| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Cellular Biology (A.J.J., I.U.A., M.M., D.J.L., N.L.W.), Scott Department of Urology (D.J.L.), and Department of Medicine (M.M.), Baylor College of Medicine, Houston, Texas 77030; School of Life Science (J.M.H.), Queensland University of Technology, Brisbane, Queensland 4001, Australia; and Flinders Cancer Centre (G.B., W.D.T.), Flinders University and Flinders Medical Centre, Adelaide SA 5042, Australia
Address all correspondence and requests for reprints to: Nancy L. Weigel, Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030. E-mail: nweigel{at}bcm.tmc.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Androgens continue to regulate the growth of malignant prostate epithelial cells as documented by the initial growth arrest of 70% of metastatic prostate cancer tumors by androgen ablation (7). Eventually, prostate cancer develops adaptive mechanisms to grow in the presence of low androgens referred to as androgen-independent or recurrent prostate cancer (reviewed in Ref. 8). In some cases of androgen-independent growth, the AR may continue to play a role. Altered activation of AR can occur through the following pathways: 1) ligand-independent activation by growth factors and/or kinases (9, 10, 11, 12, 13, 14, 15); 2) AR amplification (16, 17, 18, 19); and 3) AR mutations (20).
Germline AR gene mutations give rise to conditions such as Kennedys disease (also known as spinobulbar muscular atrophy) and androgen insensitivity syndrome (AIS). Because the genomic locus of AR is on the X chromosome, AR mutations in men with a normal karyotype (46 X, Y) have a dominant effect. In Kennedys disease, expansion of the polymorphic-glutamine tract in the AR amino terminus results in the formation of nuclear inclusions and inactivation of the receptor causing an adult onset spinobulbar muscular atrophy (21, 22). In AIS, mutations and deletions in the AR gene cause minimal to complete loss of AR activity that result in various phenotypic manifestations ranging from complete testicular feminization to a fertile but undervirilized male (reviewed in Ref. 23).
Although a significant number of somatic AR gene mutations have been identified in metastatic prostate cancer, the frequency of this occurrence and its functional consequences are controversial. Unlike the mutations found in Kennedys disease and AIS, mutations identified in prostate cancer result in mutant AR receptors with either increased activity due to altered receptor ligand specificity or decreased activity due to altered hormone interactions or decreased DNA binding (reviewed in Ref. 24). The characterization of these mutations has significantly contributed to our understanding the structural and functional domains of the AR.
We report the detailed functional characterization of an AR mutation that occurred in a patient with untreated metastatic prostate cancer. This somatic mutation of alanine to threonine at position 748 (A748T) shares several characteristics with a subset of AIS AR mutants but has the novel phenotype of decreased receptor stability in both the absence and presence of hormone. In addition, despite a normal binding affinity, A748T exhibits hormone concentration-dependent defects in nuclear translocation and consequent transcriptional activation.
| RESULTS |
|---|
|
|
|---|
A748T Receptor Expression Is Much Lower than ARWT
To determine the effect of the A748T mutation on receptor-mediated transcriptional activation, COS-1 cells were transiently transfected with cytomegalovirus (CMV)-ARWT or CMV-A748T expression plasmids and the glucocorticoid response element (GRE)2-E1b-chloramphenicol acetyl transferase (CAT) reporter and treated with 10-9 M R1881. Receptor expression of R1881-treated samples was determined by Western analysis of parallel samples. Using equimolar concentrations of plasmid DNA for ARWT and A748T, we found that A748T transcriptional activity was much lower than ARWT, but the expression level was also substantially reduced (Fig. 1A
). This finding was reproduced with several independent preparations of ARWT and A748T expression plasmids and in different cell types including HeLa and DU 145 (data not shown) and using other expression plasmids (pCR3.1-ARWT and pCR3.1-A748T, data not shown).
|
The Transcriptional Activity of A748T Is Much Less than ARWT at Subsaturating Levels of R1881 and DHT and at Physiological Levels of Testosterone
At comparable levels of ARWT and A748T expression, the transcriptional activity was next measured as a function of hormone concentration. Although the activities of ARWT and A748T were similar when treated with concentrations of R1881 or DHT equal to or higher than 10-9 M, the activity of A748T was substantially lower than ARWT in COS-1 cells treated with 10-10 M R1881 or 10-10 M DHT (Fig. 2
, A and C). The decrease in A748T activity was also observed in the prostate cancer cell line, PC-3 (data not shown). As shown by the parallel Western analysis of the samples treated with the various concentrations of R1881 (Fig. 2B
) and DHT (data not shown), A748T is less stabilized by hormone treatment than ARWT, but the difference in expression at lower levels of hormone is insufficient to account for the differences in transcriptional activity. In the presence of testosterone, a somewhat weaker androgen than DHT or R1881, there was a more dramatic difference in A748T activity compared with ARWT (Fig. 2D
). The level of A748T transcriptional activity was only slightly above basal level (vehicle-treated samples) at concentrations as high as 10-7 M testosterone in COS-1 cells, whereas ARWT exhibited very high levels of activity. As previously reported and as shown in Fig. 2
, B and E, ARWT receptor levels increase through stabilization of hormone-bound receptor (29). Interestingly, although R1881 stabilizes A748T somewhat (Fig. 2B
), the mutant receptor levels were not increased upon testosterone treatment (Fig. 2E
). This finding is consistent with the relatively low level of A748T transcriptional activation and suggests a difference in receptor-ligand interaction.
|
|
40 and 35 min, for R1881 and DHT, respectively) is approximately five times faster than ARWT (t1/2 of 190 min for both R1881 and DHT). Because A748T binds hormone with the same affinity as ARWT, A748T must also have a proportional increase in hormone association rate relative to the increased dissociation rate to maintain normal equilibrium binding affinity. We were unable to detect [3H] testosterone binding to A748T using these assays; this finding suggests that the affinity and/or dissociation are substantially altered by this mutation (data not shown).
A748T Exhibits Decreased N/C Interaction Relative to ARWT only at Low Hormone Concentrations
Mutant ARs with a rapid dissociation rate frequently exhibit a decrease in the antiparallel interaction of the amino and carboxyl termini of AR, which contributes to receptor dimerization (30, 31). This form of dimerization, termed N/C interaction, was measured using a mammalian two-hybrid assay in which the mutant or wild-type carboxyl terminus (amino acids 624919) fused to the galactosidase DNA binding domain (GAL-DBD) fragment was cotransfected with the amino terminus (amino acids 1660) fused to the VP 16 protein of the herpes simplex virus (VP-16) activation domain and the reporter plasmid, galactosidase response element luciferase reporter (17merLUC). In the presence of saturating hormone concentrations (10-8 M DHT), neither the GAL-ARWT624-919 construct, the GAL-A748T624-919, nor the VP-16-ARWT1-660 construct alone induced activity above vehicle-treated samples cotransfected with GAL-ARWT624-919 and VP-16-ARWT1-660 (data not shown). The N/C interactions of GAL-ARWT624-919 and GAL-A748T624-919 were comparable at 10-8 M DHT (Fig. 4A
). However, at 10-9 M DHT, the N/C interaction of GAL-A748T624-919 was significantly less than ARWT, showing that GAL-A748T624-919 was less capable of forming dimers at low levels of hormone. The hormone concentrations for optimal ARWT N/C interaction are considerably greater than the concentrations required for transcriptional activity, consistent with previously published data, and may be associated with a loss of contact points in the separation of the two termini (30, 31).
|
To investigate whether the decrease in N/C interaction and TIF2 coactivation was a result of a change in the hormone-binding properties of the GAL-A748T624-919, we performed whole cell binding and dissociation assays. Interestingly, the apparent binding affinity for [3H] R1881 of GAL-A748T624-919 (1.4 nM) was approximately 10-fold less than GAL-ARWT624-919 (0.13 nM) (Fig. 4C
). As shown in Fig. 4D
, this decrease in binding affinity may be a result of the accelerated dissociation of hormone from GAL-A748T624-919. Nearly 75% of the hormone dissociated within 5 min from GAL-A748T624-919, whereas 30% of the hormone dissociated from GAL-ARWT624-919. The experiments in Fig. 4
, A and B, showing equivalent interaction at 10-8 M DHT or R1881 suggest that the two hormone binding domains are expressed at comparable levels, but measurement of receptor levels by Scatchard analysis (Fig. 4C
) implies that the mutant is expressed at one third the level of the GAL-ARWT624-919. This discrepancy is most likely due to the extremely fast dissociation rate of the mutant (Fig. 4D
). Based on the observation that 75% of the measurable bound hormone is lost after 5 min of incubation with radio-inert steroid, it is likely that some significant portion of the bound hormone is lost during the processing of the cells (although the cells were washed with ice cold PBS and extracted as quickly as possible) leading to an apparent lower level of receptor. These findings suggest that in the context of just the ligand-binding domain, the A748T mutation has an intrinsic effect on the hormone-binding kinetics and affinity that contributes to the observed decrease in N/C interaction of GAL-A748T624-919 at hormone concentrations lower than 10-8 M.
A748T Nuclear Translocation Is Compromised at Low Levels of Hormone
Studies of PR translocation from the cytoplasm to the nucleus utilizing translocation competent PR and a mutant that is unable to translocate on its own, but can dimerize, suggest that PR is translocated as a dimer (34). Although it has not been determined whether AR is translocated as a monomer or dimer, subcellular localization experiments were performed to determine the effect of the A748T mutation on nuclear transport of the mutant receptor. In the absence of hormone, ARWT and A748T were predominantly cytoplasmic and translocated to the nucleus at physiological hormone levels (Fig. 5A
). However at the hormone concentrations (10-11 M R1881, 10-9 M testosterone and 10-10 M DHT) at which the activity of A748T was significantly less than ARWT, A748T appeared to be predominantly localized to the cytoplasm whereas ARWT translocated to the nucleus (Fig. 5B
). To examine this finding more closely and to quantify these results, cells transfected with ARWT or A748T were treated with the indicated hormones, fixed, stained, and analyzed for receptor distribution. Figure 5C
shows the variation in pattern of expression (predominantly cytoplasmic or predominantly nuclear). To quantify receptor distribution, approximately 400 AR-expressing cells were scored as predominantly cytoplasmic vs. predominantly nuclear, and the percentage of cells exhibiting predominantly nuclear distribution was plotted. Figure 5D
shows that nearly 100% of cells expressing ARWT exhibit predominantly nuclear localization in response to hormone concentrations as low as 10 pM R1881, 1 nM testosterone, or 0.1 nM DHT. In contrast, less than 20% of the A748T cells exhibit predominantly nuclear localization at these concentrations, although the receptor is predominantly nuclear at higher concentrations of hormone. Figure 6
shows the kinetics of nuclear localization in response to 1 nM and 10 pM R1881. Translocation of ARWT is detectable at 5 min and is complete by 20 min. At 10 pM R1881 nuclear translocation of ARWT is slower, but reaches a maximum between 1 and 4 h. In contrast, there is minimal nuclear localization of A748T at 10 pM R1881; even at 4 or 24 h, the percent of cells with predominantly nuclear localization is no more than 20%. Although this pattern might have been due to rapid export of A748T, we found no supporting evidence of this functional change. Treating ARWT and A748T with high concentrations of hormone to cause nuclear translocation followed by androgen removal for 12 h in the presence of cycloheximide did not result in the cytoplasmic relocation of either the wild-type or mutant receptor (data not shown). These data suggest that at the aforementioned hormone concentrations, A748T exhibits a significant decrease in nuclear translocation rendering it less able to activate transcription.
|
|
|
3 h) receptor levels decreased more quickly than ARWT (t1/2
10 h) in the presence of 1 nM DHT, results that correspond to the previously reported ARWT receptor level half-life (29, 30).
|
1 h) decreased significantly faster than ARWT (t1/2
3 h) in the absence of hormonea novel phenotype for an AR mutation identified in metastatic prostate cancer.
A748T Does Not Form Stable Interactions with Heat Shock Protein (hsp) Complexes
The decreased stability of A748T in the absence of hormone suggested that the mutation potentially alters interactions with hsp, which play a pivotal role in the folding the ligand-binding domain for stable hormone-binding. It has been shown that the hsp90 interaction with the rat AR requires the region that contains A748 (38, 39); therefore, we asked how blocking the formation of the mature receptor-hsp complex with geldanamycin (GA) (40) would affect A748T receptor levels compared with the ARWT. We hypothesized that the decrease in A748T receptor stability in the absence of hormone was due to decreased stability of interactions with hsp complexes. Thus, treatment with GA would have little to no effect on A748T but should decrease ARWT receptor levels. As predicted, in the presence of GA, total ARWT receptor levels rapidly decreased, but A748T receptor levels were virtually unchanged (Fig. 8C
).
Molecular Modeling of A748T
The functional properties of A748T suggested that there were intrinsic alterations in the interaction of the ligand with the mutant receptor. The recently published high-resolution crystal structure of the rat AR LBD complexed with DHT (27) allows detailed examination of the AR ligand-binding cavity and the disposition of hydrogen bonds formed between the receptor and ligand (Fig. 9A
). Inspection of the LBD-DHT structure in the vicinity of A748 revealed that the arginine residue at position 752 (R752) is predicted to form hydrogen bonds with DHT and an ordered water molecule, H2O 49, within the ligand-binding cavity (Fig. 9B
) that may play an important structural role in LBD interactions (28). Molecular modeling and minimization of the A748T substitution strongly suggests that the substituted threonine acts as an alternative hydrogen bond acceptor for R752 causing a slight displacement of this residue, abolishing the R752-DHT hydrogen bond and disrupting the network of hydrogen bonds focused on H2O 49 (Fig. 9C
). Loss of the hydrogen bond formed between DHT and R752 is consistent with altered ligand binding and dissociation properties observed for A748T.
|
| DISCUSSION |
|---|
|
|
|---|
When expression levels are equalized, the transcriptional activities of ARWT and A748T are comparable at 10-9 M DHT or R1881, but the mutant is less active at suboptimal concentrations of hormone. The hormone-binding affinity of the mutant is normal, but the dissociation rate (and therefore the association rate) of the hormone is accelerated.
Mutants with altered hormone-dependent transactivation and normal hormone-binding affinity with increased rates of dissociation of hormone have been identified in AIS patients (30). AR dimerizes in an antiparallel configuration through N/C-terminal interactions and mutants of this type including V889M and R752Q exhibit reduced interaction in a mammalian two-hybrid assay even at high hormone concentrations (31). In contrast, A748T interacts strongly at high concentrations of hormone, but its capacity to interact is diminished at suboptimal levels of hormone demonstrating that the mutant is capable of normal interactions under some conditions.
Expression of the ARWT hormone-binding domain as a fusion with the GAL-DBD does not reduce the affinity for hormone, although the dissociation rate is elevated 5-fold due to loss of the stabilizing influence of the N terminus (31). In contrast, the affinity of the A748T chimera was substantially reduced. Moreover, the dissociation rate was elevated as much as 10-fold to a rate that no longer allows us to accurately determine the dissociation (T1/2 < 5 min). Neither the V889M mutant nor the R752Q mutant exhibit altered affinity relative to wild type in the context of the GAL-DBD (31). Collectively, these data indicate that not only is the A748T N/C interaction normal, but this interaction is critical to the maintenance of high-affinity hormone-binding in the mutant. A model of the predicted structure of the mutant hormone-binding domain suggests that the mutation would reduce the number of interactions between the hormone and the amino acid side chains, which may account for this difference. As shown by the molecular model of A748T (Fig. 9
), T748 may serve as an alternative hydrogen bond acceptor for R752. The A748T mutation would then disrupt the binding of R752 with the O-3 region of DHT and an ordered H2O molecule within the ligand-binding cavity. Interestingly, an Arg to Gln mutation in the position in rat AR corresponding to Arg752 is responsible for the androgen insensitivity of the testicular feminized rat (44). This mutant exhibits normal hormone binding affinity, but the hormone binding capacity was much lower despite apparently equal expression. The transcriptional activity is decreased correspondingly. The reason for the discrepancy between levels of receptor and hormone binding is unknown. The receptor may have an extremely rapid dissociation rate; alternatively, the bulk of the receptor may be misfolded due to poor interactions with hsp.
The hormone concentration-dependent decrease in A748T activity prompted us to investigate the subcellular location of the mutant AR. Remarkably, despite the normal binding affinity of the full-length A748T, the localization in response to hormone differs substantially from ARWT. The mutant receptor translocates to the nucleus at higher levels of hormone but was predominantly cytoplasmic at 10 pM R1881 or 0.1 nM DHT. Under identical experimental conditions, ARWT was localized to the nucleus at both high and low hormone levels (Fig. 5
). We found no evidence of accelerated nuclear export of A748T (data not shown); rather, the failure of A748T to translocate to the nucleus could be mediated by aberrant ligand induced conformational changes or protein interactions at low hormone that are essential for this process. Utilizing GFPAR fusions, Georget et al. (45) found that the rate of uptake of mutants with elevated dissociation rates was reduced relative to WT and that the effects were more substantial at 10-9 M DHT than at 10-6 M DHT. The extent of nuclear localization at equilibrium correlated with the reduced affinity for hormone. In contrast, A748T exhibits differential nuclear localization at equilibrium despite very similar affinities for R1881 and DHT as those of ARWT. This was reflected both in a somewhat slower rate of nuclear localization as well as in the equilibrium distribution (Figs. 5
and 6
). We prepared GFP-A748T, but found that it was transcriptionally inactive, whereas our GFP-ARWT retained good transcriptional activity (data not shown), so we were unable to measure live kinetics of uptake. The dissociation rate for GFP-ARWT (42 min; Ref. 45) is much faster than that of ARWT as shown here and has been previously reported, suggesting that the addition of GFP may affect N/C-terminal interactions. This further supports the hypothesis that the N/C-terminal interaction is critical for the function of A748T. Although, to our knowledge there are no studies reporting whether AR is transported as a monomer or a dimer, PR dimers are transported. A nuclear localization defective, but dimerization competent mutant of PR is localized to the nucleus upon hormone treatment provided that the cells are cotransfected with a plasmid encoding a nuclear localization competent form of PR (34). There is also evidence that the glucocorticoid receptor is translocated as a dimer (46). We speculate that both molecules of the AR dimer must be occupied with hormone in order for nuclear translocation to occur. At suboptimal hormone levels, ARWT bearing hormone dimerizes and translocates before dissociation of hormone from either subunit. With the greatly accelerated dissociation rate of A748T, one mutant molecule of the dimer may lose hormone before translocation preventing nuclear uptake. Those mutant dimers that are successfully translocated before loss of hormone are rapidly degraded upon dissociation of hormone resulting in minimal nuclear accumulation at low concentrations of hormone. In contrast, at high hormone both ARWT and A748T are fully occupied by hormone; mutant receptor that loses hormone is immediately reoccupied permitting nuclear uptake and localization.
The functional significance of the majority of the mutations identified in prostate cancer remains undefined. The one class of mutations with an obvious function are the mutations found in patients who have received androgen ablation therapy that broaden the specificity of the hormone binding allowing the AR to respond to antiandrogens such as flutamide as well as glucocorticoids as agonists (47, 48). The role of AR mutations in prostate cancer before androgen ablation is less clear. Prostate cancer is initially androgen dependent, but much of the growth-stimulatory effects may be a result of androgen-dependent secretion of growth factors by the stromal cells. In LNCaP prostate cancer cell lines, the androgen-induced growth response is biphasic with low levels being stimulatory, whereas higher levels are inhibitory (49) despite the higher activity of AR as measured by PSA at high hormone. AR expression is lower in poorly differentiated primary prostate tumors than in well differentiated prostate tumors (50), suggesting that lower levels of AR could lead to more aggressive disease in an androgen replete situation. On the other hand, transgenic mice overexpressing AR in prostate epithelial cells exhibit increased epithelial cell growth and prostatic intraepithelial neoplasia (51). Whether rodent and human prostate respond equivalently is unknown. Secretory epithelial cells in humans arise from the basal epithelial cells and do not normally divide. As a result of the decreased stability of A748T, we would predict that AR expression would be low in tumor cells. If there is an optimal level of epithelial cell AR activity, in an androgen-replete patient, the induced AR activity could be in the stimulatory range rather than in the inhibitory range. Until the role of AR in growth and development of normal and malignant prostate epithelial cells is better understood and there are appropriate models to test the functional consequences, it is difficult to predict what role, if any, the A748T mutation played in the development or growth of the prostate cancer in which it was identified.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Constructs
A748T, a somatic mutation of alanine (GCC) to threonine (ACC) at position 748, was previously identified in an individual, with stage D1 prostate cancer, who had not undergone androgen ablation therapy (25). To analyze the functional consequences of the amino acid substitution, alanine was substituted for threonine at amino acid 748 in an AR expression vector using site-directed mutagenesis as previously described (52). The point mutation detected in the patient was incorporated in a primer (A-748-T) corresponding to nucleotides 23852410 of the human AR sequence (53). This primer was synthesized in the sense and antisense orientation (A-748-T-sense and A-748-T-antisense). A-748-T-antisense and a primer of opposite polarity, spanning from nucleotide 1843 to 1868 and containing the only HindIII site within the coding sequence of AR (primer H3S: 1843GGAGATGAAGCTTCTGGGTGTCACT1868) were used to amplify a 0.1-µg sample of the AR cDNA using vent polymerase, and the following amplification program: annealing and extension at 68 C for 1.30 min, denaturation at 95 C for 30 sec for 25 cycles. The resulting band (AR-mut-5') contains a segment of AR spanning nucleotides 18482410, which has incorporated the mutation of interest. 748-T-sense and a primer of opposite polarity containing the last 25 nucleotides of the AR open reading frame and a custom XbaI restriction site [oligo XbaI-AS (54)] used to amplify a 0.1-µg sample of the AR cDNA using vent polymerase, and the following amplification program: annealing and extension at 68 C for 1.30 min, denaturation at 95 C for 30 sec for 25 cycles. The resulting DNA (AR-mut-3') contains a segment of AR spanning nucleotides 23852913, and the mutation of interest. AR-mut-5' and AR-mut-3', which contain a region of homology of 25 nucleotides, were annealed and amplified using oligonucleotides H3S and XbaI-AS. The resulting band was digested with the restriction endonucleases HindIII and XbaI and subcloned in the expression vector CMV-ARWT (53), containing the ARWT cDNA treated with the same restriction endonucleases. The sequence of this mutated AR expression plasmid was confirmed by direct sequence analysis using an Applied Biosystems, Inc. (Foster City, CA) Prism Genotyping Machine, model 310.
The transcriptional activity of ARWT and A748T was measured using the GRE2-E1b-CAT reporter (obtained from Dr. John Cidlowski, NIEHS). This reporter contains two androgen response elements from the tyrosine amino transferase promoter, followed by the adenovirus E1b TATA box fused to the coding sequence of CAT (55).
For the mammalian two-hybrid assays, the carboxyl (C)- and amino (N)-terminal domains were expressed in separate vectors. The C terminus vector, GAL-AR624-919, contains the AR amino acids 624919 fused to amino acids 1147 of the GAL4 DNA binding domain. The N terminus vector, VPAR1-660, contains AR amino acids 1660 fused to amino acids 411456 of the VP-16 transactivation domain. Both vectors were kindly provided by Dr. Elizabeth M. Wilson (University of North Carolina, Chapel Hill, NC) (31). The A748T mutation was recreated in the GAL-AR624-919, by subcloning a TthIII/XbaI fragment of the CMV-A748T into the original construct. In these experiments, the 17merLUC reporter containing the DNA binding sites for the GAL DNA binding domain fusion protein (56) was cotransfected into the cells. For the coactivation experiment, the pCR3.1-TIF2 construct (33), originally cloned from the pG5-TIF2 construct (32) that was obtained from Dr. Pierre Chambon (Strasbourg, France), was cotransfected with GAL-AR624-919 or GAL-A748T624-919.
For the in vitro translation experiments that require a plasmid with a T7 promoter, ARWT in a pCR3.1 vector was used. The A748T mutation was introduced into this pCR3.1-ARWT vector by subcloning a XmaI fragment containing the mutation into the wild-type pCR3.1-ARWT vector.
The ligand-binding domains of all A748T expression vectors were sequenced to ensure the presence of the specific mutation and the absence of random mutations.
Cell Culture
Monkey kidney COS-1 cells (ATCC, Manassas, VA) were maintained in DMEM in the presence of 5% fetal calf serum, 100 µg/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Inc., Gaithersburg, MD). Twenty-four hours before transfection, the cells (plated at a density of 90,000 cells per well of a six-well plate) were transferred to the appropriate medium containing 5% charcoal-stripped fetal bovine serum and maintained in a 37 C humidified incubator with 5% CO2.
Transient Transfections
Nonrecombinant adenovirus coupled to poly-L-lysine was used as a carrier to transiently transfect COS-1 cells with plasmid DNA (12, 57, 58) for both the AR-dependent transactivation studies and the two hybrid studies. In brief, the indicated amounts of receptor and reporter plasmids were incubated at room temperature for 30 min with modified adenovirus at a multiplicity of infection of 250500 virus particles per cell. Additional poly-L-lysine (1.3 µg/µg plasmid DNA) was added to the plasmid-DNA mixture and incubated at room temperature for 30 min. The virus-DNA complexes were added to cells in serum-free medium. After 2 h, medium-containing serum was added to provide a final concentration of 5% charcoal-stripped serum. Twenty-four hours post transfection, cells were treated with ethanol or DMSO vehicle or various doses of hormones, or GA (1 µg/ml). Forty-eight hours post transfection, cells were harvested and assayed for reporter activity and/or receptor expression.
Transcriptional Activation Assays
Forty-eight hours post transfection, cells were harvested in TEN buffer (40 mM Tris; 1 mM EDTA; 150 mM NaCl, pH 8.0). Cell pellets were resuspended in high salt buffer (0.4 M NaCl and 0.25 M Tris, pH 7.5) and cellular proteins were extracted by three freeze-thaw cycles. Protein concentrations were measured by a modified Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA). Equal amounts of protein or equal volumes of each sample were incubated with [3H] chloramphenicol (20 µCi/µmol specific activity) and butyryl CoA (59). After 1560 min of incubation in a 37 C water bath, acylated chloramphenicol was extracted with a 2:1 mixture of 2, 6, 10, 14 tetramethylpentadecane to xylenes and counted in a Beckman scintillation counter. For the luciferase assay, transfected cells were harvested in PBS, resuspended in lysis buffer (Promega Corp., Madison, WI), and assayed for luciferase activity as recommended by the manufacturer. Results are reported as relative lights units. Experimental conditions were optimized to result in equal levels of ARWT and A748T expression. Based on these parameters, the receptor activity was normalized to receptor expression levels.
Immunoblot Analysis
Equal volumes of high salt protein extracts from transiently transfected cells were electrophoretically separated on 7.5% sodium dodecyl sulfate (SDS) polyacrylamide gels and transferred to a nitrocellulose membrane using a Bio-Rad semi-dry apparatus. Expression of wild-type and mutant receptors was detected using a mouse monoclonal AR antibody, AR441 (directed against amino acids 301317; Ref. 58), a secondary rabbit antimouse IgG (Zymed Laboratories, Inc., San Francisco, CA), and a tertiary antirabbit horseradish peroxidase antibody (Amersham Pharmacia Biotech, Arlington Heights, IL). The protein bands were detected using an electrochemiluminescence kit (Amersham Pharmacia Biotech) and visualized by autoradiography. Densitometry was used to quantify the AR expression levels.
Hormone-Binding and Dissociation Assays
Whole cell hormone-binding and dissociation assays (30) were performed in COS-1 cells transiently transfected with 10 ng ARWT or 100 ng A748T. For studies of steroid binding affinity measurements, 5% stripped fetal calf serum DMEM was replaced with serum-free medium 48 h post transfection. Cells were incubated with 0.15 nM [3H] R1881 for 2 h at 37 C. The cells were then washed three times with ice-cold PBS to remove any unbound hormone. Bound hormone was extracted from the cells using 100% ice-cold ethanol, and counts were measured in the Beckman scintillation counter. Specific binding was calculated by subtracting nonspecific counts of mock-transfected cells from counts of receptor-transfected cells. Scatchard analysis was used to determine the binding affinity.
For the dissociation assays, transfected cells in serum-free medium were treated with 5 nM [3H] R1881 or [3H] DHT in the absence or presence (control) of 100-fold molar excess of unlabeled hormone at 37 C. After 2 h, medium was replaced with medium containing 500-fold molar excess of unlabeled R1881 or DHT. At specific time points ranging from 03 h, cells were washed twice in ice-cold PBS and bound counts were extracted with ethanol. Specific binding was calculated by subtracting the binding in the control samples (unlabeled added with labeled hormone) from the radiolabeled samples (unlabeled hormone added only after 2-h incubation with labeled hormone). The log of bound counts was plotted vs. time to determine the time required for half of the bound counts to dissociate (t1/2).
Subcellular Localization
COS-1 cells were plated on lysine-conjugated coverslips in six-well plates at a density of 90,000 cells per well. Cells were transfected with ARWT or A748T and treated with vehicle or hormone 24 h later. Forty-eight hours post transfection, cells were fixed using 100% ethanol at -20 C for 10 min (Fig. 5
, A and B). A 1% BSA/PBS solution was used to block nonspecific binding. The cells were then incubated with AR antibody, AR441, followed by a fluorescein-conjugated goat-antimouse secondary antibody (Southern Biotechnology Associates, Birmingham, AL). A Zeiss Axioscop microscope (Carl Zeiss, Jena, Germany) was used to view images at x2040. For the experiments in Figs. 5C
and 6
, the cells were fixed in 4% formaldehyde before detection of AR using AR441 and fluorescein-conjugated goat-antimouse secondary antibody as described previously (58). This procedure is more sensitive than the ethanol fixation protocol. Cells were visualized using a Zeiss Axioplan microscope A. All expressing AR cells (
400 cells) were evaluated for cellular compartmentalization of the receptor. Captured images were processed using Adobe Photoshop 4.0.
Partial Trypsinization of in Vitro Translated AR
The pCR3.1-AR and pCR3.1-A748T plasmids (1 µg) were in vitro transcribed and translated using the TNT Quick Coupled Transcription/Translation System nuclease-treated rabbit reticulocyte kit (Promega Corp.) in the presence of L-[35S]-methionine (Amersham Pharmacia Biotech). Samples were incubated at 30 C for 90 min. Two microliters of the labeled receptor translation mixture were then preincubated with or without 10 nM R1881 for 30 min at 4 C. For partial trypsinization, 5 µl trypsin (40 µg/ml) dissolved in water (Promega Corp.) was added to the receptor and incubated at room temperature for 15 min (36). SDS loading buffer was added to the in vitro translated product, and the samples were boiled for 2 min. Samples were then electrophoretically separated on a 12.5% SDS-polyacrylamide gel. After the gel was vacuum dried, the bands were detected by autoradiography.
Stability Assays
Twenty-four hours after transfection, COS-1 cells were treated with or without hormone for 2 h in the 37-C incubator. Cycloheximide (50 µg/ml) was then added to the cells to prevent de novo protein synthesis. Cells were harvested in TEN at time points ranging from 09 h. High salt extracts of the samples were run on 7.5% polyacrylamide gels, and AR was detected using the AR monoclonal antibody AR441 as previously described.
Homology Model
The crystal structure for the rat AR complexed with DHT was retrieved from the Protein Database (PDB) using PDBid 1I37. The alanine residue at position 748 was mutated to threonine using the graphical interface SPDV3.7 (60). Minimization of the resulting structure was initially performed using the molecular mechanics program GROMOS (61) with local constraints set within 5 Å of the threonine residue, and a second minimization run with harmonic restraints. The initial mutated structure was additionally analyzed using the Sculpt molecular mechanics suite of programs (62) and simulated annealing using Biomers microcanonical (constant particle number, volume, and total energy) ensemble (63). Maximum temperature was 300 K, heating and equilibration were set for 1 ps and cooling was set for 4 ps.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: AIS, Androgen insensitivity syndrome; AR, androgen receptor; ARWT, AR wild type; C, carboxyl-terminal domain; CAT, chloramphenicol acetyl transferase; DHT, dihydrotestosterone; GA, geldanamycin; GAL-DBD, DNA binding domain of galactosidase; GRE, glucocorticoid response element; hsp, heat shock proteins; LBD, ligand binding domain; 17merLUC, galactosidase response element luciferase reporter; N, amino-terminal domain; PR, progesterone receptor; PSA, prostate-specific antigen; SDS, sodium dodecyl sulfate; TIF2, transcription intermediary factor 2; VP-16, VP 16 protein of the herpes simplex virus.
Received for publication October 22, 2001. Accepted for publication August 27, 2002.
| REFERENCES |
|---|
|
|
|---|
and coactivator turnover and for efficient estrogen receptor-
transactivation. Mol Cell 5:939948[CrossRef][Medline]
. Mol Cell Endocrinol 173:6373[CrossRef][Medline]
,25-dihydroxyvitamin D3 actions in LNCaP human prostate cancer cells are androgen dependent. Endocrinology 138:32903298
nwhite/BNURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
O. A. O'Mahony, M. P. Steinkamp, M. A. Albertelli, M. Brogley, H. Rehman, and D. M. Robins Profiling Human Androgen Receptor Mutations Reveals Treatment Effects in a Mouse Model of Prostate Cancer Mol. Cancer Res., November 1, 2008; 6(11): 1691 - 1701. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. U. Agoulnik, A. Vaid, W. E. Bingman III, H. Erdeme, A. Frolov, C. L. Smith, G. Ayala, M. M. Ittmann, and N. L. Weigel Role of SRC-1 in the Promotion of Prostate Cancer Cell Growth and Tumor Progression Cancer Res., September 1, 2005; 65(17): 7959 - 7967. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Culig, H Steiner, G Bartsch, and A Hobisch Mechanisms of endocrine therapy-responsive and -unresponsive prostate tumours Endocr. Relat. Cancer, June 1, 2005; 12(2): 229 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamamoto, N. K. Shevde, A. Warrier, L. A. Plum, H. F. DeLuca, and J. W. Pike 2-Methylene-19-nor-(20S)-1,25-dihydroxyvitamin D3 Potently Stimulates Gene-specific DNA Binding of the Vitamin D Receptor in Osteoblasts J. Biol. Chem., August 22, 2003; 278(34): 31756 - 31765. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |