| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institute of Reproductive and Developmental Biology, Imperial College School of Medicine, Hammersmith Hospital (M.C., J.J.B.), London, United Kingdom W12 0NN; IHF Institute for Hormone and Fertility Research, University of Hamburg (Y.P., R.K., B.G.), 22529 Hamburg, Germany
Address all correspondence and requests for reprints to: Dr Jan Brosens, Institute of Reproductive and Developmental Biology, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom W12 0NN. E-mail: j.brosens{at}ic.ac.uk
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Decidual PRL gene transcription requires activation of a
tissue-specific promoter located approximately 5.7 kb upstream of the
pituitary-specific PRL promoter at an additional noncoding exon 1A
(2, 10). Transient transfection studies in primary ES
cells have shown that the dPRL promoter is inducible upon treatment
with cAMP (2, 8). After a lag period of approximately
2 d, progestins markedly enhance cAMP-induced promoter activity
(1). Recently, we demonstrated that PKA activation of the
dPRL promoter is mediated through the induction and binding of
CCAAT/enhancer-binding protein-ß (C/EBPß) to two overlapping
consensus C/EBP-binding sites in the proximal promoter region
(11). C/EBPs belong to the basic region/leucine zipper
(bZIP) group of transcription factors. To date, six members of the
C/EBP family have been identified and are denoted C/EBP-
, -ß,
-
, -
, -
, and -
(reviewed in Ref. 12), of which
C/EBPß is a major isoform in human endometrial stromal cells. From a
single C/EBPß mRNA, two protein isoforms can be generated by a leaky
ribosomal scanning mechanism involving three methionine residues.
Liver-enriched activatory protein (LAP) with a molecular mass of
33.536 kDa is initiated at Met1 and
Met24, whereas the 16-kDa protein liver-enriched
inhibitory protein (LIP) results from translational initiation at
Met199. LIP lacks the trans-activation
domain that is present in LAP and acts as a potent repressor of
LAP-induced transcriptional activation (13). C/EBPß has
been shown to regulate the differentiation and function of a variety of
cells, including adipocytes (14, 15, 16) granulosa cells
(17), cells of the lymphoid and hemopoietic lineages
(18), and the mammary gland epithelium
(19).
The mechanism underlying the synergistic cooperation between progestins and cAMP in the activation of the dPRL promoter is not understood. The PR is a member of the superfamily of ligand-activated transcription factors that bind to sequence-specific DNA-binding sites in the promoter of target genes. Two isoforms exist, PR-A and PR-B, which arise from different promoter usage in a single gene (20). PR-B differs from PR-A in that it contains an additional 164 amino acids at the N-terminus [B-upstream sequence (BUS)]. Although the PR isoforms display indistinguishable hormone and DNA binding, several studies have shown that, depending on the cell and promoter context, PR-A and PR-B have remarkably different transcriptional activities (21, 22, 23, 24). In general, the PR-A isoform is transcriptionally less active and functions as a dominant inhibitor of transcription by PR-B and various other steroid receptors. Various models exist to explain the weak trans-activation potential of PR-A compared with PR-B. PR-A shares with PR-B the activation functions activating factor-1 (AF-1) and AF-2, but lacks AF-3, which is situated in the BUS segment specific to PR-B (25). AF-1 is a constitutive activation domain N-terminal to the DNA-binding domain (DBD), while the ligand-dependent activation function AF-2 is located in the ligand-binding domain (LBD) (26). The N-terminal segment of PR-A harbors an inhibitory function, termed IF or ID, which represses AF-1 or AF-2, but not AF-3. Removal of IF/ID converts PR-A into a strong transcriptional activator. The BUS domain is thought to repress IF/ID, thereby rendering PR-B a much more potent activator of transcription than PR-A (27). The lower trans-activation potential of PR-A may also be a result of its higher affinity for the corepressor silencing mediator of retinoid and thyroid hormone receptor and its less efficient recruitment of the coactivator steroid receptor coactivator-1 (28).
In addition to direct transcriptional activation through binding of the
activated receptor with its cognate DNA response element, PR and other
nuclear receptors are also capable of modulating the activity of other
classes of transcription factors through DNA binding-independent
mechanisms. For instance, direct interaction between activated PR and
the proinflammatory factor, nuclear factor-
B, has been shown to
result in reciprocal transcriptional repression (29).
Furthermore, a variety of nuclear receptors, including GR, ER
, AR,
and RAR, have been shown to bind to C/EBPß (30).
Interestingly, although ER
and RAR act to repress C/EBPß-dependent
transcription (15, 31), GR enhances C/EBPß
trans-activation (30, 32).
These observations raise the possibility that functional interaction between liganded PR and C/EBPß could mediate the enhancement of dPRL promoter activity in response to progestin treatment. We now demonstrate that both PR isoforms physically interact with the C/EBPß isoforms, LAP and LIP, in in vitro association studies. We show that PR-A enhances LAP trans-activation of a model C/EBP-responsive reporter construct as well as the proximal dPRL promoter, and that LIP potently enhances PR-B-dependent transcription of promoters driven by palindromic progesterone response elements (PREs). Our results reveal the unique complexity of C/EBPß and PR cross-coupling and demonstrate that, dependent upon the promoter context, the supposed transcriptional repressors PR-A and LIP are functional coactivators of LAP and PR-B, respectively.
| RESULTS |
|---|
|
|
|---|
|
(data
not shown). The dPRL(-332/-270)/-32/luc3 was also activated in
PR-transfected cells incubated with progesterone, demonstrating that
the response to MPA was not due to its glucocorticoid-like activity
(data not shown).
|
, GR, and AR (30). This was confirmed by
in vitro protein binding studies demonstrating specific
interactions between glutathione-S-transferase (GST)-LAP
fusion protein and both PR isoforms (Fig. 3
|
PR-A Synergistically Enhances LAP- Dependent Transcription
Physical interaction between PR and C/EBPß does not
necessarily imply functional cooperation. To determine whether
C/EBPß-responsive promoters are modulated by PR, ES cells were
transiently transfected with the reporter construct NFIL6RE/-32/luc3,
carrying a single consensus C/EBP-binding site (see Fig. 1
), and an
expression vector for LAP, LIP, PR-A, or PR-B, or a combination of
these. As expected, overexpression of LAP elicited an increase in
NFIL6RE/-32/luc3 activity (9-fold), but LIP had no effect (Fig. 4
). Remarkably, exogenously expressed
PR-B elicited an 18-fold induction in NFIL6RE/-32/luc3 activity upon
treatment with MPA. Furthermore, coexpression of LIP or LAP had little
or no effect on ligand-bound PR-B trans-activation of this
promoter-reporter construct. However, activated PR-B and, to a lesser
extent, LAP also induced the minimal dPRL promoter (dPRL-32/luc3; Fig. 4A
) and the promoterless vector pGL3-Basic (data not shown), resulting
in a qualitative response identical, albeit less pronounced, to that
observed with the NFIL6RE/-32/luc3 construct. Although PR-A also
triggered NFIL6RE/-32/luc3 activity (12-fold) upon hormone binding,
the response in the presence of C/EBPß isoforms was profoundly
different from that observed with PR-B. First, PR-A cooperated with LAP
in activating NFIL6RE/-32/luc3 in the absence of ligand, and this
cooperation was further enhanced upon hormone binding, resulting in a
63-fold increase in luciferase activity. Second, PR-A
trans-activation of NFIL6RE/-32/luc3 was abolished by
coexpressed LIP. Finally, PR-A had no effect on dPRL-32/luc3 activity
in the presence or absence of ligand. These observations indicate that
PR-A enhances NFIL6RE/-32/luc3 activity when LAP, but not LIP, is
bound to its cognate response element. In contrast, the response to
PR-B appears largely independent of the presence of the high affinity
C/EBPß-binding site.
|
LIP Synergistically Enhances PR-B Trans-Activation
Next, we examined whether cross-coupling between PR and C/EBPß
was reciprocated on PR-responsive promoters. ES cells were transfected
with the mouse mammary tumor virus (MMTV) promoter, which possesses
several consensus palindromic PREs, multiple PRE half-sites, and
response elements for other transcription factors (33).
Figure 5A
demonstrates that the MMTV
promoter was induced 17-fold by liganded PR-B, but only 4-fold by
activated PR-A. Overexpression of LIP alone had no effect on promoter
activity, but coexpression of LIP and PR-B produced a 256-fold
induction in the presence of ligand. It is noteworthy that in the
absence of coexpressed PR, luciferase activity was enhanced 15-fold by
transfected LAP in untreated cells and 24-fold in MPA-treated cells.
Coexpression of PR-B and LAP yielded 32- and 58-fold increases in
promoter activity in the absence or presence of ligand, respectively.
These results indicate that LAP and liganded PR-B had additive effects
on MMTV/luc activity, whereas LIP synergistically enhanced PR-B
trans-activation.
|
We also tested whether LIP could potentiate PR
trans-activation of a synthetic promoter construct
consisting of two palindromic PREs upstream of the minimal dPRL
promoter region (PRE/-32/luc3; see Fig. 1
). Figure 5B
demonstrates
that the pattern of PRE/-32/luc3 activity was comparable to that
observed with the MMTV promoter. PRE/-32/luc3 activity was weakly
induced by MPA in the absence of cotransfected PR, which may reflect
activation of endogenous PR. Overexpression of PR-A, LAP, or LIP alone
had little or no additional effect on PRE/-32/luc3 activity. However,
liganded PR-B activated the promoter 9-fold, and coexpression of
LIP yielded a 24-fold increase in luciferase activity. In contrast,
LAP had little or no effect on PR trans-activation,
confirming the unique role of LIP in selectively amplifying
PR-B-dependent transcription.
Effect of Binding Site Mutations on PR- and C/EBP-Dependent
Induction of dPRL-332/-270
The preceding experiments described the functional consequences of
PR and C/EBPß interaction on the activation of isolated consensus
response elements. Next, we investigated whether C/EBPß-PR
crosscoupling could be relevant for the transcriptional
control of the C/EBPß-responsive region (-332/-270) of the dPRL
promoter. Directed mutation of the PRE-half site
[dPRL(-332/-270PREmut)/-32/luc3] or C/EBPß-binding sites
[dPRL(-332/-270DBmut)/-32/luc3] within this region allowed
assessment of their relative contributions to C/EBPß-PR
crosscoupling (Fig. 1
).
Overexpression of LAP activated the wild-type C/EBPß-responsive
region [dPRL(-332/-270wt)/-32/luc3] 7-fold, whereas LIP had no
discernable effect (Table 1
). In the
absence of functional C/EBPß-binding sites, LAP
trans-activation was virtually abolished, but mutation of
the PRE half-site had no such effect. The dPRL(-332/-270wt)/-32/luc3
construct was activated 9-fold by PR-B and 4-fold by PR-A upon MPA
treatment, confirming our initial experiments (Fig. 2
). Interestingly,
both liganded PR isoforms were capable of trans-activating
the dPRL(-332/-270DBmut)/-32/luc3 construct to the same extent as
the wild-type construct, whereas induction of
dPRL(-332/-270PREmut)/-32/luc3 activity was reduced. Coexpression of
LAP and liganded PR-B had an additive effect on activation of both
the dPRL(-332/-270wt)/-32/luc3 and
dPRL(-332/-270PREmut)/-32/luc3 constructs. However, in the absence
of functional C/EBPß-binding sites, LAP actually inhibited the
response to activated PR-B. Conversely, LIP had little or no effect on
PR-B-dependent trans-activation, but consistently inhibited
liganddependent activation of the three constructs tested in
PR-A-transfected cells. Together these data suggest that activated PR
can interact with the isolated PRE half-site, although this interaction
appears to be impaired when the B-isoform is tethered to LAP or when
LIP is bound to the A-isoform. Furthermore, the inability of LIP to
significantly enhance PR-B trans-activation indicates that
the incomplete PRE is insufficient to sustain cooperation between these
two factors. In contrast, cotransfection of both LAP and PR-A yielded a
26-fold increase in dPRL(-332/-270wt)/-32/luc3 activity upon
treatment. The synergy between LAP and activated PR-A was abolished in
the absence of functional C/EBPß-binding sites, but was reduced by
approximately 40% in the presence of a mutant PRE half-site. Hence,
within the context of the proximal dPRL promoter, transcriptional
cooperation between C/EBPß and PR is effected predominantly by the
two C/EBPß-binding sites and further modulated by the upstream
PRE-half site.
|
| DISCUSSION |
|---|
|
|
|---|
B family (37, 38), Ets-1 (39), the
basic helix-loop-helix factor E47 (40), retinoblastoma
protein (41), and various members of the nuclear receptor
superfamily (30, 31). We now demonstrate, by an in
vitro interaction assay of bacterially expressed proteins, that
C/EBPß also binds PR. This interaction was not altered by the
presence or absence of hormone. Both C/EBPß isoforms interacted with
both PR isoforms, indicating that the bZIP region of C/EBPß is
sufficient for interaction, and the BUS of PR-B is not required.
Deletion of the C-terminal 124 amino acids of PR
(PR-BLBM) did not abolish binding. Furthermore,
the DBD fused to BUS still exhibited interaction with LAP. These
observations indicate that the DBD of PR is the interface for contact
with the bZIP region of C/EBPß and explain why interaction in
vitro is ligand independent. Similar observations have been made
for other members of the steroid hormone family. For instance, both ER
and GR have been shown to bind C/EBPß in the presence and absence of
estrogen or dexamethasone, respectively (30, 31). ER
binding was found to be dependent on its DBD and the bZIP of C/EBPß.
In contrast, all domains of the GR, with the exception of the isolated
C-terminal LBD, have been shown to interact with C/EBPß in
vitro (30, 31). We have extended this observation and
demonstrated that the bZIP region of C/EBPß is adequate for
interaction with GR. Interaction of PR and C/EBPß has important consequences for the transcriptional regulation of their respective promoter response elements. We demonstrated that PR-B trans-activation of the MMTV promoter, which carries several palindromic PREs (42), was greatly enhanced by the addition of exogenous LIP. PR-B mutants lacking functional DNA- or ligand-binding properties failed to induce promoter activity, and coexpression of LIP did not restore their trans-activation potential. Interestingly, LAP also triggered MMTV promoter activity, indicating the presence of C/EBP-binding sites in the complex steroid-responsive region of the MMTV promoter. Hence, we examined the regulation of a defined synthetic promoter construct driven by two palindromic PREs (PRE/-32/luc3). Although this promoter construct was no longer inducible by LAP, transcriptional activation by liganded PR-B was still markedly enhanced by coexpressed LIP, demonstrating that DNA binding of PR-B, but not of LIP, is essential for cooperation. Liganded PR-A had little effect on either MMTV or PRE promoter activity in ES cells. Overexpressed LIP alone was also without effect, and the inability of PR-A to activate transcription could not be overcome by the addition of LIP. Together these results indicate that functional interaction between LIP and PR requires not only anchoring of activated PR to its cognate DNA response element, but also a domain or configuration specific to the B-isoform.
Conversely, activation of an isolated C/EBPß response element
(NFIL6RE/-32/luc3) by LAP was synergistically enhanced by PR-A in a
ligand-dependent manner. Surprisingly, both liganded PR isoforms
elicited promoter activity even in the absence of coexpressed LAP.
Although this may reflect interaction with endogenous LAP, the
activated B-isoform of the receptor also triggered reporter activity
from the control reporter constructs, pGL3-Basic and dPRL-32/luc3.
Furthermore, the pattern of activation of these control constructs by
PR-B in the presence of coexpressed C/EBPß was identical to that seen
with the NFIL6RE/-32/luc3 construct. Transcriptional stimulation in
the absence of high affinity response elements may be due to
interaction of the receptor with components of the general
transcription machinery, such as the TATA-binding protein-associated
factor dTAFII110 (43). Likewise, the
trans-activation domain of C/EBP, conserved among C/EBP
,
-ß, and -
, has also been shown to interact with the TATA-binding
protein and TFIIB (44) and may account for the discrete
activation of the promoterless constructs in response to overexpressed
LAP. No promoter-independent transcriptional effects were seen with
either LIP or PR-A, and synergy between LAP and activated PR-A was
entirely dependent upon the presence of the C/EBPß response element.
Mutation of the DBD or deletion of the C-terminal part of the LBD in
PR-A abrogated the synergy. The latter illustrates the ligand
dependency of the phenomenon, while the former points to a
conformational requirement in the DBD in vivo, which was not
essential for in vitro interaction. Discrepancies in the
domain requirements for protein-protein interactions derived from
in vitro data and from functional tests in living cells are
not uncommon. In the case of the thymidine kinase gene promoter, the
LBD of GR suffices for enhancement of promoter activity in response to
C/EBPß, although this region is not involved in the physical
association between GR and C/EBPß in GST pull-down assays
(30).
The -332/-270 region of the dPRL promoter responded to C/EBPß-PR cross-coupling in a manner similar, but not identical, to that observed with the isolated NFIL6RE. We demonstrated that the two overlapping C/EBPß-binding sites not only mediated activation by LAP, but were also essential for the amplification of this response by liganded PR-A. However, the PRE half-site immediately upstream of the C/EBPß-binding sites contributed to the functional interaction between LAP and PR-A. Directed mutation of this site not only reduced the level of synergy by approximately 40%, but also blunted trans-activation of this promoter region by either PR isoform, suggesting that PR may interact with its incomplete response element. Coexpressed PR-B and LAP had an additive effect on promoter activity in the presence of ligand, but the marked synergy between PR-B and LIP observed on PRE-driven reporters was absent. We can therefore conclude that LIP enhances PR-B transactivation only when the receptor is bound to DNA as a dimer.
The most salient finding of our study is that PR-A and LIP, which are both considered transcriptionally inactive and even antagonistic to other members of their respective families (13, 23), assume a coactivator role for active members of the opposite family. The mechanisms underlying such a functional switch are not clear. Possibly, interaction between liganded PR-A and DNA-bound LAP could facilitate the recruitment of other intermediate factors, resulting in the formation of a more productive transcriptional complex. An alternative possibility is that LAP might inactivate the inhibitory function (IF/ID) in the N-terminal segment of PR-A, promote interaction between the activation functions AF-1 and AF-2 in the receptor, and/or facilitate receptor-corepressor dissociation or coactivator recruitment. This model implies that LAP, when bound to DNA, can convert the A-isoform into a strong transcriptional activator. There was, however, no evidence that LAP could modulate the trans-activation potential of PR-A bound to its cognate response element. In contrast, LIP potently enhanced ligand-dependent trans-activation of dimerized DNA-bound PR-B. In a reconstituted cell-free expression system Klotzbücher et al. (45) identified a repressor domain in the Cterminal region of PR-B (comprising the hinge region plus LBD). Interestingly, repression could be relieved by the addition of an activity from rat liver, which the authors termed COPRA (cofactor of PR activation). COPRA resided in a partially purified column fraction obtained during isolation of general transcription factors from rat liver extracts and has not been further characterized (45). As rat liver is a very rich source of C/EBPs, including LAP and LIP (13), it is tempting to speculate that COPRA is LIP or a related factor. A final possibility is that cross-talk between these nuclear factors is effected by a nongenomic mechanism. We previously demonstrated that the dPRL-332/-270 region forms a specific complex with nuclear proteins from differentiated ES cells (11). However, additional EMSA with supershift analysis failed to demonstrate PR within this nucleoprotein complex (data not shown). This may be due to the PR-C/EBPß-DNA complex being stable in vivo, but less stable than the C/EBPß-DNA complex in vitro, under EMSA conditions. Alternatively, other processes, such as nuclear targeting or intranuclear compartmentalization, may mediate cooperation between PR and C/EBPß.
Transcriptional cross-coupling between C/EBPß and PR could explain the overlap in reproductive phenotypes observed in knockout mice. Both PR- and C/EBPß-deficient mice fail to ovulate and have impaired mammary gland development (17, 19, 46, 47). Recently, the distinct functions of PR-A and PR-B have been defined by selective ablations. In the mammary gland, PR-B is sufficient for normal proliferation and differentiation of the epithelium in response to progesterone, whereas both receptor isoforms are essential for ovulation (46, 48). In the mouse uterus, PR-A not only mediates the antiproliferative effect of progesterone on the epithelium, but is also essential for the decidualization of the stromal compartment. In human endometrium, decidual transformation also coincides with a marked down-regulation of PR-B, but not PR-A (49), rendering PR-A the predominant isoform in decidualized stromal cells (50). Although endometrial C/EBPß expression has not yet been studied in vivo, we previously demonstrated that LAP is induced in human ES cell cultures upon treatment with a decidualizing stimulus (11). Hence, the necessary components for coordinated activation of the dPRL gene are likely to be present in differentiating ES cells (1, 11). Notably, another marker gene of decidualization, IGF-binding protein-1, has recently been reported to be more effectively activated by PR-A than by PR-B in response to progestin (51).
Our results imply that the relative ratios of C/EBPß and PR isoforms are important determinants of the cellular responses to ovarian progesterone. Within this model, the high level of circulating progesterone in the secretory phase of the cycle and during pregnancy, instead of eliciting expression of PRE-driven genes, could be of critical importance for enhancing C/EBPß-dependent transcription through activation of PR-A. However, recent evidence from our laboratory indicates that other transcription factors, such as STAT5 and FKHR (forkhead homolog in rhabdomyosarcoma), are also mediators of the PKA response in differentiating ES cells (Mak, I., J. Brosens, M. Christian, F. Hills, L. Regan, and J. White, manuscript in preparation). Both STAT5 and FKHR have been shown to associate with PR (33, 52). Hence, it appears likely that coordinated and sustained expression of the decidual phenotype is effected by diverse interactions between activated PR and decidua-specific nuclear proteins.
Activation of the dPRL promoter is highly cell specific, and therefore we have limited this study to human ES cells. Conceivably, PR-C/EBPß cross-talk may be relevant to the pathophysiology of hormone-dependent disorders of the reproductive tract that are characterized by aberrant expression of either transcription factor. For instance, altered isoforms ratios have been described for PR and C/EBPß in human breast cancers where a significant proportion of tumors have elevated levels of PR-A or LIP (53, 54). Another example is endometriosis, a common and debilitating disease during reproductive years. This disease is defined by the presence of ectopic endometrial implants and a low grade sterile inflammatory response (55). PR-A is thought to be the only receptor isoform expressed in the ectopic lesions (56), which may contribute to the aberrant expression of C/EBPß-dependent proinflammatory genes, such as IL-6 and IL-8 (57, 58).
In conclusion, we have defined novel functions for PR-A and LIP by demonstrating their ability to assume the role of transcriptional coactivators of LAP and PR-B, respectively, and provided a mechanistic basis for the progesterone-dependent enhancement of cAMP-induced dPRL gene expression in endometrial stromal cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
was constructed by
excising the cDNA for human GR
from pRS-hGR (a gift from Ron Evans,
Howard Hughes Medical Institute, San Diego, CA) with
Acc65I/XhoI and inserting it into the
corresponding sites in pcDNA3.1+
(Invitrogen, Groningen, The Netherlands). The STAT5b
expression vector was constructed by excising STAT5b cDNA from
hSTAT5b-pEFplink (a gift from James Herrington, University of Michigan
Medical School, Ann Arbor, MI) with XhoI and ligation
into pcDNA3.1+ digested with XhoI. Cloning cDNAs into the vector pGEX-6P2 (Amersham Pharmacia Biotech, Little Chalfont, UK) generated GST fusion protein constructs. To construct pGEX/LAP, LAP cDNA was generated by PCR with Pfx polymerase (Life Technologies, Inc., Uxbridge, UK) using pSG/LAP as the template. Primers were: LAP-BAM-5, 5'-CAATTGGATCCCAACGCCTGGTGGCCTGGG-3' [sense; annealing to positions 322 relative to the ATG start codon, which was mutated to introduce a BamHI site (underlined)]; and C/EBPß-XHO-3, 5'-CATTGCTCGAGGCAGTGGCCGGAGGAGGCGAG-3' [antisense; annealing to positions 10151035, mutating the stop codon to introduce an XhoI site (underlined)]. The PCR product was cleaved with BamHI and XhoI and ligated into BamHI/XhoI-digested pGEX-6P2. To construct pGEX/LIP, LIP cDNA was generated by PCR with pSG/LIP as the template. The primer used was LIP-BAM-5, 5'-CAATTGGATCCGCGGCGGGCTTCCCGTACG-3' (sense; annealing to positions 598616 relative to the ATG start codon of LAP). The ATG of LIP (position 596 relative to LAP ATG) was mutated to introduce a BamHI site (underlined). The antisense primer used was C/EBPß-XHO-3 as described above. The resulting PCR product was cleaved with BamHI and XhoI, and ligated into BamHI/XhoI-digested pGEX-6P2. Sequencing confirmed that the inserts had been cloned in-frame with the GST gene.
pMMTV/luc, carrying the MMTV long terminal repeat upstream of the luciferase reporter gene, has been described previously (2).
All luciferase reporter constructs, with the exception of pMMTV/luc,
are in pGL3-Basic (Promega Corp., Southampton, UK; Fig. 1
). The reporter constructs dPRL-332/luc3,
dPRL(-332/-270)/-32/luc3, dPRL-32/luc3, and NFIL6RE/-32/luc3 have
been described previously (11).
The reporter construct dPRL(-332/-270wt)/-32/luc3 carries the
wild-type sequence between positions -332/-270 of the dPRL promoter
in front of the minimal dPRL promoter element between positions
-32/+65 and was constructed as follows. Oligonucleotides WT-s and
WT-as, corresponding to -332/-270 in the sense and antisense
directions, were designed and annealed such that a 5'-blunt end and a
3'-BglII-compatible overhang were created: WT-s,
5'-ATTATGTTCTGAGGGCTGCTCTGTGTGTTGTAAGATGTTTAGCAACATGTCTGGTCTCTGCTC-A-3';
and WT-as,
5'GATCT-GAGCAGAGACCAGACATGTTGCTAAACATCTTACAACACACAGAGCAG
CCCTCAGAACATAAT-3'. The PRE half-site is
underlined (coordinates -328/-323), two overlapping C/EBP
binding sites, D and B (-310/-297 and -298/-285) are doubly
underlined (11), and nucleotides forming the
BglII overhang are italicized. The
double-stranded oligonucleotide was inserted into the Ecl136
II/BglII sites of dPRL-32/luc3. Correspondingly, based on
WT-s and WT-as, oligonucleotides PREmut-s and PREmut-as were designed
to mutate the PRE half-site to TGgcCa (mutated bases are in
lowercase letters), and oligonucleotides DBmut-s and DBmut-as were used
to mutate C/EBP-binding sites D and B to
GTGTGTcGTAcGATGcTgAGCAtCAT. The resultant reporter
constructs dPRL(-332/-270PREmut)/-32/luc3 and
dPRL(-332/-270DBmut)/-32/luc3 are shown in Fig. 1
. The
progesterone-responsive reporter PRE/-32/luc3, containing two
palindromic PREs, has been described previously (59).
GST Pulldown Assays
The BL21-Trx E. coli strain expressing the protein
thioredoxin (60) was transformed with the appropriate pGEX
expression construct. GST or GST fusion proteins were induced with 0.1
mM
isopropyl-1-thio-ß-D-galactopyranoside added to
the bacterial culture when the OD600 was
0.60.8. After 1 h of
isopropyl-1-thio-ß-D-galactopyranoside
stimulation at 30 C, the proteins were extracted using the reagent
B-Per (Pierce Chemical Co., Rockford, IL) according to the
manufacturers protocol.
35S-Labeled proteins were prepared by the
in vitro transcription-translation method, using the TNT
T7-coupled reticulocyte lysate system according to the manufacturers
protocol (Promega Corp.). The presence of
[35S]methionine (>1000 Ci/mmol; Amersham Pharmacia Biotech) in the incubation mixture was used to produce
labeled GR
, human PR-B, and human PR-A proteins (from the plasmids,
pcDNA/GR
, pSG/hPR-B, and pSG/hPR-A, respectively).
GST fusion proteins were immobilized on glutathione-Sepharose beads (Amersham Pharmacia Biotech). Before use, the beads were washed four times with GST buffer [20 mM Tris (pH 7), 100 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 0.5% Nonidet P-40, and 0.5% fat-free dried milk] including Complete Protease Inhibitor (Roche, East Sussex, UK). The amount of GST, GST-LAP, or GST-LIP that was added to the beads was quantified using the 1-chloro-2, 4-dinitrobenzene (CDNB) assay (Amersham Pharmacia Biotech). This assay uses the GST enzyme catalysis of the conjugation of CDNB with glutathione and results in a CDNB-glutathione product with a strong molar absorption measured at 340 nm. Thus, the results of the CDNB assay were used to calculate the relative levels of GST activity in GST and the GST fusion proteins, and equal amounts were loaded on the beads. GST buffer was added to each sample, up to 1 ml, and incubated with gentle rocking for 1 h at room temperature. The immobilized GST proteins on the glutathione-Sepharose beads were washed six times with 1 ml GST buffer. For PR binding assays, 35S-labeled proteins were preincubated with 1 µM MPA for 2 h at 4 C where indicated. Fifty microliters of 35S-labeled in vitro transcription-translation product was added to the beads and made up to 1 ml with GST buffer. The beads were incubated for 1 h at room temperature, then washed six times with 1 ml GST buffer. Fifty microliters of Laemmli buffer were added, and the samples were boiled and then electrophoresed in a 10% SDS-polyacrylamide gel. Five microliters of the in vitro transcription-translation product were loaded on the gel as the input of 35S signal. The gel was dried, and proteins were visualized by autoradiography.
Primary ES Cell Culture
ES cells were isolated from normal proliferative endometrial
tissues obtained from cycling women, by endometrial biopsy, at the time
of diagnostic laparoscopy and hysteroscopy. Hammersmith and Queen
Charlottes Hospital research and ethics committee approved the study,
and patient consent was obtained before biopsy. Samples were collected
in Earles buffered saline containing 100 U/ml penicillin and 100
µg/ml streptomycin. The tissues were washed twice in a 1:1 mixture of
DMEM and Hams F-12 (Sigma, Poole, UK), finely minced,
and enzymatically digested with collagenase (134 U/ml) and
deoxyribonuclease type I (156 U/ml; Sigma) for 1 h at
37 C. After centrifugation at 400 x g for 4 min, the
pellet was resuspended in maintenance medium of DMEM/F-12 containing
10% dextran-coated charcoal-treated FBS (DCC-FBS), 1%
L-glutamine, and 1% antibiotic-antimycotic
solution. ES cells were separated from epithelial cells and passed into
culture as previously described (1, 9). Proliferating ES
cells were cultured in maintenance medium until confluence. Confluent
monolayers were treated in DMEM/F-12 containing 2% DCC-FBS with
10-6 M MPA
(Sigma). The progestin MPA was used in this study due to
its greater stability in culture relative to progesterone. All
experiments were carried out before the fourth cell passage.
Transfections
Transient transfections of ES cells plated at a density of
2.5 x 105 cells/well in 24-well plates were
performed by the calcium phosphate precipitation in medium supplemented
with 2% DCC-FBS. Reporter-promoter constructs and expression
constructs were transfected at concentrations of 0.5 µg/well and 125
ng/well, respectively. The empty expression vector pSG5 was included as
a filler construct when required. Details of the transfection protocol
and the treatments are indicated in the figure legends. Cell extracts
were harvested, and luciferase activity was measured with the
luciferase reagent kit (Promega Corp.) and expressed as
relative light units or fold induction. Transfections were performed in
triplicate and were repeated at least three times. Representative
experiments are shown (mean ± SD).
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: AF-1, Activating factor-1; BUS, B-upstream sequence; bZIP, basic region/leucine zipper; CDNB, 1-chloro-2, 4-dinitrobenzene; C/EBPß, CCAAT/enhancer-binding protein-ß; COPRA, cofactor of PR activation; DBD, DNA-binding domain; DCC-FBS, dextran-coated charcoal-treated FBS; dPRL, decidual PRL; ES, endometrial stromal; FKHR, forkhead homolog in rhabdomyosarcoma; GST, glutathione-S-transferase; LAP, liver-enriched activatory protein; LBD, ligand-binding domain; LIP, liver-enriched inhibitory protein; MMTV, mouse mammary tumor virus; MPA, medroxyprogesterone acetate; NLS, nuclear localization signal; PRE, progesterone response element; STAT5, signal transducer and activator of transcription 5.
Received for publication April 16, 2001. Accepted for publication September 27, 2001.
| REFERENCES |
|---|
|
|
|---|
-subunit functions synergistically with progesterone to
stimulate differentiation of cultured human endometrial stromal cells
to decidualized cells: a novel role for free
-subunit in
reproduction. Endocrinology 137:13321339[Abstract]
gene. EMBO J 16:74327443[CrossRef][Medline]
, is essential
for ductal morphogenesis, lobuloalveolar proliferation, and functional
differentiation in the mouse mammary gland. Genes Dev 12:19171928
B and the
progesterone receptor. J Biol Chem 271:62176224
B and C/EBPß. Mol Cell Biol 15:49714979[Abstract]
1-acid glycoprotein promoter in vivo. DNA
Cell Biol 16:14671476[Medline]
1-acid glycoprotein gene expression. Mol Cell Biol 18:58805887
-1 acid glycoprotein (AGP) gene by synergistic
interaction of two alternative activator forms of AGP/enhancer-binding
protein (C/EBPß) and NF-
B or Nopp140. Mol Cell Biol 16:42574263[Abstract]
B and C/EBP family members: a Rel
domain-bZIP interaction. Mol Cell Biol 13:39643974
amino acid motifs with dual TBP and TFIIB binding ability co-operate to
activate transcription in both yeast and mammalian cells. EMBO J 14:43184328[Medline]
in endometriotic
tissue and in endometrium. Fertil Steril 75:489495[CrossRef][Medline]
This article has been cited by other articles:
![]() |
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee What Can We Learn from Rodents about Prolactin in Humans? Endocr. Rev., February 1, 2008; 29(1): 1 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takano, Z. Lu, T. Goto, L. Fusi, J. Higham, J. Francis, A. Withey, J. Hardt, B. Cloke, A. V. Stavropoulou, et al. Transcriptional Cross Talk between the Forkhead Transcription Factor Forkhead Box O1A and the Progesterone Receptor Coordinates Cell Cycle Regulation and Differentiation in Human Endometrial Stromal Cells Mol. Endocrinol., October 1, 2007; 21(10): 2334 - 2349. [Abstract] [Full Text] [PDF] |
||||
![]() |
|