help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schroeder, M. D.
Right arrow Articles by Schuler, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schroeder, M. D.
Right arrow Articles by Schuler, L. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Breast Cancer
Molecular Endocrinology 16 (1): 45-57
Copyright © 2002 by The Endocrine Society

PRL Modulates Cell Cycle Regulators in Mammary Tumor Epithelial Cells

Matthew D. Schroeder, Jaime Symowicz and Linda A. Schuler

Department of Comparative Biosciences, University of Wisconsin, Madison, Wisconsin 53706

Address all correspondence and requests for reprints to: Dr. L. A. Schuler, Department of Comparative Biosciences, University of Wisconsin, 2015 Linden Drive West, Madison, Wisconsin 53706. E-mail: schulerl{at}svm.vetmed.wisc.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PRL is essential for normal lobulo-alveolar growth of the mammary gland and may contribute to mammary cancer development or progression. However, analysis of the mechanism of action of PRL in these processes is complicated by the production of PRL within mammary epithelia. To examine PRL actions in a mammary cell-specific context, we selected MCF-7 cells that lacked endogenous PRL synthesis, using PRL stimulation of interferon-{gamma}-activated sequence-related PRL response elements. Derived clones exhibited a greater proliferative response to PRL than control cells. To understand the mechanism, we examined, by Western analysis, levels of proteins essential for cell cycle progression as well as phosphorylation of retinoblastoma protein. The expression of cyclin D1, a critical regulator of the G1/S transition, was significantly increased by PRL and was associated with hyperphosphorylation of retinoblastoma protein at Ser780. Cyclin B1 was also increased by PRL. In contrast, PRL decreased the Cip/Kip family inhibitor, p21, but not p16 or p27. These studies demonstrate that PRL can stimulate the cell cycle in mammary epithelia and identify specific targets in this process. This model system will enable further molecular dissection of the pathways involved in PRL-induced proliferation, increasing our understanding of this hormone and its interactions with other factors in normal and pathogenic processes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE POLYPEPTIDE hormone PRL is essential for mammary gland development and function, as demonstrated in PRL and PRL receptor (PRLR) knockout mice (1, 2, 3). Despite its critical role in the growth of the normal gland, the role of PRL in human breast cancer remains poorly understood. PRL treatment increases the development of spontaneous tumors in mice and interacts with chemical carcinogens in the induction of mammary tumors in rats (4, 5). Recent studies of human mammary tumors show that neoplastic tissue expresses higher levels of PRLR than normal adjacent tissue (6, 7). However, human clinical studies correlating circulating PRL levels to tumor incidence and disease progression are contradictory. Furthermore, treatment with the dopamine agonist, bromocriptine, to block transcription of pituitary PRL had no consistent effect on tumor progression (for reviews, see Refs. 8, 9, 10, 11). One explanation for these disparate findings is that PRL itself is expressed in a variety of extrapituitary cells, including human mammary epithelium (for reviews, see Refs. 12 and 13). At least two promoters, one of which may be dopamine independent, are used in many breast tumors and mammary cell lines (14). Despite endogenous production of PRL, exogenous PRL has been shown to modestly stimulate the proliferation of mammary cells in multiple studies (for reviews, see Refs. 8 and 13). However, PRL antagonists markedly decrease proliferation (15, 16). Taken together, these findings support an autocrine-paracrine role for PRL in the mitogenesis of mammary epithelial cells and suggest that endogenous PRL may contribute to the development or progression of mammary tumors.

One possible target mechanism for PRL in mammary neoplasia may be modulation of the cell cycle. Progression through the cell cycle is orchestrated by successive activation of cyclin-dependent kinases (cdk), which are regulated by specific cyclins as well as inhibitors (17, 18, 19). In the mammary gland, multiple mitogens, including epidermal growth factor (EGF) family members and hormones, alter the levels and activities of these complexes. Understanding the mechanism by which PRL stimulates mitogenesis and how it interacts with other factors important in breast cancer may lead to improved diagnostic assays and therapeutic approaches complementary to currently available methods.

Studies of PRL action in mammary cells are complex, as local synthesis of PRL interferes with molecular analysis of its actions in this cell type. This work would be facilitated by the development of a cell system that is able to respond to exogenous PRL in the appropriate cell-specific manner, but does not express PRL itself. In this study we have derived cell lines from the mammary adenocarcinoma cell line, MCF-7, that do not express PRL endogenously, but retain the ability to respond to exogenous PRL. We have employed these lines to examine the effects of PRL on cell cycle regulators. Our findings indicate that PRL does indeed modulate levels of these critical proteins in a pattern that shares some features with other mammary mitogens, but differs in others. This system will allow examination of the targets of PRL in mammary cells and interactions with other factors in normal and pathological processes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Approach to Develop Mammary Cell Lines That Do Not Produce PRL
To establish a sensitive experimental system for the study of PRL-regulated events associated with cell cycle progression in mammary cells, we developed a method for selection of cells that do not express PRL endogenously. Our strategy is shown in Fig. 1Go. The minimal promoter has low activity when the STAT 5-preferring interferon-{gamma}-activated (GAS) enhancer sequences are not stimulated, and consequently little thymidine kinase (TK) is transcribed in the basal state. However, in the presence of PRL from endogenous or exogenous sources, signal transducers and activators of transcription (STAT) activate transcription via the GAS sequences, and TK expression is induced. Ganciclovir (GCV), a nucleoside analog, becomes cytotoxic after conversion to its triphosphorylated form through phosphorylation by the induced herpes simplex virus (HSV)-TK and host cellular kinases (20, 21). This form acts as a chain terminator, interfering with DNA synthesis in replicating cells. Therefore, cells that contain the GAS3TK vector and express PRL should produce HSV-TK, and if grown in the presence of GCV will undergo arrest or cell death. Cells that do not express endogenous PRL or are deficient in a signaling pathway by which PRL stimulates HSV-TK production, should survive.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Diagrammatic Representation of the Strategy for Production of PRL-Deficient Cell Lines

Cells that produce PRL should stimulate TK expression via stimulation of the GAS sequences, and therefore die when exposed to GCV. Cells with the desired phenotype, i.e. no endogenous PRL production, should survive.

 
Endogenous PRL in MCF-7 Cells Can Signal through GAS Elements
For this selection process to work, cells must be able to respond to endogenously produced PRL by activating the GAS elements. To determine whether a cell line was suitable, we replaced HSV-TK with a luciferase reporter gene. This construct (GAS3Min), or the control vector (pGL3Min; no GAS), was transiently transfected into MCF-7 cells. As shown in Fig. 2Go, only low levels of luciferase activity were detected in MCF-7 cells containing the control vector in both the presence and absence of exogenous PRL, as expected. Exogenous PRL increased luciferase activity 2-fold over the vehicle control value in MCF-7 cells containing the GAS3Min vector. Importantly, MCF-7 cells that contained the GAS3Min vector also displayed a 2-fold higher level of luciferase activity in the absence of exogenous PRL than cells containing pGL3Min. This suggested that endogenously produced PRL would be sufficient to stimulate HSV-TK production and thus enable our selection process. Therefore, stable transfectants of MCF-7 cells with either the pGL3TK or the GAS3TK vector were generated (see Materials and Methods).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. GAS Activation by Endogenous and Exogenous PRL in MCF-7 Cells

MCF-7 cells were transiently transfected with pGL3Min or GAS3Min and cultured in serum-free medium with or without human PRL (4 nM). After 24 h samples were assayed for luciferase activity. Activities were corrected for transfection efficiencies using ß-galactosidase protein (RLU, relative light units). {square}, Fold activation in cells transfected with control vector (pGL3Min); {blacksquare}, fold activation in cells containing GAS3Min. Data are the mean of four experiments ± SEM. Bars with the same letters are not different, and different letters denote significant differences (P < 0.01).

 
PRL-Deficient Cell Lines Retain Responsiveness to Exogenous PRL
MCF-7 cells stably transfected with either pGL3TK or GAS3TK were selected for survival in GCV. Cell death was not obvious in the cells containing the pGL3TK vector, whereas only 62 clones containing GAS3TK survived. Forty-seven of these did not contain detectable PRL transcripts by RT-PCR (Fig. 3Go). The proliferative response to exogenous PRL was examined in several of these PRL-deficient cell lines in parallel to the MCF7-1 control cell line, which contained pGL3TK and continued to express PRL endogenously (Fig. 4AGo). After 48 h in serum-free medium (time zero), the MCF7-1 control cells were more numerous than the two PRL-deficient cell lines, PRE-1 and B PRE-2. As expected, the MCF7-1 cells treated with PRL grew modestly faster than untreated cells. However, a significantly greater proliferative response to PRL was observed in the two PRL-deficient cell lines compared with the control cells at 48 h (Fig. 4BGo). The effects of PRL on cell cycle distribution were examined in the PRL-deficient cell line, PRE-1, as well as the MCF7-1 controls. PRL treatment decreased the proportion of PRE-1 cells in G0/G1 and increased those in S phase over untreated controls, although not to the extent of 10% FBS (Fig. 5Go, A and B). In contrast, PRL treatment had minimal effects on the control cell line.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. PRL Transcripts in Parental and Selected Cell Lines

GCV-resistant MCF-7 cell lines were screened by RT-PCR for PRL and GAPDH (internal control) mRNAs under conditions that gave exponential formation of both products. Products were fractionated by agarose gel electrophoresis and visualized with SYBR Green I. The parental line is MCF-7; MCF7-1 is a stable transfectant with pGL3TK. The control is a PCR reaction without added cDNA. The remaining lanes represent some of the GCV-resistant clones.

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. Growth of Control and PRL-Deficient Cell Lines in Response to Exogenous PRL

A, Representative experiment. Cells were plated at equal densities, cultured in serum-free medium for 48 h, and then treated with (solid line) or without (dashed line) 4 nM PRL. The number of cells was counted at each time point as described in Materials and Methods. Results are expressed as the mean ± SEM of triplicate plates. B, Fold stimulation by PRL summarized from three independent experiments conducted as described in A. The ratio of the number of cells after PRL treatment to those treated with vehicle alone was calculated for each time point and each cell line. {square}, MCF7-1 cells; , PRE-1 cells; {blacksquare}, B PRE-2 cells. Asterisks indicate significantly different values compared with the control cell line, MCF7-1 (P < 0.05).

 


View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. PRL Stimulates Cell Cycle Progression in PRE-1, But Not MCF7-1, Cells

A, Representative analysis of cell cycle distribution after PRL treatment. MCF7-1 and PRE-1 cells were each cultured in serum-free medium for 48 h and then cultured for an additional 48 h in serum-free medium ± 4 nM PRL or 10% FBS. Cells were harvested by trypsinization, the nuclei were stained with propidium iodide, and flow cytometry was performed as described. B, Flow cytometric analysis of MCF7-1 and PRE-1 cells from A.

 
PRL Induces Cyclin D1 Expression and Retinoblastoma Protein Phosphorylation
Because of the key role of cyclin D1 in regulating the G1/S transition and mediating the response to other growth factors, we examined the effect of PRL on cyclin D1 protein levels. In MCF7-1 control cells, exogenous PRL did not appreciably alter cyclin D1 levels (Fig. 6AGo). However, PRL treatment significantly increased cyclin D1 in PRE-1 cells, which was readily detectable as early as 3 h after addition of hormone (Fig. 6BGo). A similar response was observed in other PRL-deficient cell lines (data not shown). In contrast, PRL did not alter levels of cyclin D3 protein, which also serves as a loading control (Fig. 6CGo). Cyclin D2 protein was not examined because its expression is low in these cells (22, 23). These changes in cyclin D1 protein expression were associated with an elevation in hyperphosphorylated retinoblastoma protein (Rb) at 9 and 12 h (Fig. 7AGo). This increase in hyperphosphorylated Rb included increased phosphorylation on Ser780, a target of cyclin D1-activated cyclin-dependent kinase-4 (cdk-4) (24, 25, 26 ; Fig. 7BGo). Minimal effects on Rb were observed in the MCF7-1 control cell line (Fig. 7BGo).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. PRL Stimulates Cyclin D1, But Not Cyclin D3, Expression

A, Left, Representative Western blot analysis of cyclin D1 in lysates from control (MCF7-1) at different times (0, 3, 6, 9, 12, and 24 h) after treatment ± 4 nM hPRL. Right, Fold change in cyclin D1 protein compared with time zero from three independent experiments (mean ± SEM). B, Left, Representative Western blot analysis of cyclin D1 in lysates from PRL-deficient cells (PRE-1) with or without hPRL treatment as described above. Right, Fold change from three independent experiments as described above. {square}, No treatment; {blacksquare}, 4 nM hPRL. The asterisk denotes significant differences (P < 0.05) between treated and untreated cells at each time point. C, Representative Western blot analysis of cyclin D3 in lysates from PRL-deficient cells (PRE-1) ± hPRL treatment as described above.

 


View larger version (19K):
[in this window]
[in a new window]
 
Figure 7. PRL Stimulates Retinoblastoma Protein Phosphorylation

A, Left, Representative Western blot analysis of pRb in lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6, 9, 12, and 24 h) after treatment with or without 4 nM hPRL. Right, Percentage of total pRb that is hyperphosphorylated from four independent experiments (mean ± SEM). {square}, No treatment; {blacksquare}, 4 nM hPRL. The asterisk denotes significant differences (P < 0.05) between treated and untreated cells at each time point. B, Representative Western blot analysis of phosphorylated Rb (Ser780) in lysates from PRL-deficient cells (PRE-1) and the control cell line (MCF7-1) at different times (0, 3, 6, 9, 12, and 24 h) after treatment with or without 4 nM hPRL.

 
Cyclin D1 Antisense Oligonucleotides Block the Proliferative Response to PRL
To assess the role of the PRL-induced increase in cyclin D1 protein levels in the elevated cell proliferation, antisense oligonucleotides were employed to inhibit translation of cyclin D1 mRNA. As shown in Fig. 8AGo, 400 nM antisense oligonucleotide decreased levels of cyclin D1 in PRL-treated cells to those in untreated, untransfected cells. Sense oligonucleotides, in contrast, did not alter cyclin D1 levels from those in the untransfected controls. Although PRL treatment of both untransfected and sense oligonucleotide-transfected cultures resulted in an increase in cell number 44–53% greater than controls after 24 h, no increase in cell number in response to PRL was observed in the cultures treated with antisense oligonucleotides (Fig. 8BGo). FACS analysis reflected these findings. The percentages of cells in S/G2/M phase 24 h after culture in 0.1% horse serum posttransfection were: control untransfected cells: 34.6% human PRL (hPRL)-negative, 40.9% hPRL-positive; antisense transfected cells: 34.8% hPRL-negative, 37.0% hPRL-positive; and sense transfected cells: 34.9% hPRL-negative, 40.6% hPRL-positive. These data are consistent with a key role for this cell cycle regulator in PRL-induced proliferation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 8. Cyclin D1 Antisense Oligonucleotides Inhibit PRL-Induced Proliferation

A, Representative Western analysis of cyclin D1 in lysates from PRE-1 cells untransfected (C) or transfected with 400 nM antisense cyclin D1 oligonucleotides (AS) or 400 nM sense cyclin D1 oligonucleotide (S) 6 h after treatment with or without 4 nM hPRL. Cells were plated at equal densities, cultured in serum-free medium for 24 h, and then transfected with oligonucleotides as described in Materials and Methods. After washing, cells were cultured in medium containing 0.1% horse serum for an additional 6 h with or without 4 nM PRL. B, Growth response to PRL in cells transfected with cyclin D1 oligonucleotides averaged from two independent experiments. Cells were transfected as described in A, then cultured in medium containing 0.1% horse serum without ({square}) or with ({blacksquare}) 4 nM hPRL for an additional 24 h. The number of cells was quantitated using a hemocytometer. Results between experiments varied less than 10%.

 
PRL and EGF Do Not Additively Stimulate Cyclin D1
MAPK pathways mediate part of the proliferative responses to many mitogens, including growth factors and cytokines. PRL has been shown to activate the p44/42, p38, as well as c-Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) pathways in various cell types (27, 28, 29). To examine the contribution of these pathways to PRL induction of cyclin D1, we used the inhibitors PD98059 (for p44/42 MAPK) and SB203580 (at 10 µM SB203580, may inhibit both p38 and JNK) (28). As shown in Fig. 9AGo, PD98059 lowered basal cyclin D1 levels by about half, and PRL was unable to overcome this suppression. In contrast, SB203580 had no effect on basal cyclin D1 levels, but prevented the increase in cyclin D1 expression after PRL treatment.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 9. Inhibitors PD98059 and SB20358 Inhibit PRL Induction of Cyclin D1 Expression, and EGF Does Not Synergize with PRL

A, Left, Representative Western blot analysis of cyclin D1 in lysates from PRL-deficient cells (PRE-1) at 6 h after treatment with PD98059 (20 µM), SB203580 (10 µM), or dimethylsulfoxide (DMSO) vehicle control with or without 4 nM PRL. Right, Fold change in cyclin D1 protein compared with DMSO vehicle control from three independent experiments (mean ± SEM). {square}, No treatment; {blacksquare}, 4 nM hPRL. B, Left, Representative Western blot analysis of cyclin D1 in lysates from PRL-deficient cells (PRE-1) at 6 h after treatment with either PRL (4 nM), EGF (30 ng/ml), PRL (4 nM) and EGF (30 ng/ml), or DMSO vehicle control. Right, Fold PRL/EGF-induced increase in cyclin D1 protein compared with vehicle control from three independent experiments (mean ± SEM). C, Left, Representative Western blot analysis of cyclin D1 in lysates of PRL-deficient cells (PRE-1) at 6 h after treatment with PD98059 (20 µM), SB203580 (10 µM), or DMSO vehicle control with or without 30 ng/ml EGF. Right, Fold change in cyclin D1 protein compared with DMSO vehicle control from three independent experiments (mean ± SEM). {square}, No treatment; {blacksquare}, 30 ng/ml EGF. Different letters denote significantly different values analyzed by one-way ANOVA, followed by Tukey’s multiple comparison test (P < 0.05).

 
EGF family members are important for normal mammary gland development as well as tumorigenesis. They share some signaling pathways with PRL (23, 27), and cross-talk between PRL and ErbB-2 results in synergistic activation of the MAPK pathway (30). MCF-7 cells express ErbB-1, but have only low levels of the other receptors for EGF family ligands (31). To examine potential interactions between PRL-PRLR and EGF-ErbB-1 pathways in these cells, we examined cyclin D1 protein expression. As shown in Fig. 9BGo, although EGF increased cyclin D1 protein to about the same level as PRL, the addition of both factors together did not further increase expression. To examine the basis of this observation, the ability of PD98059 and SB203580 to inhibit EGF effects was also investigated. As shown in Fig. 9CGo, EGF was able to overcome the effect of PD98059. However, SB203580 also prevented the EGF response.

PRL Inhibits p21 Expression
Multiple mammary mitogens alter the expression of cdk inhibitors. PRL treatment significantly decreased p21 protein levels at 9 and 12 h after the addition of hormone (Fig. 10BGo). In some, but not all, experiments PRL induced a slight increase in p21 protein at 3 h. Neither p27 nor p16, a member of the inhibitor of cdk (4) family, was affected by PRL in these cells (Fig. 10AGo). As expected, PRL did not alter p21 expression in the MCF7-1 control cell line (Fig. 10CGo).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 10. PRL Inhibits p21 Expression, But Causes No Change in Either p16 or p27

A, Representative Western blot analysis of p16 and p27 in lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6, 9, 12,and 24 h) after treatment with or without 4 nM hPRL. B, Left, Representative Western blot analysis of p21 in lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6, 9, 12, and 24 h) after treatment with or without 4 nM hPRL as described above. Right, Fold change in p21 protein compared with time zero from three independent experiments (mean ± SEM). {square}, No treatment; {blacksquare}, 4 nM hPRL. The asterisk denotes significant differences (P < 0.05) between treated and untreated cells at each time point. C, Representative Western blot of p21 in lysates from control cell line (MCF7-1) similarly treated.

 
PRL Induces Cyclin B1 Expression
As shown in Fig. 11AGo, PRL induced slight increases in cyclin A (evident at 9 and 12 h), as well as cyclin E (through 24 h). These modest changes in cyclin E may be due to the overexpression of cyclin E in the parental MCF-7 cells (32). In contrast, PRL treatment increased cyclin B1 expression approximately 2-fold at 9 and 12 h after addition of hormone (Fig. 11BGo). Only a very slight increase in response to PRL at these same time points was observed in the MCF7-1 control line (Fig. 11CGo).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 11. PRL Stimulates Cyclin B1, and Slight Increases in Cyclin A or Cyclin E Expression

A, Representative Western blot analysis of cyclin A and cyclin E in lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6, 9, 12, and 24 h) after treatment with or without 4 nM hPRL. B, Left, Representative Western blot analysis of cyclin B1 in lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6, 9, 12, and 24 h) after treatment with or without 4 nM hPRL as described above. Right, Fold change in cyclin B1 protein compared with time zero from four independent experiments (mean ± SEM). {square}, No treatment; {blacksquare}, 4 nM hPRL. The asterisk denotes significant differences (P < 0.05) between treated and untreated cells at each time point. C, Representative Western blot of cyclin B1 in lysates from a control cell line (MCF7-1) similarly treated.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
By coupling stimulation of an enhancer activated by STAT 5 to production of a toxic metabolite, we were able to derive mammary epithelial tumor cell lines that no longer express endogenous PRL. As predicted, such cell lines are more sensitive to exogenous PRL and have permitted identification of target genes and signaling pathways employing PRL in this cell type. In theory, this method should also select for defects in the PRL signaling pathway upstream of the enhancer as well as cells that may no longer express other cytokines/growth factors that stimulate this pathway. Curiously, the majority of the selected clones appeared to be deficient in the production of PRL itself, and behaved similarly in proliferation assays.

Our studies have demonstrated that PRL increases the proliferation of these cells by altering the expression of multiple regulators of cell cycle progression, which would facilitate the G1/S and G2/M phase transitions. The rate of transit through G1 is coordinated by successive actions of the cyclin-dependent kinases, cdk-4, -6, and -2, which are regulated by specific cyclins, the cyclin D family (cdk-4 and -6), and cyclin E (cdk-2). Multiple cdk inhibitors are able to reduce the activities of these kinases. These include the Ink4 family (such p16Ink4a), which specifically inhibits the catalytic subunits of cdk4 and cdk6, as well as the Cip/Kip family (including p21 and p27), which can inhibit the activities of all cyclin D-, E-, and A-dependent kinases (for reviews, see Refs. 17, 18, 19). PRL treatment of the PRL-deficient mammary cell lines increased cyclin D1, but not cyclin D3, protein expression and reduced the expression of the multifunctional Cip inhibitor, p21, but not p27 or p16. Together, the elevated cyclin D1 and reduced p21 levels would be predicted to increase cdk4 activity, resulting in phosphorylation of pRb at Ser780 (24, 25, 26), as observed here. One effect of hyperphosphorylation of pRb is the release of sequestered E2F, allowing transcription of genes required for progression through S phase, including cyclins A and E. As predicted, in our studies protein levels of cyclins E and A were slightly up-regulated by PRL. Initiation of DNA condensation and entry into mitosis at the G2/M transition is coordinated in part by cyclin B1 regulation of Cdc2 activity. In our cells PRL also increased the expression of cyclin B1, indicating another mechanism by which PRL augments mitogenesis. These effects of PRL on regulation of the cell cycle as well as the effects of PRL on apoptosis of mammary epithelial cells (Ref. 33 and our unpublished observations) increase our understanding of the mechanisms by which PRL may stimulate growth during mammary development. Furthermore, in an abnormal genetic or environmental context, these actions may contribute to mammary carcinogenesis and may point toward potential targets for pharmacological intervention in this process.

The D family of cyclins are key in initiating progress through the G1 phase of the cell cycle. Cyclin D1 is the primary member of this family expressed in the mammary gland. Genetic deletion of this gene in mice results in normal ductal branching, but a marked reduction in alveolar development (34). Conversely, increased expression of cyclin D1 has been shown to be sufficient to decrease G1 in some mammary tumor cell lines in vitro (35), although this is dependent on the functional status of other cell cycle regulators. Many growth factors stimulate cell cycle progression of numerous cell types via increased expression of this cyclin, and it is not surprising that PRL exerts effects here as well. Our studies demonstrate that cyclin D1 plays a key role in PRL stimulation of the cell cycle in these mammary tumor cells; preventing this increase with antisense oligonucleotides inhibited PRL-induced proliferation. Cyclin D1 may be a major target through which PRL and related hormones stimulate lobuloalveolar proliferation during pregnancy, as shown by the similarities among the mammary glands of the cyclin D1, PRL, and PRLR knockout mice (1, 3, 34, 36). PRL action on this regulator may also contribute to mammary cancer development or progression, as cyclin D1 is elevated in many human mammary tumors (37, 38), and overexpression of cyclin D1 in transgenic mice leads to mammary tumor formation (39). Cyclin D1 expression is controlled at multiple levels, including transcription, RNA stability, translation, and protein degradation (for reviews, see Refs. 18 and 40). The level(s) at which PRL modulates the activity of cell cycle regulators, including cyclin D1, and the signaling pathways employed, are not yet completely understood. Like human breast tissue and other mammary cell lines (41, 42), MCF-7 cells express distinct PRLR isoforms, differing in their cytoplasmic domains and signaling capacities.1 The inhibitor studies presented here suggest that both the p44/42 MAPK and p38MAPK and/or JNK/SAPK pathways mediate PRL actions at some level. Other work in our laboratory has shown that PRL can augment transcription of cyclin D1 via the JAK2 activation of STATs.2 This is consistent with the importance of STAT5A in mammary alveolar proliferation, demonstrated by the STAT5A knockout mouse (43), and points toward another pathway involved in PRL action at this target. Interestingly, the current study demonstrated no additive effect of PRL and EGF on cyclin D1 protein levels. The distinct inhibitor profile of EGF suggests that this is a result of a limiting necessary regulatory component(s) in these cells rather than a shared signaling pathway(s). Further investigation will demonstrate the applicability of these findings to a broader range of mammary cell phenotypes as well as other cell types.

In the PRL-deficient MCF-7 cells in the present study, PRL also increased levels of cyclin B1, which are critical for initiation of mitosis. Cyclin B1, like cyclin D1, is overexpressed in many breast cancers (44, 45). In the normal cell it accumulates during G2 and peaks at the G2/M transition. Cyclin B1 activity also is controlled at multiple levels, including transcription, mRNA stability, as well as nuclear translocation (for reviews, see Refs. 46, 47, 48). Whether PRL directly alters cyclin B1 expression or secondarily increases protein levels through other mediators remains to be determined. The complex control of nuclear trafficking of this cyclin (48, 49), including modulation by another target of PRL, p21 (50), suggests that additional studies of the effects of PRL on this process are needed.

Recent studies have demonstrated a complex role for p21 in the cell cycle, not only as an inhibitor of cdks, but also as a facilitator of the assembly of cdk-cyclin complexes and a regulator of cyclin B1 function at the G2/M transition, resulting in accumulation of active complexes in the nucleus as well as increased stability (for reviews, see Refs. 17, 18, 19). Like other cell cycle regulators, p21 activity is controlled at multiple levels. However, transcriptional controls have received the most attention (for review, see Ref. 51). Multiple mitogens as well as growth inhibitors alter levels of this protein in various cell types, including mammary epithelial cells. In contrast to the effects of PRL observed in the present studies, many mitogens, such as v-Src (52), IGF-I (53), and EGF (54), increase p21 transcription, perhaps consistent with its role in the assembly of active cdk complexes. In contrast, some agents that inhibit the proliferation of mammary cells also increase p21 transcription. Inhibition by the cytokine, interferon-{gamma}, appears to involve STAT1 binding to one of the three GAS enhancer elements in the p21 promoter (55, 56). The inhibitory effect of PRL on p21 protein levels in the present studies and the reported ability of PRL to activate STAT1, -3, and -5 in mammary cells (16, 57) suggest the possibility of cross-talk among these transcription factors and coactivators at this promoter. Additional studies of the association of components and location of cdk complexes will further clarify the role of p21 in PRL action on the cell cycle.

In vivo, mammary proliferation is regulated by complex interactions among hormones, including PRL, estrogens, and progestins, as well as local growth factors, such as EGF family members and IGFs. These factors can amplify or inhibit one another’s signals to the epithelial cells by several mechanisms, including altering the expression of their receptors, influencing the level or activities of signaling pathways, as well as activating paracrine modulators via action on different cell types (for reviews, see Refs. 58, 59, 60). In addition, these agents have distinct target genes, with synergistic or inhibitory consequences. In simplified in vitro mammary cell systems, including the MCF-7 cell line examined here, the effects of many of these agents on cell cycle regulators have been extensively studied. Interestingly, PRL shares some targets with these other mammary mitogens and differs in others. Predictably, because of its central role in cell cycle progression, cyclin D1 is a common target of estrogens, EGF, IGF, and possibly progesterone as well (for review, see Ref. 40). In contrast, diverse effects on the cdk inhibitors have been observed. Estrogen decreases both p27 and p21 levels (22, 53, 61). IGF-I also decreases p27 protein levels, but increases p21 levels, the latter in part by stimulating transcription in MCF-7 cells (40, 53). EGF decreases p27 protein levels in several cell types (for review, see Ref. 40) and synergizes with progesterone to increase p21 in mammary T47D cells (54). The multiple mechanisms through which the level and subcellular location of each of these cell cycle regulators can be modulated and the breadth of signaling pathways potentially employed by each ligand present multiple opportunities for cross-talk and synergistic actions in the normal and carcinogenic gland in vivo.

These studies have demonstrated that PRL is able to stimulate the cell cycle in mammary epithelial tumor cells and have identified specific targets in this process. This model system will enable molecular dissection of the pathways involved in PRL-induced proliferation, increasing our understanding of the role of this hormone and its interaction with other factors in normal and pathogenic processes in the mammary gland.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Moloney murine leukemia virus reverse transcriptase was purchased from Life Technologies, Inc. (Gaithersburg, MD). The random hexamer pd(N)6 was purchased from Pharmacia Biotech (Piscataway, NJ). SYBR Green I was obtained from Molecular Probes, Inc. (Eugene, OR). Antibodies used in Western blot analyses were as follows: cyclin A (CC17) from Oncogene Research Products (Cambridge, MA); cyclin D3 (C-16), cyclin B1 (GNS1), cyclin E (HE12), p16 (F-12), and p27 (C-19) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); cyclin D1 (MS-210-P1) from NeoMarkers (Fremont, CA); p21 (C24420; Cip1/WAF1) from Transduction Laboratories, Inc. (San Diego, CA); Rb (14001A) from PharMingen (San Diego, CA), and Phospho-RbSer780 from NEB Cell Signaling (Beverly, MA). The enhanced chemiluminescence kit was purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). The inhibitor PD98059 was purchased from Calbiochem (La Jolla, CA). All of the remaining reagents were purchased from Sigma-Aldrich Corp. (St. Louis, MO) except NaCl, which was purchased from Mallinckrodt, Inc. (Paris, KY). The vector that contains the HSV-TK gene (pHSV-106) was purchased from Life Technologies, Inc. (Gaithersburg, MD). Human PRL (lot AFP9042) was obtained through National Hormone and Pituitary Program, NIDDK, and Dr. Parlow.

Plasmid Constructions
The pGL3Min vector containing the PRL minimal promoter (GATCTCGAAGGTTTATAAAGTCAATGTCTGCAGATGAGAAAGCAGTGGTTCTCTTAGGACTTCTTGGGGAAGTGAAGCT) driving luciferase expression in the pGL3-Basic vector (Promega Corp.) was obtained from Dr. Thaddeus Golos (University of Wisconsin). Three copies of the STAT5-binding site (GAS-like sequences) from the PRE3-chloramphenicol acetyltransferase vector (62) were excised with EcoRV and BamHI and inserted upstream of the minimal promoter in the pGL3Min vector to produce the GAS3Min vector. To construct both the pGL3TK and GAS3TK vectors, the luciferase gene was removed from pGL3Min and GAS3Min by cutting with HindIII, followed by creation of blunt ends with Klenow, and then cleavage with BamHI. The TK gene was excised from the pHSV-106 vector with BglII, blunt ends were created with Klenow, followed by cleavage with BamHI, and the fragment replaced with the luciferase gene, producing MinTK and GAS3TK.

Transfections and Reporter Gene Assays
Plasmid transfections were performed with LipofectAMINE (Life Technologies, Inc.). For transient transfections, MCF-7 cells were plated at 1.6 x 105 cells/well (12-well plates) and grown for 18 h. The cells were washed once in serum-free medium, and the LipofectAMINE/DNA mixture was added to the cells. The cells were incubated at 37 C for 6–8 h, followed by removal of the LipofectAMINE/DNA mixture and replacement with fresh medium with or without PRL (4 nM). After 24 h, cells were lysed, and luciferase activity and ß-galactosidase (transfection control) were measured as previously described (63).

Production of Stable PRL-Deficient Cell Lines
MCF-7 cells were grown in RPMI 1640 medium containing 10% horse serum, which does not contain appreciable levels of lactogenic hormones (64). They were transfected with either the MinTK or GAS3TK vector, and the pcDNA3 vector in a 10:1 ratio, and stable transfectants were selected in 400 µg/ml geneticin (G418). Clones containing the MinTK or GAS3TK vector and surviving in 50 µM GCV (gift from Roche) were screened for PRL mRNA. Identified PRL-deficient cell lines, passaged continuously GCV, were found to be PRL responsive for about 20 passages. However, thereafter the cells displayed a greatly increased growth rate and became PRL insensitive, although PRL mRNA remained undetectable.

RNA Extraction and RT-PCR Analysis
RT-PCR analysis was performed essentially as previously described (65). Reactions containing cDNA and no cDNA controls were incubated with 0.5 µM PRL primers (forward primer, ACATGAACATCAAAGGATCGCCATG; reverse primer, CCGCTCGAGGCTTAGCAGTTGTTGTTGTGGAT) and 0.035 µM GAPDH primers (forward primer, TGAAGGTCGGAGTCAACGGATTTGGT; reverse primer, CATGTGGGCCATGAGGTCCACCAC), and products were amplified as described for 30 cycles.

PRL Stimulation of Cellular Growth
Each cell line was plated at 5 x 105 cells/60-mm tissue culture dish. After seeding, the cells were washed once with PBS and cultured in serum-free RPMI 1640 for 48 h before treatment with vehicle or 4 nM PRL. The cells were harvested with trypsin at the indicated times, stained with trypan blue, and counted using a hemocytometer. To analyze the effects of PRL on cell cycle distribution, cells were plated at 2 x 106 cells/100-mm tissue culture dish, cultured in serum-free RPMI 1640 for 48 h, and then treated with vehicle, 4 nM PRL, or 10% FBS for an additional 48 h. Cells were harvested by trypsinization, fixed in 95% ethanol, and stored at -20 C for 24 h. The cells were then pelleted, washed once in PBS, and incubated in propidium iodine stain (200 ng/ml ribonuclease A, 0.1% Triton X-100, and 20 µg/ml propidium iodine in PBS) in the dark at room temperature for 30 min. The samples were stored at 4 C until cell cycle analysis was performed with a FACSCalibur sorter (Becton Dickinson and Co., San Jose, CA).

Western Analysis
Each cell line was plated as described for FACS analysis before treatment with vehicle or 4 nM PRL. Cells were harvested into 100 µl lysis buffer (25 mM Tris (pH 8.0), 2 mM EDTA, 10% glycerol, 1% Triton X-100, 2 mM sodium orthovanadate, and 20 mM sodium fluoride). The cellular debris was removed by centrifugation at 10,000 rpm at 4 C for 10 min, and the protein concentration in the supernatant was determined using the bicinchoninic acid kit (Pierce Chemical Co., Rockford IL). Lysates (30 µg protein) from each time point were electrophoresed through standard Laemmli SDS-polyacrylamide gels (8%, 10%, 12%, or 15%), transferred to polyvinylidene fluoride membranes, and then probed with appropriate antibodies. Membranes were blocked for 1–4 h in 0.25% gelatin in 100 mM Tris-HCl (pH 7.5), 150 mM sodium chloride, and 0.1% Tween 20; washed once with 100 mM Tris-HCl (pH 7.5), 150 mM sodium chloride, and 0.1% Tween 20; and incubated in primary antibody overnight at 4 C (cyclin D1, 1:500; cyclin A, 1:100; cyclin E, 1:100; cyclin D3, 1:800; cyclin B1, 1:333; p16, 1:200; p27, 1:800; p21, 1:200; Rb, 1:250; Phospho-RbSer 780, 1:1000). Proteins were visualized using enhanced chemiluminescence as previously described (65). Quantification of the signals was performed using a densitometer and ImageQuant (version 4.2a) software (Molecular Dynamics, Inc., Sunnyvale, CA).

Cyclin D1 Antisense Oligonucleotides
20-Mer sense and antisense oligonucleotides, modified at both termini with phosphorothioates, were synthesized to the region around the translation start site of cyclin D1 based on the report by Carroll et al. (61) (sense, CCCAGCCATGGAACACCAGC; antisense, GCTGGTGTTCCATGGCTGGG). For Western analyses, cells were plated at 2 x 105 cells/well of a six-well plate, cultured for 24 h in serum-free medium, and then transfected with 200–800 nM oligonucleotide in 4–24 µl CellFECTIN (Life Technologies, Inc.) for 2 h according to the manufacturer’s directions. Cells were then washed, cultured in medium containing 0.1% horse serum for an additional 6 h in the presence or absence of 4 nM PRL, and then lysates were harvested as described above for Western analyses. Based on these experiments, 400 nM antisense oligonucleotide was found to decrease the cyclin D1 level to that in untransfected cells without PRL stimulation. For proliferation assays, cells were plated at the same density in 60-mm dishes, transfected with 400 nM oligonucleotides in 24 µl CellFECTIN, and otherwise treated as described above, except that cells were harvested 24 h after PRL treatment. Cell numbers were determined as described for untransfected cells.


    ACKNOWLEDGMENTS
 
We thank Dr. Thaddeus Golos (University of Wisconsin, Madison, WI), Dr. Nelson Horseman (University of Cincinnati, Cincinnati, OH), and Roche Discover Welwyn (London, UK) for their generous gifts of reagents.


    FOOTNOTES
 
This work was supported in part by NIH Grant R01-CA-78312, Grant IRG-58-011-41-6 from the American Cancer Society, the University of Wisconsin Environmental Health Science Center (NIH Grant P30-ES-09090), and the University of Wisconsin Center for Women’s Health and Women’s Health Research. Some of this work was presented at the 82nd Annual Meeting of The Endocrine Society, 2000, Toronto, Canada, in abstract form.

Abbreviations: cdk, Cyclin-dependent kinase; EGF, epidermal growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GAS, interferon-{gamma}-activated sequence; GCV, ganciclovir; hPRL, human PRL; HSV-TK, herpes simplex virus-thymidine kinase; JNK/SAPK, c-Jun N-terminal kinase/stress-activated protein kinase; PRLR, PRL receptor; Rb, retinoblastoma protein; RLU, relative light units; STAT, signal transducers and activators of transcription; TK, thymidine kinase.

Received for publication May 31, 2001. Accepted for publication September 25, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Horseman ND, Zhao WZ, Montecino-Rodriguez E, Tanaka M, Nakashima K, Engle SJ, Smith F, Markoff E, Dorshkind K 1997 Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO J 16:6926–6935[CrossRef][Medline]
  2. Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H, Edery M, Brousse N, Babinet C, Binart N, Kelly PA 1997 Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes Dev 11:167–178[Abstract/Free Full Text]
  3. Brisken C, Kaur S, Chavarria TE, Binart N, Sutherland RL, Weinberg RA, Kelly PA, Ormandy CJ 1999 Prolactin controls mammary gland development via direct and indirect mechanisms. Dev Biol 210:96–106[CrossRef][Medline]
  4. Welsch CW, Nagasawa H 1977 Prolactin and murine mammary tumorigenesis: a review. Cancer Res 37:951–963[Abstract/Free Full Text]
  5. Boot LM, Muhlbock O, Ropcke G 1962 Prolactin and the induction of mammary tumors in mice. Gen Comp Endocrinol 2:601–603
  6. Reynolds C, Montone KT, Powell CM, Tomaszewski JE, Clevenger CV 1997 Expression of prolactin and its receptor in human breast carcinoma. Endocrinology 138:5555–5560[Abstract/Free Full Text]
  7. Touraine P, Martini JF, Zafrani B, Durand JC, Labaille F, Malet C, Nicolas A, Trivin C, Postel-Vinay MC, Kuttenn F, Kelly PA 1998 Increased expression of prolactin receptor gene assessed by quantitative polymerase chain reaction in human breast tumors vs. normal breast tissues. J Clin Endocrinol Metab 83:667–674[Abstract/Free Full Text]
  8. Vonderhaar BK 2000 Prolactin in human breast cancer development. In: Ethier SP, ed. Endocrine oncology. Totowa: Humana Press; 101–120
  9. Goffin V, Touraine P, Pichard C, Bernichtein S, Kelly PA 1999 Should prolactin be reconsidered as a therapeutic target in human breast cancer. Mol Cell Endocrinol 151:79–87[CrossRef][Medline]
  10. Hankinson SE, Willett WC, Michaud S, Manson JE, Colditz GA, Longcope C, Rosner B, Speizer FE 1999 Plasma prolactin levels and subsequent risk of breast cancer in postmenopausal women. J Natl Cancer Inst 91:629–634[Abstract/Free Full Text]
  11. Wennbo H, Törnell J 2000 The role of prolactin and growth hormone in breast cancer. Oncogene 19:1072–1076[CrossRef][Medline]
  12. Ben-Jonathan N, Mershon JL, Allen DL, Steinmetz RW 1996 Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. Endocr Rev 17:639–669[Abstract/Free Full Text]
  13. Clevenger CV, Plank TL 1997 Prolactin as an autocrine/paracrine factor in breast cancer. J Mammary Gland Biol Neopl 2:59–68[CrossRef][Medline]
  14. Shaw-Bruha CM, Pirrucello SJ, Shull JD 1997 Expression of the prolactin gene in normal and neoplastic human breast tissues and human breast cell lines: promoter usage and alternative mRNA splicing. Breast Cancer Res Treat 44:243–253[CrossRef][Medline]
  15. Fuh G, Wells JA 1995 Prolactin receptor antagonists that inhibit the growth of breast cancer cell lines. J Biol Chem 270:13133–13137[Abstract/Free Full Text]
  16. Llovera M, Pichard C, Bernichtein S, Jeay S, Touraine P, Kelly PA, Goffin V 2000 Human prolactin (hPRL) antagonists inhibit hPRL-activated signaling pathways involved in breast cancer cell proliferation. Oncogene 19:4695–4705[CrossRef][Medline]
  17. Sherr CJ, Roberts JM 1999 CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 13:1501–1512[Free Full Text]
  18. Ekholm SV, Reed SI 2000 Regulation of G1 cyclin dependent kinases in the mammalian cell cycle. Curr Opin Cell Biol 12:676–684[CrossRef][Medline]
  19. Vidal A, Koff A 2000 Cell-cycle inhibitors: three families united by a common cause. Gene 247:1–15[CrossRef][Medline]
  20. Borrelli E, Heyman R, Hsi M, Evans RM 1988 Targeting of an inducible toxic phenotype in animal cells. Proc Natl Acad Sci USA 85:7572–7576[Abstract/Free Full Text]
  21. Matthews T, Boehme R 1988 Antiviral activity and mechanism of action of ganciclovir. Rev Infect Dis 10(Suppl 3):S490–S494
  22. Prall OWJ, Sarcevic B, Musgrove EA, Watts CKW, Sutherland RL 1997 Estrogen-induced activation of cdk4 and cdk2 during G1-S phase progression is accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E-cdk2. J Biol Chem 272:10882–10894[Abstract/Free Full Text]
  23. Cicatiello L, Addeo R, Altucci L, Belsito PV, Boccia V, Cancemi M, Germano D, Pacilio C, Salzano S, Bresciani F, Weisz A 2000 The antiestrogen ICI 182,780 inhibits proliferation of human breast cancer cells by interfering with multiple, sequential estrogen-regulated processes required for cell cycle completion. Mol Cell Endocrinol 165:199–209[CrossRef][Medline]
  24. Kitagawa M, Higashi H, Jung HK, Suzuki-Takahashi I, Ikeda M, Tamai K, Kato J, Segawa K, Yoshida E, Nishimura S, Taya Y 1996 The consensus motif for phosphorylation by cyclin D1-Cdk4 is different from that for phosphorylation by cyclin A/E-Cdk2. EMBO J 15:7060–7069[Medline]
  25. Connell-Crowley L, Harper JW, Goodrich DW 1997 Cyclin D1/Cdk4 regulates retinoblastoma protein-mediated cell cycle arrest by site-specific phosphorylation. Mol Biol Cell 8:287–301[Abstract]
  26. Grafstrom RH, Pan W, Hoess RH 1999 Defining the substrate specificity of cdk4 kinase-cyclin D1 complex. Carcinogenesis 20:193–198[Abstract/Free Full Text]
  27. Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA 1998 Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev 19:225–268[Abstract/Free Full Text]
  28. Cheng Y, Zhizhin I, Perlman R L, Mangoura D 2000 Prolactin-induced cell proliferation in PC12 cells depends on JNK but not ERK activation. J Biol Chem 275:23326–23332[Abstract/Free Full Text]
  29. Olazabal I, Munoz J, Ogueta S, Obregon E, Garcia-Ruiz JP 2000 Prolactin (PRL)-PRL receptor system increases cell proliferation involving JNK (c-Jun amino terminal kinase) and AP-1 activation: inhibition by glucocorticoids. Mol Endocrinol 14:564–575[Abstract/Free Full Text]
  30. Yamauchi T, Yamauchi N, Ueki K, Sugiyama T, Waki H, Miki H, Tobe K, Matsuda S, Tsushima T, Yamamoto T, Fujita T, Taketani Y, Fukayama M, Kimura S, Yazaki Y, Nagai R, Kadowaki T 2000 Constitutive tyrosine phosphorylation of ErbB-2 via Jak2 by autocrine secretion of prolactin in human breast cancer. J Biol Chem 275:33937–33944[Abstract/Free Full Text]
  31. Saceda M, Grunt TW, Colomer R, Lippman ME, Lupu R, Martin MB 1996 Regulation of estrogen receptor concentration and activity by an erbB/HER ligand in breast carcinoma cell lines. Endocrinology 137:4322–4330[Abstract]
  32. Bablin-Gray J, Zalvide J, Fox MP, Knickerbocker CJ, DeCaprio JA, Keyomarsi K 1996 Cyclin E, a redundant cyclin in breast cancer. Proc Natl Acad Sci USA 93:15215–15220[Abstract/Free Full Text]
  33. Chen WY, Ramamoorthy P, Chen N, Sticca R, Wagner TE 1999 A human prolactin antagonist, hPRL-G129R, inhibits breast cancer cell proliferation through induction of apoptosis. Clin Cancer Res 5:3583–3593[Abstract/Free Full Text]
  34. Dickson C, Creer A, Fantl V 2000 Mammary gland oncogenes as indicators of pathways important in mammary gland development. Oncogene 19:1097–1101[CrossRef][Medline]
  35. Musgrove EA, Lee CS, Buckley MF, Sutherland RL 1994 Cyclin D1 induction in breast cancer cells shortens G1 and is sufficient for cells arrested in G1 to complete the cell cycle. Proc Natl Acad Sci USA 91:8022–8026[Abstract/Free Full Text]
  36. Sicinski P, Weinberg RA 1997 A specific role for cyclin D1 in mammary gland development. J Mammary Gland Biol Neopl 2:335–342[CrossRef][Medline]
  37. Van Diest PJ, Michalides RJAM, Jannink I, Van der Valk P, Peterse HL, De Jong JS, Meijer CJLM, Baak JPA 1997 Cyclin D1 expression in invasive breast cancer: correlations and prognostic value. Am J Pathol 150:705–711[Abstract]
  38. Barnes DM 1997 Cyclin D1 in mammary carcinoma. J Pathol 181:267–269[CrossRef][Medline]
  39. Wang TC, Cardiff RD, Zukerberg L, Lees M, Arnold A, Schmidt EV 1994 Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 369:669–671[CrossRef][Medline]
  40. Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ, Arnold A 1999 The cyclins and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation and differentiation. Endocr Rev 20:501–534[Abstract/Free Full Text]
  41. Clevenger CV, Chang W-P, Ngo W, Pasha TLM, Montone KT, Tomaszewski JE 1995 Expression of prolactin and prolactin receptor in human breast carcinoma: evidence for an autocrine/paracrine loop. Am J Pathol 146:695–705[Abstract]
  42. Kline JB, Roehrs H, Clevenger CV 1999 Functional characterization of the intermediate isoform of the human prolactin receptor. J Biol Chem 274:35461–35468[Abstract/Free Full Text]
  43. Hennighausen L, Robinson GW, Wagner K-U, Liu XW 1997 Prolactin signaling in mammary gland development. J Biol Chem 272:7567–7569[Free Full Text]
  44. Keyomarsi K, Pardee AB 1993 Redundant cyclin overexpression and gene amplification in breast cancer cells. Proc Natl Acad Sci USA 90:1112–1116[Abstract/Free Full Text]
  45. Megha T, Lazzi S, Ferrari F, Vatti R, Howard CM, Cevenini G, Leoncini L, Luzi P, Giordano A, Tosi P 1999 Expression of the G2-M checkpoint regulators cyclin B1 and P34CDC2 in breast cancer: a correlation with cellular kinetics. Anticancer Res 19:163–169[Medline]
  46. Ohi R, Gould KL 1999 Regulating the onset of mitosis. Curr Opin Cell Biol 11:267–273[CrossRef][Medline]
  47. Hershko A 1996 Mechanisms and regulation of ubiquitin-mediated cyclin degradation. Adv Exp Med Biol 389:221–227[Medline]
  48. Pines J 1999 Four-dimensional control of the cell cycle. Nat Cell Biol 1:E73–E79
  49. Yang J, Song H, Walsh S, Bardes ES, Kornbluth S 2000 Combinatorial control of cyclin B1 nuclear trafficking through phosphorylation at multiple sites. J Biol Chem 276:3604–3609[Abstract/Free Full Text]
  50. McShea A, Samuel T, Eppel JT, Galloway DA, Funk JO 2000 Identification of CIP-1-associated regulator of cyclin B (CARB), a novel p21-binding protein acting in the G2 phase of the cell cycle. J Biol Chem 275:23181–23186[Abstract/Free Full Text]
  51. Gartel AL, Tyner AL 1999 Transcriptional regulation of the p21(WAF1/CIP1) gene. Exp Cell Res 246:280–289[CrossRef][Medline]
  52. Sinibaldi D, Wharton W, Turkson J, Bowman T, Pledger WJ, Jove R 2000 Induction of p21WAF1/CIP1 and cyclin D1 expression by the Src oncoprotein in mouse fibroblasts: role of activated STAT3 signaling. Oncogene 19:5419–5427[CrossRef][Medline]
  53. Dupont J, Karas M, LeRoith D 2000 The potentiation of estrogen on insulin-like growth factor I action in MCF-7 human breast cancer cells includes cell cycle components. J Biol Chem 275:35893–35901[Abstract/Free Full Text]
  54. Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB 1998 Convergence of progesterone with growth factor and cytokine signaling in breast cancer: progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem 273:31317–31326[Abstract/Free Full Text]
  55. Gooch JL, Herrera RE, Yee D 2000 The role of p21 in interferon gamma-mediated growth inhibition of human breast cancer cells. Cell Growth Differ 11:335–342[Abstract/Free Full Text]
  56. Chin YE, Kitagawa M, Su WCS, You ZH, Iwamoto Y, Fu XY 1996 Cell growth arrest and induction of cyclindependent kinase inhibitor p21 (WAF1/CIP1) mediated by Stat 1. Science 272:719–722[Abstract]
  57. DaSilva L, Rui H, Erwin RA, Howard OM, Kirken RA, Malabarba MG, Hackett RH, Larner AC, Farrar WL 1996 Prolactin recruits STAT1, STAT3 and STAT5 independent of conserved receptor tyrosines TYR402, TYR479, TYR515 and TYR580. Mol Cell Endocrinol 117:131–140[CrossRef][Medline]
  58. Ormandy CJ, Hall RE, Manning DL, Robertson JFR, Blamey RW, Kelly PA, Nicholson RI, Sutherland RL 1997 Coexpression and cross-regulation of the prolactin receptor and sex steroid hormone receptors in breast cancer. J Clin Endocrinol Metab 82:3692–3699[Abstract/Free Full Text]
  59. Yee D, Lee AV 2000 Crosstalk between the insulin-like growth factors and estrogens in breast cancer. J Mammary Gland Biol Neopl 5:107–115[CrossRef][Medline]
  60. Lange CA, Richer JK, Horwitz KB 1999 Hypothesis: progesterone primes breast cancer cells for cross-talk with proliferative or antiproliferative signals. Mol Endocrinol 13:829–836[Free Full Text]
  61. Carroll JS, Prall OWJ, Musgrove EA, Sutherland RL 2000 A pure enstrogen antagonist inhibits cyclin E-cdk2 activity in MCF-7 breast cancer cells and induces accumulation of p130–E2F4 complexes characteristic of quiescence. J Biol Chem 275:38221–338229[Abstract/Free Full Text]
  62. Gao J, Hughes JP, Auperin B, Buteau H, Edery M, Zhuang HM, Wojchowski DM, Horseman ND 1996 Interactions among JANUS kinases and the prolactin (PRL) receptor in the regulation of a PRL response element. Mol Endocrinol 10:847–856[Abstract/Free Full Text]
  63. Tseng YH, Schuler LA 1998 Transcriptional regulation of interleukin-1ß gene by interleukin- 1ß itself is mediated in part by Oct-1 in thymic stromal cells. J Biol Chem 273:12633–12641[Abstract/Free Full Text]
  64. Gout PW, Beer CT, Noble RL 1980 Prolactin-stimulated growth of cell cultures established from malignant Nb rat lymphomas. Cancer Res 40:2433–2436[Abstract/Free Full Text]
  65. Schroeder MD, Rose-Hellekant T, Sandgren EP, Schuler LA 2001 Dysregulation of signal transducers and activators of transcription 1, 3, and 5 and prolactin receptors by overexpression of mammary TGF{alpha}. Mol Cell Endocrinol 175:173–183[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
A. Plotnikov, B. Varghese, T. H. Tran, C. Liu, H. Rui, and S. Y. Fuchs
Impaired Turnover of Prolactin Receptor Contributes to Transformation of Human Breast Cells
Cancer Res., April 1, 2009; 69(7): 3165 - 3172.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
L. M. Arendt, T. L. Grafwallner-Huseth, and L. A. Schuler
Prolactin-Growth Factor Crosstalk Reduces Mammary Estrogen Responsiveness Despite Elevated ER{alpha} Expression
Am. J. Pathol., March 1, 2009; 174(3): 1065 - 1074.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. M. Piazza, J.-C. Lu, K. C. Carver, and L. A. Schuler
Src Family Kinases Accelerate Prolactin Receptor Internalization, Modulating Trafficking and Signaling in Breast Cancer Cells
Mol. Endocrinol., February 1, 2009; 23(2): 202 - 212.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. C. Carver and L. A. Schuler
Prolactin Does Not Require Insulin-Like Growth Factor Intermediates but Synergizes with Insulin-Like Growth Factor I in Human Breast Cancer Cells
Mol. Cancer Res., April 1, 2008; 6(4): 634 - 643.
[Abstract] [Full Text] [PDF]


Home page
J PsychopharmacolHome page
P. W. Harvey, D. J. Everett, and C. J. Springall
Adverse effects of prolactin in rodents and humans: breast and prostate cancer
J Psychopharmacol, March 1, 2008; 22(2_suppl): 20 - 27.
[Abstract] [PDF]


Home page
Endocr. Rev.Home page
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee
What Can We Learn from Rodents about Prolactin in Humans?
Endocr. Rev., February 1, 2008; 29(1): 1 - 41.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
L. M. Arendt and L. A. Schuler
Prolactin Drives Estrogen Receptor-{alpha}-Dependent Ductal Expansion and Synergizes with Transforming Growth Factor-{alpha} to Induce Mammary Tumors in Males
Am. J. Pathol., January 1, 2008; 172(1): 194 - 202.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Ge, C. A. Fernandez, M. A. Moses, and D. S. Greenspan
Bone morphogenetic protein 1 processes prolactin to a 17-kDa antiangiogenic factor
PNAS, June 12, 2007; 104(24): 10010 - 10015.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
O. Eyal, J.-B. Jomain, C. Kessler, V. Goffin, and S. Handwerger
Autocrine Prolactin Inhibits Human Uterine Decidualization: A Novel Role for Prolactin
Biol Reprod, May 1, 2007; 76(5): 777 - 783.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. S. Tworoger, A. H. Eliassen, P. Sluss, and S. E. Hankinson
A Prospective Study of Plasma Prolactin Concentrations and Risk of Premenopausal and Postmenopausal Breast Cancer
J. Clin. Oncol., April 20, 2007; 25(12): 1482 - 1488.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
J. P Wiebe
Progesterone metabolites in breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 717 - 738.
[Abstract] [Full Text] [PDF]


Home page
Hum Exp ToxicolHome page
P W Harvey, D J Everett, and C J Springall
Hyperprolactinaemia as an adverse effect in regulatory and clinical toxicology: role in breast and prostate cancer
Human and Experimental Toxicology, July 1, 2006; 25(7): 395 - 404.
[Abstract] [PDF]


Home page
Am. J. Pathol.Home page
L. M. Arendt, T. A. Rose-Hellekant, E. P. Sandgren, and L. A. Schuler
Prolactin Potentiates Transforming Growth Factor {alpha} Induction of Mammary Neoplasia in Transgenic Mice
Am. J. Pathol., April 1, 2006; 168(4): 1365 - 1374.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. S. Tworoger, P. Sluss, and S. E. Hankinson
Association between Plasma Prolactin Concentrations and Risk of Breast Cancer among Predominately Premenopausal Women
Cancer Res., February 15, 2006; 66(4): 2476 - 2482.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-C. Lu, T. M. Piazza, and L. A. Schuler
Proteasomes Mediate Prolactin-induced Receptor Down-regulation and Fragment Generation in Breast Cancer Cells
J. Biol. Chem., October 7, 2005; 280(40): 33909 - 33916.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. P. Tabruyn, N.-Q.-N. Nguyen, A. M. Cornet, J. A. Martial, and I. Struman
The Antiangiogenic Factor, 16-kDa Human Prolactin, Induces Endothelial Cell Cycle Arrest by Acting at Both the G0-G1 and the G2-M Phases
Mol. Endocrinol., July 1, 2005; 19(7): 1932 - 1942.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. H. Gutzman, S. E. Nikolai, D. E. Rugowski, J. J. Watters, and L. A. Schuler
Prolactin and Estrogen Enhance the Activity of Activating Protein 1 in Breast Cancer Cells: Role of Extracellularly Regulated Kinase 1/2-Mediated Signals to c-fos
Mol. Endocrinol., July 1, 2005; 19(7): 1765 - 1778.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Goffin, S. Bernichtein, P. Touraine, and P. A. Kelly
Development and Potential Clinical Uses of Human Prolactin Receptor Antagonists
Endocr. Rev., May 1, 2005; 26(3): 400 - 422.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. H. Gutzman, D. E. Rugowski, M. D. Schroeder, J. J. Watters, and L. A. Schuler
Multiple Kinase Cascades Mediate Prolactin Signals to Activating Protein-1 in Breast Cancer Cells
Mol. Endocrinol., December 1, 2004; 18(12): 3064 - 3075.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. S. Tworoger, A. H. Eliassen, B. Rosner, P. Sluss, and S. E. Hankinson
Plasma Prolactin Concentrations and Risk of Postmenopausal Breast Cancer
Cancer Res., September 15, 2004; 64(18): 6814 - 6819.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. M. Karp, H. Pan, M. Zhang, D. J. Buckley, L. A. Schuler, and A. R. Buckley
Identification of HRPAP20: A Novel Phosphoprotein that Enhances Growth and Survival in Hormone-Responsive Tumor Cells
Cancer Res., February 1, 2004; 64(3): 1016 - 1025.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. D. Schroeder, J. L. Brockman, A. M. Walker, and L. A. Schuler
Inhibition of Prolactin (PRL)-Induced Proliferative Signals in Breast Cancer Cells by a Molecular Mimic of Phosphorylated PRL, S179D-PRL
Endocrinology, December 1, 2003; 144(12): 5300 - 5307.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. J. Acosta, R. M. Munoz, L. Gonzalez, A. Subtil-Rodriguez, M. A. Dominguez-Caceres, J. M. Garcia-Martinez, A. Calcabrini, I. Lazaro-Trueba, and J. Martin-Perez
Src Mediates Prolactin-Dependent Proliferation of T47D and MCF7 Cells via the Activation of Focal Adhesion Kinase/Erk1/2 and Phosphatidylinositol 3-Kinase Pathways
Mol. Endocrinol., November 1, 2003; 17(11): 2268 - 2282.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. B. Kabotyanski and J. M. Rosen
Signal Transduction Pathways Regulated by Prolactin and Src Result in Different Conformations of Activated Stat5b
J. Biol. Chem., May 2, 2003; 278(19): 17218 - 17227.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. V. Clevenger, P. A. Furth, S. E. Hankinson, and L. A. Schuler
The Role of Prolactin in Mammary Carcinoma
Endocr. Rev., February 1, 2003; 24(1): 1 - 27.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Graichen, D. Liu, Y. Sun, K.-O. Lee, and P. E. Lobie
Autocrine Human Growth Hormone Inhibits Placental Transforming Growth Factor-beta Gene Transcription to Prevent Apoptosis and Allow Cell Cycle Progression of Human Mammary Carcinoma Cells
J. Biol. Chem., July 12, 2002; 277(29): 26662 - 26672.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. L. Brockman, M. D. Schroeder, and L. A. Schuler
PRL Activates the Cyclin D1 Promoter Via the Jak2/Stat Pathway
Mol. Endocrinol., April 1, 2002; 16(4): 774 - 784.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schroeder, M. D.
Right arrow Articles by Schuler, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schroeder, M. D.
Right arrow Articles by Schuler, L. A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Breast Cancer


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals