| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
and ERß
Department of Anatomy and Neurobiology, Kyoto Prefectural University of Medicine, Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan
Address all correspondence and requests for reprints to: Ken-ichi Matsuda, Department of Anatomy and Neurobiology, Kyoto Prefectural University of Medicine, Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan. E-mail: matsuken{at}basic.kpu-m.ac.jp.
| ABSTRACT |
|---|
|
|
|---|
and that of ERß, we analyzed the subnuclear distribution of ER
and ERß in response to ligand in single living cells using fusion proteins labeled with different spectral variants of green fluorescent protein. Upon activation with ligand treatment, fluorescent protein-tagged (FP)-ERß redistributed from a diffuse to discrete pattern within the nucleus, showing a similar time course as FP-ER
, and colocalized with FP-ER
in the same discrete cluster. Analysis using deletion mutants of ER
suggested that the ligand-dependent redistribution of ER
might occur through a large part of the receptor including at least the latter part of activation function (AF)-1, the DNA binding domain, nuclear matrix binding domain, and AF-2/ligand binding domain. In addition, a single AF-1 region within ER
homodimer, or a single DNA binding domain as well as AF-1 region within the ER
/ERß heterodimer, could be sufficient for the cluster formation. More than half of the discrete clusters of FP-ER
and FP-ERß were colocalized with hyperacetylated histone H4 and a component of the chromatin remodeling complex, Brg-1, indicating that ERs clusters might be involved in structural changes of chromatin. | INTRODUCTION |
|---|
|
|
|---|
and ERß) have been identified that are encoded by different genes. ER
and ERß have similar overall structures with at least three functional domains in common: the ligand-binding domain located at the C-terminal half of the proteins, the DNA-binding domain located centrally, and a variable transactivation domain located at the N-terminal end (2, 3). In several areas of the estrogen target tissues such as brain, pituitary, and mammary gland, both ER subtypes are coexpressed in the same cells (4, 5, 6, 7, 8, 9), whereas tissues where ER
and ERß are differentially distributed are also observed (3, 10, 11). The coexpression of ER
and ERß suggests a possibility that two ER subtypes interact with each other. In fact, ER
and ERß form heterodimers in vitro and in vivo (12, 13, 14), and the transcriptional activity of ER
is positively or negatively modulated by dimerizing with ERß (15, 16), indicating that the relative expression level of the two isoforms would be a key determinant in the cellular responses to estrogen.
The subcellular localization of ER
was found to be in the nucleus, and this was independent of ligand as shown by immunocytochemistry as well as hormone-binding assays of cytoplast and nucleoplast fractions (17, 18). The unliganded form of ER
, although localized in the nucleus, is not tightly bound to nuclear components, and ligand binding causes a transformation of ER
to a more tightly bound form (19). ER
has been known to specifically associate with the nuclear matrix (NM) after ligand binding, suggesting that the more tightly bound form of ER
is the NM-associated form of ER
(20, 21). A direct visualization approach in living cells based on green fluorescent protein (GFP) tagging revealed the difference in the intranuclear localization of unliganded and liganded forms of ER
(22, 23, 24). In the absence of ligand, GFP-tagged ER
(GFP-ER
) is diffusely distributed throughout the nucleoplasm being excluded from nucleolar regions. Upon the addition of ligand, a redistribution of GFP-ER
from a diffuse to discrete pattern occurs rapidly within the nucleus. The discrete clusters of ER
are associated with NM and steroid receptor coactivator-1 (SRC-1), which is a member of a class of transcriptional coactivators that enhance agonist-induced transcription of the nuclear receptor superfamily proteins including ER
. Recently, florescence recovery after photobleaching (FRAP) technique showed that ER
and SRC-1 were mobilized rapidly within the nucleus depending upon proteasome activity, despite being bound to the NM, suggesting that the ligand-activated ER
-SRC-1 complex might be rapidly exchanged at internuclear target sites on chromatin and NM to exert positive effects on transcription (25).
It has been thought that ERs control the expression of specific genes by binding to regulatory DNA sequences, named estrogen-responsive elements (ERE) located at the promoter or enhancer regions of the genes (1). However, discrete ER
foci are not localized at the sites of nascent mRNA transcription as labeled by an antibody recognizing phosphorylated RNA polymerase II except only a small incidence (23, 26, 27, 28, 29). Therefore, the ligand-dependent intranuclear reorganization of ER
may involve more complex events than the simple recognition of ERE as previously believed.
