help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0004
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, A.
Right arrow Articles by Reiter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, A.
Right arrow Articles by Reiter, R. E.
Molecular Endocrinology 16 (10): 2323-2337
Copyright © 2002 by The Endocrine Society

Identification of an Androgen-Dependent Enhancer within the Prostate Stem Cell Antigen Gene

Anjali Jain, Amanda Lam, Igor Vivanco, Michael F. Carey and Robert E. Reiter

Departments of Urology (A.J., R.E.R.), Biological Chemistry (A.L., M.F.C.), and Medicine (I.V.), and Molecular Biology Institute (M.F.C., R.E.R.), UCLA School of Medicine, Los Angeles, California 90095

Address all correspondence and requests for reprints to: Dr. Michael F. Carey, Department of Biological Chemistry, UCLA School of Medicine, Box 951737, Los Angeles, California 90095. E-mail: mcarey{at}mednet.ucla.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Prostate stem cell antigen (PSCA) is emerging as an important diagnostic marker and therapeutic target in prostate cancer. Previous studies indicated that PSCA was directly regulated by androgens, but the mechanism has not been elucidated. Here we describe the identification of a compact cell-specific and androgen-responsive enhancer between 2.7 and 3 kb upstream of the transcription start site. The enhancer functions autonomously when positioned immediately adjacent to a minimal promoter. Deoxyribonuclease I footprinting analysis with recombinant androgen receptor (AR) reveals that the enhancer contains two AR binding sites at one end. Mutational analysis of the AR binding sites revealed the importance of the higher affinity one. The dissociation constant of the high affinity binding site (androgen response element I) was determined to be approximately 87 nM. The remainder of the enhancer contains elements that function synergistically with the AR. We discuss the structural organization of the PSCA enhancer and compare it with that found in other AR-regulated genes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PROSTATE CANCER BEGINS as an androgen-dependent (AD) tumor but progresses to an androgen-independent (AI) phenotype upon androgen deprivation (1, 2, 3). Serum levels of the prostate-specific antigen (PSA) are used clinically as a marker for diagnosis and management of prostate cancer. Analysis of PSA gene regulation has provided considerable insight into the mechanisms of prostate cancer progression and the role that the androgen receptor (AR) plays in this transition (4, 5, 6, 7, 8, 9, 10). However, PSA is not an ideal marker for prostate cancer progression (11, 12, 13), and considerable effort has been expended to identify new markers and understand their regulation.

One such marker is prostate stem cell antigen (PSCA) (14), a cell surface protein related to the Ly-6/Thy-1 family of glycosylphosphatidyl-inositol (GPI)-anchored antigens. PSCA is expressed in normal prostate and bladder and is up-regulated in a large proportion of localized and metastatic prostate cancers (15). Overexpression of PSCA correlates with increasing tumor stage, grade, and metastasis to bone. A murine homolog of PSCA (mPSCA has been isolated and has a similar tissue distribution to human PSCA (16, 17). Like human PSCA, expression of mPSCA is up-regulated in multiple mouse models of prostate cancer, such as TRAMP (transgenic adenocarcinoma of the mouse prostate) and PTEN (phosphatase and tensin homolog) heterozygous mice. PSCA is also overexpressed in a large percentage of bladder and pancreatic cancers (18, 19). Although the precise role of PSCA in cancer progression is not known, its homologs (Thy-1 and Ly-6) have defined roles in cell signaling (20, 21) and have been implicated in cancer progression. A role for PSCA in cancer progression is suggested by studies showing that monoclonal antibodies targeting PSCA can block prostate cancer growth and metastasis in xenograft models of human prostate cancer (22). Together, these studies suggest that PSCA expression is both linked to and may play a biological role in carcinogenesis.

The mechanism(s) by which PSCA expression is regulated in normal tissue and cancer is not known. To study PSCA gene regulation, we recently isolated a 9-kb genomic fragment containing the human PSCA promoter/enhancer region (23). Consistent with the normal tissue distribution of PSCA, the 9-kb promoter/enhancer region was active in cell lines derived from normal and malignant prostate and bladder cells. This region was also androgen responsive in the LNCaP prostate cancer cell line, consistent with in vivo studies of mPSCA showing down-regulation of PSCA after castration (16). These initial studies suggest that the PSCA promoter is tissue specific and may be regulated by both AD (LNCaP) and AI (normal AR-negative prostate epithelial cells and bladder cells) pathways.

Transgenic mice bearing the human PSCA promoter region fused to green fluorescent protein (GFP) express GFP in mid-gestation after the appearance of prostatic buds from the urogenital sinus (23). In adult mice, GFP expression was restricted to a subset of cells located in the distal tips of the glands, which are hypothesized to be progenitors for the terminally differentiated secretory cells. GFP expression increased and expanded during periods of active ductal growth, such as puberty and after administration of testosterone to castrate mice, but was barely detectable after castration-induced prostate regression. Prostate carcinogenesis driven by T antigen in the TRAMP model resulted in an increased percentage and intensity level for PSCA promoter-driven GFP-positive cells. These results indicate that PSCA expression in vivo is related to growth, regeneration, and tumorigenesis of the prostate and that PSCA is regulated at the transcriptional level.

A critical observation is that PSCA and its regulatory regions are androgen regulated. It is not known whether androgen regulates the PSCA promoter directly or indirectly. It is possible, for example, that androgen induction of the PSCA promoter is related to the positive proliferative effect of androgen on LNCaP or to the expansion of GFP-positive progenitor cells during prostatic growth. To address this specific question, we have now carried out a detailed analysis of the PSCA regulatory region. Our major findings are 1) that androgen regulates PSCA directly and 2) that the bulk of PSCA androgen responsiveness can be mapped to one of two AR binding sites within a 300-bp enhancer region located 2.7 kb upstream of its transcription start site. Mutation of the high affinity binding site results in loss of binding to an AR DNA binding domain (ARDBD) in vitro and to a significant loss of androgen responsiveness in vivo These studies demonstrate that the PSCA promoter/enhancer has an androgen-responsive region with structure and function reminiscent of other prostate-specific and AD genes. The relationship of this region to PSCA overexpression in cancer remains to be determined.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Transcription Start Site Mapping
As a preliminary step in characterizing the DNA elements involved in androgen regulation of PSCA it was necessary to identify the transcriptional start site. Total RNA from the LAPC9-AD and AI prostate cancer xenografts (24) was subjected to Cap-dependent RACE (rapid amplification of cDNA ends), which accurately identifies transcription initiation sites because it is dependent upon the presence of a 7 meGTP Cap at the 5'end of the mRNA. Of 19 clones sequenced, 10 indicated that the major transcription start site was an adenine, 18 bp upstream from the initiating AUG (GenBank accession no. AF176678; this sequence represents the antisense strand of the genomic clone where nucleotide no. 65248 represents the initiating ATG) and 23 bp downstream of the putative TATA box. A minor start site was located 2 bp downstream of the adenine.

Promoter Activity in Cell Line Transfections Correlates with Endogenous PSCA Expression
To determine whether the cell specificity of the PSCA promoter constructs match that of the endogenous gene, a PSCA promoter-luciferase construct bearing 6 kb of upstream sequence was transfected into a panel of prostate and nonprostate cell lines and normalized to cytomegalovirus (CMV) luciferase activity (Fig. 1Go). Previous studies had shown that the 6-kb construct elicited a transcriptional activity similar to that of the 9-kb construct employed in the transgenic study (23). Transfections were performed in the presence and absence of the synthetic androgen R1881.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Activity of the PSCA Promoter in Cell Lines

The 6-kb PSCA promoter, PSCA-6.0, was analyzed by transient transfection into various cell lines in the presence or absence of 10 nM R1881. For each cell line tested, the data are represented as a percentage of the CMV-luciferase activity. The PSCA promoter is active in human prostate (LNCaP, LAPC4, and LAPC9) and bladder (HT1376) cell lines but is relatively inactive in FLAG-tagged AR containing cervical carcinoma cells (fAR-HeLa). The promoter is also active in primary prostate epithelial cell culture (PrEC) but not in primary prostate stromal cell culture (PrSC). The promoter is androgen-inducible in LNCaP and LAPC4 cells. PSCA expression has been observed in LAPC4, LAPC9, PrEC, and HT1376 cells, whereas it is absent in fAR-HeLa and PrSC cells.

 
The promoter was found to be active and androgen-inducible in the AR-positive prostate cancer LNCaP cell line (25) and in a cell line derived from the LAPC4 xenograft. It was also active but not inducible in the bladder carcinoma cell line HT1376 (26), which lacks AR but still expresses PSCA, and in the LAPC9 xenograft, which contains AR and expresses PSCA. The transfected gene was active but not androgen inducible in AR-negative, PrEC populations, which express PSCA. In contrast, the promoter was relatively inactive in a panel of cell lines derived from tissues that do not express PSCA, such as primary PrSCs (Fig. 1Go), HeLa cells expressing FLAG-AR (AR with N-terminal FLAG epitope tag DYKDDDDK) (cervical carcinoma) (27), 293T (human kidney) (not shown), baby hamster kidney cells (not shown), MCF7 (breast carcinoma), and NIH3T3 fibroblasts (23). The data indicate a selectivity of PSCA expression in cell culture that parallels the in vivo pattern.

Authentic Regulation Is Achieved with Stably Integrated Reporter Constructs in LNCaP Cells
LNCaP cells were employed as an experimental system for promoter mapping because these cells support a robust androgen response analogous to that observed in the transgenic models (23). To validate the system for detailed expression studies, a 6-kb PSCA-GFP fusion was stably integrated into LNCaP cells, and androgen-inducible GFP expression was assessed by fluorescence microscopy and fluorescence-activated cell sorting (FACS). In the absence of androgen, the PSCA 6-kb GFP cells displayed low but measurable levels of expression vs. the GFP control by both microscopy and FACS analysis (Fig. 2Go, panel C vs. A). However, with the addition of androgen a 2-fold increase in the number of cells expressing GFP (panel C vs. D) was observed along with a 10-fold increase in the fluorescence intensity (Fig. 2Go, panel C vs. D). These data demonstrated that authentic PSCA gene regulation could be recreated in the LNCaP cell line and that it maintained its binary mode of regulation in the context of a chromatin environment. This is an important observation because it has been established that appropriate assessment of endogenous transcriptional responses to hormones requires a chromatin environment (28, 29).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. PSCA Promoter Is Androgen Responsive in a Genomic Context

The androgen responsiveness of the PSCA promoter was assessed in the human prostate cancer cell line, LNCaP. Stable LNCaP cell lines expressing the GFP reporter were generated using either the PSCA 6-kb promoter (PSCA 6 kb+GFP) or a promoterless construct (Promoterless + GFP) as a negative control. These lines were grown in steroid-depleted medium for 1 wk and androgen (10 nM R1881) was added for 48 h. The GFP expression was assessed by FACS (left figure in every panel) and by fluorescence microscopy (right figure in every set) in the presence (B and D) and absence (A and C) of 10 nM R1881. The x-axis on the FACS graph represents the FL1 channel which measures light in the green range of the spectrum (515–545 nm) and the y-axis represents the FL2 channel that measures the orange-red light (564–606 nm). The PSCA promoter was clearly induced in the presence of androgen as is demonstrated by the increase in the number (39–73%) and intensity (~10-fold induction) of cells expressing GFP.

 
Identification of the PSCA Enhancer and Promoter
LNCaP cells were employed to systematically map the promoter using a collection of 5' promoter deletions between -38 bp and -6 kb (Fig. 3AGo). We performed the analysis in a stepwise fashion by gradually homing in on the androgen-responsive enhancer using two sets of deletions. The first set comprised 500-bp to 1-kb deletions (Fig. 3BGo) and the second set comprised 200- to 300-bp deletions (Fig. 3CGo). Each set provided data that allowed us to assign functional borders to the regions conferring AI and AD promoter activity. The PSA basic promoter-enhancer construct (PSA-2.4; Ref. 30), a classic AR-responsive regulatory region, and two other constructs, ARE4 (30) and EnhE4 (27), were used as positive controls for androgen induction. All three positive controls lacked AI activity but displayed a robust androgen response in the presence of 10 nM R1881 (Fig. 3BGo).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Delineating the PSCA Enhancer

A, Schematic of PSCA promoter deletion constructs. Progressive 5' deletions of the PSCA promoter between -6 kb and the TATA box at -0.038 (PSCAT) were linked to the luciferase reporter gene and analyzed in transient transfection assays. The shaded boxes 1–3 represent exons I–III of the PSCA gene. 5' UTL and 3' UTR refer to the 5' untranslated leader and 3' untranslated regions respectively. The PSA promoter-enhancer construct (PSA 2.4), quadruplicated PSA AREI construct (ARE4) and PSA enhancer core construct (EnhE4) were used as a positive controls (30 ). ARE4 and EnhE4 were cloned upstream to the E4 TATA box in the E4T construct. B, The PSCA promoter exhibits distinct AD and AI modes of regulation. The PSCA promoter deletion series (PSCAT, PSCA-0.5, PSCA-1.0, PSCA-1.5, PSCA-2.0, PSCA-3.0, and PSCA-6.0) was analyzed by transient transfection into LNCaP cells in the presence or absence of 10 nM R1881. The pGL3basic (promoterless vector alone) construct was used as a negative control. PSA2.4, ARE4, and EnhE4 were used as positive controls to assess androgen responsiveness. The results are average ± SD of triplicate samples and are expressed in relative light units (RLU). Luciferase values were normalized to the protein content. The table below the graph indicates the fold activation of a construct in the presence (+R1881) of androgen. Fold activation in the presence of androgen was calculated by dividing the average luciferase value obtained in the presence of androgen by that obtained in the absence of androgen. C, The PSCA androgen-responsive enhancer lies within a 300-bp sequence between -2.7 kb and -3.0 kb. The PSCA androgen-responsive element was narrowed down to a 300-bp region by transfection of finer deletions between -2.0 kb and -3.0 kb (PSCA-2.2, PSCA-2.5 and PSCA-2.7). The deletion series was analyzed in the presence or absence of 10 nM synthetic androgen analog, R1881. The luciferase activity is the average of an experiment performed in triplicate and is represented as RLU. The numbers in parentheses represent the fold induction in the presence of R1881.

 
The PSCA-0.038 construct or PSCAT, bearing the putative TATA box, does not contribute significantly to the reporter activity in either the presence or absence of R1881 (Fig. 3BGo). The AI promoter activity is first detected in PSCA-0.5 and continues to increase gradually (~67-fold) up to PSCA-6.0. The androgen-inducible transcription is first measurable in PSCA-0.5. The most dramatic increase occurs between PSCA-2.0 and PSCA-3.0 (Fig. 3BGo). No additional fold increases in androgen responsiveness are observed between PSCA-3.0 and PSCA-6.0. To delineate the DNA region conferring the steep increase in androgen responsiveness further, we analyzed a second set of deletions between PSCA-2.0 and PSCA-3.0 (Fig. 3CGo). The R1881-induced luciferase activity of PSCA-3.0 is significantly higher than that of PSCA-2.7. The androgen responsiveness of PSCA-3.0 is 19-fold, as compared with 5-fold for PSCA-2.7. The results indicated the sharp increase in androgen responsiveness was conferred by DNA elements located within a 300-bp region between 2.7 and 3 kb.

Sufficiency of the PSCA Enhancer
The deletion data suggested the possibility that the 300-bp region contained an enhancer. One definition of an enhancer is its ability to function autonomously when tethered to a heterologous promoter (i.e. a sufficiency clone). The enhancer was positioned upstream of both the heterologous adenovirus E4 minimal promoter from -38 to +40, and its own minimal promoter from -38 to +12, each bearing the natural TATA box, start site and 5' untranslated region. The two sufficiency constructs, E4T+2.7–3 and PSCAT+2.7–3, were transfected into LNCaP cells (Fig. 4AGo) to measure androgen inducibility and into HT1376 (Fig. 4BGo), 293T, and fAR-Hela (data not shown) to determine whether the enhancer maintained the proper cell specificity (see Fig. 1Go). In LNCaP, both constructs exhibited increased basal expression above the minimal promoter controls and responded to androgen 12.4- and 18.0-fold, respectively. The constructs were active in HT1376 but not induced by androgen (Fig. 4BGo), indicating that the enhancer maintains a level of AI activity. Finally, the constructs were inactive in 293T cells and fAR-HeLa cells, indicating that the enhancer maintains tissue selectivity (data not shown). Remarkably, the constructs were as active and specific as PSCA-3.0, indicating that they retained the stimulatory activity and specificity of the parental construct. The strong androgen responsiveness of the constructs indicated that the 0.3-kb PSCA enhancer might plausibly contain AREs (androgen response elements), the binding sites for AR.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 4. The 300-bp PSCA Enhancer Can Function Autonomously

Constructs bearing the 300-bp enhancer (-2.7-kb to -3.0-kb) linked to the PSCA TATA box (PSCAT+2.7–3) or to the E4 TATA box (E4T+2.7–3) were generated. These were tested in transient transfection assays in A, LNCaP cells or B, HT1376 cells in the presence or absence of 10 nM R1881. The numbers in parentheses indicate the fold induction in the presence of the androgen analog, R1881.

 
Identification of AREs within the PSCA Enhancer
To determine if AR was acting directly, we mapped binding sites for AR within the 300-bp androgen-responsive PSCA enhancer by deoxyribonuclease (DNase) I footprinting using recombinant ARDBD (27). The PSA enhancer was included as a positive control because it contains AREs that have been validated by footprinting and detailed mutational analysis (27). Two DNase I footprints, each encompassing a region of 23-bp and separated from each other by a distance of 25-bp, were detected on the PSCA enhancer (Fig. 5Go, right panel). Both of these sites were present between -2.7 kb and -2.8 kb. We term these sites high affinity and low affinity. The high affinity site appeared at approximately 14.8 nM of recombinant ARDBD (active protein), whereas the low affinity site did not appear until approximately 133.3 nM of ARDBD. As shown in the left panel of Fig. 5Go, AREIII of the PSA enhancer (31) and PSCA high affinity site seem to display comparable affinities for ARDBD. The sequence of the high affinity site is GGAACTttcCGTCCT, and the sequence of the low affinity site is CGCACAagaCGTTTT. Both sites display approximately 67% homology to the ARE consensus sequence (GGTACAnnnTGTTCT) (32).



View larger version (54K):
[in this window]
[in a new window]
 
Figure 5. The PSCA Enhancer Binds Recombinant ARDBD

In vitro DNase I footprinting of the PSA enhancer region with increasing amounts of recombinant ARDBD was used as a positive control (lanes 1–4). The positions of ARE III, IIIA, IV, V, and VI are shown. DNase I footprinting of the 300-bp PSCA promoter region with recombinant ARDBD revealed two distinct protected sites (lanes 6–8; lane 5 is a DNA alone control): a high affinity site and a low affinity site. Similar amounts of active ARDBD [0 (lanes 1 and 5), 14.8 nM (lanes 2 and 6), 44.4 nM (lanes 3 and 7), and 133.3 nM (lanes 4 and 8); ARDBD active concentration: 4 x 10-7 M] were used for both PSA and PSCA enhancers.

 
Determination of the Relative Affinity of ARDBD to PSCA AR Binding Sites
To evaluate the binding affinities of the two AR binding sites within the PSCA enhancer, their dissociation constants or Kd values were determined and compared with several known naturally occurring ARE sequences (summarized in Table 1Go). The active protein concentration of ARDBD was first shown to be approximately 4 x 10-7 M. This preparation was used to determine the dissociation constants in EMSAs (see Materials and Methods and Fig. 6AGo). The PSCA low affinity site sequence did not display a detectable DNA-protein complex in a gel shift assay. The apparent dissociation constant of the PSCA high affinity binding site was determined to be approximately 87 nM, which was about twice that for PSA AREIII sequence (~46 nM). The affinity of PSA AREIII was almost half of that reported for the PSA AREI sequence (~26 nM), which agrees with the PSA ARE affinity order as determined by Huang et al. (27).


View this table:
[in this window]
[in a new window]
 
Table 1. Kd Values of Androgen Response Elements

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 6. PSCA Binding Site Mutations Abrogate ARDBD Binding

A, An EMSA demonstrating the ARDBD dose-response curve on consensus ARE, consensus ARE mutant (top panel), PSA AREIII, PSCA high and PSCA high-mut (bottom panel) oligonucleotides is shown. See Table 2Go for a description of the PSCA ARE mutations. The ARDBD complex (bound) and the free probe (unbound) are marked with arrows. These dose curves were used to calculate the Kd of ARDBD on various ARE sequences (see Materials and Methods and Table 1Go). The molar active concentrations of ARDBD used are as follows—Top panel, 0 (lanes 1 and 6), 1.6 nM (lanes 2 and 7), 4.9 nM (lanes 3 and 8), 14.8 nM (lanes 4 and 9) and 44.4 nM (lanes 5 and 10). Bottom panel, 0 (lanes 1, 6, and 11), 14.8 nM (lanes 2, 7 and 12), 44.4 nM (lanes 3, 8, and 13), 133.3 nM (lanes 4, 9, and 14) and 400 nM (lanes 5, 10 and 15). B, DNaseI footprinting analysis was carried out with the PSCA binding sites and their mutants in presence of recombinant ARDBD. Mutation of either the high affinity binding site (high-mut; lanes 6–10 in the left panels) or the low affinity binding site (low-mut; lanes 6–10 in the right panels) abolished ARDBD binding when compared with the unmutated (WT) control (lanes 1–5 in both left and right panels). ARDBD active concentrations used are as follows: 0 (lanes 1 and 6), 20 nM (lanes 2 and 7), 40 nM (lanes 3 and 8), 80 nM (lanes 4 and 9) and 160 nM (lanes 5 and 10).

 
Both PSCA AR Binding Site Mutants Abolish ARDBD Binding, whereas Only the High Affinity Site Mutation Abolishes Function
To determine whether PSCA AR binding site sequences are functional, we mutated the sites at positions important for AR binding (33, 34, 35). The mutations (Table 2Go) were tested in an EMSA (Fig. 6AGo) and a DNase I footprinting assay (Fig. 6BGo). They were also introduced in the context of the PSCA-6.0 construct or the PSCAT+2.7–3 construct and subjected to transfection analyses (Fig. 7Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Sequences of PSCA AR Binding Site Mutations

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. PSCA AREI Responds to Androgen in Vivo

The contribution of PSCA ARDBD binding sites to androgen responsiveness was demonstrated by analyzing the binding site mutations in the context of PSCA-6.0 (PSCA-6.0 AREImut, PSCA-6.0 low-mut; see Materials and Methods and Table 2Go for mutant details) in transient transfection assays in the presence and absence of R1881. The mutations were tested in AR-responsive prostate cancer cell lines: A, LNCaP cells; and B, LAPC4 cells. C, The mutations were also tested in the context of the sufficiency clones (PSCAT+2.7–3 AREImut and PSCAT+2.7–3 low-mut). RLU normalized to total protein amount is presented. The values in parentheses indicate the fold enhancement in luciferase activity in the presence of R1881.

 
The gel shift assay indicated that the ARDBD binding was abolished in the high affinity site mutant (compare PSCA-high to PSCA high-mut; Fig. 6AGo). As stated earlier, we could not detect a stable DNA-protein complex using the PSCA low affinity binding site in this assay. The consensus ARE sequence, its mutant, and the PSA AREIII sequence were used for comparisons (Fig. 6AGo). The footprinting analysis indicated that ARDBD binding was also abrogated in both the high affinity (high-mut) and low affinity (low-mut) site mutants compared with the wild-type probe (Fig. 6BGo).

The transfection analyses into LNCaP and LAPC4 cells revealed that mutations in the high affinity site (PSCA-6.0 high-mut) cause a significant reduction in androgen-responsive activity (Fig. 7Go, A and B). In contrast, mutations in the low affinity site (PSCA-6.0 low-mut) had only a marginal effect (Fig. 7AGo). Note that in some cases the basal activity is reduced with the mutation. We have found via casodex inhibition with the PSA enhancer that there are still residual androgens in our depleted medium. Based on these results, it was clear that the high affinity binding site was an authentic androgen response element and we termed it PSCA AREI. The low affinity site did not seem to play an essential role in the androgen responsiveness of the PSCA enhancer. The effect of the AREI mutant was restricted to LNCaP and LAPC4 cells because the mutations failed to affect the AI activity of PSCA-6.0 in HT1376 cells (not shown).

To solidify our conclusion that the reduction in androgen responsiveness was due to mutation of the high affinity AREI, the same mutations were tested in the context of the minimal construct, PSCAT+2.7–3. As expected, the AREI mutant (PSCAT+2.7–3.0 AREImut) caused a decrease in androgen inducibility (Fig. 7CGo).

PSCA AREI Sequence Has a Low Affinity in Isolation But Can Nevertheless Function as a Genuine ARE
A bona fide ARE should be able to function by itself and from a heterologous gene promoter, i.e. respond to androgens in vivo. To test these definitions for PSCA AREI, we multimerized the AREI sequence and cloned it next to a TATA box from the adenovirus E4 gene. The constructs were subjected to transient transfection analyses in the presence of the androgen analog R1881 in LNCaP cells. Although a duplicated version of the ARE displayed a low level of androgen responsiveness (data not shown), a robust response (~18-fold induction) was observed with a quadruplicated version of the ARE (E4T+PSCA ARE4; Fig. 8Go). This androgen response was lowered to 3.6-fold when the quadruplicated sequence contained the AREI mutation (E4T+PSCA ARE4mut). As a control, we compared the PSCA ARE4 construct to the PSA ARE4 construct (quadruplicated PSA AREI sequence upstream of an E4 TATA box). The androgen induction of the PSA ARE4 construct was approximately 137-fold. The higher responsiveness of this construct is in agreement with the higher affinity of PSA AREI (Table 1Go). These data demonstrate that the PSCA AREI sequence, albeit of a lower affinity, has the ability to direct androgen response from a heterologous promoter.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 8. PSCA AREI Is a Bona Fide ARE

PSCA AREI oligonucleotide sequence and the mutated version were quadruplicated (E4T+PSCA ARE4 and E4T+ PSCA ARE4mut) and cloned next to a heterologous E4 TATA box. The multimerized clones were analyzed in a transient transfection assay in LNCaP cells with or without 10 nM R1881. pGL3basic (vector alone), E4T, E4T+2.7–3 (300-bp PSCA enhancer cloned next to the E4T) and PSA ARE4 (same as ARE4 i.e. quadruplicated PSA AREI sequence cloned next to the E4T) were used as controls. The data are presented normalized to the total protein content, and the numbers in parentheses indicate the fold induction achieved in the presence of R1881.

 
Sequences Flanking AREI Are Required for the AD Activity of the PSCA Enhancer
The functional AREI sequence is located between 2.7 and 2.8 kb upstream of the gene and constitutes the downstream end of the enhancer. To determine if the enhancer could be further delineated, we analyzed it in greater detail by creating additional 100-bp deletions within the 300-bp region (Fig. 9Go, PSCA-2.8 and PSCA-2.9). Surprisingly, deletions outside of the ARE between 2.8 and 3.0 kb severely reduced enhancer activity. To rule out the possibility of additional AR binding sites between 2.8 and 3.0 kb, we carried out DNase I footprinting assays and gel shift assays (data not shown) with the 300-bp enhancer region. The major binding site was that of AREI, which was abolished upon mutation. We saw very low affinity nonspecific complexes of varying mobilities within the 2.8–3.0 region, but only at very high concentrations of ARDBD. We also analyzed two additional clones, PSCAT+2.8–3.0 and PSCAT+2.7–2.8 in transient transfection assays (data not shown). Neither of the two clones displayed any androgen responsiveness above that of the PSCAT construct; however, they interacted synergistically to provide robust levels of androgen responsiveness in PSCAT+2.7–3.0. The data suggest that the PSCA enhancer comprises an androgen responsive component in combination with other elements important for synergizing with the ARE and possibly for conferring the cell specificity of the enhancer.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 9. The 300-bp PSCA Enhancer Consists of Multiple Components that Are Necessary for Androgen Responsiveness

The 300-bp PSCA enhancer was characterized further by generating additional 5' deletions within the enhancer sequence (PSCA-2.8 and PSCA-2.9). These were analyzed by transient transfection into LNCaP cells in the presence and absence of 10 nM R1881. The data are presented as RLU normalized to protein content, and the numbers in parentheses indicate the fold androgen responsiveness.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have focused our efforts on the identification and characterization of androgen-responsive enhancers that function during prostate cancer progression from the AD to the AI state (27, 30, 36). PSCA is an ideal gene to pursue this problem because of its natural expression patterns and response to androgens only in certain epithelial cells of the prostate and in prostate cancer. Our study indicates that PSCA contains a proximal promoter located within the 500-bp region upstream from the TATA box and an enhancer located between -2.7 and -3.0 kb. The promoter is weakly responsive to androgens and contains a putative sequence that binds to ARDBD in in vitro DNA binding assays. However, this sequence element is not responsible for the androgen responsiveness as determined by mutagenesis (data not shown). A deletion analysis of the promoter narrowed the androgen-responsive region to another sequence element that does not bind ARDBD. The androgen-responsive mechanism of the promoter region is not fully understood, but it is possible that this may be an indirect effect, i.e. another AD protein may bind to and regulate this region. Analysis of PSCA upstream sequences (-3.0 to -6.0 kb) failed to identify any additional androgen-responsive activity in transient transfection assays (data not shown). The enhancer, however, is localized to a 300-bp region and confers strong androgen responsiveness.

The enhancer functions autonomously in the context of a heterologous promoter and contains cell-type specific elements that allow PSCA to be expressed in both AI cell lines such as the bladder cancer line HT1376, and in the AD prostate cancer lines such as LNCaP and LAPC4. It does not function in human kidney (293T) or cervical carcinoma (HeLa) cells that do not support the expression of PSCA. The absolute promoter activity and androgen responsiveness of this mini-enhancer is equal to that of the entire 3-kb PSCA regulatory sequence. The data imply that the tissue-specific and AI elements overlap at the PSCA enhancer, making it an important target for detailed genetic analysis. Intriguingly, the enhancer also responds to dexamethasone (data not shown) but only at much higher concentrations than its Kd for a wild-type GR (glucocorticoid receptor) (37). It would be interesting to analyze the effect of GR on the endogenous PSCA gene. We have identified the key enhancer ARE through DNA binding and transfection studies and have validated its relevance by mutagenesis and multimerization studies. The Kd of PSCA AREI is higher than that of PSA AREI, which is also reflected on multimerizing the two ARE sequences.

It is remarkable that PSCA promoter is not androgen responsive in the LAPC9 cells, which express AR and PSA. LAPC9 cells express the highest levels of PSCA that we have detected. It is plausible that expression in these cells has plateaued, muting the effect of added androgens. It is also plausible that PSCA expression in this cell population has evolved to become independent of androgen as in PrEC cells and bladder carcinomas. The physiological role of androgens in expression of PSCA is not known and the other signaling pathways that influence PSCA expression in vivo need to be examined.

The promoter-enhancer of PSCA conforms to the general organizational principles observed in other androgen-regulated, prostate-specific genes like PSA, Slp (sex limited protein), probasin and hK2 (31, 38, 39, 40). The PSA regulatory region comprises a 541-bp core promoter bearing two AREs with an enhancer element at -4.2 kb. The enhancer contains multiple AREs that function with nearby cell-specific elements to activate transcription (27, 31, 41, 42, 43). Slp and probasin regulatory regions have identified androgen-responsive regions (ARR) where single or multiple AR binding sequences function in conjunction with neighboring sequences (44, 45, 46). The principle of coupling an ARR to a strong ARE was initially elucidated for the enhancer within the first intron of the C3 (1) gene (47, 48, 49). The PSCA enhancer follows a similar scheme of an ARR in that the adjoining sequences in combination with AREI are necessary for providing androgen responsiveness. DNA-binding studies failed to identify additional AR binding sites within -2.8 to -3.0 kb (data not shown); however, this region was necessary to provide androgen responsiveness from the enhancer. The sequence between -2.8 and -3.0 kb was also scanned for potential transcription factor binding sites. We did not find sites for any prostate-specific transcription factors, such as the Ets family member prostate-derived Ets factor (50). However, some interesting observations were: acute myeloid leukemia transcription factor (AML)-1a (85% homology), Arnt (aryl hydrocarbon receptor nuclear receptor; 86% homology), GATA-1 (89% homology), and activator protein-1 (87% homology). An AML family member has been shown to be functionally required for hormonal induction of the Slp enhancer (51). Likewise, six GATA sites have been shown flanking an androgen-response element located in the far-upstream enhancer of the PSA gene, and the study suggested the involvement of prostatic GATA factors in androgen regulation of the gene (52).

A key issue that we and others have faced is what DNA sequences constitute an authentic ARE. It is becoming apparent that the answer to this question involves several complexities. Subtle amino acid differences in the ARDBD coupled with subtle differences in the steroid receptor-responsive elements play a role in simple recognition by AR and allow it to be used in place of related steroid receptors (33, 34, 35, 53). However, cooperativity of AR both with itself and nearby proteins also probably contributes to the stringency of the receptor response (27, 43).

The optimized ARE is an imperfect palindrome, GGTACAnnnTGTTCT (32, 33) comprising four highly conserved guanines on the sense and antisense strands (Table 3Go). Modeling of the crystal structure of the related GR (54, 55) suggests that these guanines directly contact the recognition helix (CGSCKVFFKRAAE) of the protein. Functional AREs apparently display a minimal requirement for three out of the four guanine contacts. PSCA AREI (AGGACGgaaAGTTCC) and PSCA low affinity site (AAAACGtctTGTGCG) maintain this requirement. However, PSCA low affinity site displays a poor match with other bases in the optimal site (32, 56). This observation is reinforced by comparison to the ARE consensus determined in a competitive amplification and binding assay, where AR was forced to select a binding site in the presence of a competing steroid receptor. Based on this assay, Nelson et al. (33) determined the AR-specific ARE sequence as: (G/A)G(T/A)AC(A/G) (C/t)(g/a)(G/c) TGTTCT. This site contains a bias away from the optimized steroid response element at positions -2, -5, and -7 (Table 3Go). The middle base of the 3-bp spacer is considered as position 0 for nomenclature purposes. The authors noticed a bias against cytosines except at position -3 in the left half-site (Table 3Go). Both PSCA AR binding sequences adhere to this restriction. The weaker binding of AR at the low affinity binding site may inhibit association with specific coactivators making the site nonfunctional (57, 58).


View this table:
[in this window]
[in a new window]
 
Table 3. Comparison of Human PSCA AR Binding Sites to Naturally Occurring AREs

 
Although binding site selection studies have assumed that AR typically recognizes an imperfect inverted repeat (32), an argument has been made that structural determinants in AR may allow it to bind direct repeats of the consensus half site. It was proposed that this is one mechanism for conferring AR specificity (35, 56). The PSCA ARE sequences match to a certain extent both the putative inverted repeat and the direct repeat. More work will have to be done to resolve this issue.

Claessens and colleagues (59, 60) have defined an HRE (hormone response element) as a sequence which responds to multiple steroid receptors. Various sequence changes in these HREs cause them to favor one steroid receptor over another. An AR-specific consensus HRE sequence (called AR-specific ARE; see Table 3Go) was determined by mutagenesis of AR-specific AREs from the secretory component and Slp enhancers and the probasin promoter. An A at position +2 (relative to the central nucleotide in the three nucleotide spacer) and a T at position -4 are critical to these AR-specific AREs and are never found in sequences recognized by GRDBD (glucocorticoid receptor DNA binding domain) (59). In contrast, a C at position -3 and an A at position -4 will favor binding of GR (glucocorticoid receptor) and response to dexamethasone (61). PSCA AREI has an A at position +2, suggesting that this ARE may be AR-selective (Table 3Go). However, it has a C and an A at positions -3 and -4, respectively. Not surprisingly, the 300-bp PSCA enhancer responds to dexamethasone but only at very high concentrations (data not shown). In conclusion, it seems that PSCA AREI is largely AR selective but less than the AR-specific AREs. Further experiments would be needed to address this issue in detail.

AREs have been further classified as class I and class II elements (62) determined by the nucleotide sequences that function to mediate cooperative binding, hormone sensitivity and transcriptional activity. It has been suggested that the two classes function cooperatively to achieve a robust hormone response. PSCA AREI seems to conform as a class I element in terms of its guanine contacts and androgen sensitivity (Table 3Go). This is also apparent by comparing the sequence to other class I elements identified in naturally occurring ARE sequences (see Table 3Go). PSCA low affinity site matches well with the class I sequences only in one half-site. It does not match very well with the suggested class II consensus sequence and the ARDBD binding at the two sites is not cooperative.

The PSCA promoter sequence is well conserved across species. DNA sequencing analysis of the first 3-kb of the mouse PSCA promoter revealed a 49.3% identity with the human sequence. The mouse promoter sequence has several gaps in it as 2930 bp of the mouse sequence aligns up with 3513 bp of the human sequence. More importantly, however, comparison of the 300-bp human PSCA enhancer with the corresponding mouse sequence revealed a high homology (~60%) (Fig. 10Go). Interestingly, the sequence corresponding to the PSCA AREI displayed a higher identity than the low affinity binding site sequence and contained base pair changes that would still maintain the site as an AR binding site. Further, the 5' sequence flanking the AREI was identical (~80% identity within the first 50 bp 5' to AREI) to the human sequence. This sequence was shown to be important for androgen responsiveness from the human PSCA enhancer.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 10. Sequence Comparison of the PSCA Enhancer

The 300-bp human PSCA enhancer sequence was aligned to that of the mouse PSCA sequence (mPSCA enhancer). The bases in bold represent the identical bases between the two sequences. The position of AREI and the low affinity binding site (low affinity) in the human enhancer sequence is underlined with arrows. The -2.8-kb and -2.9-kb positions on the human PSCA enhancer are shown. The bold line represents the region of high homology between the two sequences. The box shows the sequence comparisons between the human PSCA ARDBD binding sites and the putative mouse sequences.

 
With the identification of a dual regulatory pathway within the PSCA promoter, we have demonstrated that the nature of the PSCA-expressing cells is mirrored within the promoter itself. The natural AI and AD response patterns of the promoter will provide an important tool to generate models that can be used to address basic questions in prostate cancer progression and the role of PSCA in that process.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Transcription Start Site Mapping
The PSCA transcription start site was mapped using the GeneRacer Kit (Invitrogen, Carlsbad, CA), which employs the Cap-dependent RACE method to detect transcripts containing authentic 5'ends. Five micrograms of total RNA from LAPC9 AD and AI tumors were decapped and ligated to an RNA oligonucleotide. PCR was performed using a 3' PSCA-specific primer with the 5' GeneRacer primer complementary to the RNA oligonucleotide. The sequence and the Tm of the primer were 5' CTGGCTGCAGGGCCAAGCCT 3' and 76 C, respectively. The PCR product, a slightly diffuse single band of approximately 100 bp, was cloned into the pCR4Blunt-TOPO vector using the Zero Blunt TOPO PCR cloning kit (Invitrogen). Plasmid DNA was extracted from 19 colonies and sequenced (Laragen, Inc., Santa Monica, CA) using the flanking T7 promoter primer. The DNA sequences were aligned to the human PSCA genomic sequence to determine the transcription start site.

PSCA Deletions
The PSCA promoter-luciferase reporter constructs (PSCA-1.0, PSCA-3.0 and PSCA-6.0) are as described (23). Briefly, PSCA-1.0, PSCA-3.0 and PSCA-6.0 contain 1 kb, 3 kb, and 6 kb of sequence upstream of the PSCA transcription start site. The ATG of the PSCA coding sequence was changed to CTG so that the ATG of luciferase gene could be used in the transient transfection experiments. All the subsequent promoter deletion constructs were constructed from the PSCA-6.0 clone. The promoter deletion constructs PSCA-0.038 or PSCAT (10-bp upstream to the TATA box) and PSCA-0.5 were constructed by subcloning the appropriate PCR promoter fragments into KpnI/HindIII cleaved pGL3basic vector (Promega Corp., Madison, WI). Likewise, PSCA-2.0 was generated by subcloning the appropriate PCR promoter fragment into BglII/HindIII sites of the pGL3basic vector (Promega Corp.). The constructs PSCA-1.5, PSCA-2.2, PSCA-2.5, PSCA-2.7, PSCA-2.8, and PSCA-2.9 were generated by subcloning the appropriate PCR promoter fragments into the KpnI site of the PSCA-1.0 construct. The integrity of all the constructs was confirmed by automated sequencing reactions (Laragen Inc., Santa Monica, CA).

PSCA Sufficiency Clones
The E4T construct contains the adenovirus E4 TATA, start site and 5'untranslated sequences (-38 to +40) cloned into pGL3basic vector (Promega Corp.) at the SacI and XhoI restriction enzyme sites. PSCAT+2.7–3.0 and E4T+2.7–3.0 were constructed by PCR-amplifying the 300-bp enhancer and subcloning it into the KpnI site of the PSCAT and E4T constructs. Multimerized PSCA AREI clones were constructed by phosphorylation followed by self-ligation of the following oligonucleotides: For E4T+PSCA ARE4 (5' CGGAACTTTCCGTCCTCCTTGAACACGGAACTTTCCGTCCTGGTAC 3') and for E4T+PSCA ARE4mut (5' CGCGGGTTTCCGTCCTCCTTGAACACGCGGGTTTCCGTCCTCCTAC 3'). The underlined sequences represent the PSCA AREI sequence. The ligated oligonucleotides were cloned into KpnI site of E4T construct. All constructs were confirmed by automated sequencing (Laragen Inc.).

PSCA ARE Mutations
PSCA ARE mutations were generated using a site-directed mutagenesis technique based on the QuikChange procedure described by Stratagene (La Jolla, CA). Briefly, complementary oligonucleotides containing the desired high affinity AR binding site mutation (5'-CAAGGTGCCAGCCTGCGGGTTTCCGTCCTCAAATATTTATA-3') and the low affinity AR binding site mutation (5'-ACTCTGGCCACTCCCCGGGAAGACGTTTTCTTATCTGTCTC-3') (the mutant bases are underlined) were synthesized and used as primers with wild-type PSCA-6.0 or the sufficiency clone PSCAT+2.7–3.0 as template in a standard amplification reaction. The resulting product was cleaved with DpnI to remove the wild-type template and the products were transformed into competent DH5{alpha} Escherichia coli. The clones were sequenced by automated sequencing (Laragen Inc.) to confirm the position of the mutation and integrity of the clone.

Cell Culture and Transfections
LNCaP cells were grown in Roswell Park Memorial Institute (RPMI) 1640 medium (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% FBS, L-glutamine, and antibiotics (penicillin/streptomycin). Twenty-four hours before transfections, 2.5 x 105 cells per well were seeded into 6-well plates in phenol red-free RPMI 1640 (Mediatech, Herndon, VA) supplemented with 10% charcoal/dextran-treated FBS (Omega Scientific, Tarzana, CA), L-glutamine, and antibiotics (penicillin/streptomycin). LNCaP cells were transfected with 1.5 µg of plasmid DNA containing 400 ng of reporter plasmid using Tfx-50 reagent (Promega Corp.). Androgen-responsive expression was induced with 10 nM R1881. After 48 h, reporter gene expression was measured using a luciferase assay kit (Promega Corp.). Each experiment was repeated three times or more and in each experiment the transfection assays were carried out in triplicate to determine the standard deviations. Relative luciferase activity is maintained in different experiments but due to cell density and other experimental variations, absolute luciferase units vary.

fAR-HeLa cells stably express FLAG-tagged AR. These were maintained as described previously (27). HT1376, human bladder carcinoma cells, were maintained in DMEM (Life Technologies, Inc.) supplemented with 10% FBS, 1% nonessential amino acids (Life Technologies, Inc.), 1% sodium pyruvate (Life Technologies, Inc.) and antibiotics (penicillin/streptomycin). LAPC4 (cell line derived from a human prostate xenograft) were cultured in Iscove’s modified DMEM (Life Technologies, Inc.) with 10% FBS and antibiotics. fAR-HeLa, HT1376 and LAPC4 were transfected with 1.5 µg of plasmid DNA containing 400 ng of reporter plasmid using Tfx-20 reagent (Promega Corp.). Prostate epithelial cells (PrECs) were maintained in serum-free Prostate Epithelial Cell Growth Medium BulletKit (PrEGM~BulletKit, Clonetics, BioWhittaker, Belgium) according to manufacturer’s instructions. Prostate stromal cells (PrSC) were maintained in RPMI 1640 medium with 10% FBS. Both the primary cell populations were transfected with similar amounts of plasmid DNA as described above using Tfx50 reagent (Promega Corp.). LAPC9 tumor explants were maintained as a disaggregated single-cell suspension in short-term culture in PrEGM and were transfected with Tfx50 reagent. The disaggregated single-cell suspensions were prepared from approximately 1 g of LAPC9-AD tumor (~1.3–1.5 cm3) using a standard protocol (63). Briefly, under sterile conditions, the tumor was washed and cut into small pieces of approximately 1–2 mm3. These pieces were resuspended in Iscove’s modified DMEM (Life Technologies, Inc.), and the tissue was disintegrated with 1% pronase for 20 min at room temperature. The cells were washed with Iscove’s medium and then resuspended in 25 ml of PrEGM media with 1x fungizone and 10 nM R1881 and seeded in 10-cm cell culture dishes. On the next day, the cells were filtered through a sterile 40-µm mesh to get rid of the cellular aggregates and they were plated back again in 10-cm Petri dishes. Approximately 3 x 107 cells were obtained from 1 g tumor.

DNase I Footprinting
The binding reactions for DNase I footprinting were as described previously (27). Radiolabeled probes were prepared by PCR, where the PSCA-6.0 plasmid (or the respective binding site mutant plasmids) was employed as a template. Two primers, 3 kb-fp1 (5'-GTGTGTTGCCCCCTCCTTGGCC-3') and 2.7 kb-fp1 (5'-CCGCCCCAGCTCGCCCGGACTC-3'), flanking the 300-bp enhancer region were used for the PCR amplification of the probe. One of the primers, 2.7 kb-fp1 was 32P-end-labeled with polynucleotide kinase and [{gamma}32P]ATP. The probes were purified on a 4% polyacrylamide gel before they were used in DNase I footprinting reactions. The amounts of recombinant ARDBD (27) used were as indicated in the figure legends.

EMSA
Ten picomoles of ARE containing double-stranded oligonucleotides were 32P-end-labeled with polynucleotide kinase and [{gamma}32P]ATP. The oligonucleotides used were as follows: consensus ARE (5' CCCCCCCGGTACATGATGTTCTCCCCC 3'), consensus ARE mutant (5' CCCCCCCGGTACATGAACAAGACCCCC 3'), PSA AREIII (5' CTCTGGAGGAACATATTGTATTGATTG 3'), PSCA high (5' CCTGGAACTTTCCGTCCTCAAATA 3'), and PSCA high-mut (5' CCTGTAATTTTCCGTCCTCAAATA 3'). Indicated amounts of recombinant ARDBD was incubated in a 10-µl reaction volume containing 5 fmol of the radiolabeled probe; 20 mM HEPES, pH 7.9; 25% glycerol; 1.5 mM MgCl2; 0.2 mM EDTA; 100 mM KCl; 0.5 mg/ml BSA; 0.01% Nonidet P-40; and 400 ng of poly(deoxyinosine-deoxycytidine). When carrying out a cold competition assay, the required amount of the cold competitor was added to the reaction mixture along with the labeled oligonucleotide. After 20 min at room temperature, the complexes were separated at 4 C on a 4% polyacrylamide gel containing 1% glycerol and 0.5x TBE.

Calculation of the Dissociation Constant
To determine the Kd of ARDBD, we first calculated the active protein concentration. This was determined by an oligonucleotide competition assay in an EMSA. The ARDBD concentration was raised 50- to 100-fold above the concentration required to generate 50% occupancy of the probe or the Kd. At this stage, the amount of cold competitor was gradually raised. As the competitor oligonucleotide is raised, it begins to compete with the bound 32P-labeled oligonucleotide for ARDBD and the unbound radiolabeled DNA is observed by EMSA. When 50% of the labeled oligonucleotide is competed to the unbound form, the oligonucleotide competitor has exceeded the amount of active protein (ARDBD) by 2-fold. The ARDBD active protein concentration was then calculated to be equivalent to half of the molar concentration of the oligonucleotide or approximately 4 x 10-7 M. The active protein concentration was independently calculated with consensus ARE, PSA AREIII, and PSCA-high oligonucleotides, and similar results were obtained.

Having calculated the active protein concentration, ARDBD dose response reactions at low concentrations of ARDBD were carried out in EMSAs over consensus ARE, PSA AREIII, and PSCA-high oligonucleotides. The gels were scanned by a PhosphorImager (Molecular Dynamics, Amersham Biosciences, Sunnyvale, CA) to calculate the intensity of the bound and unbound complexes and the amount of active protein required for 50% complex formation was determined. This value was equivalent to the Kd.

Generation of Stable Cell Lines
GFP-expressing stable cell lines were generated in LNCaP cells. pEGFP-promoterless was generated from pEGFP-N1 (CLONTECH Laboratories, Inc., Palo Alto, CA) by removing the CMV promoter (AseI-Eco47III). pEGFP-N1 contains a neomycin-resistance cassette (neor), which allows stably transfected eukaryotic cells to be selected using G418. PSCA-6.0 GFP clone was constructed by cloning the 6-kb PSCA promoter as a HindIII/BglII fragment into pEGFP-promoterless clone. pEGFP-promoterless and PSCA-6.0 GFP clones were transfected into LNCaP cells using Tfx-50 reagent (Promega Corp.), and stable clones were selected over a 3-wk period using 500 µg/ml of G418. To avoid a bias for an integration site, G418-resistant positive populations were employed for the analyses without separating the high expressing populations from the low expressing ones.

Flow Cytometry and Fluorescence Microscopy
Flow cytometric and fluorescent microscopic analyses were performed after the stable cell lines were starved in steroid-depleted RPMI media for 1 wk followed by a 48-h induction with 10 nM R1881 or ethanol as a negative control. In brief, cells were resuspended in RPMI at approximately 105 cells/ml and analyzed for GFP fluorescence. In each analysis, 10,000 cells were counted. Analysis was performed on a FACScan (Becton Dickinson and Co., Franklin Lakes, NJ) using Cellquest software. GFP-fluorescence microscopy on live LNCaP cells 48 h post R1881 treatment was performed using the Leica Corp. DM IRBE microscope attached to the Hamamatsu Digital Camera (both instruments were obtained from McBain Instruments, Chatsworth, CA). GFP-fluorescence was captured using Openlab version 3.0 software (Improvision, Coventry, UK).


    ACKNOWLEDGMENTS
 
We thank Dr. Owen Witte for the mouse genomic clone containing the mouse PSCA regulatory sequences; Drs. Charles Sawyers, Owen Witte, and Purnima Dubey for helpful discussions; Dr. Joann Zhang for careful reading of the manuscript; and Kim Le for help with the digital artwork.


    FOOTNOTES
 
This work was supported in part by the CaP CURE (Association for Cure of Cancer of the Prostate) grant (to M.C.); Department of Defense Project Grant DAMD17-00-1-0077 (to C. Sawyers, M. Carey, and P. Cohen); and Grants (to R.E.R.) NCI-K08-CA-74169, NCI-RFA-CA-98-013, and Department of Defense Award No. PC-001588. A.J. was supported by the California Cancer Research Program (2PD0109).

Abbreviations: AD, Androgen dependent; AI, androgen independent; AR, androgen receptor; ARDBD, AR DNA binding domain; ARE (AREI, AREII, AREIII), androgen response element (I, II, or III); ARR, androgen-responsive region; CMV, cytomegalovirus; DNase, deoxyribonuclease; FACS, fluorescence-activated cell sorting; FLAG, epitope DYKDDDDK; GFP, green fluorescent protein; GPI, glycosylphosphatidyl-inositol; GR, glucocorticoid receptor; GRDBD, glucocorticoid receptor DNA binding domain; high-mut, high affinity site mutant; HRE, hormone response element; Kd, dissociation constant; low-mut, low affinity site mutant; mPSCA, murine prostate stem cell antigen; PrEC, prostate epithelial cell; PrSC, prostate stromal cell; PSA, prostate-specific antigen; PSCA, prostate stem cell antigen; PTEN, phosphatase and tensin homolog; RACE, rapid amplification of cDNA ends; RLU, relative light units; RPMI, Roswell Park Memorial Institute; Slp, sex-limited protein; TRAMP, transgenic adenocarcinoma of the mouse prostate.

Received for publication January 4, 2002. Accepted for publication July 5, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Isaacs JT 1999 The biology of hormone refractory prostate cancer. Why does it develop? Urol Clin North Am 26:263–273[CrossRef][Medline]
  2. Abate-Shen C, Shen MM 2000 Molecular genetics of prostate cancer. Genes Dev 14:2410–2434[Free Full Text]
  3. Elo JP, Visakorpi T 2001 Molecular genetics of prostate cancer. Ann Med 33:130–141[Medline]
  4. Weigel NL, Zhang Y 1998 Ligand-independent activation of steroid hormone receptors. J Mol Med 76:469–479[CrossRef][Medline]
  5. Craft N, Sawyers CL 1998 Mechanistic concepts in androgen-dependence of prostate cancer. Cancer Metastasis Rev 17:421–427[CrossRef][Medline]
  6. Jenster G 1999 The role of the androgen receptor in the development and progression of prostate cancer. Semin Oncol 26:407–421[Medline]
  7. Lamb DJ, Weigel NL, Marcelli M 2001 Androgen receptors and their biology. Vitam Horm 62:199–230[Medline]
  8. Brinkmann AO 2001 Molecular basis of androgen insensitivity. Mol Cell Endocrinol 179:105–109[CrossRef][Medline]
  9. Avila DM, Zoppi S, McPhaul MJ 2001 The androgen receptor (AR) in syndromes of androgen insensitivity and in prostate cancer. J Steroid Biochem Mol Biol 76:135–142[CrossRef][Medline]
  10. Cinar B, Koeneman KS, Edlund M, Prins GS, Zhau HE, Chung LW 2001 Androgen receptor mediates the reduced tumor growth, enhanced androgen responsiveness, and selected target gene transactivation in a human prostate cancer cell line. Cancer Res 61:7310–7317[Abstract/Free Full Text]
  11. Stamey TA 2001 Preoperative serum prostate-specific antigen (PSA) below 10 microg/l predicts neither the presence of prostate cancer nor the rate of postoperative PSA failure. Clin Chem 47:631–634[Abstract/Free Full Text]
  12. Pannek J, Partin AW 1997 Prostate-specific antigen: what’s new in 1997. Oncology (Huntingt) 11:1273–8; discussion 1279–1282[Medline]
  13. Lee CT, Oesterling JE 1995 Diagnostic markers of prostate cancer: utility of prostate-specific antigen in diagnosis and staging. Semin Surg Oncol 11:23–35[Medline]
  14. Reiter RE, Gu Z, Watabe T, Thomas G, Szigeti K, Davis E, Wahl M, Nisitani S, Yamashiro J, Le Beau MM, Loda M, Witte ON 1998 Prostate stem cell antigen: a cell surface marker overexpressed in prostate cancer. Proc Natl Acad Sci USA 95:1735–1740[Abstract/Free Full Text]
  15. Gu Z, Thomas G, Yamashiro J, Shintaku IP, Dorey F, Raitano A, Witte ON, Said JW, Loda M, Reiter RE 2000 Prostate stem cell antigen (PSCA) expression increases with high gleason score, advanced stage and bone metastasis in prostate cancer. Oncogene 19:1288–1296[CrossRef][Medline]
  16. Dubey P, Wu H, Reiter RE, Witte ON 2001 Alternative pathways to prostate carcinoma activate prostate stem cell antigen expression. Cancer Res 61:3256–3261[Abstract/Free Full Text]
  17. Ross S, Spencer SD, Lasky LA, Koeppen H 2001 Selective expression of murine prostate stem cell antigen in fetal and adult tissues and the transgenic adenocarcinoma of the mouse prostate model of prostate carcinogenesis. Am J Pathol 158:809–816[Abstract/Free Full Text]
  18. Amara N, Palapattu GS, Schrage M, Gu Z, Thomas GV, Dorey F, Said J, Reiter RE 2001 Prostate stem cell antigen is overexpressed in human transitional cell carcinoma. Cancer Res 61:4660–4665[Abstract/Free Full Text]
  19. Argani P, Rosty C, Reiter RE, Wilentz RE, Murugesan SR, Leach SD, Ryu B, Skinner HG, Goggins M, Jaffee EM, Yeo CJ, Cameron JL, Kern SE, Hruban RH 2001 Discovery of new markers of cancer through serial analysis of gene expression: prostate stem cell antigen is overexpressed in pancreatic adenocarcinoma. Cancer Res 61:4320–4324[Abstract/Free Full Text]
  20. Beissert S, He HT, Hueber AO, Lellouch AC, Metze D, Mehling A, Luger TA, Schwarz T, Grabbe S 1998 Impaired cutaneous immune responses in Thy-1-deficient mice. J Immunol 161:5296–5302[Abstract/Free Full Text]
  21. Killeen N 1997 T-cell regulation: Thy-1—hiding in full view. Curr Biol 7:R774–R777
  22. Saffran DC, Raitano AB, Hubert RS, Witte ON, Reiter RE, Jakobovits A 2001 Anti-PSCA mAbs inhibit tumor growth and metastasis formation and prolong the survival of mice bearing human prostate cancer xenografts. Proc Natl Acad Sci USA 98:2658–2663[Abstract/Free Full Text]
  23. Watabe T, Lin M, Ide H, Donjacour AA, Cunha GR, Witte ON, Reiter RE 2002 Growth, regeneration, and tumorigenesis of the prostate activates the PSCA promoter. Proc Natl Acad Sci USA 99:401–406[Abstract/Free Full Text]
  24. Klein KA, Reiter RE, Redula J, Moradi H, Zhu XL, Brothman AR, Lamb DJ, Marcelli M, Belldegrun A, Witte ON, Sawyers CL 1997 Progression of metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat Med 3:402–408[CrossRef][Medline]
  25. Horoszewicz JS, Leong SS, Kawinski E, Karr JP, Rosenthal H, Chu TM, Mirand EA, Murphy GP 1983 LNCaP model of human prostatic carcinoma. Cancer Res 43:1809–1818[Abstract/Free Full Text]
  26. Rasheed S, Gardner MB, Rongey RW, Nelson-Rees WA, Arnstein P 1977 Human bladder carcinoma: characterization of two new tumor cell lines and search for tumor viruses. J Natl Cancer Inst 58:881–890[Medline]
  27. Huang W, Shostak Y, Tarr P, Sawyers C, Carey M 1999 Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer. J Biol Chem 274:25756–25768[Abstract/Free Full Text]
  28. Cordingley MG, Riegel AT, Hager GL 1987 Steroid-dependent interaction of transcription factors with the inducible promoter of mouse mammary tumor virus in vivo Cell 48:261–270
  29. Archer TK, Lefebvre P, Wolford RG, Hager GL 1992 Transcription factor loading on the MMTV promoter: a bimodal mechanism for promoter activation. Science 255:1573–1576[Abstract/Free Full Text]
  30. Wu L, Matherly J, Smallwood A, Adams JY, Billick E, Belldegrun A, Carey M 2001 Chimeric PSA enhancers exhibit augmented activity in prostate cancer gene therapy vectors. Gene Ther 8:1416–1426[CrossRef][Medline]
  31. Cleutjens KB, van der Korput HA, van Eekelen CC, van Rooij HC, Faber PW, Trapman J 1997 An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol Endocrinol 11:148–161[Abstract/Free Full Text]
  32. Roche PJ, Hoare SA, Parker MG 1992 A consensus DNA-binding site for the androgen receptor. Mol Endocrinol 6:2229–2235[Abstract/Free Full Text]
  33. Nelson CC, Hendy SC, Shukin RJ, Cheng H, Bruchovsky N, Koop BF, Rennie PS 1999 Determinants of DNA sequence specificity of the androgen, progesterone, and glucocorticoid receptors: evidence for differential steroid receptor response elements. Mol Endocrinol 13:2090–2107[Abstract/Free Full Text]
  34. Massaad C, Garlatti M, Wilson EM, Cadepond F, Barouki R 2000 A natural sequence consisting of overlapping glucocorticoid-responsive elements mediates glucocorticoid, but not androgen, regulation of gene expression. Biochem J 350(Part 1):123–129
  35. Claessens F, Verrijdt G, Schoenmakers E, Haelens A, Peeters B, Verhoeven G, Rombauts W 2001 Selective DNA binding by the androgen receptor as a mechanism for hormone-specific gene regulation. J Steroid Biochem Mol Biol 76:23–30[CrossRef][Medline]
  36. Craft N, Shostak Y, Carey M, Sawyers CL 1999 A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5:280–285[CrossRef][Medline]
  37. Ray DW, Suen CS, Brass A, Soden J, White A 1999 Structure/function of the human glucocorticoid receptor: tyrosine 735 is important for transactivation. Mol Endocrinol 13:1855–1863[Abstract/Free Full Text]
  38. Mitchell SH, Murtha PE, Zhang S, Zhu W, Young CY 2000 An androgen response element mediates LNCaP cell dependent androgen induction of the hK2 gene. Mol Cell Endocrinol 168:89–99[CrossRef][Medline]
  39. Yu DC, Sakamoto GT, Henderson DR 1999 Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res 59:1498–1504[Abstract/Free Full Text]
  40. Xie X, Zhao X, Liu Y, Young CY, Tindall DJ, Slawin KM, Spencer DM 2001 Robust prostate-specific expression for targeted gene therapy based on the human kallikrein 2 promoter. Hum Gene Ther 12:549–561[CrossRef][Medline]
  41. Schuur ER, Henderson GA, Kmetec LA, Miller JD, Lamparski HG, Henderson DR 1996 Prostate-specific antigen expression is regulated by an upstream enhancer. J Biol Chem 271:7043–7051[Abstract/Free Full Text]
  42. Pang S, Dannull J, Kaboo R, Xie Y, Tso CL, Michel K, deKernion JB, Belldegrun AS 1997 Identification of a positive regulatory element responsible for tissue-specific expression of prostate-specific antigen. Cancer Res 57:495–499[Abstract/Free Full Text]
  43. Farmer G, Connolly Jr ES, Mocco J, Freedman LP 2001 Molecular analysis of the prostate-specific antigen upstream gene enhancer. Prostate 46:76–85[CrossRef][Medline]
  44. Adler AJ, Scheller A, Robins DM 1993 The stringency and magnitude of androgen-specific gene activation are combinatorial functions of receptor and nonreceptor binding site sequences. Mol Cell Biol 13:6326–6335[Abstract/Free Full Text]
  45. Adler AJ, Danielsen M, Robins DM 1992 Androgen-specific gene activation via a consensus glucocorticoid response element is determined by interaction with nonreceptor factors. Proc Natl Acad Sci USA 89:11660–11663[Abstract/Free Full Text]
  46. Kasper S, Rennie PS, Bruchovsky N, Sheppard PC, Cheng H, Lin L, Shiu RP, Snoek R, Matusik RJ 1994 Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J Biol Chem 269:31763–31769[Abstract/Free Full Text]
  47. Devos A, Claessens F, Alen P, Winderickx J, Heyns W, Rombauts W, Peeters B 1997 Identification of a functional androgen-response element in the exon 1-coding sequence of the cystatin-related protein gene crp2. Mol Endocrinol 11:1033–1043[Abstract/Free Full Text]
  48. Claessens F, Celis L, De Vos P, Peeters B, Heyns W, Verhoeven G, Rombauts W 1993 Intronic androgen response elements of prostatic binding protein genes. Biochem Biophys Res Commun 191:688–694[CrossRef][Medline]
  49. Celis L, Claessens F, Peeters B, Heyns W, Verhoeven G, Rombauts W 1993 Proteins interacting with an androgen-responsive unit in the C3(1) gene intron. Mol Cell Endocrinol 94:165–172[CrossRef][Medline]
  50. Oettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, Boltax J, Grall F, Dube A, Weiss A, Brown L, Quinn G, Kas K, Endress G, Kunsch C, Libermann TA 2000 PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J Biol Chem 275:1216–1225[Abstract/Free Full Text]
  51. Ning YM, Robins DM 1999 AML3/CBF{alpha}1 is required for androgen-specific activation of the enhancer of the mouse sex-limited protein (Slp) gene. J Biol Chem 274:30624–30630[Abstract/Free Full Text]
  52. Perez-Stable CM, Pozas A, Roos BA 2000 A role for GATA transcription factors in the androgen regulation of the prostate-specific antigen gene enhancer. Mol Cell Endocrinol 167:43–53[CrossRef][Medline]
  53. Scheller A, Hughes E, Golden KL, Robins DM 1998 Multiple receptor domains interact to permit, or restrict, androgen-specific gene activation. J Biol Chem 273:24216–24222[Abstract/Free Full Text]
  54. Luisi BF, Xu WX, Otwinowski Z, Freedman LP, Yamamoto KR, Sigler PB 1991 Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352:497–505[CrossRef][Medline]
  55. Gewirth DT, Sigler PB 1995 The basis for half-site specificity explored through a non-cognate steroid receptor-DNA complex. Nat Struct Biol 2:386–394[CrossRef][Medline]
  56. Zhou Z, Corden JL, Brown TR 1997 Identification and characterization of a novel androgen response element composed of a direct repeat. J Biol Chem 272:8227–8235[Abstract/Free Full Text]
  57. Saatcioglu F, Lopez G, West BL, Zandi E, Feng W, Lu H, Esmaili A, Apriletti JW, Kushner PJ, Baxter JD, Karin M 1997 Mutations in the conserved C-terminal sequence in thyroid hormone receptor dissociate hormone-dependent activation from interference with AP-1 activity. Mol Cell Biol 17:4687–4695[Abstract/Free Full Text]
  58. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA, Trapman J 1999 Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69:307–313[CrossRef][Medline]
  59. Verrijdt G, Schoenmakers E, Haelens A, Peeters B, Verhoeven G, Rombauts W, Claessens F 2000 Change of specificity mutations in androgen-selective enhancers. Evidence for a role of differential DNA binding by the androgen receptor. J Biol Chem 275:12298–12305[Abstract/Free Full Text]
  60. Schoenmakers E, Verrijdt G, Peeters B, Verhoeven G, Rombauts W, Claessens F 2000 Differences in DNA binding characteristics of the androgen and glucocorticoid receptors can determine hormone-specific responses. J Biol Chem 275:12290–12297[Abstract/Free Full Text]
  61. Nordeen SK, Suh BJ, Kuhnel B, Hutchison CD 1990 Structural determinants of a glucocorticoid receptor recognition element. Mol Endocrinol 4:1866–1873[Abstract/Free Full Text]
  62. Reid KJ, Hendy SC, Saito J, Sorensen P, Nelson CC 2001 Two classes of androgen receptor elements mediate cooperativity through allosteric interactions. J Biol Chem 276:2943–2952[Abstract/Free Full Text]
  63. Craft N, Chhor C, Tran C, Belldegrun A, DeKernion J, Witte ON, Said J, Reiter RE, Sawyers CL 1999 Evidence for clonal outgrowth of androgen-independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Res 59:5030–5036[Abstract/Free Full Text]
  64. Rundlett SE, Miesfeld RL 1995 Quantitative differences in androgen and glucocorticoid receptor DNA binding properties contribute to receptor-selective transcriptional regulation. Mol Cell Endocrinol 109:1–10[CrossRef][Medline]
  65. Rennie PS, Bruchovsky N, Leco KJ, Sheppard PC, McQueen SA, Cheng H, Snoek R, Hamel A, Bock ME, MacDonald BS, Nickel BE, Chang C, Liao S, Cattini PA, Matusik RJ 1993 Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol 7:23–36[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   AR
Ligands:   R1881



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. M. Eacker, J. E. Shima, C. M. Connolly, M. Sharma, R. W. Holdcraft, M. D. Griswold, and R. E. Braun
Transcriptional Profiling of Androgen Receptor (AR) Mutants Suggests Instructive and Permissive Roles of AR Signaling in Germ Cell Development
Mol. Endocrinol., April 1, 2007; 21(4): 895 - 907.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. A. Magee, L.-w. Chang, G. D. Stormo, and J. Milbrandt
Direct, Androgen Receptor-Mediated Regulation of the FKBP5 Gene via a Distal Enhancer Element
Endocrinology, January 1, 2006; 147(1): 590 - 598.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Gao, P. Lee, H. Wang, W. Gerald, M. Adler, L. Zhang, Y.-F. Wang, and Z. Wang
The Androgen Receptor Directly Targets the Cellular Fas/FasL-Associated Death Domain Protein-Like Inhibitory Protein Gene to Promote the Androgen-Independent Growth of Prostate Cancer Cells
Mol. Endocrinol., July 1, 2005; 19(7): 1792 - 1802.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. V. Litvinov, A. M. De Marzo, and J. T. Isaacs
Is the Achilles' Heel for Prostate Cancer Therapy a Gain of Function in Androgen Receptor Signaling?
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2972 - 2982.
[Full Text] [PDF]


Home page
Mol Cancer ResHome page
C. P. Tran, C. Lin, J. Yamashiro, and R. E. Reiter
Prostate Stem Cell Antigen Is a Marker of Late Intermediate Prostate Epithelial Cells
Mol. Cancer Res., December 1, 2002; 1(2): 113 - 121.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, A.
Right arrow Articles by Reiter, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, A.
Right arrow Articles by Reiter, R. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals