2824), respectively (Fig. 4AGo). Two PCR products of the expected size for the wild- type hMR (688 bp) and for hMR{Delta}5,6 (192 bp) were detected in all tissues analyzed. In this experiment, hMR{Delta}5,6 was highly expressed in the hippocampus and in the hepatic cell line SK Hep1, whereas its expression seems very low in the colon. In all other tissues, including lung, kidney, heart, and lymphocytes, substantial amounts of hMR{Delta}5,6 were detected. Therefore, both hMR variants are expressed in human tissues. Interestingly, an additional band of approximately 330 bp was also detected by RT-PCR in all tissues, with the exception of the hepatic cell lines Hep3B and SK Hep1. Given the size, we supposed that this band could result from the amplification of another hMR splice variant lacking exon 5. Indeed, a cDNA containing an internal 351-bp deletion comprising nucleotides 2,237–2,587 was originally isolated by Arriza et al. (2) during the initial cloning of the hMR cDNA, and alignment with the genomic sequence (6) has subsequently shown that the deleted fragment corresponds to exon 5 (26). Sequencing of the approximately 330-bp amplification product confirmed the existence of the variant lacking exon 5 (hMR{Delta}5), which encodes for a predicted receptor lacking amino acids 672–788, including the whole hinge region and the N-terminal part of the ligand-binding domain of the receptor. However, since the full-length clone of this variant was not isolated during our library screening, precise exon composition, i. e. presence of untranslated exons 1{alpha} or 1ß, and its functional properties remain to be established.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 4. hMR{Delta}5,6 Is Widely Expressed in Human Tissues at Different Levels

A, Expression of hMR{Delta}5,6 was studied in different human tissue samples and two human hepatic cell lines (Hep3B and SK Hep1) by RT-PCR analysis using primers located in exons 4 and 7. A 688-bp and a 192-bp band corresponding to amplification of wild-type hMR and hMR{Delta}5,6, respectively, are indicated by arrows. An additional band of approximately 330 bp, corresponding to a hMR exon 5 splice variant, is also amplified (see Results for details). Molecular standards are indicated on the right. Hippoc, Hippocampus; Lympho, lymphocytes; RT -RNA, Reverse transcription in the absence of RNA. B, Quantitative real-time PCR analysis of hMR{Delta}5,6 expression. Relative quantification was done by comparing hMR{Delta}5,6/hMR expression in different tissues to that observed in the heart, which was chosen as the calibrator and set to 1. Results, expressed in arbitrary units, represent means ± SE of three to six different determinations.

 
To precisely quantify tissue-specific expression of hMR{Delta}5,6, we have performed real-time PCR experiments using a Taqman probe. The hMR and hMR{Delta}5,6 common forward primer is located on exon 4, whereas the reverse primers for the two hMR isoforms were chosen to overlap the junction between alternatively spliced exons. The Taqman probe is also located on exon 4. Thus, specific detection of each isoform during real-time PCR is obtained exclusively by the specificity of the reverse primer. Several tests of specificity were conducted. No fluorescent signal was observed in PCR samples without a previous reverse transcription. The PCR primers amplified only their cognate template and produced no detectable amplification from the cDNA of the other isoform (data not shown). Real-time PCR analysis allowed detection of as little as 6 molecules of template, with a mean threshold cycle (CT) of 37.51 for hMR{Delta}5,6 and 36.15 for hMR. Under these conditions, as illustrated in Fig. 4BGo, the relative hMR{Delta}5,6 expression compared with that of hMR clearly differs among tissues, with highest levels observed in the kidney. In three independent experiments using kidney cDNA, the threshold cycle CT for hMR{Delta}5,6 was 33.33 ± 0.30 (n = 8). Using the same primers, a fluorescent signal for hMR and hMR{Delta}5,6 was also detected in mouse kidney, indicating that expression of hMR{Delta}5,6 is conserved among species (data not shown).

The hMR{Delta}5,6 Isoform Is Able to Bind to DNA
The DNA binding properties of hMR{Delta}5,6 were next investigated by EMSA. Whole-cell extracts were prepared from RCSV3 cells after transfection with the expression plasmids coding for hMR{Delta}5,6 and from Sf9 cells expressing hMR, and assayed for binding to a consensus GRE sequence from the MMTV promoter. As previously shown (3), hMR specifically bound to a consensus 32P-labeled GRE oligonucleotide (Fig. 5AGo, lane 8). hMR{Delta}5,6 was also able to bind to the consensus GRE in a specific manner, since binding was efficiently competed for by excess amounts of unlabeled GRE (Fig. 5AGo, lanes 2–7). Comparison of competition experiments between the two isoforms indicated that hMR{Delta}5,6 possesses a similar affinity for the GRE as hMR (data not shown). GRE-hMR{Delta}5,6 complexes display a faster mobility than GRE-hMR, consistent with the lower molecular mass of the splice variant. The same results were obtained using in vitro translated hMR{Delta}5,6 (Fig. 5BGo). Coincubation of whole-cell extracts (WCE) of hMR{Delta}5,6 with different amounts of wild-type hMR (data not shown) or cotranslation of hMR and hMR{Delta}5,6 in the reticulocyte lysate system (Fig. 5BGo, lanes 6 and 7) did not generate additional retarded bands, indicating that in our experimental conditions, hMR{Delta}5,6 does not interact with hMR and does not form heterodimers on the consensus GRE. Our results demonstrate that, although hMR{Delta}5,6 lacks the entire hinge region and ligand-binding domain, it is competent for DNA binding.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 5. hMR{Delta}5,6 Binds to a Consensus GRE Sequence

A, WCE from RCSV3 cells expressing hMR{Delta}5,6 or from hMR-expressing Sf9 cells were analyzed for binding to the consensus GRE sequence from the MMTV promoter. In lanes 3–7, an increasing amount (12.5 to 200 ng) of unlabeled probe was added as competitor. Lane 1, Free probe. B, hMR and hMR{Delta}5,6 were translated in vitro alone (1 µg) or together (0.5 µg each) and analyzed for binding to the consensus GRE. For competition experiments, 50 ng unlabeled GRE (comp.) were used for hMR (lane 3) and hMR{Delta}5,6 (lane 5), whereas 100 ng were used in the presence of both receptors (lane 7). As a negative control, the empty pcDNA3 plasmid was translated under the same conditions (lane 8).

 
Transcriptional Properties of hMR{Delta}5,6
Given the structure and the DNA binding capacities of hMR{Delta}5,6, we tested its functional properties by transient transfection assays in RCSV3 cells. For this purpose, different amounts of a hMR{Delta}5,6 expression vector were cotransfected with an MMTV-luciferase reporter plasmid. In these experiments, hMR{Delta}5,6 was able to activate transcription from the MMTV promoter in a dose-dependent manner, reaching a transactivation plateau with 0.5 µg of transfected plasmid (Fig. 6AGo). Maximal activation corresponded to approximately 30–40% of luciferase activity observed when transfecting wild-type hMR in the presence of 10-9 M aldosterone. Furthermore, as expected by the absence of the ligand-binding domain, the transactivation activity of hMR{Delta}5,6 was totally hormone independent, since it was not modified by incubation with increasing doses of aldosterone (Fig. 6BGo). These data were also confirmed by transient transfections in CV1 cells (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 6. hMR{Delta}5,6 Is a Ligand-Independent Transactivator

RCSV3 cells cultivated in charcoal-stripped serum were transiently transfected with an expression plasmid coding for hMR{Delta}5,6 and 1.25 µg of an MMTV-luciferase reporter construct. Cotransfection of 0.5 µg pSVßgal (CLONTECH Laboratories, Inc.), a plasmid encoding for ß-galactosidase, was performed to normalize for transfection efficiencies. Results represent the mean ± SEM of two to four independent experiments performed in triplicate and are the ratio of luciferase activity over ß-galactosidase activity. A, Different amounts (0.05 to 5 µg) of hMR{Delta}5,6 expression plasmid were transfected. Results are expressed as a percentage of transcriptional induction observed with 0.5 or 2.5 µg wild-type hMR in the presence of 10-9 M aldosterone. B, Aldosterone dose-response curve. Results are plotted as percentage of induction observed with 0.5 µg of hMR{Delta}5,6 expression plasmid alone. Basal luciferase activity was always lower than 3%.

 
We next investigated whether hMR{Delta}5,6 could influence the activity of the wild- type hMR. Three different amounts of hMR{Delta}5,6 (0.05 µg, 0.5 µg, and 2.5 µg) were transfected in RCSV3 cells together with 0.5 µg of hMR and an MMTV-luciferase reporter plasmid (Fig. 7AGo). In the presence of increasing concentrations of aldosterone, hMR activated transcription in a dose-dependent manner, with an ED50 of approximately 10-11 M, reaching a plateau of activation at concentrations of aldosterone between 10-10 and 10-7 M. As expected, in the presence of hMR{Delta}5,6, transcriptional activation already occurred in the absence of hormone, but only starting from a hMR{Delta}5,6 to hMR ratio of 1. At lower ratios, hMR seems to inhibit ligand-independent transcriptional activation by hMR{Delta}5,6. These data were also confirmed using 2.5 µg of hMR and 1.25 or 2.5 µg of hMR{Delta}5,6 (data not shown). At a hMR{Delta}5,6 to hMR ratio of 0.1 and 5, the dose-response curve to aldosterone was not markedly modified, although the maximum levels of transcriptional activation corresponded to approximately 120% of hMR plus aldosterone alone. At a 1:1 hMR{Delta}5,6 to hMR ratio, a significant increase in transactivation was observed (200% of hMR in the presence of 10-7 M aldosterone) with no evident plateau. Therefore, these data indicate that in RCSV3 cells hMR{Delta}5,6 modulates transcriptional activation of hMR depending on the relative level of the splice variant.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 7. hMR{Delta}5,6 Modulates Transcriptional Activity of Wild-Type hMR and hGR

A, RCSV3 were transiently transfected with 0.5 µg of the expression plasmid pcDNA3-hMR coding for hMR alone or together with 0.05 µg, 0.5 µg, or 2.5 µg of hMR{Delta}5,6 expression vector to give hMR{Delta}5,6/hMR ratios of 0.1, 1, and 5, respectively, and incubated with increasing concentrations of aldosterone. Statistical significance was evaluated by Student’s t test for different ratios of hMR{Delta}5,6/hMR vs. hMR alone. Statistical significance (P < 0.05) is also obtained for hMR{Delta}5,6/hMR 1 in the presence of 10-7 M aldosterone vs. hMR{Delta}5,6/hMR 1 in the presence of 10-9 M aldosterone. B, RCSV3 were transiently transfected with 0.5 µg of the expression plasmid pRShGR coding for hGR alone or with 0.5 µg of pCMV6-hMR{Delta}5,6 to give a hMR{Delta}5,6/hGR ratio of 1. Statistical significance is calculated for hMR{Delta}5,6/hGR vs. hGR alone. All results are expressed as relative induction compared with hMR or hGR alone in the presence of 10-9 M aldosterone or 10-8 M dexamethasone, respectively, and represent the mean ± SEM of two to four independent experiments performed in triplicate. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

 
Since heterodimerization and transcriptional modulation between hMR and hGR have already been described, we questioned whether hMR{Delta}5,6 could also influence hGR-mediated transactivation. We therefore performed cotransfection assays using wild-type hGR alone or in the presence of an equal amount of hMR{Delta}5,6 (Fig. 7BGo). While the dexamethasone dose-response curve of hGR decreased to 60% of maximal levels at high doses of hormone (P < 0.001 for 10-7 M and 10-6 M dexamethasone vs. 10-8 M), in the presence of hMR{Delta}5,6 approximately 100% of activation was maintained even in the presence of high concentrations of hormone. Note that very little relative hormone-independent transactivation was observed with hMR{Delta}5,6 (expressed as percentage of hGR plus dexamethasone); this is due to the fact that hGR is a stronger transactivator than hMR. Altogether, these results indicate that hMR{Delta}5,6 is also able to potentiate hGR-mediated transcriptional activation.

hMR{Delta}5,6 Activates Transcription by Interacting with Transcriptional Coactivators
The next question was how hMR{Delta}5,6 was able to activate transcription in the absence of a ligand-binding domain and a functional AF-2. We speculated that hMR{Delta}5,6 could interact with transcriptional coactivators through its amino terminal domain, as already reported for the PR (27), ER{alpha} and ERß (28, 29), and TRß2 (30). To test this hypothesis, hMR{Delta}5,6 was cotransfected in RCSV3 cells either alone or with the expression plasmids for different transcriptional coactivators, including steroid receptor coactivator (SRC)1a and SRC1e [two isoforms of SRC1 diverging at their C termini (31)], RIP140 (32), and TIF1{alpha} (33). A significant increase in transactivation was observed in the presence of all four coactivators, although to a different extent (Fig. 8Go). Whereas SRC1a and RIP140 increased transcriptional activation of hMR{Delta}5,6 only by approximately 50%, SRC1e and hTIF1{alpha} enhanced the ability of hMR{Delta}5,6 to stimulate transcription by more than 2-fold. These results are consistent with previous data showing that SRC1e enhanced the ability of the ER to stimulate transcription to a greater extent than SRC1a (31). Neither coactivator alone had any effect in the absence or presence of aldosterone (data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 8. hMR{Delta}5,6-Mediated Transactivation Is Enhanced by Coactivators

RCSV3 cells were transiently transfected with 0.5 µg of pCMV6-hMR{Delta}5,6 and the reporter plasmid pF31luc alone or in the presence of 0.5 µg of expression plasmids coding for transcriptional coactivators SRC1a, SRC1e, RIP140, and TIF1{alpha}. Normalized values are expressed as percentage activity compared with hMR{Delta}5,6 alone (100%). Results represent the mean ± SEM of two to four independent experiments performed in triplicate. **, P < 0.01; ***, P < 0.001. CoA, coactivator.

 
To identify the molecular mechanisms of transcriptional enhancement, recruitment of coactivators by hMR{Delta}5,6 was tested by glutathione S-transferase (GST) pull-down assays using in vitro translated hMR{Delta}5,6. As shown in Fig. 9Go, a strong interaction could be observed when hMR{Delta}5,6 was incubated with TIF1{alpha}, whereas weaker, although visible, signals are present with GST-SRC1 and GST-RIP140. As expected, this interaction was independent of the addition of aldosterone. Taken together, these results strongly suggest that hMR{Delta}5,6 activates transcription by recruiting transcriptional coactivators probably via its amino-terminal domain.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 9. hMR{Delta}5,6 Is Capable of Recruiting Transcriptional Coactivators

Binding of hMR{Delta}5,6 to GST fusion proteins of SRC1, TIF1{alpha}, and RIP140 or GST alone was analyzed by GST pull-down assays. In vitro transcribed and translated 35S-labeled hMR{Delta}5,6 was incubated with the fusion proteins on glutathione-Sepharose beads; samples were subsequently resolved on a 7.5% SDS-polyacrylamide gel. The input lane represents 10% of the total volume of lysate used in each reaction. Molecular weight markers (MW) are represented on the left.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
MR plays a fundamental role in the maintenance of water and electrolyte balance through regulation of transepithelial sodium transport in tight epithelia (34). Inactivating mutations of the MR lead to a severe salt-wasting syndrome (35), whereas activating mutations result in hypertension (36). In addition to these major effects, which are mediated by the mineralocorticoid hormone aldosterone, MR appears to be implicated in a large variety of other physiological processes, such as memory, regulation of salt appetite, brown adipose tissue differentiation, and thermogenesis. In the heart, infusion of aldosterone produces cardiac fibrosis, an effect that is specifically mediated by the MR and not reproduced by the injection of glucocorticoids (11, 12). Given that the heart, like other nonepithelial target tissues, possesses very little 11HSD2 to inactivate glucocorticoids and prevent illicit occupation of MR, other mechanisms must exist allowing for specific mineralocorticoid effects in this tissue. The aim of our study was to search for hMR isoforms that could possibly be capable of modulating hMR activity and corticosteroid function in nonepithelial target tissues. A new hMR splice variant, referred to as hMR{Delta}5,6, was isolated, which arises from the skipping of exons 5 and 6 of the hMR gene and is also observed in mice. hMR{Delta}5,6 transcripts are present in several human tissues, including lung, kidney, heart, liver, lymphocytes, and brain, but their relative expression compared with the wild-type hMR is variable. Relative quantitative real-time PCR analysis has shown that the hMR{Delta}5,6 to hMR ratio is approximately 5-fold higher in the kidney than in the heart, with intermediary levels observed in brain and liver. Although these results suggest that hMR{Delta}5,6 modulates corticosteroid effects in a tissue-specific manner, extensive analysis of isoform expression in several individuals and in normal and pathological states should give a more precise insight into the mechanisms of regulation of hMR expression and splicing.

The 75-kDa hMR{Delta}5,6 protein, which lacks the entire receptor hinge region and the ligand-binding domain, but contains unique 35 residues after the DNA-binding domain, not only binds to a consensus GRE but is also able to activate transcription in a ligand-independent manner from the MMTV promoter. In cotransfection assays, we have also shown that hMR{Delta}5,6 is able to potentiate the transcriptional activation induced by wild-type hMR and hGR, particularly at high doses of hormone, where these receptors alone either reach a transactivation plateau, or display a progressive decrease of their transactivation potential. Finally, transcriptional activation by hMR{Delta}5,6 seems to involve recruitment of transcriptional coactivators by the amino-terminal domain of the receptor.

Different MR isoforms have already been described (26). In addition to hMR{alpha} and hMRß, three rat MR mRNA variants, rMR{alpha}, rMRß, and rMR{gamma}, have been identified, which are generated by alternative transcription of different 5'-untranslated exons (37). In addition, two MR splice variants changing the MR coding region have recently been described. A 12-bp insertion resulting from the use of a cryptic splice site at the exon 3/intron C splice junction leads to an in-frame insertion of four amino acids to the first zinc finger of the DNA-binding domain of the receptor (38). Although this insertion variant might possess slightly different DNA binding characteristics and transactivation properties than MR, it is interesting to note that insertion of nine amino acids between the two zinc fingers of the trout GR does not significantly alter its functional characteristics (39, 40). Another MR variant with a 10-bp deletion results in a truncated receptor lacking the C-terminal part of the steroid binding domain. This isoform is largely expressed in rat and human tissues but has no intrinsic activity nor does it modify transcriptional activity of the wild-type MR (41).

Other than an exon 5-deleted ER{alpha} splice variant (42), ER{alpha}{Delta}5, whose role in carcinogenesis has been strongly suggested (43), hMR{Delta}5,6 is the only example of a naturally occurring C-terminal deletion mutant acting as ligand-independent transactivator and capable of positively modulating activity of the wild-type receptor. Indeed, similar splice variants of TR (44), VDR (45), or the recently identified truncated form of PPAR{alpha} (PPAR{alpha}tr) (46) exhibit a dominant negative activity on the wild-type receptor. In particular, it is interesting to note that PPAR{alpha}tr, which arises from skipping of exon 6 of the human PPAR{alpha} gene, possesses a structure very close to that of hMR{Delta}5,6 but is unable to bind to a consensus DNA element and to activate transcription. This difference might be due to the fact that for PPAR{alpha} the C-terminal part of the receptor is required for heterodimerization and therefore for DNA binding (47). In MR, which binds as homodimer or MR/GR heterodimer to a GRE (3, 20, 21), one region involved in dimerization has been mapped to the DNA-binding domain (21), which is conserved in hMR{Delta}5,6. However, no heterodimerization between hMR{Delta}5,6 and hMR was observed under our experimental conditions. This implies that either hMR{Delta}5,6 binds DNA and activates transcription as a monomer or that elements conserved in the DNA-binding domain (DBD) are sufficient for homodimerization but not for heterodimerization, which requires regions located in the hinge region or in the ligand-binding domain (LBD). Furthermore, our results indicate that the observed modulation of wild-type hMR or hGR effects by hMR{Delta}5,6 might result from synergistic activation of response elements or from modification of intracellular receptor localization, rather than from heterodimerization. Additional experiments, investigating interactions of hMR{Delta}5,6 with DNA and intracellular trafficking of the receptors, are needed to fully elucidate this aspect.

Concerning the particular functional characteristics of hMR{Delta}5,6, it is also worth noting that truncation of the ligand binding domain of the GR yields a constitutively active protein with partial transcriptional function (48). However, the presence of a short amino acid stretch after the DNA-binding domain is required for transactivation. In this context it might be hypothesized that the 35 additional C-terminal residues of hMR{Delta}5,6, although unrelated, are important for the correct folding of the two zinc fingers. The lack of the C-terminal part of hMR not only abolishes the ligand- binding domain, which in the absence of hormone normally locks the receptor in an inactive conformation, but also the region interacting with heat shock protein 90, which acts as a molecular chaperone for many steroid receptors and could also play a role in the nucleo-cytoplasmic shuttling (49). Indeed, whereas the other steroid receptors are localized in the nucleus in the absence of hormone, MR has been shown to reside predominantly in the cytoplasm in the absence of ligand and to translocate into the nucleus upon addition of aldosterone (50, 51). Given that a hormone-independent nuclear localization signal is present in the second zinc finger of the rat GR DBD (52), one could speculate that an analogous signal allows hMR{Delta}5,6, whose activity is no more repressed by the LBD, to be present in the nucleus in the absence of ligand.

Our study has shown that hMR{Delta}5,6 is capable of recruiting coactivators such as SRC1, TIF1{alpha}, and RIP140 that enhance its transcriptional property. Although these factors were isolated for binding to the LBD of nuclear receptors, including hMR (53), in the presence of hormone, it has subsequently been shown that SRC1 interacts also with the A/B domain of the PR in a ligand-independent manner and that it is able to mediate transcriptional enhancement by both the AF1 and AF2 of ER and GR to a similar extent (27). Furthermore, SRC1 can be recruited in a ligand-independent manner by ERß through phosphorylation of the AF1 (28). Two particular serine residues, one of which is contained in a motif also present in other steroid receptors, are critical for this interaction. By analogy, TR-ß2 binds CREB-binding protein, SRC1, and pCIP in the absence of thyroid hormone through a domain located between amino acids 1–50 of the receptor, whereas this is not the case for TR-ß1 and TR-{alpha}1 (30). Alignment of the amino-terminal regions of ERß, TR-ß2, PR, GR, and MR shows some amino acid conservation, in particular a GXP motif at position 232 and a SP motif at position 283 of the hMR, the latter being localized in the AF1 core of the GR (54). These motifs might correspond to putative structural segments responsible for interaction with coactivators. Indeed it was suggested that the proper assembly of the individual activation functions AF1 and AF2 is necessary to render the steroid receptor-DNA complex transcriptionally productive (55), thus allowing functional synergism between AF1 and AF2 (29), and that this assembly might depend on coactivators (27).

In conclusion, it appears that corticosteroid function in target tissues is regulated by a complex cascade of events. In addition to regulation of intracellular hormone availability, differential transcriptional regulation of hMR expression by alternative promoter usage, and interaction of GR and MR variants, the generation of MR isoforms by alternative splicing appears to modulate the final transcriptional response. Although MR- and GR-mediated effects are not redundant, as shown by inactivation of single receptors in mice (56, 57), interaction between the mineralocorticoid- and glucocorticoid-signaling pathways certainly has major functional significance in many physiological processes. It will be of interest to analyze whether modifications of expression of hMR isoforms are involved in pathological processes.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Isolation and Characterization of cDNA Clones
A human heart cDNA library panel in the expression vector pCMV6-XL4 (Rapid-Screen cDNA library panels, Origene, Rockville, MD) was screened by subsequent rounds of PCR using exon-specific primers following manufacturer’s instructions. For one PCR, a vector-specific sense primer was used in combination with a hMR-specific antisense primer located in exon 1{alpha} to screen a 96-well master plate containing 5,000 cDNA clones per well; the other primers were located in exons 6 and 8, respectively. hMR primers were as follows [23-mers, numbering corresponds to the position of the 5'-nucleotide according to the published hMR cDNA sequence (2), S identifies primers in the sense orientation and A in the antisense orientation]: A180; S2601 and A2980; the vector-specific primer VP3 was 5'-GCAGAGCTCGTTTAGTGAACC-3'. Ninety six-well subplates containing bacterial glycerol stocks of cDNAs contained in positive wells diluted at 50 clones per well were subsequently screened by PCR using the same primer pairs. PCR was performed using Platinum Taq DNA polymerase (Life Technologies, Inc., Paisley, UK) in the following conditions: one step at 94 C for 5 min followed by 35 cycles of 94 C for 45 sec, 60 C or 56 C for 45 sec, and 72 C for 45 sec, and one step at 72 C for 7 min. Bacterial glycerol stocks of positive wells were seeded at a density of 5,000 colonies per Petri dish, grown at 30 C overnight and hybridized with hMR exon-specific probes or with a 1.7-kb EcoRI hMR restriction fragment using standard techniques. DNA of positive clones was analyzed by restriction enzyme digestion with NotI and EcoRI and sequencing.

RNA Extraction and RT-PCR Analysis
Total RNA was obtained from different human tissues using standard techniques (Trizol, Life Technologies, Inc.), and 3 µg were first treated with DNAse I (Life Technologies, Inc.) to eliminate possible contaminations and then reverse transcribed using Superscript Reverse Transcriptase and oligo dT16 primer (Life Technologies, Inc.) in a final volume of 20 µl, as recommended by the manufacturer. Primers used for PCR amplification were S2136 and A2824 (23-mers). cDNA was subsequently amplified using Platinum Taq DNA polymerase (one step at 94 C for 5 min followed by 30 cycles of 94 C for 45 sec, 58 C for 45 sec, and 72 C for 1 min, and one step at 72 C for 7 min). Products were separated on 3% agarose gel and visualized by ethidium bromide staining.

Real-Time Quantitative PCR
Real-time quantitative PCR analysis of hMR variants was carried out on an ABI7700 Sequence Detector (Applied Biosystems, Foster City, CA). Taqman probe and primers (Eurogentec, Seraing, Belgium) were as follows:

upper primer: 5'-TTATGTGCTGGAAGAAATGATTGC-3'

lower primers: hMR 5'-AACTTCTTTGACTTTCGTGCTCCT-3'

hMR{Delta}5,6 5'-CAGACTGATGCATCTTCTCTCTCCTA-3'

TaqMan probe: 5'-FAM CATTGATAAGATTCGACGAAAGAATTGTCT TAMRA-3'.

cDNA was generated as described above using 250 ng of random hexamers (Promega Corp., Madison, WI). For each experiment, one-tenth of the reverse transcription reaction was used for PCR in the presence of 5 mM MgCl2, 200 µM deoxynucleoside triphosphates (dNTPs), and 1.25 U Taq polymerase. Final primers and probe concentrations were 400 nM for each primer and 100 nM probe. PCR reagents were from Eurogentec (Seraing, Belgium). Reaction parameters were 95 C for 10 min followed by 40 cycles at 95 C, 15 sec and 55 C, 1 min. These conditions were chosen after an assay optimization study, in which different concentrations of MgCl2, primers, and probe were tested. For preparation of standards, restriction fragments covering exon 4 to 7 of hMR and hMR{Delta}5,6 were purified from agarose gel, and DNA concentration was accurately quantified by spectrofluorometry using Hoechst 33258 trihydrochlorid [Sigma, St. Louis, MO (58)]. Standard curves were generated using serial dilutions of purified fragments spanning 5 orders of magnitude, yielding correlation coefficients of at least 0.98 in all experiments. Each standard and sample values were determined in triplicate in one to three independent experiments. hMR{Delta}5,6 expression within a given tissue was calculated relative to wild-type hMR, and results were represented as relative hMR{Delta}5,6/hMR expression compared with the heart, which was chosen as the calibrator.

In Vitro Transcription and Translation
In vitro transcription and translation were accomplished using the TNT Quick Coupled Transcription/Translation system (Promega Corp., Madison, WI) according to the manufacturer’s protocol. Recombinant pCMV6-hMR{Delta}5,6 containing hMR{Delta}5,6 or recombinant pcDNA3-hMR containing a 3 kb hMR XmaIII-AflII fragment inserted into pcDNA3 (Invitrogen, San Diego, CA) (59) was used as a template for transcription with T7 polymerase followed by translation with [35S]-methionine (1,000 Ci/mmol, Amersham Pharmacia Biotech, Les Ulis, France). Radioactive products were analyzed on a 10% SDS-polyacrylamide gel. Cold methionine was used for translation of proteins used in EMSAs.

Cell Culture and Transfection Procedures
Rabbit RCSV3 cells derived from kidney cortical collecting duct (60) were kindly provided by Dr. P. Ronco (Hôpital Tenon, Paris, France). Cells were grown in a defined medium composed of DMEM-Ham’s F12 supplemented with 5 µg/ml insulin, 5 µg/ml transferrin, 2 mM glutamine, 100 IU/ml penicillin and 100 µg/ml streptomycin, 20 mM HEPES, 50 nM sodium selenate, 50 nM dexamethasone, and 2% charcoal-stripped FCS. The cells were seeded in six-well plates at a density of 5 x 105 cells per well at least 6 h before transfection in fresh medium without any added steroid. For all transfection experiments, RCSV3 cells were used between passages 30 and 40.

Cells were cotransfected by the calcium phosphate method (61) with plasmid pCMV6-hMR{Delta}5,6 coding for hMR{Delta}5,6 and 1.25 µg of an MMTV-luciferase reporter construct (pF31luc, gift of Dr. H. Richard-Foy, Laboratoire de Biologie Moléculaire Eucaryote, CNRS, Toulouse, France), with or without expression plasmids coding for the human MR (pcDNA3-hMR) and GR (pRShGR) (gift of Dr. R. Evans, Howard Hughes Medical Institute, La Jolla, CA). Cotransfection of 0.5 µg pSVßgal (CLONTECH Laboratories, Inc.), a plasmid encoding for ß-galactosidase, was performed to normalize for transfection efficiencies. The day after transfection, cells were rinsed with PBS and steroids were added for 24 h. The cells were rinsed twice with cold PBS and lysed in 25 mM glycyl-glycine, pH 7.8, 1 mM EDTA, 1 mM dithiothreitol, 8 mM MgSO4, 1% Triton X100, 15% glycerol. Cellular extracts were assayed for luciferase (62) and ß-galactosidase (63) activities. Results were standardized for transfection efficiency and expressed as the ratio of luciferase activity over ß-galactosidase activity in arbitrary units.

For coactivator assays, 0.5 µg of hMR{Delta}5,6 was cotransfected in the same conditions as described above, together with 0.5 µg of expression vectors for steroid receptor coactivators 1a (SRC1a) and 1e (SRC1e), as well as RIP140 and hTIF1{alpha} (plasmids were kindly provided by Drs. V. Cavaillès, INSERM 4148, Montpellier, France, and M. G. Parker, Imperial Cancer Research Fund, London, UK).

Aldosterone and dexamethasone were purchased from Sigma.

EMSA
For EMSA, WCE were prepared from RCSV3 cells previously transfected with recombinant pCMV6-hMR{Delta}5,6 by the lipofectamine method (Life Technologies, Inc. Inc., Paisley, UK) and from Sf9 cells infected by recombinant baculovirus AcNPV-hMR containing the full-length hMR cDNA (64). Forty eight hours after transfection, cells were washed with cold PBS and homogenized in 20 mM HEPES, pH 7.9, 1,5 mM MgCl2, 0,6 M NaCl, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 25% glycerol and 0.1% protease, and phosphatase inhibitor cocktail (Sigma) by 20 strokes in a glass-glass Potter apparatus at 4 C. The homogenates were centrifuged at 15,000 rpm for 30 min at 4 C, and the supernatant was used as WCE. One microgram of recombinant pcDNA3-hMR, 1 µg recombinant pCMV6-hMR{Delta}5,6, or a combination of them (0.5 µg each) were in vitro translated in the presence of cold methionine, as described above. Gel mobility shift assays were performed essentially as described in Ref. 3 . Purified oligonucleotides were annealed and labeled with [{alpha}32P]dCTP (Amersham Pharmacia Biotech) using the Klenow fragment of DNA polymerase (Life Technologies, Inc., Paisley, UK) to a specific activity of approximately 108 cpm/µg of DNA. Unlabeled oligonucleotides were used as competitors. Oligonucleotides used in the gel mobility shift experiments are as follows:

GREcon: 5'-AGCTGCTCAGCTAGAACACTCTGTTCTCTACT-3'

and 5'-AGCTAGTAGAGAACAGAGTGTTCTAGCTAGC-3'.

Protein-DNA complexes were separated from free DNA by electrophoresis on nondenaturing 4.5% polyacrylamide gel in 0.25 x Tris-borate-EDTA buffer at 200 V for 1 h. Gels were dried and exposed to x-ray film at -80 C.

GST Pull-Down Assays
Plasmids containing the GST (pGEX2TK), GST fused to RIP140 (GST-RIP140), and GST fused to hTIF1{alpha} amino acid sequence 630–854 (GST-hTIF1{alpha}) were kindly provided by Dr. V. Cavaillès. GST-SRC1 encoding a fusion protein of GST with residues 570–780 of hSRC1 (common to both hSRC1a and hSRC1e isoforms) was provided by Dr. M. G. Parker. GST and GST fusion proteins were expressed, and proteins were prepared as previously described (31). An aliquot of crude bacterial extract containing GST fusion proteins was incubated for 30 min at 4 C with 100 µl glutathione-Sepharose beads, previously washed three times in 1:1 (vol/vol) NETN (0.5% Nonidet P-40, 1 mM EDTA, 20 mM Tris-HCl, pH 8.0, 100 mM NaCl). Glutathione-Sepharose beads were then washed three times with NETN. hMR{Delta}5,6 was transcribed and translated in vitro in the presence of 35S-methionine and incubated with the fusion proteins on glutathione-Sepharose beads for 1 h at 4 C. The beads were washed, suspended in 20 µl loading buffer, boiled for 3 min, and analyzed by SDS-PAGE. Signals were amplified with Entensify, and gels were autoradiographed at -80 C overnight.


    ACKNOWLEDGMENTS
 
We thank Dr. R. Evans for providing plasmid pRShGR and Dr. P. Ronco for RCSV3 cells, Drs. V. Cavaillès and M. G. Parker for coactivator plasmids, and Dr. R. Barouki for GRE oligonucleotides. We are grateful to Dr. M-E. Oblin for helpful discussion and to Dr. S. Millington for introduction to real time PCR. M.-C.Z. is indebted to M. Bonnefoy for his support.


    FOOTNOTES
 
Address requests for reprints to: Maria-Christina Zennaro, M.D., Ph.D., INSERM U 478, Faculté de Médecine Xavier Bichat, B.P. 416, 16, rue Henri Huchard, 75870 Paris Cedex 18, France. E-mail: zennaro{at}infobiogen.fr

This work was supported in part by a grant of the European Section of Aldosterone Council (ESAC).

Abbreviations: DBD, DNA-binding domain; GST, glutathione-S-transferase; GRE, glucocorticoid response element; 11HSD2, 11ß-hydroxysteroid dehydrogenase type II; LBD, ligand-binding domain; PPAR{alpha}tr, truncated form of PPAR{alpha}; RIP140, receptor interacting protein 140; SRC, steroid receptor coactivator; TIF1{alpha}, transcriptional intermediary factor 1{alpha}; WCE, whole-cell extract.

Received for publication September 6, 2000. Accepted for publication May 23, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Mangelsdorf DJ, Thummel C, Beato M, et al. 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  2. Arriza JL, Weinberger C, Cerelli G, et al. 1987 Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237:268–275[Abstract/Free Full Text]
  3. Lombes M, Binart N, Oblin M-E, Joulin V, Baulieu EE 1993 Characterization of the interaction of the human mineralocorticosteroid receptor with hormone responsive elements. Biochem J 292:577–583
  4. Tsai M-J, O’Malley B 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  5. Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121–41[Free Full Text]
  6. Zennaro M-C, Keightley MC, Kotelevtsev Y, Conway G, Soubrier F, Fuller PJ 1995 Human mineralocorticoid receptor genomic structure and identification of expressed isoforms. J Biol Chem 270:21016–21020[Abstract/Free Full Text]
  7. Zennaro M-C, Farman N, Bonvalet J-P, Lombes M 1997 Tissue-specific expression of {alpha} and ß messenger ribonucleic acid isoforms of the human mineralocorticoid receptor in normal and pathological states. J Clin Endocrinol Metab 82:1345–1352[Abstract/Free Full Text]
  8. Zennaro M-C, Le Menuet D, Lombès M 1996 Characterization of the human mineralocorticoid receptor gene 5'-regulatory region: evidence for differential hormonal regulation of two alternative promoters via non-classical mechanisms. Mol Endocrinol 10:1549–1560[Abstract]
  9. Le Menuet D, Viengchareun S, Penfornis P, Walker F, Zennaro MC, Lombes M 2000 Targeted oncogenesis reveals a distinct tissue-specific utilization of alternative promoters of the human mineralocorticoid receptor gene in transgenic mice. J Biol Chem 275:7878–7886[Abstract/Free Full Text]
  10. Verrey F 1995 Transcriptional control of sodium transport in tight epithelia by adrenal steroids. J Membrane Biol 144:93–110[Medline]
  11. Brilla CG, Matsubara LS, Weber KT 1993 Anti-aldosterone treatment and the prevention of myocardial fibrosis in primary and secondary hyperaldosteronism. J Mol Cell Cardiol 25:563–575[CrossRef][Medline]
  12. Young M, Fullerton M, Dilley R, Funder JW 1994 Mineralocorticoids, hypertension and cardiac fibrosis. J Clin Invest 93:2578–2583
  13. Robert V, Silvestre JS, Charlemagne D, et al. 1995 Biological determinants of aldosterone-induced cardiac fibrosis in rats. Hypertension 26:971–978[Abstract/Free Full Text]
  14. Penfornis P, Viengchareun S, Le Menuet D, Cluzeaud F, Zennaro MC, Lombes M 2000 The mineralocorticoid receptor mediates aldosterone-induced differentiation of T37i cells into brown adipocytes. Am J Physiol Endocrinol Metab 279:E386–E394
  15. Edwards CRW, Stewart PM, Burt D, et al. 1988 Localization of 11ß-hydroxysteroid dehydrogenase-tissue specific protector of the mineralocorticoid receptor. Lancet 2:986–989[CrossRef][Medline]
  16. Funder JW, Pearce PT, Smith R, Smith AI 1988 Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242:583–585[Abstract/Free Full Text]
  17. Arriza JL, Simerly RB, Swanson LW, Evans RM 1988 The neuronal mineralocorticoid receptor as a mediator of glucocorticoid response. Neuron 1:887–900[CrossRef][Medline]
  18. Lombes M, Kenouch S, Souque A, Farman N, Rafestin-Oblin M-E 1994 The mineralocorticoid receptor discriminates aldosterone from glucocorticoids independently of the 11ß-hydroxysteroid dehydrogenase. Endocrinology 135:834–840[Abstract]
  19. Hellal-Levy C, Couette B, Fagart J, Souque A, Gomez-Sanchez C, Rafestin-Oblin M 1999 Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralocorticoid receptors. FEBS Lett 464:9–13[CrossRef][Medline]
  20. Trapp T, Rupprecht R, Castrèn M, Reul JMHM, Holsboer F 1994 Heterodimerization between mineralocorticoid and glucocorticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron 13:1457–1462[CrossRef][Medline]
  21. Liu W, Wang J, Sauter NK, Pearce D 1995 Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc Natl Acad Sci USA 92:12480–12484[Abstract/Free Full Text]
  22. Bamberger CM, Bamberger AM, Wald M, Chrousos GP, Schulte HM 1997 Inhibition of mineralocorticoid activity by the ß-isoform of the human glucocorticoid receptor. J Steroid Biochem Mol Biol 60:43–50[CrossRef][Medline]
  23. Govindan MV, Warriar N 1998 Reconstitution of the N-terminal transcription activation function of human mineralocorticoid receptor in a defective human glucocorticoid receptor. J Biol Chem 273:24439–24447[Abstract/Free Full Text]
  24. Ludwig M, Bolkenius U, Wickert L, Bidlingmaier F 1998 Common polymorphisms in genes encoding the human mineralocorticoid receptor and the human amiloride-sensitive sodium channel. J Steroid Biochem Mol Biol 64:227–230[CrossRef][Medline]
  25. Arai K, Tsigos C, Suzuki Y, et al. 1994 Physiological and molecular aspects of mineralocorticoid action in pseudohypoaldosteronism: a responsiveness test and therapy. J Clin Endocrinol Metab 79:1019–1023[Abstract]
  26. Zennaro M-C, Lombès M 1998 Mineralocorticoid receptor isoforms. Curr Opin Endocrinol Diab 5:183–188
  27. Onate SA, Boonyaratanakornkit V, Spencer TE, et al. 1998 The steroid receptor coactivator-1 contains multiple receptor interacting and activation domains that cooperatively enhance the activation function 1 (AF1) and AF2 domains of steroid receptors. J Biol Chem 273:12101–12108[Abstract/Free Full Text]
  28. Tremblay A, Tremblay GB, Labrie F, Giguere V 1999 Ligand-independent recruitment of SRC-1 to estrogen receptor ß through phosphorylation of activation function AF-1. Mol Cell 3:513–519[CrossRef][Medline]
  29. Kobayashi Y, Kitamoto T, Masuhiro Y, et al. 2000 p300 Mediates functional synergism between AF-1 and AF-2 of estrogen receptor {alpha} and ß by interacting directly with the N-terminal A/B domains. J Biol Chem 275:15645–15651[Abstract/Free Full Text]
  30. Oberste-Berghaus C, Zanger K, Hashimoto K, Cohen RN, Hollenberg AN, Wondisford FE 2000 Thyroid hormone-independent interaction between the thyroid hormone receptor ß2 amino terminus and coactivators. J Biol Chem 275:1787–1792[Abstract/Free Full Text]
  31. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  32. Cavailles V, Dauvois S, L’Horset F, et al. 1995 Nuclear factor RIP140 modulates transcriptional activation by the estrogen receptor. EMBO J 14:3741–3751[Medline]
  33. Thenot S, Henriquet C, Rochefort H, Cavailles V 1997 Differential interaction of nuclear receptors with the putative human transcriptional coactivator hTIF1. J Biol Chem 272:12062–2068[Abstract/Free Full Text]
  34. Funder JW 1993 Aldosterone action. Annu Rev Physiol 55:115–130[CrossRef][Medline]
  35. Geller DS, Rodriguez-Soriano J, Vallo Boado A, et al. 1998 Mutations in the mineralocorticoid receptor gene cause autosomal dominant pseudohypoaldosteronism type I. Nat Genet 19:279–81[CrossRef][Medline]
  36. Geller DS, Farhi A, Pinkerton N, et al. 2000 Activating mineralocorticoid receptor mutation in hypertension exacerbated by pregnancy. Science 289:119–123[Abstract/Free Full Text]
  37. Kwak SP, Patel PD, Thompson RC, Akil H, Watson SJ 1993 5'-heterogeneity of the mineralocorticoid receptor messenger ribonucleic acid: differential expression and regulation of splice variants within rat hippocampus. Endocrinology 133:2344–2350[Abstract]
  38. Bloem LJ, Guo C, Pratt JH 1995 Identification of a splice variant of the rat and human mineralocorticoid receptor genes. J Steroid Biochem Mol Biol 55:159–162[CrossRef][Medline]
  39. Ducouret B, Tujague M, Ashraf J, et al. 1995 Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals. Endocrinology 136:3774–3783[Abstract]
  40. Takeo J, Hata J, Segawa C, Toyohara H, Yamashita S 1996 Fish glucocorticoid receptor with splicing variants in the DNA binding domain. FEBS Lett 389:244–248[CrossRef][Medline]
  41. Zhou MY, Gomez-Sanchez CE, Gomez-Sanchez EP 2000 An alternatively spliced rat mineralocorticoid receptor mRNA causing truncation of the steroid binding domain. Mol Cell Endocrinol 159:125–31[CrossRef][Medline]
  42. Fuqua SA, Fitzgerald SD, Chamness GC, et al. 1991 Variant human breast tumor estrogen receptor with constitutive transcriptional activity. Cancer Res 51:105–109[Abstract/Free Full Text]
  43. Fujimoto J, Ichigo S, Hirose R, Hori M, Tamaya T 1997 Expression of estrogen receptor exon 5 splicing variant (ER E5SV) mRNA in gynaecological cancers. J Steroid Biochem Mol Biol 60:25–30[CrossRef][Medline]
  44. Koenig RJ, Lazar MA, Hodin RA, et al. 1989 Inhibition of thyroid hormone action by a non-hormone binding c-erbA protein generated by alternative mRNA splicing. Nature 337:659–661[CrossRef][Medline]
  45. Ebihara K, Masuhiro Y, Kitamoto T, et al. 1996 Intron retention generates a novel isoform of the murine vitamin D receptor that acts in a dominant negative way on the vitamin D signaling pathway. Mol Cell Biol 16:3393–3400[Abstract]
  46. Gervois P, Torra IP, Chinetti G, et al. 1999 A truncated human peroxisome proliferator-activated receptor {alpha} splice variant with dominant negative activity. Mol Endocrinol 13:1535–1549[Abstract/Free Full Text]
  47. Ijpenberg A, Jeannin E, Wahli W, Desvergne B 1997 Polarity and specific sequence requirements of peroxisome proliferator-activated receptor (PPAR)/retinoid X receptor heterodimer binding to DNA. A functional analysis of the malic enzyme gene PPAR response element. J Biol Chem 272:20108–20117[Abstract/Free Full Text]
  48. Hollenberg SM, Giguere V, Segui P, Evans RM 1987 Colocalization of DNA-binding and transcriptional activation functions in the human glucocorticoid receptor. Cell 49:39–46[CrossRef][Medline]
  49. Pratt WB 1997 The role of the hsp90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Annu Rev Pharmacol Toxicol 37:297–326[CrossRef][Medline]
  50. Robertson NM, Schulman G, Karnik S, Almemri E, Litwack 1993 Demonstration of nuclear translocation of the mineralocorticoid receptor (MR) using an anti-MR antibody and confocal later scanning microscopy. Mol Endocrinol 7:1226–1238[Abstract]
  51. Lombes M, Binart N, Delahaye F, Baulieu EE, Rafestin-oblin ME 1994 Differential intracellular localization of human mineralocorticosteroid receptor on binding of agonists and antagonists. Biochem J 302:191–197
  52. DeFranco DB, Madan AP, Tang YT, Chandran UR, Xiao NT, Yang J 1995 Nucleocytoplasmic shuttling of steroid receptors. In: Litwack G, ed. Vitamins and hormones—advances in research and applications. New York: Academic Press Inc; 315–338
  53. Hellal-Levy C, Fagart J, Souque A, Wurtz JM, Moras D, Rafestin-Oblin ME 2000 Crucial role of the H11–H12 loop in stabilizing the active conformation of the human mineralocorticoid receptor. Mol Endocrinol 14:1210–1221[Abstract/Free Full Text]
  54. Warnmark A, Gustafsson JA, Wright AP 2000 Architectural principles for the structure and function of the glucocorticoid receptor {tau} 1 core activation domain. J Biol Chem 275:15014–15018[Abstract/Free Full Text]
  55. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906[CrossRef][Medline]
  56. Berger S, Bleich M, Schmid W, et al. 1998 Mineralocorticoid receptor knockout mice: pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95:9424–9429[Abstract/Free Full Text]
  57. Cole TJ, Blendy JA, Monaghan AP, et al. 1995 Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 9:1608–1621[Abstract/Free Full Text]
  58. Labarca C, Paigen K 1980 A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102:344–352[CrossRef][Medline]
  59. Massaad C, Houard N, Lombes M, Barouki R 1999 Modulation of human mineralocorticoid receptor function by protein kinase A. Mol Endocrinol 13:57–65[Abstract/Free Full Text]
  60. Vandewalle A, Lelongt B, Geniteau-Legendre M, et al. 1989 Maintenance of proximal and distal cell functions in SV40-transformed tubular cell lines derived from rabbit kidney cortex. J Cell Physiol 141:203–221[CrossRef][Medline]
  61. Graham FL, van der Eb AJ 1973 A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456–467[CrossRef][Medline]
  62. deWet JR, Wood KV, Deluc