There exists abundant evidence that the structure and chemical composition of chromatin directly affect gene expression (30). The acetylation of histones has emerged as a regulatory mechanism for modulating the properties of chromatin and thus as a general key step in transcriptional control. SRC-1 and other transcriptional coactivators that interact with nuclear receptors possess intrinsic histone acetyltransferase (HAT) activity, and these coactivator complexes formed in response to the ligand activation have been proposed to modulate expression of target genes not only through direct interaction with the RNA polymerase II but also through HAT activity (31, 32). The chromatin structure is also altered via the ATP-dependent disruption of nucleosomes by large multiprotein chromatin remodeling complexes (30, 33). One such complex, the human Brahma/Brahma related gene-1 (BRG-1) complex, has previously been shown to enhance transcriptional activation by nuclear receptors (34, 35, 36). In addition, functional cooperation between BRG-1 and coactivators that modulate the histone acetylation status in ER
-mediated transcriptional activation has been reported recently (37). Further investigation of the role of the chromatin status in estrogen signaling therefore seems to be important to our understanding of gene regulation by ERs in vivo.
In the present study, we investigated the relationships between the loci expressing functions of ER
and that of ERß by analyzing the subnuclear distribution of ER
and ERß in response to ligand in single living cells using fusion proteins labeled with different spectral variants of GFP, yellow fluorescent protein (YFP), and cyan fluorescent protein (CFP). Here we report colocalization of fluorescent protein tagged (FP)-ER
and -ß in the nucleus forming discrete clusters in response to ligand activation, and domains of the ER
protein needed to form the cluster by making heterodimer with ERß using chimera proteins of fluorescent protein and deletion mutants of ER
. Furthermore, to elucidate the meaning of the cluster formation, we also examine colocalization of FP-ERs and two nuclear components, Brg-1 and hyperacetylated histone H4 (AcH4), which are involved in conformational changes of the chromatin structure.
| RESULTS |
|---|
|
|
|---|
and -ß
or rat ERß was ligated in frame to the 3'-end of enhanced GFP (EGFP), enhanced CFP (ECFP), and enhanced YFP (EYFP) of cytomegalovirus promoter driven expression vectors. These plasmids were transiently transfected into COS-1 cells that lacked endogenous ERs, and the cells were incubated for 20 h. Lysates of the transfected cells were analyzed by Western blotting using anti-GFP antibody that cross-reacts with YFP and CFP. The expressed GFP-ER
, GFP-ERß, CFP-ER
, CFP-ERß, and YFP-ER
were all detected with the major bands at expected molecular weights (Fig. 1A
and ERß (Fig. 1B
|
previously reported (22, 23, 24).
|
and FP-ERß
construct was singly transfected to COS-1 cells, we could observe YFP fluorescence using a filter set for YFP-imaging (Fig. 3Aa
and FP-ERß were distributed when both receptor proteins were coexpressed in a single living cell, expression plasmid of YFP-ER
and CFP-ERß were cotransfected to COS-1 cells. Fluorescent images of YFP-ER
and CFP-ERß were captured before and after the addition of ligand (40 min). To visualize the intranuclear area where the two receptor proteins were colocalized, the images were pseudocolored with red and green, respectively, and then merged (Fig. 3B
and CFP-ERß almost completely overlapped in both the unliganded and liganded states. In the presence of 10-7 M E2, YFP-ER
, and CFP-ERß were localized at the same discrete clusters, suggesting that both subtypes of estrogen receptor were bound to the same nuclear sites. Dose response for the cluster formation was examined by treating the cells with lower concentration of E2 (Fig. 3C
and CFP-ERß localized at the same nuclear loci by forming discrete cluster at similar intensity to the clusters formed in the presence of 10-7 M E2. At 10-9 M, the cluster formation was weakened but still observed, whereas, at 10-10 M, both receptor proteins were distributed diffusely within the nucleus. There was no detectable difference in the dose of E2 to form the discrete cluster between YFP-ER
and CFP-ERß. In addition, there was no detectable difference in the time course of the relocalization between the two receptor proteins (Fig. 4A
/CFP-ERß double (Fig. 4A
and CFP-ERß in a rat hypothalamic cell line, RCF12, which expressed endogenous ERß (38, 39). The redistribution of FP-ERs from diffuse to discrete pattern was observed with a similar time course regardless of the estrogen responsiveness of the cell lines (Fig. 4A
|
|
Protein Essential for the Discrete Cluster Formation
was responsible for the ligand-dependent discrete cluster formation, we constructed YFP fusions with a series of ER
