help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0110
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
16/10/2215    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuda, K.-i.
Right arrow Articles by Kawata, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuda, K.-i.
Right arrow Articles by Kawata, M.
Molecular Endocrinology 16 (10): 2215-2230
Copyright © 2002 by The Endocrine Society

Colocalization and Ligand-Dependent Discrete Distribution of the Estrogen Receptor (ER){alpha} and ERß

Ken-ichi Matsuda, Ikuo Ochiai, Mayumi Nishi and Mitsuhiro Kawata

Department of Anatomy and Neurobiology, Kyoto Prefectural University of Medicine, Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan

Address all correspondence and requests for reprints to: Ken-ichi Matsuda, Department of Anatomy and Neurobiology, Kyoto Prefectural University of Medicine, Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan. E-mail: matsuken{at}basic.kpu-m.ac.jp.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
To investigate the relationships between the loci expressing functions of estrogen receptor (ER){alpha} and that of ERß, we analyzed the subnuclear distribution of ER{alpha} and ERß in response to ligand in single living cells using fusion proteins labeled with different spectral variants of green fluorescent protein. Upon activation with ligand treatment, fluorescent protein-tagged (FP)-ERß redistributed from a diffuse to discrete pattern within the nucleus, showing a similar time course as FP-ER{alpha}, and colocalized with FP-ER{alpha} in the same discrete cluster. Analysis using deletion mutants of ER{alpha} suggested that the ligand-dependent redistribution of ER{alpha} might occur through a large part of the receptor including at least the latter part of activation function (AF)-1, the DNA binding domain, nuclear matrix binding domain, and AF-2/ligand binding domain. In addition, a single AF-1 region within ER{alpha} homodimer, or a single DNA binding domain as well as AF-1 region within the ER{alpha}/ERß heterodimer, could be sufficient for the cluster formation. More than half of the discrete clusters of FP-ER{alpha} and FP-ERß were colocalized with hyperacetylated histone H4 and a component of the chromatin remodeling complex, Brg-1, indicating that ERs clusters might be involved in structural changes of chromatin.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
ESTROGEN REGULATES VARIOUS physiological functions upon binding to its specific receptors. Estrogen receptors (ERs) are members of the nuclear receptor superfamily of ligand-dependent transcription factors that regulate the expression of target genes (1). To date, two ERs (ER{alpha} and ERß) have been identified that are encoded by different genes. ER{alpha} and ERß have similar overall structures with at least three functional domains in common: the ligand-binding domain located at the C-terminal half of the proteins, the DNA-binding domain located centrally, and a variable transactivation domain located at the N-terminal end (2, 3). In several areas of the estrogen target tissues such as brain, pituitary, and mammary gland, both ER subtypes are coexpressed in the same cells (4, 5, 6, 7, 8, 9), whereas tissues where ER{alpha} and ERß are differentially distributed are also observed (3, 10, 11). The coexpression of ER{alpha} and ERß suggests a possibility that two ER subtypes interact with each other. In fact, ER{alpha} and ERß form heterodimers in vitro and in vivo (12, 13, 14), and the transcriptional activity of ER{alpha} is positively or negatively modulated by dimerizing with ERß (15, 16), indicating that the relative expression level of the two isoforms would be a key determinant in the cellular responses to estrogen.

The subcellular localization of ER{alpha} was found to be in the nucleus, and this was independent of ligand as shown by immunocytochemistry as well as hormone-binding assays of cytoplast and nucleoplast fractions (17, 18). The unliganded form of ER{alpha}, although localized in the nucleus, is not tightly bound to nuclear components, and ligand binding causes a transformation of ER{alpha} to a more tightly bound form (19). ER{alpha} has been known to specifically associate with the nuclear matrix (NM) after ligand binding, suggesting that the more tightly bound form of ER{alpha} is the NM-associated form of ER{alpha} (20, 21). A direct visualization approach in living cells based on green fluorescent protein (GFP) tagging revealed the difference in the intranuclear localization of unliganded and liganded forms of ER{alpha} (22, 23, 24). In the absence of ligand, GFP-tagged ER{alpha} (GFP-ER{alpha}) is diffusely distributed throughout the nucleoplasm being excluded from nucleolar regions. Upon the addition of ligand, a redistribution of GFP-ER{alpha} from a diffuse to discrete pattern occurs rapidly within the nucleus. The discrete clusters of ER{alpha} are associated with NM and steroid receptor coactivator-1 (SRC-1), which is a member of a class of transcriptional coactivators that enhance agonist-induced transcription of the nuclear receptor superfamily proteins including ER{alpha}. Recently, florescence recovery after photobleaching (FRAP) technique showed that ER{alpha} and SRC-1 were mobilized rapidly within the nucleus depending upon proteasome activity, despite being bound to the NM, suggesting that the ligand-activated ER{alpha}-SRC-1 complex might be rapidly exchanged at internuclear target sites on chromatin and NM to exert positive effects on transcription (25).

It has been thought that ERs control the expression of specific genes by binding to regulatory DNA sequences, named estrogen-responsive elements (ERE) located at the promoter or enhancer regions of the genes (1). However, discrete ER{alpha} foci are not localized at the sites of nascent mRNA transcription as labeled by an antibody recognizing phosphorylated RNA polymerase II except only a small incidence (23, 26, 27, 28, 29). Therefore, the ligand-dependent intranuclear reorganization of ER{alpha} may involve more complex events than the simple recognition of ERE as previously believed.

There exists abundant evidence that the structure and chemical composition of chromatin directly affect gene expression (30). The acetylation of histones has emerged as a regulatory mechanism for modulating the properties of chromatin and thus as a general key step in transcriptional control. SRC-1 and other transcriptional coactivators that interact with nuclear receptors possess intrinsic histone acetyltransferase (HAT) activity, and these coactivator complexes formed in response to the ligand activation have been proposed to modulate expression of target genes not only through direct interaction with the RNA polymerase II but also through HAT activity (31, 32). The chromatin structure is also altered via the ATP-dependent disruption of nucleosomes by large multiprotein chromatin remodeling complexes (30, 33). One such complex, the human Brahma/Brahma related gene-1 (BRG-1) complex, has previously been shown to enhance transcriptional activation by nuclear receptors (34, 35, 36). In addition, functional cooperation between BRG-1 and coactivators that modulate the histone acetylation status in ER{alpha}-mediated transcriptional activation has been reported recently (37). Further investigation of the role of the chromatin status in estrogen signaling therefore seems to be important to our understanding of gene regulation by ERs in vivo.

In the present study, we investigated the relationships between the loci expressing functions of ER{alpha} and that of ERß by analyzing the subnuclear distribution of ER{alpha} and ERß in response to ligand in single living cells using fusion proteins labeled with different spectral variants of GFP, yellow fluorescent protein (YFP), and cyan fluorescent protein (CFP). Here we report colocalization of fluorescent protein tagged (FP)-ER{alpha} and -ß in the nucleus forming discrete clusters in response to ligand activation, and domains of the ER{alpha} protein needed to form the cluster by making heterodimer with ERß using chimera proteins of fluorescent protein and deletion mutants of ER{alpha}. Furthermore, to elucidate the meaning of the cluster formation, we also examine colocalization of FP-ERs and two nuclear components, Brg-1 and hyperacetylated histone H4 (AcH4), which are involved in conformational changes of the chromatin structure.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Characterization of FP-ER{alpha} and -ß
A cDNA fragment containing the entire sequence of rat ER{alpha} or rat ERß was ligated in frame to the 3'-end of enhanced GFP (EGFP), enhanced CFP (ECFP), and enhanced YFP (EYFP) of cytomegalovirus promoter driven expression vectors. These plasmids were transiently transfected into COS-1 cells that lacked endogenous ERs, and the cells were incubated for 20 h. Lysates of the transfected cells were analyzed by Western blotting using anti-GFP antibody that cross-reacts with YFP and CFP. The expressed GFP-ER{alpha}, GFP-ERß, CFP-ER{alpha}, CFP-ERß, and YFP-ER{alpha} were all detected with the major bands at expected molecular weights (Fig. 1AGo). To elucidate the functional properties of the fusion proteins, the constructs were cotransfected with an ER-responsive reporter plasmid, pERE-luciferase, into CV-1 cells (which lack endogenous ERs). When treated with 17ß-estradiol (E2: final concentration 10-7 M) for 30 h, all of FP-ERs induced the activation of the ER-responsive reporter gene to similar level of untagged ER{alpha} and ERß (Fig. 1BGo). Thus, it was confirmed that the receptor proteins used in this study maintained the capacity to function as ligand-dependent transcription factor.



View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Characterization of FP-ERs

A, Immunoblot analysis of the protein products of FP-ERs. Cellular lysates of COS-1 cells transiently transfected with the expression plasmids of GFP-ER{alpha}, YFP-ER{alpha}, CFP-ER{alpha}, GFP-ERß, or CFP-ERß were subjected to SDS-PAGE (10% separating gel), and then Western blotting was performed using a polyclonal antibody against GFP that cross-reacts to YFP and CFP. Expression of FP-ERs was detected at the predicted molecular masses of 95 kDa (FP-ER{alpha}) or 82 kDa (FP-ERß). B, Transcriptional activation by FP-ERs in CV-1 cells. The estrogen-inducible reporter ERE-luciferase was cotransfected with expression plasmids encoding G/Y/CFP-ER{alpha} G/CFP-ERß, untagged ER{alpha}, or untagged ERß. As an internal standard, a mammalian positive control vector, pAct-ßGal, was also cotransfected in each case. Fold inductions shown were calculated from luciferase activity of E2-treated samples relative to untreated controls after normalization of the transfection efficiencies with ß-galactosidase activity.

 
Subcellular Distribution of GFP-ERß in Living Cells
To determine the localization of FP-ERß, we transfected an expression vector of GFP-ERß to COS-1 cells and captured fluorescence images by conventional fluorescence microscopy every 10 min after addition of E2 (final concentration 10-7 M). Fluorescence of GFP-ERß was restricted to the nucleus of the cells, both in the absence and in the presence of ligand as shown by a comparison of the images from the differential interference contrast and Hoechst 33342 DNA staining (Fig. 2Go). Before ligand addition, GFP-ERß showed a diffuse distribution throughout the nucleoplasm but was excluded from nucleoli. Upon ligand treatment, GFP-ERß in the same cell was relocalized to show a discrete pattern. The discrete cluster formation appeared within 10 min and reached in maximum within 30 min after the addition of ligand. These subcellular distribution patterns of GFP-ERß were very similar to the patterns of GFP-ER{alpha} previously reported (22, 23, 24).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. Time-Lapse Imaging of a GFP-ERß Transfected Cell

COS-1 cells were transiently transfected with pGFP-ERß, and fluorescent images of a living cell expressing GFP-ERß were captured before (0 min) and after the addition of 10-7 M E2 at 10-min intervals. An image of the nucleus stained with Hoechst 33342 (Hoe) and a Nomarski differential interference contrast image of the cell (Nom) are shown together. All of fluorescent images were shown after applying a deconvolution procedure. Bar, 5 µm.

 
Colocalization of FP-ER{alpha} and FP-ERß
YFP and CFP, well-characterized spectral variants of GFP, have been used for double imaging of two different molecules because it is easy to distinguish each fluorescence by using specific filters. When YFP-ER{alpha} construct was singly transfected to COS-1 cells, we could observe YFP fluorescence using a filter set for YFP-imaging (Fig. 3AaGo) but only faint autofluorescence using a filter set for CFP-imaging despite 10 times longer capturing (Fig. 3AbGo). In contrast, when CFP-ERß construct was singly transfected, we could observe CFP fluorescence using a filter set for CFP-imaging (Fig. 3AdGo) but only faint autofluorescence using a filter set for YFP-imaging (Fig. 3AcGo) despite 10 times longer capturing. Thus, it was shown that YFP fluorescence and CFP fluorescence were separately observed without leaking each other by filter sets using in this study. To investigate how FP-ER{alpha} and FP-ERß were distributed when both receptor proteins were coexpressed in a single living cell, expression plasmid of YFP-ER{alpha} and CFP-ERß were cotransfected to COS-1 cells. Fluorescent images of YFP-ER{alpha} and CFP-ERß were captured before and after the addition of ligand (40 min). To visualize the intranuclear area where the two receptor proteins were colocalized, the images were pseudocolored with red and green, respectively, and then merged (Fig. 3BGo). The distribution of YFP-ER{alpha} and CFP-ERß almost completely overlapped in both the unliganded and liganded states. In the presence of 10-7 M E2, YFP-ER{alpha}, and CFP-ERß were localized at the same discrete clusters, suggesting that both subtypes of estrogen receptor were bound to the same nuclear sites. Dose response for the cluster formation was examined by treating the cells with lower concentration of E2 (Fig. 3CGo). In the presence of 10-8 M E2, YFP-ER{alpha} and CFP-ERß localized at the same nuclear loci by forming discrete cluster at similar intensity to the clusters formed in the presence of 10-7 M E2. At 10-9 M, the cluster formation was weakened but still observed, whereas, at 10-10 M, both receptor proteins were distributed diffusely within the nucleus. There was no detectable difference in the dose of E2 to form the discrete cluster between YFP-ER{alpha} and CFP-ERß. In addition, there was no detectable difference in the time course of the relocalization between the two receptor proteins (Fig. 4AGo) or in the time course between GFP-ERß single (Fig. 2Go) and YFP-ER{alpha}/CFP-ERß double (Fig. 4AGo) expression. We also analyzed the subcellular localization of YFP-ER{alpha} and CFP-ERß in a rat hypothalamic cell line, RCF12, which expressed endogenous ERß (38, 39). The redistribution of FP-ERs from diffuse to discrete pattern was observed with a similar time course regardless of the estrogen responsiveness of the cell lines (Fig. 4AGo).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 3. Dual-Color Imaging of ER{alpha} and ERß with GFP Spectral Variants in a Single Living Cell

A, COS-1 cells were singly transfected with pYFP-ER{alpha} or pCFP-ERß. Fluorescent images of a YFP-ER{alpha} expressing cell that was captured for 300 msec with a filter set for YFP and that was captured for 3000 msec with a filter set for CFP are shown in a and b, respectively. Fluorescent images of a CFP-ERß expressing cell that was captured for 3000 msec with a filter set for YFP and that was captured for 300 msec with a filter set for CFP are shown in c and d, respectively. B, COS-1 cells were transiently transfected with pYFP-ER{alpha} and pCFP-ERß. Fluorescent images of YFP-ER{alpha} and CFP-ERß were captured before (0 min; upper) and 40 min after the addition of 10-7 M E2 (lower). Images of YFP-ER{alpha} were pseudocolored with red (left) and images of CFP-ERß were done with green (middle). Merged images of these two figures are shown in the right panels. C, Fluorescent images of COS-1 cells transfected with pYFP-ER{alpha} (upper) and pCFP-ERß (lower) were captured 60 min after the addition of 10-8 M (left), 10-9 M (middle), or 10-10 M (right) of E2. All of images were shown after applying a deconvolution procedure. Bar, 5 µm.

 


View larger version (63K):
[in this window]
[in a new window]
 
Figure 4. Time-Lapse Imaging of YFP-ER{alpha} and CFP-ERß Expressed in COS-1 and RCF12 Cells

A, Time-lapse imaging of YFP-ER{alpha} and CFP-ERß cotransfected in COS-1 cells. COS-1 cells were transiently transfected with pYFP-ER{alpha} and pCFP-ERß. Fluorescent images of a living cell expressing YFP-ER{alpha} (upper) and CFP-ERß (lower) were captured before (0 min) and after the addition of 10-7 M E2 at 10-min intervals. B, Time-lapse imaging of YFP-ER{alpha} and CFP-ERß cotransfected in RCF12 cells. RCF12 cells were transiently transfected with pYFP-ER{alpha} and pCFP-ERß, Fluorescent images of a living cell expressing YFP-ER{alpha} (upper) and CFP-ERß (lower) were captured before (0 min) and after the addition of 10-7 M E2 at 10-min intervals. All of images were shown after applying a deconvolution procedure. Bar, 5 µm.

 
Domains of ER{alpha} Protein Essential for the Discrete Cluster Formation
To determine which region of ER{alpha} was responsible for the ligand-dependent discrete cluster formation, we constructed YFP fusions with a series of ER{alpha} deletion mutants (Fig. 5AGo) (40) and transfected the constructs in COS-1 cells. The expressed YFP fusions of ER{alpha} deletion mutants were detected with all the major bands at the expected molecular weights (Fig. 5BGo). The cluster formation activity was retained with N-terminal deletion up to amino acid 81. However, deletion extended to amino acid 140 or 246 resulted in a loss of the activity, although in a small population of the cells transfected with the YFP-ER{alpha}{Delta}N140 construct, slight faint clusters were observed (Fig. 6AGo). These results indicate that the latter part of the N-terminal transactivation domain and DNA binding domain are essential for the foci formation. We also analyzed the cellular localization of two C-terminal deletion mutants, YFP-ER{alpha}{Delta}C341 and YFP-ER{alpha}{Delta}C480 (Fig. 6BGo). It is conceivable that these constructs do not have the ligand-dependent discrete cluster formation activity because these constructs lack almost all or the latter half part of the ligand-binding domain, respectively. As expected, the C-terminally truncated proteins did not show the cluster formation. In addition, YFP fluorescence was also observed in the cytoplasm of YFP-ER{alpha}{Delta}C480 transfected cells. These results suggest that C-terminal region of the ER{alpha} protein is necessary not only for cluster formation in the nucleus but also for the proper nuclear localization. To examine whether the YFP and ER{alpha} deletion mutant chimera proteins which did not have cluster formation activity were changed to show the discrete distribution by coexpressing full-length ER{alpha}, constructs of the deletion chimera and CFP-ER{alpha} were cotransfected in COS-1 cells (Fig. 7AGo). When YFP-ER{alpha}{Delta}N140 was coexpressed with CFP-ER{alpha}, YFP-ER{alpha}{Delta}N140 was distributed discretely in the nucleus after addition of ligand and was localized in the same clusters of CFP-ER{alpha}, indicating that ligand bound YFP-ER{alpha}{Delta}N140 and CFP-ER{alpha} dimerized with each other and were then localized to the nuclear loci that should be bound. However, YFP-ER{alpha}{Delta}N246, YFP-ER{alpha}{Delta}C341, and YFP-ER{alpha}{Delta}C480 did not show the ligand-dependent relocalization even in the presence of full-length ER{alpha}. We next investigated how the deletion mutants of YFP-ER{alpha} were distributed when these proteins were coexpressed with CFP-ERß (Fig. 7BGo). Both of YFP-ER{alpha}{Delta}N140 and YFP-ER{alpha}{Delta}N246 formed discrete clusters in the nucleus upon ligand addition and the distribution of these clusters was overlapped with CFP-ERß clusters. Although the cluster formation did not show when the proteins were expressed alone, coexpression with CFP-ERß allowed these truncated protein to localize to discrete loci, suggesting that CFP-ERß formed heterodimers with YFP-ER{alpha}{Delta}N140 or YFP-ER{alpha}{Delta}N246 after ligand binding. There was a difference in the region of the ER{alpha} protein needed to form the discrete cluster by making homodimers or heterodimers with ERß because, in the presence of CFP-ERß, YFP-ER{alpha}{Delta}N246 formed the cluster, whereas, in the presence of CFP-ER{alpha}, YFP-ER{alpha}{Delta}N246 did not. In contrast to the N-terminal deletions, neither of the two C-terminal deletion chimeras was able to show the cluster formation irrespective of the presence of ERß as was found in the case of ER{alpha}.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. Structure and Expression of YFP Fusions of ER{alpha} Deletion Mutants

A, Schematic representation of the structure for YFP fusions of the full-length or deletion mutants of ER{alpha}. In all of the fusion proteins, the C-terminal of YFP is coupled to the full-length or truncated ER{alpha}. The N-terminal deletion mutants are designated up to the amino acid number where the deletion was carried out (for example, in {Delta}N81 the first Met to 81st amino acid is deleted) The C-terminal deletion mutants are designated according to the amino acid number from where the deletion was carried out (for example, in {Delta}C341 the 341st amino acid to the last amino acid is deleted). Dimerization, Region required for dimerization; DNA-binding, DNA binding domain; Hsp-binding, heat shock protein binding domain; LBD, ligand-binding domain; NLS, nuclear localization signals; NM-binding, region required for nuclear matrix binding. B, Immunoblot analysis of the protein products for YFP fusions of ER{alpha} deletion mutants. Cellular lysates of COS-1 cells transiently transfected with each expression plasmid for the chimera constructs of the ER{alpha} deletion mutants and YFP were subjected to SDS-PAGE (10% separating gel), and then Western blotting was performed using the polyclonal antibody against GFP that cross-reacts to YFP and CFP. Expression of the chimera proteins was detected at the predicted molecular masses of 85.4 kDa ({Delta}N81), 79.1 kDa ({Delta}N140), 67.1 kDa ({Delta}N246), 64.5 kDa ({Delta}C341), or 74.6 kDa ({Delta}C430).

 


View larger version (57K):
[in this window]
[in a new window]
 
Figure 6. Subcellular Localization of YFP Fusions of ER{alpha} Deletion Mutants

COS-1 cells were transiently transfected with each expression plasmid for the chimera constructs of ER{alpha} deletion mutants and YFP. Fluorescence images were captured before (0 min; upper) and 60 min after the addition of 10-7 M E2 (lower). A, Images of the N-terminal deletion mutants ({Delta}N81, left; {Delta}N140, middle; {Delta}N246, right). B, Images of the C-terminal deletion mutants ({Delta}C341, left; {Delta}C430, right). All of images were shown after applying a deconvolution procedure. Bar, 5 µm.

 


View larger version (62K):
[in this window]
[in a new window]
 
Figure 7. Nuclear Distribution of ER{alpha} Deletion Mutants Coexpressed with Full-Length ER{alpha} or ERß

COS-1 cells were transiently transfected with each expression plasmid for the YFP fusion of ER{alpha} deletion mutants, and the CFP fusion of full-length ER{alpha} (A) or ERß (B). Fluorescence of the chimera proteins of YFP and ER{alpha} deletion mutants (upper) and chimera proteins of CFP and full-length ERs (lower) in single living cells were captured 60 min after the addition of 10-7 M E2. All of images were shown after applying a deconvolution procedure. Bar, 5 µm.

 
Colocalization of FP-ERs with AcH4 and Brg-1
To examine the functional meaning of the ligand-dependent discrete cluster formation of FP-ERs, we compared the distribution of GFP-ERs with that of nuclear components involved in conformational changes of the chromatin structure (30). RCF12 cells were transiently transfected with GFP-ER{alpha} or GFP-ERß expression vectors, and then cultured in the presence or absence of E2 for 60 min before being stained with antibodies recognizing AcH4 or Brg-1 (31, 32, 34, 35). Fluorescent images were captured using confocal laser scanning microscopy, and then, to compare the ratio of colocalization quantitatively, approximation curves of fluorescence intensity along the line crossing the nuclear area were plotted. The immunolabeling of Brg-1 and AcH4 showed a discrete pattern in the nucleus being excluded from nucleolar regions, and it was not affected by the addition of ligand (Figs. 8Go and 9Go). In the absence of ligand, there did not seem to have significant relationships between distribution of GFP-ERs and Brg-1 (Fig. 8Go, A and C) or AcH4 (Fig. 9Go, A and C). The graphs of fluorescence intensity of GFP-ERs (green lines) showed smaller amplitude in consequence of their diffuse distribution, whereas the graphs Brg-1 and AcH4 (red lines) showed intensive amplitude in consequence of their discrete distribution. Because GFP-ERs and Brg-1 or AcH4 exhibited respective distribution pattern, significant overlap of their fluorescence peak was not detected. In the presence of ligand, fluorescence intensity of GFP-ER{alpha} (Fig. 8Go, B and D) and GFP-ERß (Fig. 9Go, B and D) showed intensive amplitude reflecting their discrete distribution. More than half of the fluorescence peaks of GFP-ERs were overlapped with the peaks of Brg-1 (Fig. 8Go, B and D) or AcH4 (Fig. 9Go, B and D) (yellow arrowheads), although foci with each of the components solely distributed were also observed (green or red arrowheads). These results suggest that more than half of the ERs clusters are involved in the chromatin remodeling machinery. The Brg-1 or AcH4 foci that were not colocalized with GFP-ERs (red arrowheads) could be nuclear sites that receive conformational change signals from proteins other than estrogen, because histone acetylation and chromatin remodeling via Brg-1 activity are general regulatory mechanisms of transcription. However, the meaning of the discrete clusters of GFP-ERs that were not colocalized with Brg-1 or AcH4 (green arrowheads) is not clear. As one possibility, it is conceivable that the discrete clusters of ERs consist of the receptors in several functionally distinct states.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 8. Distribution of Brg-1 and FP-ERs

RCF12 cells transfected with the GFP-ER{alpha} or GFP-ERß expression plasmids were cultured in the absence of ligand or in the presence of E2 for 60 min. The cells were fixed and labeled with anti-BRG-1, followed by a red fluorescent second antibody. All images were captured using confocal laser scanning microscopy. Fluorescent images shown in green are distribution of GFP-ER{alpha} or GFP-ERß. The images shown in red are distribution of Brg-1. Fluorescence intensity of GFP-ER{alpha}/ß and Brg-1 along the white line in each image is plotted in the right graph with green and red curve, respectively. Yellow arrowheads indicated in the graphs are the positions where fluorescence peaks of GFP-ER{alpha}/ß and Brg-1 are overlapped. Fluorescence peaks of GFP-ER{alpha}/ß that were not overlapped with the peak of Brg-1 are indicated with green arrowhead. Fluorescence peaks of Brg-1 that were not overlapped with the peak of GFP-ER{alpha}/ß are indicated with red arrowhead. Distribution of FP-ER{alpha} and Brg-1 in the nucleus of the cells cultured in the absence (A) or in the presence (B) of the ligand. Distribution of FP-ERß and Brg-1 in the nucleus of the cells cultured in the absence (C) or in the presence (D) of the ligand. Bar, 2 µm.

 


View larger version (54K):
[in this window]
[in a new window]
 
Figure 9. Distribution of FP-ERs with AcH4

RCF12 cells transfected with the GFP-ER{alpha} or GFP-ERß expression plasmids were cultured in the absence of ligand or in the presence of E2 for 60 min. The cells were fixed and labeled with anti-AcH4, followed by a red fluorescent second antibody. All images were captured using confocal laser scanning microscopy. Fluorescent images shown in green are distribution of GFP-ER{alpha} or GFP-ERß. The images shown in red are distribution of AcH4. Fluorescence intensity of GFP-ER{alpha}/ß and AcH4 along the white line in each image is plotted in the right graph with green and red curve, respectively. Yellow arrowheads indicated in the graphs are the positions where fluorescence peaks of GFP-ER{alpha}/ß and AcH4 are overlapped. Fluorescence peaks of GFP-ER{alpha}/ß that were not overlapped with the peak of AcH4 are indicated with green arrowhead. Fluorescence peaks of AcH4 that were not overlapped with the peak of GFP-ER{alpha}/ß are indicated with red arrowhead. Distribution of FP-ER{alpha} and AcH4 in the nucleus of the cells cultured in the absence (A) or in the presence (B) of the ligand. Distribution of FP-ERß and AcH4 in the nucleus of the cells cultured in the absence (C) or in the presence (D) of the ligand. Bar, 2 µm.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Until recently, it was thought that a single ER was responsible for the biological actions of estrogen. However, the recent identification of ERß has indicated that the cellular responses to estrogen are far more complex (2, 3). ER{alpha} and ERß are coexpressed in the same cells of several tissues (4, 5, 6, 7, 8, 9) and thus may regulate transcription of target genes positively or negatively by forming homo- or heterodimers (12, 13, 14, 15, 16). It has been proposed that the relative expression level of the two isoforms in each cell determines the cellular responses to estrogen (15). However, the detailed mechanisms of the interaction between ER{alpha} and ERß are still not clear. Therefore, further investigations on the interactions of ERs are needed to understand estrogen signaling.

In the present study, to investigate the relationships between the loci expressing functions of ER{alpha} and that of ERß, we analyzed the intracellular distribution of ER{alpha} and ERß in single living cells by tagging ERs with FP. The subcellular localization of GFP-ER{alpha} has previously been reported (22, 23, 24). In the absence of ligand, GFP-ER{alpha} is diffusely distributed throughout the nucleoplasm being excluded from nucleolar regions. In addition, it was reported that a natural occurring ER{alpha} isoform that lacked the nuclear localization signal encoded in exon 4 was localized in the nucleus at the unliganded state (41). The distribution of ERß presented in this study was also in the nucleus with the unliganded state. With the exception of the A form of progesterone receptor, other steroid hormone receptors such as glucocorticoid receptor, mineralocorticoid receptor, androgen receptor, and the B form of the progesterone receptor have been reported to show a cytoplasmic distribution in the absence of hormone (24, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51). Although the steroid receptor family possesses nuclear localization signals (1), there is a difference in the intracellular distribution at the unliganded state, indicating that the subcellular localization of steroid hormone receptor is dependent not only simply on the existence of nuclear localization signals but also on the manner by which each receptor interacts with the machinery proteins involved in its distribution, such as chaperone proteins (52, 53) and nuclear transporters (54, 55).

Upon activation with ligand treatment, the FP-ERß redistributed to a discrete pattern regardless of the estrogen responsiveness of the cell line with a similar time course of GFP-ER{alpha} as shown in previous reports (22, 23). The FP-ERß colocalized with FP-ER{alpha} in the same cluster within the nucleus when both receptor subtypes were coexpressed in a cell. Colocalization of FP-ERß and FP-ER{alpha} could mean that FP-ER{alpha}/FP-ERß heterodimers were formed rather than homodimers of each subtype, because biochemical studies showed that heterodimers are preferentially formed over each type of homodimer (13, 14). Most members of the steroid hormone receptor family are reported to form discrete clusters within the nucleus in response to ligand (42, 44, 45, 47, 48, 50, 51, 56), but the biological meaning of the cluster formation remains unclear. Stenoien et al. (23) showed that discrete ER{alpha} foci are not localized at the sites of nascent mRNA transcription as labeled by an antibody recognizing phosphorylated RNA polymerase II except for in a small number of incidences. We also confirmed this finding by using GFP-ERß constructs (data not shown). These results suggest that most of the receptors are not directly correlated with the ongoing transcription sites. Several factors that modify the chemical and structural composition of chromatin also mediate activation by ER{alpha}. SRC-1 and other coactivators that interact with agonist-bound nuclear receptors, such as cAMP response element binding protein-binding protein (CBP), p300, and p300/CBP-associated factor, have potent HAT activity, and regulate the transcription of target genes through their HAT activity (31, 32). In addition, factors including Brg-1 that are involved in the structural remodeling of chromatin also mediate hormone-dependent transcriptional activation by ER{alpha} (34, 35, 36). In a recent study, it was proposed that these two distinct mechanisms of coactivation may operate in a collaborative manner (37). The coactivation of estrogen signaling by either SRC-1 or CBP is Brg-1 dependent, and ligand-activated ER{alpha} recruits Brg-1 to regions of the chromatin that contain the EREs from estrogen-dependent promoters. These events coincide with the histone acetylation of these promoters. Consistent with these findings, we demonstrated in the present work that more than half of the discrete clusters of GFP-ER{alpha} and GFP-ERß were colocalized with Brg-1 or AcH4, indicating that ERs clusters might be involved in structural changes of the chromatin in cooperation with the cofactors. Considering these results together with the recent report that ER{alpha} was highly mobile within the nucleus (25), it suggests that the conformational change of the chromatin via ligand-activated ERs might not be a static phase but a dynamic or plastic one. However, a minor population of ERs foci not colocalized with Brg-1 or AcH4 was also observed in the present study. The meaning of these foci is not clear, but it may be conceivable that these discrete clusters of ERs consist of receptors in more than two functionally distinct states.

Imakado et al. (40) clearly demonstrated the regions of ER{alpha} protein that were necessary for transcriptional activation by making deletion mutants of ER{alpha}. Transactivation activity was retained with N-terminal deletion up to amino acid 81 but was diminished when the deletion extended to amino acid 140. These results were coincident with the capacity of ERs to form discrete cluster as presented in this study, suggesting that redistribution of ERs in response to ligand treatment did not occur irrespective of the receptor function, but might actually be involved in the transcriptional regulation. It can be assumed that the stepwise bindings to some components within the nucleus, such as ligand binding, dimerization, DNA binding, binding with cofactors and binding with NM, are required for ERs to form the discrete foci. The C-terminal half of ERs (E/F domain) plays important roles in the receptor function, because this part includes regions that are essential for ligand binding and for ligand-dependent transcriptional activation through binding with coactivators (AF-2) as well as for dimerization (1, 32, 57). Truncated forms of ER{alpha} that lacked the E/F domain did not possess the capacity for discrete cluster formation as shown in the analysis using YFP-ER{alpha}{Delta}C341 and YFP-ER{alpha}{Delta}C480 constructs. The transcriptional activity of ERs is also mediated by an N-terminal transcriptional activation function domain (AF-1) and recent studies identified cofactors that regulate the activity of nuclear receptors by binding to the AF-1 domain (58, 59). Deletion analysis showed that the latter part of AF-1 (amino acid 81–140) was also necessary for the cluster formation. Pasqualini et al. (41) reported that a natural occurring ER{alpha} isoform which lacked exon 4 did not have the ability to associate with NM, suggesting that the domain encoded by exon 4, corresponding mainly to the hinge region, was required for the ER{alpha} to associate with NM. All of the YFP and ER{alpha} deletion mutant chimera proteins used in this study included this region, but none of the chimera proteins except YFP-ER{alpha}{Delta}N81 could form the discrete clusters, indicating that the AF-1 function with NM binding or AF-2 function with NM binding was not sufficient for cluster formation and that the ligand-dependent redistribution of ERs might occur through complex interactions via a large part of the receptor including at least the latter part of AF-1, the DNA binding domain, NM binding domain and AF-2/ligand binding domain. Coexpression of chimera proteins of FP and the full-length ER{alpha} or ERß restored the capacity of YFP-ER{alpha}{Delta}N140 to form discrete cluster. Therefore, it could be supposed that one AF-1 region within the receptor dimer was sufficient for the discrete cluster formation. In addition, in the ER{alpha}/ERß heterodimer, a single DNA binding domain of ERß could be sufficient for the cluster formation as shown in the analysis with cotransfection of YFP-ER{alpha}{Delta}N246 and CFP-ERß. It was reported previously that the C-terminal half truncated form of ER{alpha} bound to a DNA fragment that contained the ERE sequence by forming a heterodimer with the full-length ERß (13). However, both C-terminal half parts of ER{alpha}/ERß heterodimer were necessary for the discrete cluster formation because even in the presence of CFP-ERß, YFP-ER{alpha}{Delta}C341 and YFP-ER{alpha}{Delta}C430 did not show the redistribution. These results coincide well with another report, which showed that two functional AF-2 domain within the ER{alpha}/ERß heterodimer are required for transcriptional activity (60). It is still uncertain whether these receptor proteins really form dimers at the cluster. One possibility is that two receptor proteins interact with a common protein independent of dimerization. Analysis detecting dimerization such as fluorescence resonance energy transfer technique will make clear this point.

In the present work, we demonstrate the colocalization of FP-ER{alpha} and FP-ERß in the same discrete clusters within nucleus at the ligand-activated state. Thus, it could be considered that the differential effects of estrogen mediated through three alternative pathways with ER{alpha} homo-, ERß homo-, and ER{alpha}/ERß heterodimers might be generated by the manner in which each receptor subtype interacts with the factors that regulate the activities of the receptors (61, 62) as well as by the ratio of the subtypes expressed in each cell. Further detailed studies on the interactions among ERs and transcriptional regulators will be required to improve our understanding of estrogen signaling. For this purpose, visualization of ERs and the transcriptional regulators in living cells by tagging FP may provide a number of findings that cannot be detected by biochemical methods.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Construction
To generate G/Y/CFP-ER{alpha} and G/CFP-ERß construct, a cDNA fragment containing the entire coding region of the rat ER{alpha} or rat ERß genes was obtained by introducing an XhoI site just upstream of the first ATG in the genes that cloned into the pUC118 vector (pUC-ER6, provided by Dr. M. Muramatsu, Department of Biochemistry, Saitama Medical School, Saitama, Japan) (40) or pBluescriptKS- vector (clone 29, provided by Dr. J. A. Gustafsson, Department of Medical Nutrition, Karolinska Institute, NOVUM, Huddinge, Sweden) (2) with a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) using oligonucleotide primer sets ctgtacctcggcggctgcctcgagccatgaccatgacccttcac and gtgaagggtcatggtcatggctcgaggcagccgccgaggtacag, or cgtagacaaccgccatgagtctcgagctatgacattctacagtcc and ggactgtagaatgtcatagctcgagactcatggcggttgtctacg, respectively. After cutting with XhoI and EcoRI, the gene was then subcloned into pEG/Y/CFP-C1 vectors (CLONTECH Laboratories, Inc., Palo Alto, CA) cut with the same restriction enzymes. Three N-terminal ER{alpha} deletion mutants and YFP chimeras, YFP-ER{alpha}{Delta}N81, YFP-ER{alpha}{Delta}N140, and YFP-ER{alpha}{Delta}N246, were generated by a similar method to the G/Y/CFP-ER{alpha} construction except for the primer sets to introduce the XhoI site. In this case, the oligonucleotide inserted the XhoI recognition sequence just upstream of amino acid 81, 140, or 246 were used as primer sets, ctccggtctatggccctcgaggcatcacttacggtccgggg and ccccggaccgtaagtgatgcctcgagggccatagaccggag for {Delta}N81, ggtgccctactacctggctcgagggcccagcgcctacgc and gcgtaggcgctgggccctcgagccaggtagtagggcacc for {Delta}N140, or gggatacgaaaagaccctcgagcagggagaatgttg and caacattctccctgctcgagggtcttttcgtatccc for {Delta}N246. Construction of the two C-terminal ER{alpha} deletion mutants and YFP chimeras was performed by creating a stop codon after amino acid 341 or 430 in the YFP-ER{alpha} expression construct using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) and oligonucleotide primer sets gatccttcttgacccttcagtgaagcctc and gaggcttcactgaagggtcaagaggatc for {Delta}C341, or ggcatggtggagatctgagacatgttgctggc and gccagcaacatgtctcagatctccaccatgcc for {Delta}C430. In all of the resulting fusion proteins, the C-terminal of G/Y/CFP was coupled to the full-length or truncated ER{alpha}, or ERß through a seven-amino acid peptide linker.

Cell Culture and Transfection
COS-1, CV-1, and RCF12 cells (38, 39) were maintained in DMEM (Life Technologies, Inc., Gaithersburg, MD), without phenol red, supplemented with 10% fetal calf serum. The day before transfection, cells were reseeded in a four-well multidish with 16-mm diameter (Nunc, Roskilde, Denmark) at an initial plating density of 2 x 104 cells per well in 400 µl of medium in humidified atmosphere at 37 C with 5% CO2/95% air. Plasmid DNA (250 ng per well) was transiently transfected into cells by a liposome-mediated method using LipofectAMINE PLUS (Life Technologies, Inc.) according to the manufacturer’s instructions. Before analyzing, the cells washed five times with 400 µl of PBS and then cultured again in a serum-free medium, OPTI MEM (Life Technologies, Inc.) for at least 15 h to remove any effects of the remaining steroid hormones.

Immnoblotting
COS-1 cells plated on 35-mm dish were transfected with the expression plasmids, G/Y/CFP-ER{alpha}, G/CFP-ERß or YFP-ER{alpha} deletion mutant chimera constructs, and then cultured overnight before being lysed in 1x Laemmli sample buffer. Proteins from the cell lysates were separated by a 10% SDS-PAGE and transferred to Immobilon (Millipore Corp., Bedford, MA) using a semidry transfer apparatus (Bio-Rad Laboratories, Inc., Hercules, CA). The membrane was blocked for 1 h with 5% skim milk in TBST, and then incubated with an anti-GFP polyclonal antibody (1:1000 dilution, CLONTECH Laboratories, Inc.), which cross-reacts with YFP and CFP. After washing in Tris-buffered saline, 0.05% Tween (TBST), the membranes were incubated with horseradish peroxidase-conjugated goat antirabbit IgG secondary antibody (1:5000 dilution, Bio-Rad Laboratories, Inc.) at 25 C for 1 h, and then once more washed in TBST. Signals were detected using the enhanced chemiluminescence (enhanced chemiluminescence, Amersham Pharmacia Biotech, Buckinghamshire, UK).

Transcriptional Assays
CV-1 cells (3 x 105) plated on 35-mm dishes were cotransfected with 1 µg of pERE-luciferase reporter plasmid (63) and 10 ng of either G/Y/CFP-ER{alpha} or G/CFP-ERß expression plasmids using LipofectAMINE PLUS. pAct-ßGal (1 µg), a ß-actin promoter driven ß-galactosidase expression plasmid, was also transfected as an internal standard to estimate the transfection efficiency. Cells were incubated in the absence or presence (final concentration 10-7 M) of 17ß-estradiol (E2) for 30 h, and washed with 2 ml of PBS, and lysed in a buffer from the luciferase assay system, Pica Gene (Toyo Inki). Cell lysates were centrifuged at 12,000 rpm for 2 min at 4 C and the luciferase activity of the resulted supernatants was assayed at 25 C according to the manufacture’s protocol for Pica Gene. The results were normalized with ß-galactosidase activity measured using a Luminescent ß-galactosidase Detection Kit II (CLONTECH Laboratories, Inc.).

Time-Lapse Image Acquisition and Analysis
The living cell image acquisition was performed in a temperature-controlled room at 37 C. Images were acquired using a Sensys1400 high-resolution cooled charge-coupled device camera (Photometrics, Tucson, AZ) attached to a microscope (IXL70, Olympus Corp., Tokyo, Japan) equipped with an epifluorescence attachment (49). Cells were observed with a 40x objective lens. For the identification of the nuclear position, the chromatin DNA was stained with 100 ng/ml Hoechst 33342 (Sigma, St. Louis, MO). GFP fluorescence was observed using a filter set with an excitation of 480-nm and emission of 515-nm, and as well as a dichroic mirror of 505-nm (Olympus Corp.); YFP fluorescence was observed using a filter set with an excitation of 500-nm and emission of 545-nm, and a dichroic mirror of 525-nm (Omega Optical, Inc., Brattleboro, VT); The CFP fluorescence was observed using a filter set with an excitation of 440 nm and emission of 480 nm, and a dichroic mirror of 455 nm (Omega Optical, Inc.). Time-lapse image capturing and data evaluation were performed using the image analysis software program, MetaMorph (Universal Imaging Corp., West Chester, PA). For high-resolution analysis, an image deconvolution procedure, Nearest Neighbor Estimate, was applied to Z-series focal plane images.

Immunofluorescent Labeling and Confocal Laser Scanning
RCF12 cells (3 x 105) plated on 35-mm dishes were transfected with either 1 µg of GFP-ER{alpha} or GFP-ERß expression plasmids using LipofectAMINE PLUS. They were then stripped with 0.05% trypsin 0.53 mM EDTA (Life Technologies, Inc.), and reseeded on poly-L-lysine-courted 35-mm glass bottom dish (Matsunami Glass Ind., Ltd.), before being cultured in OPTI MEM for 24 h. After 60 min of ligand treatment (10-7 M of E2), the cells were fixed with 4% paraformaldehyde in PBS and the subjected to blocking with 2% BSA in PBS including 0.2% Triton X-100 for 1 h at 25 C. The fixed cells were incubated with goat polyclonal anti-Brg-1 (1:300 dilution, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or rabbit polyclonal antihyperacetylated histone H4 (1:10000 dilution, Upstate Biotechnology, Inc., Lake Placid, NY) for 48 h at 4 C. Alexa Fluor 546-linked antirabbit or goat IgG second antibody, respectively (1:1000 dilution, Molecular Probes, Inc., Eugene, OR) was used for detection. The preparations were observed with a 63x oil-immersion lens (Carl Zeiss, Jena, Germany). Images were collected with a confocal laser scanning microscope, LSM510 (Carl Zeiss) using a 488-nm argon laser and a 505-nm long pass filter for the GFP signal, and a 543-nm helium-neon laser and 560-nm long pass filter for the Alexa Fluor 546 signal.


    ACKNOWLEDGMENTS
 
The authors thank Drs. M. Muramatsu, J. A. Gustafsson, K. Maruyama, and T. Inoue for providing plasmids and Dr. G. Mor for providing cell lines. We thank Y. Kurihara, H. Fukuoka, K. Kimura, and M. Kataoka for technical assistance.


    FOOTNOTES
 
This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, Culture and Technology, Japan (to M.K. and M. N.) and Special Coordination Fund for Promoting Sciences and Technology (to M.K.).

Abbreviations: AcH4, Hyperacetylated histone H4; AF-1 or -2, activation function-1 or -2; BRG-1, Brahma related gene-1; CBP, cAMP response element binding protein-binding protein; CFP, cyan fluorescent protein; E2, estradiol; ECFP, enhanced CFP; EGFP, enhanced GFP; ER, estrogen receptor; ERE, estrogen-responsive element; EYFP, enhanced YFP; FP, fluorescent protein tagged; FRAP, florescence recovery after photobleaching; GFP, green fluorescent protein; HAT, histone acetyltransferase; NM, nuclear matrix; SRC-1, steroid receptor coactivator-1; TBST, Tris-buffered saline, 0.05% Tween; YFP, yellow fluorescence protein.

Received for publication March 19, 2002. Accepted for publication June 24, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kawata M 1995 Roles of steroid hormones and their receptors in structural organization in the nervous system. Neurosci Res 24:1–46[CrossRef][Medline]
  2. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  3. Gustafsson JA 1999 Estrogen receptor ß-a new dimension in estrogen mechanism of action. J Endocrinol 163:379–383[CrossRef][Medline]
  4. Shughrue PJ, Scrimo PJ, Merchenthaler I 1998 Evidence for the colocalization of estrogen receptor-ß mRNA and estrogen receptor-{alpha} immunoreactivity in neurons of the rat forebrain. Endocrinology 139:5267–5270[Abstract/Free Full Text]
  5. Chaidarun SS, Swearingen B, Alexander JM 1998 Differential expression of estrogen receptor-ß (ERß) in human pituitary tumors: functional interactions with ER {alpha} and a tumor-specific splice variant. J Clin Endocrinol Metab 83:3308–3315[Abstract/Free Full Text]
  6. Skynner MJ, Sim JA, Herbison AE 1999 Detection of estrogen receptor {alpha} and ß messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons. Endocrinology 140:5195–5201[Abstract/Free Full Text]
  7. Speirs V, Parkes AT, Kerin MJ, Walton DS, Carleton PJ, Fox JN, Atkin SL 1999 Coexpression of estrogen receptor {alpha} and ß: poor prognostic factors in human breast cancer? Cancer Res 59:525–528[Abstract/Free Full Text]
  8. Jarvinen TA, Pelto-Huikko M, Holli K, Isola J 2000 Estrogen receptor ß is coexpressed with ER{alpha} and PR and associated with nodal status, grade, and proliferation rate in breast cancer. Am J Pathol 156:29–35[Abstract/Free Full Text]
  9. Saji S, Sakaguchi H, Andersson S, Warner M, Gustafsson JA 2001 Quantitative analysis of estrogen receptor proteins in rat mammary gland. Endocrinology 142:3177–3186[Abstract/Free Full Text]
  10. Shughrue PJ, Lane MV, Scrimo PJ, Merchenthaler I 1998 Comparative distribution of estrogen receptor-{alpha} (ER-{alpha}) and beta (ER-ß) mRNA in the rat pituitary, gonad, and reproductive tract. Steroids 63:498–504[CrossRef][Medline]
  11. Sar M, Welsch F 1999 Differential expression of estrogen receptor-ß and estrogen receptor-{alpha} in the rat ovary. Endocrinology 140:963–971[Abstract/Free Full Text]
  12. Cowley SM, Hoare S, Mosselman S, Parker MG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–19862[Abstract/Free Full Text]
  13. Pace P, Taylor J, Suntharalingam S, Coombes RC, Ali S 1997 Human estrogen receptor ß binds DNA in a manner similar to and dimerizes with estrogen receptor {alpha}. J Biol Chem 272:25832–25838[Abstract/Free Full Text]
  14. Pettersson K, Grandien K, Kuiper GG, Gustafsson JA 1997 Mouse estrogen receptor ß forms estrogen response element-binding heterodimers with estrogen receptor {alpha}. Mol Endocrinol 11:1486–1496[Abstract/Free Full Text]
  15. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  16. Pettersson K, Delaunay F, Gustafsson JA 2000 Estrogen receptor ß acts as a dominant regulator of estrogen signaling. Oncogene 19:4970–4978[CrossRef][Medline]
  17. King WJ, Greene GL 1984 Monoclonal antibodies localize oestrogen receptor in the nuclei of target cells. Nature 307:745–747[CrossRef][Medline]
  18. Welshons WV, Lieberman ME, Gorski J 1984 Nuclear localization of unoccupied oestrogen receptors. Nature 307:747–749[CrossRef][Medline]
  19. Press MF, Xu SH, Wang JD, Greene GL 1989 Subcellular distribution of estrogen receptor and progesterone receptor with and without specific ligand. Am J Pathol 135:857–864[Abstract]
  20. Alexander RB, Greene GL, Barrack ER 1987 Estrogen receptors in the nuclear matrix: direct demonstration using monoclonal antireceptor antibody. Endocrinology 120:1851–1857[Abstract]
  21. Barrack ER 1987 Steroid hormone receptor localization in the nuclear matrix: interaction with acceptor sites. J Steroid Biochem 27:115–121[CrossRef][Medline]
  22. Htun H, Holth LT, Walker D, Davie JR, Hager GL 1999 Direct visualization of the human estrogen receptor {alpha} reveals a role for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471–486[Abstract/Free Full Text]
  23. Stenoien DL, Mancini MG, Patel K, Allegretto EA, Smith CL, Mancini MA 2000 Subnuclear trafficking of estrogen receptor-{alpha} and steroid receptor coactivator-1. Mol Endocrinol 14:518–534[Abstract/Free Full Text]
  24. Yoshida M, Nishi M, Kizaki Z, Sawada T, Kawata M 2002 Subcellular and subnuclear distributions of estrogen receptor {alpha} in living cells using green fluorescent protein. Acta Histochem Cytochem 34:413–422[CrossRef]
  25. Stenoien DL, Patel K, Mancini MG, Dutertre M, Smith CL, O’Malley BW, Mancini MA 2001 FRAP reveals that mobility of oestrogen receptor-{alpha} is ligand- and proteasome-dependent. Nat Cell Biol 3:15–23[CrossRef][Medline]
  26. Wansink DG, Schul W, van der Kraan I, van Steensel B, van Driel R, de Jong L 1993 Fluorescent labeling of nascent RNA polymerase II in domains scattered throughout the nucleus. J Cell Biol 122:283–293[Abstract/Free Full Text]
  27. Bregman DB, Du L, van der Zee S, Warren SL 1995 Transcription-dependent redistribution of the large subunit of RNA polymerase II to discrete nuclear domains. J Cell Biol 129:286–298
  28. Kim E, Du L, Bregman DB, Warren SL 1997 Splicing factors associate with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA. J Cell Biol 136:19–28[Abstract/Free Full Text]
  29. Du L, Warren SL 1997 A functional interaction brtween the carboxy-terminal domain of RNA polymerase II and pre-mRNA splicing. J Cell Biol 136:5–18[Abstract/Free Full Text]
  30. Workman JL, Kingston RE 1998 Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem 67:545–579[CrossRef][Medline]
  31. Spencer, TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  32. Freedman LP 1999 Increasing the complexity of coactivation in nuclear receptor signaling. Cell 97:5–8[CrossRef][Medline]
  33. Reyes JC, Muchardt C, Yaniv M 1997 Components of the human SWI/SNF complex are enriched in active chromatin and are associated with the nuclear matrix. J Cell Biol 137:263–274[Abstract/Free Full Text]
  34. Chiba H, Muramatsu M, Nomoto A, Kato H 1994 Two human homologues of Saccharomyces cerevisiae SWI2/SNF2 and Drosophila brahma are transcriptional coactivators cooperating with the estrogen receptor and the retinoic acid receptor. Nucleic Acids Res 22:1815–1820[Abstract/Free Full Text]
  35. Ichinose H, Garnier JM, Chambon P, Losson R 1997 Ligand-dependent interaction between the estrogen receptor and the human homologues of SWI2/SNF2. Gene 188:95–100[CrossRef][Medline]
  36. Muller WG, Walker D, Hager GL, McNally JC 2001 Large-scale chromatin decondensation and recondensation regulated by transcription from a natural promoter. J Cell Biol 154:33–48[Abstract/Free Full Text]
  37. DiRenzo J, Shang Y, Phelan M, Sif S, Myers M, Kingston R, Brown M 2000 BRG-1 is recruited to estrogen-responsive promoters and cooperates with factors involved in histone acetylation. Mol Cell Biol 20:7541–7549[Abstract/Free Full Text]
  38. Rasmussen JE, Torres-Aleman I, MacLusky NJ, Naftolin F, Robbins RJ 1990 The effects of estradiol on the growth patterns of estrogen receptor-positive hypothalamic cell lines. Endocrinology 126:235–240[Abstract]
  39. Nilsen J, Mor G, Naftolin F 2000 Estrogen-regulated developmental neuronal apoptosis is determined by estrogen receptor subtype and the Fas/Fas ligand system. J Neurobiol 43:64–78[CrossRef][Medline]
  40. Imakado S, Koike S, Kondo S, Sakai M, Muramatsu M 1991 The N-terminal transactivation domain of rat estrogen receptor is localized in a hydrophobic domain of eighty amino acids. J Biochem (Tokyo) 109:684–689[Abstract/Free Full Text]
  41. Pasqualini C, Guivarc’h D, Barnier JV, Guibert B, Vincent JD, Vernier P 2001 Differential subcellular distribution and transcriptional activity of {Sigma}E3, {Sigma}E4, and {Sigma}E3–4 isoforms of the rat estrogen receptor-{alpha}. Mol Endocrinol 15:894–908[Abstract/Free Full Text]
  42. Htun H, Barsony J, Renyi I, Gould DL, Hager GL 1996 Visualization of glucocorticoid receptor translocation and intranuclear organization in living cells with a green fluorescent protein chimera. Proc Natl Acad Sci USA 93:4845–4850[Abstract/Free Full Text]
  43. Georget V, Lobaccaro JM, Terouanne B, Mangeat P, Nicolas JC, Sultan C 1997 Trafficking of the androgen receptor in living cells with fused green fluorescent protein-androgen receptor. Mol Cell Endocrinol 129:17–26[CrossRef][Medline]
  44. Fejes-Toth G, Pearce D, Naray-Fejes-Toth A 1998 Subcellular localization of mineralocorticoid receptors in living cells: effects of receptor agonists and antagonists. Proc Natl Acad Sci USA 95:2973–2978[Abstract/Free Full Text]
  45. Nishi M, Takenaka N, Morita N, Ito T, Ozawa H, Kawata M 1999 Real-time imaging of glucocorticoid receptor dynamics in living neurons and glial cells in comparison with non-neural cells. Eur J Neurosci 11:1927–1936[CrossRef][Medline]
  46. Lim CS, Baumann CT, Htun H, Xian W, Irie M, Smith CL, GL Hager 1999 Differential localization and activity of the A- and B-forms of the human progesterone receptor using green fluorescent protein chimeras. Mol Endocrinol 13:366–375[Abstract/Free Full Text]
  47. Tyagi RK, Lavrovsky Y, Ahn SC, Song CS, Chatterjee B, Roy AK 2000 Dynamics of intracellular movement and nucleocytoplasmic recycling of the ligand-activated androgen receptor in living cells. Mol Endocrinol 14:1162–1174