deletion mutants (Fig. 5A
deletion mutants were detected with all the major bands at the expected molecular weights (Fig. 5B
N140 construct, slight faint clusters were observed (Fig. 6A
C341 and YFP-ER
C480 (Fig. 6B
C480 transfected cells. These results suggest that C-terminal region of the ER
protein is necessary not only for cluster formation in the nucleus but also for the proper nuclear localization. To examine whether the YFP and ER
deletion mutant chimera proteins which did not have cluster formation activity were changed to show the discrete distribution by coexpressing full-length ER
, constructs of the deletion chimera and CFP-ER
were cotransfected in COS-1 cells (Fig. 7A
N140 was coexpressed with CFP-ER
, YFP-ER
N140 was distributed discretely in the nucleus after addition of ligand and was localized in the same clusters of CFP-ER
, indicating that ligand bound YFP-ER
N140 and CFP-ER
dimerized with each other and were then localized to the nuclear loci that should be bound. However, YFP-ER
N246, YFP-ER
C341, and YFP-ER
C480 did not show the ligand-dependent relocalization even in the presence of full-length ER
. We next investigated how the deletion mutants of YFP-ER
were distributed when these proteins were coexpressed with CFP-ERß (Fig. 7B
N140 and YFP-ER
N246 formed discrete clusters in the nucleus upon ligand addition and the distribution of these clusters was overlapped with CFP-ERß clusters. Although the cluster formation did not show when the proteins were expressed alone, coexpression with CFP-ERß allowed these truncated protein to localize to discrete loci, suggesting that CFP-ERß formed heterodimers with YFP-ER
N140 or YFP-ER
N246 after ligand binding. There was a difference in the region of the ER
protein needed to form the discrete cluster by making homodimers or heterodimers with ERß because, in the presence of CFP-ERß, YFP-ER
N246 formed the cluster, whereas, in the presence of CFP-ER
, YFP-ER
N246 did not. In contrast to the N-terminal deletions, neither of the two C-terminal deletion chimeras was able to show the cluster formation irrespective of the presence of ERß as was found in the case of ER
.
|
|
|
or GFP-ERß expression vectors, and then cultured in the presence or absence of E2 for 60 min before being stained with antibodies recognizing AcH4 or Brg-1 (31, 32, 34, 35). Fluorescent images were captured using confocal laser scanning microscopy, and then, to compare the ratio of colocalization quantitatively, approximation curves of fluorescence intensity along the line crossing the nuclear area were plotted. The immunolabeling of Brg-1 and AcH4 showed a discrete pattern in the nucleus being excluded from nucleolar regions, and it was not affected by the addition of ligand (Figs. 8
(Fig. 8
|
|
| DISCUSSION |
|---|
|
|
|---|
and ERß are coexpressed in the same cells of several tissues (4, 5, 6, 7, 8, 9) and thus may regulate transcription of target genes positively or negatively by forming homo- or heterodimers (12, 13, 14, 15, 16). It has been proposed that the relative expression level of the two isoforms in each cell determines the cellular responses to estrogen (15). However, the detailed mechanisms of the interaction between ER
and ERß are still not clear. Therefore, further investigations on the interactions of ERs are needed to understand estrogen signaling.
In the present study, to investigate the relationships between the loci expressing functions of ER
and that of ERß, we analyzed the intracellular distribution of ER
and ERß in single living cells by tagging ERs with FP. The subcellular localization of GFP-ER
has previously been reported (22, 23, 24). In the absence of ligand, GFP-ER
is diffusely distributed throughout the nucleoplasm being excluded from nucleolar regions. In addition, it was reported that a natural occurring ER
isoform that lacked the nuclear localization signal encoded in exon 4 was localized in the nucleus at the unliganded state (41). The distribution of ERß presented in this study was also in the nucleus with the unliganded state. With the exception of the A form of progesterone receptor, other steroid hormone receptors such as glucocorticoid receptor, mineralocorticoid receptor, androgen receptor, and the B form of the progesterone receptor have been reported to show a cytoplasmic distribution in the absence of hormone (24, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51). Although the steroid receptor family possesses nuclear localization signals (1), there is a difference in the intracellular distribution at the unliganded state, indicating that the subcellular localization of steroid hormone receptor is dependent not only simply on the existence of nuclear localization signals but also on the manner by which each receptor interacts with the machinery proteins involved in its distribution, such as chaperone proteins (52, 53) and nuclear transporters (54, 55).
Upon activation with ligand treatment, the FP-ERß redistributed to a discrete pattern regardless of the estrogen responsiveness of the cell line with a similar time course of GFP-ER
as shown in previous reports (22, 23). The FP-ERß colocalized with FP-ER
in the same cluster within the nucleus when both receptor subtypes were coexpressed in a cell. Colocalization of FP-ERß and FP-ER
could mean that FP-ER
/FP-ERß heterodimers were formed rather than homodimers of each subtype, because biochemical studies showed that heterodimers are preferentially formed over each type of homodimer (13, 14). Most members of the steroid hormone receptor family are reported to form discrete clusters within the nucleus in response to ligand (42, 44, 45, 47, 48, 50, 51, 56), but the biological meaning of the cluster formation remains unclear. Stenoien et al. (23) showed that discrete ER
foci are not localized at the sites of nascent mRNA transcription as labeled by an antibody recognizing phosphorylated RNA polymerase II except for in a small number of incidences. We also confirmed this finding by using GFP-ERß constructs (data not shown). These results suggest that most of the receptors are not directly correlated with the ongoing transcription sites. Several factors that modify the chemical and structural composition of chromatin also mediate activation by ER
. SRC-1 and other coactivators that interact with agonist-bound nuclear receptors, such as cAMP response element binding protein-binding protein (CBP), p300, and p300/CBP-associated factor, have potent HAT activity, and regulate the transcription of target genes through their HAT activity (31, 32). In addition, factors including Brg-1 that are involved in the structural remodeling of chromatin also mediate hormone-dependent transcriptional activation by ER
(34, 35, 36). In a recent study, it was proposed that these two distinct mechanisms of coactivation may operate in a collaborative manner (37). The coactivation of estrogen signaling by either SRC-1 or CBP is Brg-1 dependent, and ligand-activated ER
recruits Brg-1 to regions of the chromatin that contain the EREs from estrogen-dependent promoters. These events coincide with the histone acetylation of these promoters. Consistent with these findings, we demonstrated in the present work that more than half of the discrete clusters of GFP-ER
and GFP-ERß were colocalized with Brg-1 or AcH4, indicating that ERs clusters might be involved in structural changes of the chromatin in cooperation with the cofactors. Considering these results together with the recent report that ER
was highly mobile within the nucleus (25), it suggests that the conformational change of the chromatin via ligand-activated ERs might not be a static phase but a dynamic or plastic one. However, a minor population of ERs foci not colocalized with Brg-1 or AcH4 was also observed in the present study. The meaning of these foci is not clear, but it may be conceivable that these discrete clusters of ERs consist of receptors in more than two functionally distinct states.
Imakado et al. (40) clearly demonstrated the regions of ER
protein that were necessary for transcriptional activation by making deletion mutants of ER
. Transactivation activity was retained with N-terminal deletion up to amino acid 81 but was diminished when the deletion extended to amino acid 140. These results were coincident with the capacity of ERs to form discrete cluster as presented in this study, suggesting that redistribution of ERs in response to ligand treatment did not occur irrespective of the receptor function, but might actually be involved in the transcriptional regulation. It can be assumed that the stepwise bindings to some components within the nucleus, such as ligand binding, dimerization, DNA binding, binding with cofactors and binding with NM, are required for ERs to form the discrete foci. The C-terminal half of ERs (E/F domain) plays important roles in the receptor function, because this part includes regions that are essential for ligand binding and for ligand-dependent transcriptional activation through binding with coactivators (AF-2) as well as for dimerization (1, 32, 57). Truncated forms of ER
that lacked the E/F domain did not possess the capacity for discrete cluster formation as shown in the analysis using YFP-ER
C341 and YFP-ER
C480 constructs. The transcriptional activity of ERs is also mediated by an N-terminal transcriptional activation function domain (AF-1) and recent studies identified cofactors that regulate the activity of nuclear receptors by binding to the AF-1 domain (58, 59). Deletion analysis showed that the latter part of AF-1 (amino acid 81140) was also necessary for the cluster formation. Pasqualini et al. (41) reported that a natural occurring ER
isoform which lacked exon 4 did not have the ability to associate with NM, suggesting that the domain encoded by exon 4, corresponding mainly to the hinge region, was required for the ER
to associate with NM. All of the YFP and ER
deletion mutant chimera proteins used in this study included this region, but none of the chimera proteins except YFP-ER
N81 could form the discrete clusters, indicating that the AF-1 function with NM binding or AF-2 function with NM binding was not sufficient for cluster formation and that the ligand-dependent redistribution of ERs might occur through complex interactions via a large part of the receptor including at least the latter part of AF-1, the DNA binding domain, NM binding domain and AF-2/ligand binding domain. Coexpression of chimera proteins of FP and the full-length ER
or ERß restored the capacity of YFP-ER
N140 to form discrete cluster. Therefore, it could be supposed that one AF-1 region within the receptor dimer was sufficient for the discrete cluster formation. In addition, in the ER
/ERß heterodimer, a single DNA binding domain of ERß could be sufficient for the cluster formation as shown in the analysis with cotransfection of YFP-ER
N246 and CFP-ERß. It was reported previously that the C-terminal half truncated form of ER
bound to a DNA fragment that contained the ERE sequence by forming a heterodimer with the full-length ERß (13). However, both C-terminal half parts of ER
/ERß heterodimer were necessary for the discrete cluster formation because even in the presence of CFP-ERß, YFP-ER
C341 and YFP-ER
C430 did not show the redistribution. These results coincide well with another report, which showed that two functional AF-2 domain within the ER
/ERß heterodimer are required for transcriptional activity (60). It is still uncertain whether these receptor proteins really form dimers at the cluster. One possibility is that two receptor proteins interact with a common protein independent of dimerization. Analysis detecting dimerization such as fluorescence resonance energy transfer technique will make clear this point.
In the present work, we demonstrate the colocalization of FP-ER
and FP-ERß in the same discrete clusters within nucleus at the ligand-activated state. Thus, it could be considered that the differential effects of estrogen mediated through three alternative pathways with ER
homo-, ERß homo-, and ER
/ERß heterodimers might be generated by the manner in which each receptor subtype interacts with the factors that regulate the activities of the receptors (61, 62) as well as by the ratio of the subtypes expressed in each cell. Further detailed studies on the interactions among ERs and transcriptional regulators will be required to improve our understanding of estrogen signaling. For this purpose, visualization of ERs and the transcriptional regulators in living cells by tagging FP may provide a number of findings that cannot be detected by biochemical methods.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and G/CFP-ERß construct, a cDNA fragment containing the entire coding region of the rat ER
or rat ERß genes was obtained by introducing an XhoI site just upstream of the first ATG in the genes that cloned into the pUC118 vector (pUC-ER6, provided by Dr. M. Muramatsu, Department of Biochemistry, Saitama Medical School, Saitama, Japan) (40) or pBluescriptKS- vector (clone 29, provided by Dr. J. A. Gustafsson, Department of Medical Nutrition, Karolinska Institute, NOVUM, Huddinge, Sweden) (2) with a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) using oligonucleotide primer sets ctgtacctcggcggctgcctcgagccatgaccatgacccttcac and gtgaagggtcatggtcatggctcgaggcagccgccgaggtacag, or cgtagacaaccgccatgagtctcgagctatgacattctacagtcc and ggactgtagaatgtcatagctcgagactcatggcggttgtctacg, respectively. After cutting with XhoI and EcoRI, the gene was then subcloned into pEG/Y/CFP-C1 vectors (CLONTECH Laboratories, Inc., Palo Alto, CA) cut with the same restriction enzymes. Three N-terminal ER
deletion mutants and YFP chimeras, YFP-ER
N81, YFP-ER
N140, and YFP-ER
N246, were generated by a similar method to the G/Y/CFP-ER
construction except for the primer sets to introduce the XhoI site. In this case, the oligonucleotide inserted the XhoI recognition sequence just upstream of amino acid 81, 140, or 246 were used as primer sets, ctccggtctatggccctcgaggcatcacttacggtccgggg and ccccggaccgtaagtgatgcctcgagggccatagaccggag for
N81, ggtgccctactacctggctcgagggcccagcgcctacgc and gcgtaggcgctgggccctcgagccaggtagtagggcacc for
N140, or gggatacgaaaagaccctcgagcagggagaatgttg and caacattctccctgctcgagggtcttttcgtatccc for
N246. Construction of the two C-terminal ER
deletion mutants and YFP chimeras was performed by creating a stop codon after amino acid 341 or 430 in the YFP-ER
expression construct using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) and oligonucleotide primer sets gatccttcttgacccttcagtgaagcctc and gaggcttcactgaagggtcaagaggatc for
C341, or ggcatggtggagatctgagacatgttgctggc and gccagcaacatgtctcagatctccaccatgcc for
C430. In all of the resulting fusion proteins, the C-terminal of G/Y/CFP was coupled to the full-length or truncated ER
, or ERß through a seven-amino acid peptide linker.
Cell Culture and Transfection
COS-1, CV-1, and RCF12 cells (38, 39) were maintained in DMEM (Life Technologies, Inc., Gaithersburg, MD), without phenol red, supplemented with 10% fetal calf serum. The day before transfection, cells were reseeded in a four-well multidish with 16-mm diameter (Nunc, Roskilde, Denmark) at an initial plating density of 2 x 104 cells per well in 400 µl of medium in humidified atmosphere at 37 C with 5% CO2/95% air. Plasmid DNA (250 ng per well) was transiently transfected into cells by a liposome-mediated method using LipofectAMINE PLUS (Life Technologies, Inc.) according to the manufacturers instructions. Before analyzing, the cells washed five times with 400 µl of PBS and then cultured again in a serum-free medium, OPTI MEM (Life Technologies, Inc.) for at least 15 h to remove any effects of the remaining steroid hormones.
Immnoblotting
COS-1 cells plated on 35-mm dish were transfected with the expression plasmids, G/Y/CFP-ER
, G/CFP-ERß or YFP-ER
deletion mutant chimera constructs, and then cultured overnight before being lysed in 1x Laemmli sample buffer. Proteins from the cell lysates were separated by a 10% SDS-PAGE and transferred to Immobilon (Millipore Corp., Bedford, MA) using a semidry transfer apparatus (Bio-Rad Laboratories, Inc., Hercules, CA). The membrane was blocked for 1 h with 5% skim milk in TBST, and then incubated with an anti-GFP polyclonal antibody (1:1000 dilution, CLONTECH Laboratories, Inc.), which cross-reacts with YFP and CFP. After washing in Tris-buffered saline, 0.05% Tween (TBST), the membranes were incubated with horseradish peroxidase-conjugated goat antirabbit IgG secondary antibody (1:5000 dilution, Bio-Rad Laboratories, Inc.) at 25 C for 1 h, and then once more washed in TBST. Signals were detected using the enhanced chemiluminescence (enhanced chemiluminescence, Amersham Pharmacia Biotech, Buckinghamshire, UK).
Transcriptional Assays
CV-1 cells (3 x 105) plated on 35-mm dishes were cotransfected with 1 µg of pERE-luciferase reporter plasmid (63) and 10 ng of either G/Y/CFP-ER
or G/CFP-ERß expression plasmids using LipofectAMINE PLUS. pAct-ßGal (1 µg), a ß-actin promoter driven ß-galactosidase expression plasmid, was also transfected as an internal standard to estimate the transfection efficiency. Cells were incubated in the absence or presence (final concentration 10-7 M) of 17ß-estradiol (E2) for 30 h, and washed with 2 ml of PBS, and lysed in a buffer from the luciferase assay system, Pica Gene (Toyo Inki). Cell lysates were centrifuged at 12,000 rpm for 2 min at 4 C and the luciferase activity of the resulted supernatants was assayed at 25 C according to the manufactures protocol for Pica Gene. The results were normalized with ß-galactosidase activity measured using a Luminescent ß-galactosidase Detection Kit II (CLONTECH Laboratories, Inc.).
Time-Lapse Image Acquisition and Analysis
The living cell image acquisition was performed in a temperature-controlled room at 37 C. Images were acquired using a Sensys1400 high-resolution cooled charge-coupled device camera (Photometrics, Tucson, AZ) attached to a microscope (IXL70, Olympus Corp., Tokyo, Japan) equipped with an epifluorescence attachment (49). Cells were observed with a 40x objective lens. For the identification of the nuclear position, the chromatin DNA was stained with 100 ng/ml Hoechst 33342 (Sigma, St. Louis, MO). GFP fluorescence was observed using a filter set with an excitation of 480-nm and emission of 515-nm, and as well as a dichroic mirror of 505-nm (Olympus Corp.); YFP fluorescence was observed using a filter set with an excitation of 500-nm and emission of 545-nm, and a dichroic mirror of 525-nm (Omega Optical, Inc., Brattleboro, VT); The CFP fluorescence was observed using a filter set with an excitation of 440 nm and emission of 480 nm, and a dichroic mirror of 455 nm (Omega Optical, Inc.). Time-lapse image capturing and data evaluation were performed using the image analysis software program, MetaMorph (Universal Imaging Corp., West Chester, PA). For high-resolution analysis, an image deconvolution procedure, Nearest Neighbor Estimate, was applied to Z-series focal plane images.
Immunofluorescent Labeling and Confocal Laser Scanning
RCF12 cells (3 x 105) plated on 35-mm dishes were transfected with either 1 µg of GFP-ER
or GFP-ERß expression plasmids using LipofectAMINE PLUS. They were then stripped with 0.05% trypsin 0.53 mM EDTA (Life Technologies, Inc.), and reseeded on poly-L-lysine-courted 35-mm glass bottom dish (Matsunami Glass Ind., Ltd.), before being cultured in OPTI MEM for 24 h. After 60 min of ligand treatment (10-7 M of E2), the cells were fixed with 4% paraformaldehyde in PBS and the subjected to blocking with 2% BSA in PBS including 0.2% Triton X-100 for 1 h at 25 C. The fixed cells were incubated with goat polyclonal anti-Brg-1 (1:300 dilution, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or rabbit polyclonal antihyperacetylated histone H4 (1:10000 dilution, Upstate Biotechnology, Inc., Lake Placid, NY) for 48 h at 4 C. Alexa Fluor 546-linked antirabbit or goat IgG second antibody, respectively (1:1000 dilution, Molecular Probes, Inc., Eugene, OR) was used for detection. The preparations were observed with a 63x oil-immersion lens (Carl Zeiss, Jena, Germany). Images were collected with a confocal laser scanning microscope, LSM510 (Carl Zeiss) using a 488-nm argon laser and a 505-nm long pass filter for the GFP signal, and a 543-nm helium-neon laser and 560-nm long pass filter for the Alexa Fluor 546 signal.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: AcH4, Hyperacetylated histone H4; AF-1 or -2, activation function-1 or -2; BRG-1, Brahma related gene-1; CBP, cAMP response element binding protein-binding protein; CFP, cyan fluorescent protein; E2, estradiol; ECFP, enhanced CFP; EGFP, enhanced GFP; ER, estrogen receptor; ERE, estrogen-responsive element; EYFP, enhanced YFP; FP, fluorescent protein tagged; FRAP, florescence recovery after photobleaching; GFP, green fluorescent protein; HAT, histone acetyltransferase; NM, nuclear matrix; SRC-1, steroid receptor coactivator-1; TBST, Tris-buffered saline, 0.05% Tween; YFP, yellow fluorescence protein.
Received for publication March 19, 2002. Accepted for publication June 24, 2002.
| REFERENCES |
|---|
|
|
|---|
immunoreactivity in neurons of the rat forebrain. Endocrinology 139:52675270
and a tumor-specific splice variant. J Clin Endocrinol Metab 83:33083315
and ß messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons. Endocrinology 140:51955201
and ß: poor prognostic factors in human breast cancer? Cancer Res 59:525528
and PR and associated with nodal status, grade, and proliferation rate in breast cancer. Am J Pathol 156:2935
(ER-
) and beta (ER-ß) mRNA in the rat pituitary, gonad, and reproductive tract. Steroids 63:498504[CrossRef][Medline]
in the rat ovary. Endocrinology 140:963971
and ß form heterodimers on DNA. J Biol Chem 272:1985819862
. J Biol Chem 272:2583225838
. Mol Endocrinol 11:14861496
transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:55665578
reveals a role for ligand in the nuclear distribution of the receptor. Mol Biol Cell 10:471486
and steroid receptor coactivator-1. Mol Endocrinol 14:518534
in living cells using green fluorescent protein. Acta Histochem Cytochem 34:413422[CrossRef]
is ligand- and proteasome-dependent. Nat Cell Biol 3:1523[CrossRef][Medline]
E3,
E4, and
E34 isoforms of the rat estrogen receptor-
. Mol Endocrinol 15:894908
coactivator through the N-terminal activation domain (AF-1) with an RNA coactivator, SRA. EMBO J 20:13411352[CrossRef][Medline]
-ß heterodimeric complex. Mol Cell Biol 19:19191927
and ERß) at AP-1 sites. J Biol Chem 276:38273832
and ERß. J Biol Chem 276:2339723404NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
K. L. Gonzales, M. J. Tetel, and C. K. Wagner Estrogen Receptor (ER) {beta} Modulates ER{alpha} Responses to Estrogens in the Developing Rat Ventromedial Nucleus of the Hypothalamus Endocrinology, September 1, 2008; 149(9): 4615 - 4621. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tudor, J. N. Feige, H. Pingali, V. B. Lohray, W. Wahli, B. Desvergne, Y. Engelborghs, and L. Gelman Association with Coregulators Is the Major Determinant Governing Peroxisome Proliferator-activated Receptor Mobility in Living Cells J. Biol. Chem., February 16, 2007; 282(7): 4417 - 4426. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Arnett-Mansfield, J. D. Graham, A. R. Hanson, P. A. Mote, A. Gompel, L. L. Scurr, N. Gava, A. de Fazio, and C. L. Clarke Focal Subnuclear Distribution of Progesterone Receptor Is Ligand Dependent and Associated with Transcriptional Activity Mol. Endocrinol., January 1, 2007; 21(1): 14 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, E. Ariazi, K. Kim, S. Khan, R. Barhoumi, R. Burghardt, S. Liu, D. Hill, R. Finnell, B. Wlodarczyk, et al. 3-Methylcholanthrene and Other Aryl Hydrocarbon Receptor Agonists Directly Activate Estrogen Receptor {alpha} Cancer Res., February 15, 2006; 66(4): 2459 - 2467. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Chen, L.-J. Juan, and B.-c. Chung SF-1 (Nuclear Receptor 5A1) Activity Is Activated by Cyclic AMP via p300-Mediated Recruitment to Active Foci, Acetylation, and Increased DNA Binding Mol. Cell. Biol., December 1, 2005; 25(23): 10442 - 10453. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takahashi, M. Ohmichi, J. Kawagoe, C. Ohshima, M. Doshida, T. Ohta, M. Saitoh, A. Mori-Abe, B. Du, H. Igarashi, et al. Growth Factors Change Nuclear Distribution of Estrogen Receptor-{alpha} via Mitogen-Activated Protein Kinase or Phosphatidylinositol 3-Kinase Cascade in a Human Breast Cancer Cell Line Endocrinology, September 1, 2005; 146(9): 4082 - 4089. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. M. Schaaf, L. J. Lewis-Tuffin, and J. A. Cidlowski Ligand-Selective Targeting of the Glucocorticoid Receptor to Nuclear Subdomains Is Associated with Decreased Receptor Mobility Mol. Endocrinol., June 1, 2005; 19(6): 1501 - 1515. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Ruas, L. Poellinger, and T. Pereira Role of CBP in regulating HIF-1-mediated activation of transcription J. Cell Sci., January 15, 2005; 118(2): 301 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nishi, M. Tanaka, K.-i. Matsuda, M. Sunaguchi, and M. Kawata Visualization of Glucocorticoid Receptor and Mineralocorticoid Receptor Interactions in Living Cells with GFP-Based Fluorescence Resonance Energy Transfer J. Neurosci., May 26, 2004; 24(21): 4918 - 4927. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Yang, R. Liu, E. J. Perez, Y. Wen, S. M. Stevens Jr., T. Valencia, A.-M. Brun-Zinkernagel, L. Prokai, Y. Will, J. Dykens, et al. Mitochondrial localization of estrogen receptor {beta} PNAS, March 23, 2004; 101(12): 4130 - 4135. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Arnett-Mansfield, A. deFazio, P. A. Mote, and C. L. Clarke Subnuclear Distribution of Progesterone Receptors A and B in Normal and Malignant Endometrium J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1429 - 1442. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ochiai, K.-i. Matsuda, M. Nishi, H. Ozawa, and M. Kawata Imaging Analysis of Subcellular Correlation of Androgen Receptor and Estrogen Receptor {alpha} in Single Living Cells Using Green Fluorescent Protein Color Variants Mol. Endocrinol., January 1, 2004; 18(1): 26 - 42. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |