help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2001-0281
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by James, A. J.
Right arrow Articles by Weigel, N. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by James, A. J.
Right arrow Articles by Weigel, N. L.
Molecular Endocrinology 16 (12): 2692-2705
Copyright © 2002 by The Endocrine Society

A Novel Androgen Receptor Mutant, A748T, Exhibits Hormone Concentration-Dependent Defects in Nuclear Accumulation and Activity Despite Normal Hormone-Binding Affinity

Alaina J. James, Irina U. Agoulnik, Jonathan M. Harris, Grant Buchanan, Wayne D. Tilley, Marco Marcelli, Dolores J. Lamb and Nancy L. Weigel

Department of Molecular and Cellular Biology (A.J.J., I.U.A., M.M., D.J.L., N.L.W.), Scott Department of Urology (D.J.L.), and Department of Medicine (M.M.), Baylor College of Medicine, Houston, Texas 77030; School of Life Science (J.M.H.), Queensland University of Technology, Brisbane, Queensland 4001, Australia; and Flinders Cancer Centre (G.B., W.D.T.), Flinders University and Flinders Medical Centre, Adelaide SA 5042, Australia

Address all correspondence and requests for reprints to: Nancy L. Weigel, Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030. E-mail: nweigel{at}bcm.tmc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Functional analysis of androgen receptor (AR) gene mutations isolated from prostate cancer has led to the identification of residues that play important roles in the structure and function of the receptor. Here we report the characteristics of a novel AR mutation A748T located in helix 5 of the ligand-binding domain, which was identified in metastatic prostate cancer. Despite a normal hormone-binding affinity, A748T causes hormone concentration-dependent defects in nuclear accumulation and transcriptional activation. Moreover, when equivalent amounts of DNA are transfected, the mutant is expressed at much lower levels than the wild-type AR (ARWT). Treatment with geldanamycin to disrupt receptor-heat shock protein complexes rapidly decreases the levels of ARWT but not A748T, suggesting that the lower expression and rapid degradation rate of A748T is due to weaker interactions with heat shock proteins. Further analysis revealed that hormone dissociates from A748T five times faster than from ARWT. Loss of the ability to form stable amino/carboxyl-terminal interactions causes accelerated dissociation rates in some AR mutants. However, A748T exhibits normal amino/carboxyl-terminal interactions at high hormone concentrations, suggesting that the mutation alters interactions with ligand. Consistent with this conclusion, our structural model predicts that A748T disrupts crucial contact points with ligand, thereby altering the conformation of the ligand-binding domain.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE ANDROGEN RECEPTOR (AR), a member of the steroid receptor family of hormone-activated transcription factors, plays a major role in the normal growth and development of the prostate, as well as in prostate carcinogenesis. Androgens activate the AR in the prostate stroma to secrete growth factors that stimulate the normal growth of the prostate epithelial cells through a paracrine pathway (1, 2, 3). Additionally, the prostate epithelial cells express AR, which may also contribute to epithelial cell growth. Androgen ablation results in programmed cell death of prostate epithelial cells leading to the involution of the gland (4). Androgens also regulate differentiation of the prostate epithelial cells by activating the AR to function as a transcriptional modulator of target genes such as prostate-specific antigen (PSA), a commonly used marker for the presence and progression of prostate tumors (5, 6).

Androgens continue to regulate the growth of malignant prostate epithelial cells as documented by the initial growth arrest of 70% of metastatic prostate cancer tumors by androgen ablation (7). Eventually, prostate cancer develops adaptive mechanisms to grow in the presence of low androgens referred to as androgen-independent or recurrent prostate cancer (reviewed in Ref. 8). In some cases of androgen-independent growth, the AR may continue to play a role. Altered activation of AR can occur through the following pathways: 1) ligand-independent activation by growth factors and/or kinases (9, 10, 11, 12, 13, 14, 15); 2) AR amplification (16, 17, 18, 19); and 3) AR mutations (20).

Germline AR gene mutations give rise to conditions such as Kennedy’s disease (also known as spinobulbar muscular atrophy) and androgen insensitivity syndrome (AIS). Because the genomic locus of AR is on the X chromosome, AR mutations in men with a normal karyotype (46 X, Y) have a dominant effect. In Kennedy’s disease, expansion of the polymorphic-glutamine tract in the AR amino terminus results in the formation of nuclear inclusions and inactivation of the receptor causing an adult onset spinobulbar muscular atrophy (21, 22). In AIS, mutations and deletions in the AR gene cause minimal to complete loss of AR activity that result in various phenotypic manifestations ranging from complete testicular feminization to a fertile but undervirilized male (reviewed in Ref. 23).

Although a significant number of somatic AR gene mutations have been identified in metastatic prostate cancer, the frequency of this occurrence and its functional consequences are controversial. Unlike the mutations found in Kennedy’s disease and AIS, mutations identified in prostate cancer result in mutant AR receptors with either increased activity due to altered receptor ligand specificity or decreased activity due to altered hormone interactions or decreased DNA binding (reviewed in Ref. 24). The characterization of these mutations has significantly contributed to our understanding the structural and functional domains of the AR.

We report the detailed functional characterization of an AR mutation that occurred in a patient with untreated metastatic prostate cancer. This somatic mutation of alanine to threonine at position 748 (A748T) shares several characteristics with a subset of AIS AR mutants but has the novel phenotype of decreased receptor stability in both the absence and presence of hormone. In addition, despite a normal binding affinity, A748T exhibits hormone concentration-dependent defects in nuclear translocation and consequent transcriptional activation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The somatic mutation of alanine to threonine at 748 was identified in a lymph node metastasis of prostate cancer and reported by our laboratories (25). Residue 748, located in helix 5 of the ligand-binding domain, is conserved as an alanine in the members of the classic steroid receptor family (estrogen receptor, glucocorticoid receptor, and mineralocorticoid receptor) with the exception of the progesterone receptor (PR), in which the residue is a glycine (reviewed in Ref. 26). Based on the x-ray crystal structure of the ligand-binding domain, position 748 lies in proximity to the O-3 region of the synthetic androgen R1881 and the natural ligand dihydrotestosterone (DHT) but does not directly interact with it (27, 28).

A748T Receptor Expression Is Much Lower than ARWT
To determine the effect of the A748T mutation on receptor-mediated transcriptional activation, COS-1 cells were transiently transfected with cytomegalovirus (CMV)-ARWT or CMV-A748T expression plasmids and the glucocorticoid response element (GRE)2-E1b-chloramphenicol acetyl transferase (CAT) reporter and treated with 10-9 M R1881. Receptor expression of R1881-treated samples was determined by Western analysis of parallel samples. Using equimolar concentrations of plasmid DNA for ARWT and A748T, we found that A748T transcriptional activity was much lower than ARWT, but the expression level was also substantially reduced (Fig. 1AGo). This finding was reproduced with several independent preparations of ARWT and A748T expression plasmids and in different cell types including HeLa and DU 145 (data not shown) and using other expression plasmids (pCR3.1-ARWT and pCR3.1-A748T, data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. AR Mutation, A748T, Identified in Untreated Metastatic Prostate Cancer Exhibits Decreased Receptor Expression Level

A, COS-1 cells were transiently transfected with 0.1 ng ARWT or A748T expression plasmid in the presence of 0.5 µg of the GRE2-E1b-CAT reporter plasmid. B, Cells were transfected with 0.1 ng ARWT or 1 ng A78T in the presence of 0.5 µg of the GRE2-E1b-CAT. Cells were treated with 10-9 M R1881 or vehicle for 24 h and then harvested, and CAT assays were performed on samples containing equal amounts of total protein. The error bars represent the SEM of triplicate samples. Receptor expression level in parallel R1881-treated samples was detected by Western analysis using the AR antibody AR441 and is shown below the corresponding bars.

 
To compensate for the difference in expression levels, a 10-fold excess of A748T (1 ng) relative to ARWT (0.1 ng) was transfected into the COS-1 cells. Under these conditions, the expression level in the presence of R1881, as well as the transcriptional activity of A784T, was comparable with that of ARWT in the presence of 10-9 M R1881 (Fig. 1BGo). To compare the function of A748T to ARWT, all subsequent experiments, unless indicated, were performed using a 10-fold higher amount of A748T relative to ARWT to produce equal receptor levels.

The Transcriptional Activity of A748T Is Much Less than ARWT at Subsaturating Levels of R1881 and DHT and at Physiological Levels of Testosterone
At comparable levels of ARWT and A748T expression, the transcriptional activity was next measured as a function of hormone concentration. Although the activities of ARWT and A748T were similar when treated with concentrations of R1881 or DHT equal to or higher than 10-9 M, the activity of A748T was substantially lower than ARWT in COS-1 cells treated with 10-10 M R1881 or 10-10 M DHT (Fig. 2Go, A and C). The decrease in A748T activity was also observed in the prostate cancer cell line, PC-3 (data not shown). As shown by the parallel Western analysis of the samples treated with the various concentrations of R1881 (Fig. 2BGo) and DHT (data not shown), A748T is less stabilized by hormone treatment than ARWT, but the difference in expression at lower levels of hormone is insufficient to account for the differences in transcriptional activity. In the presence of testosterone, a somewhat weaker androgen than DHT or R1881, there was a more dramatic difference in A748T activity compared with ARWT (Fig. 2DGo). The level of A748T transcriptional activity was only slightly above basal level (vehicle-treated samples) at concentrations as high as 10-7 M testosterone in COS-1 cells, whereas ARWT exhibited very high levels of activity. As previously reported and as shown in Fig. 2Go, B and E, ARWT receptor levels increase through stabilization of hormone-bound receptor (29). Interestingly, although R1881 stabilizes A748T somewhat (Fig. 2BGo), the mutant receptor levels were not increased upon testosterone treatment (Fig. 2EGo). This finding is consistent with the relatively low level of A748T transcriptional activation and suggests a difference in receptor-ligand interaction.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. A748T Exhibits Decreased Transcriptional Activation at Low Levels of Hormone

COS-1 cells were cotransfected with 1.0 ng ARWT or 10 ng A748T and 0.5 µg of the GRE2-E1b-CAT reporter plasmid. Twenty-four hours later, the cells were treated with concentrations of R1881 (A and B), DHT (C), or testosterone (Tes) (D and E) ranging from 10-11 to 10-7 M or ethanol control. After an additional 24 h, cells were harvested and transcriptional activation was measured. Experiments were performed in triplicate with the error bar representing the SEM of the triplicate samples.

In panels B and E, parallel samples from panels A and D, respectively, were separated on a 7.5% polyacrylamide gel and the receptor expression levels were detected by Western analysis using the AR antibody AR441.

 
The Affinity of A748T for DHT and R1881 Is Comparable to ARWT, but its Dissociation Rate Is Accelerated
To determine whether the decrease in transcriptional activity of A748T was due to a change in hormone-binding affinity, whole cell hormone-binding assays were performed using [3H] R1881 or [3H] DHT at concentrations ranging from 0.1–5 nM. In each case, the binding affinity of A748T (0.22 nM for R1881 and 1.2 nM for DHT), as calculated by Scatchard analysis, was similar to ARWT (0.14 nM for R1881 and 0.6 nM for DHT) (Fig. 3Go, A and B).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. A748T Exhibits a Similar Binding Affinity but a Much Faster Dissociation Rate than ARWT

In panel A, COS-1 cells were transiently transfected with 10 ng ARWT, 100 ng A748T, or mock transfected. Forty-eight hours post transfection, cells were placed in serum-free DMEM. For the whole cell hormone-binding affinity assay, cells were treated with concentrations of [3H] R1881 (A) or [3H] DHT (B) ranging from 0.1–5 nM. Bound hormone was extracted and measured using a Beckman scintillation counter. Counts in the mock-transfected samples were subtracted from total bound counts. The binding affinity was calculated by Scatchard analysis.

For the dissociation assays in panels C and D, the transfected cells were treated with 5 nM [3H] R1881 or [3H] DHT, respectively. Control samples were incubated with 5 nM [3H] R1881 and [3H] DHT in the presence of 100x molar excess unlabeled hormone. After 2 h, cells were washed, and both sets of samples were placed in medium containing 500-fold molar excess of R1881 or DHT. At the indicated time points, bound hormone was extracted and counted. Nonspecific counts of the control samples were subtracted from bound counts of radiolabeled samples. Shown here is a plot of log bound counts as a function of time.

 
Several AR mutations previously identified in AIS patients, have normal binding affinities but exhibit decreased transcriptional activity at low levels of hormone and an increased rate of hormone dissociation (30). To determine whether A748T exhibits a similar defect, the dissociation rate of A748T was measured. As shown in Fig. 3Go, C and D, the dissociation rate of A748T (t1/2 ~ 40 and 35 min, for R1881 and DHT, respectively) is approximately five times faster than ARWT (t1/2 of 190 min for both R1881 and DHT). Because A748T binds hormone with the same affinity as ARWT, A748T must also have a proportional increase in hormone association rate relative to the increased dissociation rate to maintain normal equilibrium binding affinity. We were unable to detect [3H] testosterone binding to A748T using these assays; this finding suggests that the affinity and/or dissociation are substantially altered by this mutation (data not shown).

A748T Exhibits Decreased N/C Interaction Relative to ARWT only at Low Hormone Concentrations
Mutant ARs with a rapid dissociation rate frequently exhibit a decrease in the antiparallel interaction of the amino and carboxyl termini of AR, which contributes to receptor dimerization (30, 31). This form of dimerization, termed N/C interaction, was measured using a mammalian two-hybrid assay in which the mutant or wild-type carboxyl terminus (amino acids 624–919) fused to the galactosidase DNA binding domain (GAL-DBD) fragment was cotransfected with the amino terminus (amino acids 1–660) fused to the VP 16 protein of the herpes simplex virus (VP-16) activation domain and the reporter plasmid, galactosidase response element luciferase reporter (17merLUC). In the presence of saturating hormone concentrations (10-8 M DHT), neither the GAL-ARWT624-919 construct, the GAL-A748T624-919, nor the VP-16-ARWT1-660 construct alone induced activity above vehicle-treated samples cotransfected with GAL-ARWT624-919 and VP-16-ARWT1-660 (data not shown). The N/C interactions of GAL-ARWT624-919 and GAL-A748T624-919 were comparable at 10-8 M DHT (Fig. 4AGo). However, at 10-9 M DHT, the N/C interaction of GAL-A748T624-919 was significantly less than ARWT, showing that GAL-A748T624-919 was less capable of forming dimers at low levels of hormone. The hormone concentrations for optimal ARWT N/C interaction are considerably greater than the concentrations required for transcriptional activity, consistent with previously published data, and may be associated with a loss of contact points in the separation of the two termini (30, 31).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. GAL-A748T624-919 Exhibits Decreased N/C Interaction, TIF2 Coactivation, and Hormone-Binding Kinetics Relative to GAL-ARWT624-919

A, COS-1 cells were transfected with 10 ng GAL-ARWT624-919 or 10 ng GAL-A748T624-919 and 10 ng VP16-AR1-660 in the presence of 0.5 µg 17merLUC reporter. Cells were treated with ethanol control or concentrations of DHT ranging from 10-10 to 10-8 M. Twenty-four hours later, cells were harvested and luciferase activity was measured. In the presence of 10-8 M DHT, neither the GAL-ARWT624-919 construct nor the VP-16-ARWT1-660 construct alone induced activity above vehicle-treated samples cotransfected with GAL-ARWT624-919 and VP-16-ARWT1-660 (data not shown). B, COS-1 cells were transfected with 10 ng GAL-ARWT624-919 or 10 ng GAL-A748T624-919 and 100 ng pCR3.1 TIF2 expression plasmids in the presence of the 17merLUC reporter plasmid. Cells were treated with ethanol control or concentrations of DHT ranging from 10-10 to 10-8 M. Twenty-four hours later, cells were harvested and luciferase activity was measured. In the presence of saturating hormone concentrations (10-8 M DHT), neither the GAL-ARWT624-919 construct nor the pCR3.1 TIF2 construct alone induced activity above vehicle-treated samples cotransfected with GAL-ARWT624-919 and pCR3.1 TIF2 (data not shown). C, COS-1 cells were transiently transfected with 1 µg of GAL-ARWT624-919, 1 µg of GAL-A748T624-919 (see inset graph), or mock transfected. Forty-eight hours post transfection, cells were placed in serum-free DMEM. For the whole cell hormone-binding affinity assay, cells were treated with concentrations of [3H] R1881 ranging from 0.1–5 nM for 2 h. Bound hormone was extracted and measured using a Beckman scintillation counter. Counts in the mock-transfected samples were subtracted from total bound. The binding affinity was calculated by Scatchard analysis. D, COS-1 cells were transiently transfected with 1 µg CMW-ARWT (black bars), 1 µg GAL-ARWT624-919 (gray bars), or 1 µg GAL-A748T624-919 (white bars) and treated with 5 nM [3H] R1881. Control samples were incubated with 5 nM [3H] R1881 in the presence of 100-fold molar excess unlabeled hormone. After 2 h, cells were washed and both sets of samples were placed in medium containing 500-fold molar excess R1881 or DHT. At the indicated time points, bound hormone was extracted and counted. Nonspecific counts from control samples were subtracted from bound counts of radiolabeled samples. Time point 0 min was set at 100% for each sample.

 
To determine whether the mutation also altered functional interactions of the C terminus with coactivators, GAL-ARWT624-919 or GAL-A748T624-919 was cotransfected with the p160 coactivator transcription intermediary factor 2 (TIF2) (32, 33) and 17merLUC. At 10-8 M DHT, the level of coactivation was comparable with ARWT; however, at 10-9 M DHT the level of TIF2-mediated coactivation of GAL-A748T624-919 was much lower than GAL-ARWT624-919 (Fig. 4BGo). At saturating hormone levels, neither GAL-ARWT624-919, GAL-A748T624-919 nor the TIF2 alone induced activity above the no-hormone control (data not shown).

To investigate whether the decrease in N/C interaction and TIF2 coactivation was a result of a change in the hormone-binding properties of the GAL-A748T624-919, we performed whole cell binding and dissociation assays. Interestingly, the apparent binding affinity for [3H] R1881 of GAL-A748T624-919 (1.4 nM) was approximately 10-fold less than GAL-ARWT624-919 (0.13 nM) (Fig. 4CGo). As shown in Fig. 4DGo, this decrease in binding affinity may be a result of the accelerated dissociation of hormone from GAL-A748T624-919. Nearly 75% of the hormone dissociated within 5 min from GAL-A748T624-919, whereas 30% of the hormone dissociated from GAL-ARWT624-919. The experiments in Fig. 4Go, A and B, showing equivalent interaction at 10-8 M DHT or R1881 suggest that the two hormone binding domains are expressed at comparable levels, but measurement of receptor levels by Scatchard analysis (Fig. 4CGo) implies that the mutant is expressed at one third the level of the GAL-ARWT624-919. This discrepancy is most likely due to the extremely fast dissociation rate of the mutant (Fig. 4DGo). Based on the observation that 75% of the measurable bound hormone is lost after 5 min of incubation with radio-inert steroid, it is likely that some significant portion of the bound hormone is lost during the processing of the cells (although the cells were washed with ice cold PBS and extracted as quickly as possible) leading to an apparent lower level of receptor. These findings suggest that in the context of just the ligand-binding domain, the A748T mutation has an intrinsic effect on the hormone-binding kinetics and affinity that contributes to the observed decrease in N/C interaction of GAL-A748T624-919 at hormone concentrations lower than 10-8 M.

A748T Nuclear Translocation Is Compromised at Low Levels of Hormone
Studies of PR translocation from the cytoplasm to the nucleus utilizing translocation competent PR and a mutant that is unable to translocate on its own, but can dimerize, suggest that PR is translocated as a dimer (34). Although it has not been determined whether AR is translocated as a monomer or dimer, subcellular localization experiments were performed to determine the effect of the A748T mutation on nuclear transport of the mutant receptor. In the absence of hormone, ARWT and A748T were predominantly cytoplasmic and translocated to the nucleus at physiological hormone levels (Fig. 5AGo). However at the hormone concentrations (10-11 M R1881, 10-9 M testosterone and 10-10 M DHT) at which the activity of A748T was significantly less than ARWT, A748T appeared to be predominantly localized to the cytoplasm whereas ARWT translocated to the nucleus (Fig. 5BGo). To examine this finding more closely and to quantify these results, cells transfected with ARWT or A748T were treated with the indicated hormones, fixed, stained, and analyzed for receptor distribution. Figure 5CGo shows the variation in pattern of expression (predominantly cytoplasmic or predominantly nuclear). To quantify receptor distribution, approximately 400 AR-expressing cells were scored as predominantly cytoplasmic vs. predominantly nuclear, and the percentage of cells exhibiting predominantly nuclear distribution was plotted. Figure 5DGo shows that nearly 100% of cells expressing ARWT exhibit predominantly nuclear localization in response to hormone concentrations as low as 10 pM R1881, 1 nM testosterone, or 0.1 nM DHT. In contrast, less than 20% of the A748T cells exhibit predominantly nuclear localization at these concentrations, although the receptor is predominantly nuclear at higher concentrations of hormone. Figure 6Go shows the kinetics of nuclear localization in response to 1 nM and 10 pM R1881. Translocation of ARWT is detectable at 5 min and is complete by 20 min. At 10 pM R1881 nuclear translocation of ARWT is slower, but reaches a maximum between 1 and 4 h. In contrast, there is minimal nuclear localization of A748T at 10 pM R1881; even at 4 or 24 h, the percent of cells with predominantly nuclear localization is no more than 20%. Although this pattern might have been due to rapid export of A748T, we found no supporting evidence of this functional change. Treating ARWT and A748T with high concentrations of hormone to cause nuclear translocation followed by androgen removal for 12 h in the presence of cycloheximide did not result in the cytoplasmic relocation of either the wild-type or mutant receptor (data not shown). These data suggest that at the aforementioned hormone concentrations, A748T exhibits a significant decrease in nuclear translocation rendering it less able to activate transcription.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 5. A748T Is Localized to the Cytoplasm at Low Levels of Hormone

COS-1 cells were transfected with 1 ng ARWT or 10 ng A748T. A, Cells were treated with ethanol control or R1881 concentrations of 10-9 to 10-11 M. B, Cells were treated with ethanol control, 10-11 M R1881, 10-9 M testosterone (Tes), or 10-10 M DHT. After 24 h, cells were fixed and probed with the AR441 antibody followed by a FITC-conjugated goat antimouse secondary antibody. Cells were viewed using the Zeiss microscope and images were captured in Adobe Photoshop 4.0. C, Cells were transfected as in A and B but were fixed with 4% formaldehyde before processing for detection of AR. D, Transfected cells were treated with the indicated concentrations of hormone for 16 h, fixed with formaldehyde, and processed to detect AR. Approximately 400 cells in each treatment group were scored as mostly cytoplasmic or mostly nuclear, and the percentage of cells with mostly nuclear AR was plotted.

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. A748T Translocates to the Nucleus More Slowly than ARWT

Cells were transfected with ARWT or A748T. Twenty-four hours after transfection, the indicated hormones were added and cells fixed and counted at the indicated time points. A, Cells were treated with 1 nM R1881. B, Cells were treated with 10 pM R1881.

 
A748T Exhibits Decreased Receptor Stability in the Presence and Absence of Hormone
The mutant receptor characteristics of decreased transcriptional activation, N/C interaction and nuclear translocation as well as rapid hormone dissociation suggest that the A748T ligand-binding domain does not form the stable receptor-ligand complex characteristic of ARWT. To test this hypothesis, in vitro translated and [S35] radiolabeled ARWT and A748T were treated with trypsin in the presence and absence of hormone. In the absence of hormone, neither the ligand-binding domain of A748T nor ARWT was protected from trypsin digestion. In the presence of hormone, a 29-kDa fragment of ARWT was protected from trypsinization (Fig. 7Go). This 29-kDa fragment has been shown previously to contain the holo-ligand binding domain (LBD) folded in a stable conformation (35, 36, 37). In contrast to ARWT, A748T did not form a comparable stable receptor-ligand conformation as shown by the absence of the 29-kDa fragment in the presence of 10-8 M R1881.



View larger version (72K):
[in this window]
[in a new window]
 
Figure 7. A748T Does Not Form a Stable Hormone-Receptor Complex Resistant to Trypsin Digestion

In vitro stability experiments were performed using 1 µg ARWT or 1 µg A748T expression vectors for in vitro translation and [35S]-labeling receptor products. Two microliters of each sample were incubated in the presence or absence of 10-8 M R1881. After samples were partially trypsinized using 5 µl trypsin (40 µg/ml) for 15 min at room temperature, samples were run on a 12.5% polyacrylamide gel, and bands were detected by autoradiography.

 
To determine whether A748T similarly exhibits decreased stability in vivo, cycloheximide experiments were performed. As shown in Fig. 8AGo, A748T (t1/2~ 3 h) receptor levels decreased more quickly than ARWT (t1/2 ~10 h) in the presence of 1 nM DHT, results that correspond to the previously reported ARWT receptor level half-life (29, 30).



View larger version (48K):
[in this window]
[in a new window]
 
Figure 8. A748T Exhibits Decreased Stability and Is Not Affected by GA Treatments

A and B, Stability experiments were performed in COS-1 cells that were transfected with 1 ng ARWT or 10 ng A748T. Cells were treated with 10-9 M DHT (A) or ethanol vehicle (B) for 24 h. To prevent de novo protein synthesis, cells were treated with 50 µg/ml cycloheximide. Cells were then harvested at 0, 3, 6, and 9 h after the initiation of cycloheximide treatment. The protein samples were run on the 7.5% polyacrylamide gel for Western analysis. The receptor expression levels were detected using the AR441 antibody and quantified using densitometry. C, COS-1 cells were transfected with 1 ng ARWT or 10 ng A748T. Forty-eight hours later, cells were treated with 1 µM GA (C) and harvested at 0, 30, and 60 min. The protein samples were run on a 7.5% polyacrylamide gel for Western analysis and receptor expression levels detected using the AR441 antibody.

 
As previously mentioned, experiments with full-length receptor were performed using 10-fold higher A748T relative to ARWT to achieve comparable expression levels. This finding suggested that A748T was not only less stable in the presence of androgens but also in the absence of androgens. As shown in Fig. 8BGo, A748T receptor levels (t1/2~ 1 h) decreased significantly faster than ARWT (t1/2~ 3 h) in the absence of hormone—a novel phenotype for an AR mutation identified in metastatic prostate cancer.

A748T Does Not Form Stable Interactions with Heat Shock Protein (hsp) Complexes
The decreased stability of A748T in the absence of hormone suggested that the mutation potentially alters interactions with hsp, which play a pivotal role in the folding the ligand-binding domain for stable hormone-binding. It has been shown that the hsp90 interaction with the rat AR requires the region that contains A748 (38, 39); therefore, we asked how blocking the formation of the mature receptor-hsp complex with geldanamycin (GA) (40) would affect A748T receptor levels compared with the ARWT. We hypothesized that the decrease in A748T receptor stability in the absence of hormone was due to decreased stability of interactions with hsp complexes. Thus, treatment with GA would have little to no effect on A748T but should decrease ARWT receptor levels. As predicted, in the presence of GA, total ARWT receptor levels rapidly decreased, but A748T receptor levels were virtually unchanged (Fig. 8CGo).

Molecular Modeling of A748T
The functional properties of A748T suggested that there were intrinsic alterations in the interaction of the ligand with the mutant receptor. The recently published high-resolution crystal structure of the rat AR LBD complexed with DHT (27) allows detailed examination of the AR ligand-binding cavity and the disposition of hydrogen bonds formed between the receptor and ligand (Fig. 9AGo). Inspection of the LBD-DHT structure in the vicinity of A748 revealed that the arginine residue at position 752 (R752) is predicted to form hydrogen bonds with DHT and an ordered water molecule, H2O 49, within the ligand-binding cavity (Fig. 9BGo) that may play an important structural role in LBD interactions (28). Molecular modeling and minimization of the A748T substitution strongly suggests that the substituted threonine acts as an alternative hydrogen bond acceptor for R752 causing a slight displacement of this residue, abolishing the R752-DHT hydrogen bond and disrupting the network of hydrogen bonds focused on H2O 49 (Fig. 9CGo). Loss of the hydrogen bond formed between DHT and R752 is consistent with altered ligand binding and dissociation properties observed for A748T.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 9. Molecular Model of A748T

In panel A, the crystal structure of the rat AR-LBD bound to DHT is represented as a ribbon diagram (purple). Key residues in close proximity to A748 are depicted in stick form and colored according to the CPK standard; bound water molecule 49 is represented as a red sphere; ligand is shown in stick form; and hydrogen bonds are represented as dashed green lines. A magnified view of DHT and AR residues in the vicinity of residue 748 for (B) ARWT and the A748T variant receptor (C) are depicted using the same color scheme as for panel A. Substitution of threonine for alanine at position 748 results in loss of the hydrogen bond between R752 and DHT and disrupts the hydrogen bond network surrounding H2O 49, thereby providing a molecular explanation for altered ligand binding and dissociation.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Analysis of the A748T mutant has led to several important findings regarding the role of this region and amino acid in the function of AR. The mutant is less stable than WT both in the absence and presence of hormone, and exhibits hormone concentration dependent defects in nuclear translocation and transcriptional activation despite a normal hormone binding affinity. Decreased stability of hormone bound receptors appears to be common in receptors with accelerated off rates (31). The finding of decreased stability in a functional receptor in the absence of hormone is novel. Steroid receptors must associate with hsp90 complexes to fold into the correct conformation to generate a high affinity hormone-binding site (38, 41). Functional hsp90 is required to express AR with high affinity binding (38), and the region in rat AR that is required for hsp90 binding contains the amino acid corresponding to A748 (39). Treatment of AR-containing mammalian cells with GA (an ansamycin antibiotic that binds to hsp90 and disrupts hsp complexes) blocks the transcriptional activity of AR (42). We show here that GA treatment decreases the expression level of ARWT as predicted, but that expression of the mutant is unchanged indicating that this substitution reduces interactions with hsp. In contrast, an A748D mutation, which was detected in an AIS patient (43), also exhibits enhanced hormone dissociation rates but is expressed at normal levels; this suggests that the aspartic acid substitution does not alter interactions with hsp.

When expression levels are equalized, the transcriptional activities of ARWT and A748T are comparable at 10-9 M DHT or R1881, but the mutant is less active at suboptimal concentrations of hormone. The hormone-binding affinity of the mutant is normal, but the dissociation rate (and therefore the association rate) of the hormone is accelerated.

Mutants with altered hormone-dependent transactivation and normal hormone-binding affinity with increased rates of dissociation of hormone have been identified in AIS patients (30). AR dimerizes in an antiparallel configuration through N/C-terminal interactions and mutants of this type including V889M and R752Q exhibit reduced interaction in a mammalian two-hybrid assay even at high hormone concentrations (31). In contrast, A748T interacts strongly at high concentrations of hormone, but its capacity to interact is diminished at suboptimal levels of hormone demonstrating that the mutant is capable of normal interactions under some conditions.

Expression of the ARWT hormone-binding domain as a fusion with the GAL-DBD does not reduce the affinity for hormone, although the dissociation rate is elevated 5-fold due to loss of the stabilizing influence of the N terminus (31). In contrast, the affinity of the A748T chimera was substantially reduced. Moreover, the dissociation rate was elevated as much as 10-fold to a rate that no longer allows us to accurately determine the dissociation (T1/2 < 5 min). Neither the V889M mutant nor the R752Q mutant exhibit altered affinity relative to wild type in the context of the GAL-DBD (31). Collectively, these data indicate that not only is the A748T N/C interaction normal, but this interaction is critical to the maintenance of high-affinity hormone-binding in the mutant. A model of the predicted structure of the mutant hormone-binding domain suggests that the mutation would reduce the number of interactions between the hormone and the amino acid side chains, which may account for this difference. As shown by the molecular model of A748T (Fig. 9Go), T748 may serve as an alternative hydrogen bond acceptor for R752. The A748T mutation would then disrupt the binding of R752 with the O-3 region of DHT and an ordered H2O molecule within the ligand-binding cavity. Interestingly, an Arg to Gln mutation in the position in rat AR corresponding to Arg752 is responsible for the androgen insensitivity of the testicular feminized rat (44). This mutant exhibits normal hormone binding affinity, but the hormone binding capacity was much lower despite apparently equal expression. The transcriptional activity is decreased correspondingly. The reason for the discrepancy between levels of receptor and hormone binding is unknown. The receptor may have an extremely rapid dissociation rate; alternatively, the bulk of the receptor may be misfolded due to poor interactions with hsp.

The hormone concentration-dependent decrease in A748T activity prompted us to investigate the subcellular location of the mutant AR. Remarkably, despite the normal binding affinity of the full-length A748T, the localization in response to hormone differs substantially from ARWT. The mutant receptor translocates to the nucleus at higher levels of hormone but was predominantly cytoplasmic at 10 pM R1881 or 0.1 nM DHT. Under identical experimental conditions, ARWT was localized to the nucleus at both high and low hormone levels (Fig. 5Go). We found no evidence of accelerated nuclear export of A748T (data not shown); rather, the failure of A748T to translocate to the nucleus could be mediated by aberrant ligand induced conformational changes or protein interactions at low hormone that are essential for this process. Utilizing GFPAR fusions, Georget et al. (45) found that the rate of uptake of mutants with elevated dissociation rates was reduced relative to WT and that the effects were more substantial at 10-9 M DHT than at 10-6 M DHT. The extent of nuclear localization at equilibrium correlated with the reduced affinity for hormone. In contrast, A748T exhibits differential nuclear localization at equilibrium despite very similar affinities for R1881 and DHT as those of ARWT. This was reflected both in a somewhat slower rate of nuclear localization as well as in the equilibrium distribution (Figs. 5Go and 6Go). We prepared GFP-A748T, but found that it was transcriptionally inactive, whereas our GFP-ARWT retained good transcriptional activity (data not shown), so we were unable to measure live kinetics of uptake. The dissociation rate for GFP-ARWT (42 min; Ref. 45) is much faster than that of ARWT as shown here and has been previously reported, suggesting that the addition of GFP may affect N/C-terminal interactions. This further supports the hypothesis that the N/C-terminal interaction is critical for the function of A748T. Although, to our knowledge there are no studies reporting whether AR is transported as a monomer or a dimer, PR dimers are transported. A nuclear localization defective, but dimerization competent mutant of PR is localized to the nucleus upon hormone treatment provided that the cells are cotransfected with a plasmid encoding a nuclear localization competent form of PR (34). There is also evidence that the glucocorticoid receptor is translocated as a dimer (46). We speculate that both molecules of the AR dimer must be occupied with hormone in order for nuclear translocation to occur. At suboptimal hormone levels, ARWT bearing hormone dimerizes and translocates before dissociation of hormone from either subunit. With the greatly accelerated dissociation rate of A748T, one mutant molecule of the dimer may lose hormone before translocation preventing nuclear uptake. Those mutant dimers that are successfully translocated before loss of hormone are rapidly degraded upon dissociation of hormone resulting in minimal nuclear accumulation at low concentrations of hormone. In contrast, at high hormone both ARWT and A748T are fully occupied by hormone; mutant receptor that loses hormone is immediately reoccupied permitting nuclear uptake and localization.

The functional significance of the majority of the mutations identified in prostate cancer remains undefined. The one class of mutations with an obvious function are the mutations found in patients who have received androgen ablation therapy that broaden the specificity of the hormone binding allowing the AR to respond to antiandrogens such as flutamide as well as glucocorticoids as agonists (47, 48). The role of AR mutations in prostate cancer before androgen ablation is less clear. Prostate cancer is initially androgen dependent, but much of the growth-stimulatory effects may be a result of androgen-dependent secretion of growth factors by the stromal cells. In LNCaP prostate cancer cell lines, the androgen-induced growth response is biphasic with low levels being stimulatory, whereas higher levels are inhibitory (49) despite the higher activity of AR as measured by PSA at high hormone. AR expression is lower in poorly differentiated primary prostate tumors than in well differentiated prostate tumors (50), suggesting that lower levels of AR could lead to more aggressive disease in an androgen replete situation. On the other hand, transgenic mice overexpressing AR in prostate epithelial cells exhibit increased epithelial cell growth and prostatic intraepithelial neoplasia (51). Whether rodent and human prostate respond equivalently is unknown. Secretory epithelial cells in humans arise from the basal epithelial cells and do not normally divide. As a result of the decreased stability of A748T, we would predict that AR expression would be low in tumor cells. If there is an optimal level of epithelial cell AR activity, in an androgen-replete patient, the induced AR activity could be in the stimulatory range rather than in the inhibitory range. Until the role of AR in growth and development of normal and malignant prostate epithelial cells is better understood and there are appropriate models to test the functional consequences, it is difficult to predict what role, if any, the A748T mutation played in the development or growth of the prostate cancer in which it was identified.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
R1881 (methyltrienelone), [3H] R1881, DHT, and [3H] chloramphenicol were obtained from NEN Life Science Products (Boston, MA). Testosterone, DHT, estrogen, poly-L-lysine, and GA were purchased from Sigma (St. Louis, MO). Tissue culture supplies were from Fisher Scientific (Pittsburgh, PA). All other chemicals used were reagent grade. This study was done with the oversight and approval of the Institutional Review Board for the Protection of Human Subjects at Baylor College of Medicine.

Plasmid Constructs
A748T, a somatic mutation of alanine (GCC) to threonine (ACC) at position 748, was previously identified in an individual, with stage D1 prostate cancer, who had not undergone androgen ablation therapy (25). To analyze the functional consequences of the amino acid substitution, alanine was substituted for threonine at amino acid 748 in an AR expression vector using site-directed mutagenesis as previously described (52). The point mutation detected in the patient was incorporated in a primer (A-748-T) corresponding to nucleotides 2385–2410 of the human AR sequence (53). This primer was synthesized in the sense and antisense orientation (A-748-T-sense and A-748-T-antisense). A-748-T-antisense and a primer of opposite polarity, spanning from nucleotide 1843 to 1868 and containing the only HindIII site within the coding sequence of AR (primer H3S: 1843GGAGATGAAGCTTCTGGGTGTCACT1868) were used to amplify a 0.1-µg sample of the AR cDNA using vent polymerase, and the following amplification program: annealing and extension at 68 C for 1.30 min, denaturation at 95 C for 30 sec for 25 cycles. The resulting band (AR-mut-5') contains a segment of AR spanning nucleotides 1848–2410, which has incorporated the mutation of interest. 748-T-sense and a primer of opposite polarity containing the last 25 nucleotides of the AR open reading frame and a custom XbaI restriction site [oligo XbaI-AS (54)] used to amplify a 0.1-µg sample of the AR cDNA using vent polymerase, and the following amplification program: annealing and extension at 68 C for 1.30 min, denaturation at 95 C for 30 sec for 25 cycles. The resulting DNA (AR-mut-3') contains a segment of AR spanning nucleotides 2385–2913, and the mutation of interest. AR-mut-5' and AR-mut-3', which contain a region of homology of 25 nucleotides, were annealed and amplified using oligonucleotides H3S and XbaI-AS. The resulting band was digested with the restriction endonucleases HindIII and XbaI and subcloned in the expression vector CMV-ARWT (53), containing the ARWT cDNA treated with the same restriction endonucleases. The sequence of this mutated AR expression plasmid was confirmed by direct sequence analysis using an Applied Biosystems, Inc. (Foster City, CA) Prism Genotyping Machine, model 310.

The transcriptional activity of ARWT and A748T was measured using the GRE2-E1b-CAT reporter (obtained from Dr. John Cidlowski, NIEHS). This reporter contains two androgen response elements from the tyrosine amino transferase promoter, followed by the adenovirus E1b TATA box fused to the coding sequence of CAT (55).

For the mammalian two-hybrid assays, the carboxyl (C)- and amino (N)-terminal domains were expressed in separate vectors. The C terminus vector, GAL-AR624-919, contains the AR amino acids 624–919 fused to amino acids 1–147 of the GAL4 DNA binding domain. The N terminus vector, VPAR1-660, contains AR amino acids 1–660 fused to amino acids 411–456 of the VP-16 transactivation domain. Both vectors were kindly provided by Dr. Elizabeth M. Wilson (University of North Carolina, Chapel Hill, NC) (31). The A748T mutation was recreated in the GAL-AR624-919, by subcloning a TthIII/XbaI fragment of the CMV-A748T into the original construct. In these experiments, the 17merLUC reporter containing the DNA binding sites for the GAL DNA binding domain fusion protein (56) was cotransfected into the cells. For the coactivation experiment, the pCR3.1-TIF2 construct (33), originally cloned from the pG5-TIF2 construct (32) that was obtained from Dr. Pierre Chambon (Strasbourg, France), was cotransfected with GAL-AR624-919 or GAL-A748T624-919.

For the in vitro translation experiments that require a plasmid with a T7 promoter, ARWT in a pCR3.1 vector was used. The A748T mutation was introduced into this pCR3.1-ARWT vector by subcloning a XmaI fragment containing the mutation into the wild-type pCR3.1-ARWT vector.

The ligand-binding domains of all A748T expression vectors were sequenced to ensure the presence of the specific mutation and the absence of random mutations.

Cell Culture
Monkey kidney COS-1 cells (ATCC, Manassas, VA) were maintained in DMEM in the presence of 5% fetal calf serum, 100 µg/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Inc., Gaithersburg, MD). Twenty-four hours before transfection, the cells (plated at a density of 90,000 cells per well of a six-well plate) were transferred to the appropriate medium containing 5% charcoal-stripped fetal bovine serum and maintained in a 37 C humidified incubator with 5% CO2.

Transient Transfections
Nonrecombinant adenovirus coupled to poly-L-lysine was used as a carrier to transiently transfect COS-1 cells with plasmid DNA (12, 57, 58) for both the AR-dependent transactivation studies and the two hybrid studies. In brief, the indicated amounts of receptor and reporter plasmids were incubated at room temperature for 30 min with modified adenovirus at a multiplicity of infection of 250–500 virus particles per cell. Additional poly-L-lysine (1.3 µg/µg plasmid DNA) was added to the plasmid-DNA mixture and incubated at room temperature for 30 min. The virus-DNA complexes were added to cells in serum-free medium. After 2 h, medium-containing serum was added to provide a final concentration of 5% charcoal-stripped serum. Twenty-four hours post transfection, cells were treated with ethanol or DMSO vehicle or various doses of hormones, or GA (1 µg/ml). Forty-eight hours post transfection, cells were harvested and assayed for reporter activity and/or receptor expression.

Transcriptional Activation Assays
Forty-eight hours post transfection, cells were harvested in TEN buffer (40 mM Tris; 1 mM EDTA; 150 mM NaCl, pH 8.0). Cell pellets were resuspended in high salt buffer (0.4 M NaCl and 0.25 M Tris, pH 7.5) and cellular proteins were extracted by three freeze-thaw cycles. Protein concentrations were measured by a modified Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA). Equal amounts of protein or equal volumes of each sample were incubated with [3H] chloramphenicol (20 µCi/µmol specific activity) and butyryl CoA (59). After 15–60 min of incubation in a 37 C water bath, acylated chloramphenicol was extracted with a 2:1 mixture of 2, 6, 10, 14 tetramethylpentadecane to xylenes and counted in a Beckman scintillation counter. For the luciferase assay, transfected cells were harvested in PBS, resuspended in lysis buffer (Promega Corp., Madison, WI), and assayed for luciferase activity as recommended by the manufacturer. Results are reported as relative lights units. Experimental conditions were optimized to result in equal levels of ARWT and A748T expression. Based on these parameters, the receptor activity was normalized to receptor expression levels.

Immunoblot Analysis
Equal volumes of high salt protein extracts from transiently transfected cells were electrophoretically separated on 7.5% sodium dodecyl sulfate (SDS) polyacrylamide gels and transferred to a nitrocellulose membrane using a Bio-Rad semi-dry apparatus. Expression of wild-type and mutant receptors was detected using a mouse monoclonal AR antibody, AR441 (directed against amino acids 301–317; Ref. 58), a secondary rabbit antimouse IgG (Zymed Laboratories, Inc., San Francisco, CA), and a tertiary antirabbit horseradish peroxidase antibody (Amersham Pharmacia Biotech, Arlington Heights, IL). The protein bands were detected using an electrochemiluminescence kit (Amersham Pharmacia Biotech) and visualized by autoradiography. Densitometry was used to quantify the AR expression levels.

Hormone-Binding and Dissociation Assays
Whole cell hormone-binding and dissociation assays (30) were performed in COS-1 cells transiently transfected with 10 ng ARWT or 100 ng A748T. For studies of steroid binding affinity measurements, 5% stripped fetal calf serum DMEM was replaced with serum-free medium 48 h post transfection. Cells were incubated with 0.1–5 nM [3H] R1881 for 2 h at 37 C. The cells were then washed three times with ice-cold PBS to remove any unbound hormone. Bound hormone was extracted from the cells using 100% ice-cold ethanol, and counts were measured in the Beckman scintillation counter. Specific binding was calculated by subtracting nonspecific counts of mock-transfected cells from counts of receptor-transfected cells. Scatchard analysis was used to determine the binding affinity.

For the dissociation assays, transfected cells in serum-free medium were treated with 5 nM [3H] R1881 or [3H] DHT in the absence or presence (control) of 100-fold molar excess of unlabeled hormone at 37 C. After 2 h, medium was replaced with medium containing 500-fold molar excess of unlabeled R1881 or DHT. At specific time points ranging from 0–3 h, cells were washed twice in ice-cold PBS and bound counts were extracted with ethanol. Specific binding was calculated by subtracting the binding in the control samples (unlabeled added with labeled hormone) from the radiolabeled samples (unlabeled hormone added only after 2-h incubation with labeled hormone). The log of bound counts was plotted vs. time to determine the time required for half of the bound counts to dissociate (t1/2).

Subcellular Localization
COS-1 cells were plated on lysine-conjugated coverslips in six-well plates at a density of 90,000 cells per well. Cells were transfected with ARWT or A748T and treated with vehicle or hormone 24 h later. Forty-eight hours post transfection, cells were fixed using 100% ethanol at -20 C for 10 min (Fig. 5Go, A and B). A 1% BSA/PBS solution was used to block nonspecific binding. The cells were then incubated with AR antibody, AR441, followed by a fluorescein-conjugated goat-antimouse secondary antibody (Southern Biotechnology Associates, Birmingham, AL). A Zeiss Axioscop microscope (Carl Zeiss, Jena, Germany) was used to view images at x20–40. For the experiments in Figs. 5CGo and 6Go, the cells were fixed in 4% formaldehyde before detection of AR using AR441 and fluorescein-conjugated goat-antimouse secondary antibody as described previously (58). This procedure is more sensitive than the ethanol fixation protocol. Cells were visualized using a Zeiss Axioplan microscope A. All expressing AR cells (~400 cells) were evaluated for cellular compartmentalization of the receptor. Captured images were processed using Adobe Photoshop 4.0.

Partial Trypsinization of in Vitro Translated AR
The pCR3.1-AR and pCR3.1-A748T plasmids (1 µg) were in vitro transcribed and translated using the TNT Quick Coupled Transcription/Translation System nuclease-treated rabbit reticulocyte kit (Promega Corp.) in the presence of L-[35S]-methionine (Amersham Pharmacia Biotech). Samples were incubated at 30 C for 90 min. Two microliters of the labeled receptor translation mixture were then preincubated with or without 10 nM R1881 for 30 min at 4 C. For partial trypsinization, 5 µl trypsin (40 µg/ml) dissolved in water (Promega Corp.) was added to the receptor and incubated at room temperature for 15 min (36). SDS loading buffer was added to the in vitro translated product, and the samples were boiled for 2 min. Samples were then electrophoretically separated on a 12.5% SDS-polyacrylamide gel. After the gel was vacuum dried, the bands were detected by autoradiography.

Stability Assays
Twenty-four hours after transfection, COS-1 cells were treated with or without hormone for 2 h in the 37-C incubator. Cycloheximide (50 µg/ml) was then added to the cells to prevent de novo protein synthesis. Cells were harvested in TEN at time points ranging from 0–9 h. High salt extracts of the samples were run on 7.5% polyacrylamide gels, and AR was detected using the AR monoclonal antibody AR441 as previously described.

Homology Model
The crystal structure for the rat AR complexed with DHT was retrieved from the Protein Database (PDB) using PDBid 1I37. The alanine residue at position 748 was mutated to threonine using the graphical interface SPDV3.7 (60). Minimization of the resulting structure was initially performed using the molecular mechanics program GROMOS (61) with local constraints set within 5 Å of the threonine residue, and a second minimization run with harmonic restraints. The initial mutated structure was additionally analyzed using the Sculpt molecular mechanics suite of programs (62) and simulated annealing using Biomer’s microcanonical (constant particle number, volume, and total energy) ensemble (63). Maximum temperature was 300 K, heating and equilibration were set for 1 ps and cooling was set for 4 ps.


    ACKNOWLEDGMENTS
 
We thank William E. Bingman III for assistance with the nuclear localization studies.


    FOOTNOTES
 
This work was supported by a NIH Grant CA-68615 (to D.J.L., M.M., N.L.W.), the Baylor SPORE in Prostate Cancer Grant CA-58204 (to D.J.L., M.M., N.L.W.), a UNCF MERCK Fellowship (to A.J.J.), the Molecular Endocrinology Training Grant T32-DK-07696 (to A.J.J.), DAMD17-01-1-0018 postdoctoral fellowship (to I.U.A.), the National Health and Medical Research Council of Australia (ID 102174), the Anti-Cancer Foundation of South Australia (RG 58/00), and the Prostate Cancer Foundation of Australia (to J.M.H., G.B., W.D.T.).

Abbreviations: AIS, Androgen insensitivity syndrome; AR, androgen receptor; ARWT, AR wild type; C, carboxyl-terminal domain; CAT, chloramphenicol acetyl transferase; DHT, dihydrotestosterone; GA, geldanamycin; GAL-DBD, DNA binding domain of galactosidase; GRE, glucocorticoid response element; hsp, heat shock proteins; LBD, ligand binding domain; 17merLUC, galactosidase response element luciferase reporter; N, amino-terminal domain; PR, progesterone receptor; PSA, prostate-specific antigen; SDS, sodium dodecyl sulfate; TIF2, transcription intermediary factor 2; VP-16, VP 16 protein of the herpes simplex virus.

Received for publication October 22, 2001. Accepted for publication August 27, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ, Sugimura Y 1987 The endocrinology and developmental biology of the prostate. Endocr Rev 8:338–362[Abstract/Free Full Text]
  2. Cunha GR, Hayward SW, Dahiya R, Foster BA 1996 Smooth muscle-epithelial interactions in normal and neoplastic prostatic development. Acta Anat 155:63–72[Medline]
  3. Nemeth JA, Lee C 1996 Prostatic ductal system in rats: regional variation in stromal organization. Prostate 28:124–128[CrossRef][Medline]
  4. Isaacs JT, Lundmo PI, Berges R, Martikainen P, Kyprianou N, English HF 1992 Androgen regulation of programmed death of normal and malignant prostatic cells. J Androl 13:457–464[Abstract/Free Full Text]
  5. Luke MC, Coffey DS 1994 Human androgen receptor binding to the androgen response element of prostate specific antigen. J Androl 15:41–51[Abstract/Free Full Text]
  6. Riegman PH, Vlietstra RJ, van der Korput JA, Brinkmann AO, Trapman J 1991 The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 5:1921–1930[Abstract/Free Full Text]
  7. Kaisary AV, Tyrrell CJ, Peeling WB, Griffiths K 1991 Comparison of LHRH analogue (Zoladex) with orchiectomy in patients with metastatic prostatic carcinoma. Br J Urol 67:502–508[Medline]
  8. Mahler C, Verhelst J, Denis L 1998 Clinical pharmacokinetics of the antiandrogens and their efficacy in prostate cancer. Clin Pharmacokinet 34:405–417[CrossRef][Medline]
  9. Culig Z, Hobisch A, Cronauer MV, Radmayr C, Trapman J, Hittmair A, Bartsch G, Klocker H 1994 Androgen receptor activation in prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte growth factor, and epidermal growth factor. Cancer Res 54:5474–5478[Abstract/Free Full Text]
  10. de Ruiter PE, Teuwen R, Trapman J, Dijkema R, Brinkmann AO 1995 Synergism between androgens and protein kinase-C on androgen-regulated gene expression. Mol Cell Endocrinol 110:R1–R6
  11. Darne C, Veyssiere G, Jean C 1998 Phorbol ester causes ligand-independent activation of the androgen receptor. Eur J Biochem 256:541–549[Medline]
  12. Nazareth LV, Weigel NL 1996 Activation of the human androgen receptor through a protein kinase A signaling pathway. J Biol Chem 271:19900–19907[Abstract/Free Full Text]
  13. Sadar MD 1999 Androgen-independent induction of prostate-specific antigen gene expression via cross-talk between the androgen receptor and protein kinase A signal transduction pathways. J Biol Chem 274:7777–7783[Abstract/Free Full Text]
  14. Hobisch A, Eder IE, Putz T, Horninger W, Bartsch G, Klocker H, Culig Z 1998 Interleukin-6 regulates prostate-specific protein expression in prostate carcinoma cells by activation of the androgen receptor. Cancer Res 58:4640–4645[Abstract/Free Full Text]
  15. Craft N, Shostak Y, Carey M, Sawyers CL 1999 A mechanism for hormone-independent prostate cancer through modulation of androgen receptor signaling by the HER-2/neu tyrosine kinase. Nat Med 5:280–285[CrossRef][Medline]
  16. Koivisto P, Kononen J, Palmberg C, Tammela T, Hyytinen E, Isola J, Trapman J, Cleutjens K, Noordzij A, Visakorpi T, Kallioniemi OP 1997 Androgen receptor gene amplification: a possible molecular mechanism for androgen deprivation therapy failure in prostate cancer. Cancer Res 57:314–319[Abstract/Free Full Text]
  17. Koivisto PA, Helin HJ 1999 Androgen receptor gene amplification increases tissue PSA protein expression in hormone-refractory prostate carcinoma. J Pathol 189:219–223[CrossRef][Medline]
  18. Wallen MJ, Linja M, Kaartinen K, Schleutker J, Visakorpi T 1999 Androgen receptor gene mutations in hormone-refractory prostate cancer. J Pathol 189:559–563[CrossRef][Medline]
  19. Palmberg C, Koivisto P, Hyytinen, E, Isola J, Visakorpi T, Kallioniemi OP, Tammela T 1997 Androgen receptor gene amplification in a recurrent prostate cancer after monotherapy with the nonsteroidal potent antiandrogen Casodex (bicalutamide) with a subsequent favorable response to maximal androgen blockade. Eur Urol 31:216–219[Medline]
  20. Taplin ME, Bubley GJ, Ko YJ, Small EJ, Upton M, Rajeshkumar B, Balk SP 1999 Selection for androgen receptor mutations in prostate cancers treated with androgen antagonist. Cancer Res 59:2511–2515[Abstract/Free Full Text]
  21. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH 1991 Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 352:77–79[CrossRef][Medline]
  22. Li M, Miwa S, Kobayashi Y, Merry DE, Yamamoto M, Tanaka F, Doyu M, Hashizume Y, Fischbeck KH, Sobue G 1998 Nuclear inclusions of the androgen receptor protein in spinal and bulbar muscular atrophy. Ann Neurol 44:249–254[CrossRef][Medline]
  23. Gottlieb B, Pinsky L, Beitel LK, Trifiro M 1999 Androgen insensitivity. Am J Med Genet 89:210–217[CrossRef][Medline]
  24. Gottlieb B http://ww2.mcgill.ca/androgendb/AR23C.pdf
  25. Marcelli M, Ittmann M, Mariani S, Sutherland R, Nigam R, Murthy L, Zhao Y, DiConcini D, Puxeddu E, Esen A, Eastham J, Weigel NL, Lamb DJ 2000 Androgen receptor mutations in prostate cancer. Cancer Res 60:944–949[Abstract/Free Full Text]
  26. Poujol N, Wurtz JM, Tahiri B, Lumbroso S, Nicolas JC, Moras D, Sultan C 2000 Specific recognition of androgens by their nuclear receptor. A structure-function study. J Biol Chem 275:24022–24031[Abstract/Free Full Text]
  27. Sack JS, Kish KF, Wang C, Attar RM, Kiefer SE, An Y, Wu GY, Scheffler JE, Salvati ME, Krystek Jr SR, Weinmann R, Einspahr HM 2001 Crystallographic structures of the ligand-binding domains of the androgen receptor and its T877A mutant complexed with the natural agonist dihydrotestosterone. Proc Natl Acad Sci USA 98:4904–4909[Abstract/Free Full Text]
  28. Matias PM, Donner P, Coelho R, Thomaz M, Peixoto C, Macedo S, Otto N, Joschko S, Scholz P, Wegg A, Basler S, Schafer M, Egner U, Carrondo MA 2000 Structural evidence for ligand specificity in the binding domain of the human androgen receptor. Implications for pathogenic gene mutations. J Biol Chem 275:26164–26171[Abstract/Free Full Text]
  29. Kemppainen JA, Lane MV, Sar M, Wilson EM 1992 Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J Biol Chem 267:968–974[Abstract/Free Full Text]
  30. Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM 1995 Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 9:208–218[Abstract/Free Full Text]
  31. Langley, E, Kemppainen JA, Wilson EM 1998 Intermolecular NH2-/carboxyl-terminal interactions in androgen receptor dimerization revealed by mutations that cause androgen insensitivity. J Biol Chem 273:92–101[Abstract/Free Full Text]
  32. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  33. Lonard DM, Nawaz Z, Smith CL, O’Malley BW 2000 The 26S proteasome is required for estrogen receptor-{alpha} and coactivator turnover and for efficient estrogen receptor-{alpha} transactivation. Mol Cell 5:939–948[CrossRef][Medline]
  34. Guiochon-Mantel A, Loosfelt H, Lescop P, Christin-Maitre S, Perrot-Applanat M, Milgrom E 1992 Mechanisms of nuclear localization of the progesterone receptor. J Steroid Biochem Mol Biol 41:209–215[CrossRef][Medline]
  35. Kallio PJ, Janne OA, Palvimo JJ 1994 Agonists, but not antagonists, alter the conformation of the hormone-binding domain of androgen receptor. Endocrinology 134:998–1001[Abstract/Free Full Text]
  36. Kuil CW, Mulder E 1994 Mechanism of antiandrogen action: conformational changes of the receptor. Mol Cell Endocrinol 102:R1–R5
  37. Kuil CW, Berrevoets CA, Mulder E 1995 Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization. Studies on the mechanism of antiandrogen action. J Biol Chem 270:27569–27576[Abstract/Free Full Text]
  38. Fang Y, Fliss AE, Robins DM, Caplan AJ 1996 Hsp90 regulates androgen receptor hormone binding affinity in vivo. J Biol Chem 271:28697–28702[Abstract/Free Full Text]
  39. Marivoet S, Van Dijck P, Verhoeven G, Heyns W 1992 Interaction of the 90-kDa heat shock protein with native and in vitro translated androgen receptor and receptor fragments. Mol Cell Endocrinol 88:165–174[CrossRef][Medline]
  40. Johnson JL, Toft DO 1995 Binding of p23 and hsp90 during assembly with the progesterone receptor. Mol Endocrinol 9:670–678[Abstract/Free Full Text]
  41. Whitesell L, Cook P 1996 Stable and specific binding of heat shock protein 90 by geldanamycin disrupts glucocorticoid receptor function in intact cells. Mol Endocrinol 10:705–712[Abstract/Free Full Text]
  42. Haendler B, Schuttke I, Schleuning WD 2001 Androgen receptor signalling: comparative analysis of androgen response elements and implication of heat-shock protein 90 and 14–3-3{eta}. Mol Cell Endocrinol 173:63–73[CrossRef][Medline]
  43. Marcelli M, Zoppi S, Wilson CM, Griffin JE, McPhaul MJ 1994 Amino acid substitutions in the hormone-binding domain of the human androgen receptor alter the stability of the hormone receptor complex. J Clin Invest 94:1642–1650
  44. Yarbrough WG, Quarmby VE, Simental JA, Joseph DR, Sar M, Lubahn DB, Olsen KL, French FS, Wilson EM 1990 A single base mutation in the androgen receptor gene causes androgen insensitivity in the testicular feminized rat. J Biol Chem 265:8893–8900[Abstract/Free Full Text]
  45. Georget V, Terouanne B, Lumbroso S, Nicolas JC, Sultan C 1998 Trafficking of androgen receptor mutants fused to green fluorescent protein: a new investigation of partial androgen insensitivity syndrome. J Clin Endocrinol Metab 83:3597–3603[Abstract/Free Full Text]
  46. Kino T, Stauber RH, Resau JH, Pavlakis GN, Chrousos GP 2001 Pathologic human GR mutant has a transdominant negative effect on the wild-type GR by inhibiting its translocation into the nucleus: importance of the ligand-binding domain for intracellular GR trafficking. J Clin Endocrinol Metab 86:5600–5608[Abstract/Free Full Text]
  47. Fenton MA, Shuster TD, Fertig AM, Taplin ME, Kolvenbag G, Bubley GJ, Balk SP 1997 Functional characterization of mutant androgen receptors from androgen-independent prostate cancer. Clin Cancer Res 3:1383–1388[Abstract]
  48. Chang CY, Walther PJ, McDonnell DP 2001 Glucocorticoids manifest androgenic activity in a cell line derived from a metastatic prostate cancer. Cancer Res 61:8712–8717[Abstract/Free Full Text]
  49. Zhao XY, Ly LH, Peehl DM, Feldman D 1997 1{alpha},25-dihydroxyvitamin D3 actions in LNCaP human prostate cancer cells are androgen dependent. Endocrinology 138:3290–3298[Abstract/Free Full Text]
  50. Chodak GW, Kranc DM, Puy LA, Takeda H, Johnson K, Chang C 1992 Nuclear localization of androgen receptor in heterogeneous samples of normal, hyperplastic and neoplastic human prostate. J Urol 147:798–803[Medline]
  51. Stanbrough M, Leav I, Kwan, PW, Bubley GJ, Balk SP 2001 Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium. Proc Natl Acad Sci USA 98:10823–10828[Abstract/Free Full Text]
  52. Marcelli M, Tilley WD, Zoppi S, Griffin JE, Wilson JD, McPhaul MJ 1991 Androgen resistance associated with a mutation of the androgen receptor at amino acid 772 (Arg–Cys) results from a combination of decreased messenger ribonucleic acid levels and impairment of receptor function. J Clin Endocrinol Metab 73:318–325[Abstract/Free Full Text]
  53. Tilley WD, Marcelli M, Wilson JD, McPhaul MJ 1989 Characterization and expression of a cDNA encoding the human androgen receptor. Proc Natl Acad Sci USA 86:327–331[Abstract/Free Full Text]
  54. Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul MJ 1990 Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol Endocrinol 4:1105–1116[Abstract/Free Full Text]
  55. Allgood VE, Oakley RH, Cidlowski JA 1993 Modulation by vitamin B6 of glucocorticoid receptor-mediated gene expression requires transcription factors in addition to the glucocorticoid receptor. J Biol Chem 268:20870–20876[Abstract/Free Full Text]
  56. Nawaz Z, Lonard DM, Smith CL, Lev-Lehman E, Tsai SY, Tsai MJ, O’Malley BW 1999 The Angelman syndrome-associated protein, E6-AP, is a coactivator for the nuclear hormone receptor superfamily. Mol Cell Biol 19:1182–1189[Abstract/Free Full Text]
  57. Allgood VE, Zhang Y, O’Malley BW, Weigel NL 1997 Analysis of chicken progesterone receptor function and phosphorylation using an adenovirus-mediated procedure for high-efficiency DNA transfer. Biochemistry 36:224–332[CrossRef][Medline]
  58. Nazareth LV, Stenoien DL, Bingman 3rd WE, James AJ, Wu C, Zhang Y, Edwards DP, Mancini M, Marcelli M, Lamb DJ, Weigel NL 1999 A C619Y mutation in the human androgen receptor causes inactivation and mislocalization of the receptor with concomitant sequestration of SRC-1 (steroid receptor coactivator 1). Mol Endocrinol 13:2065–2075[Abstract/Free Full Text]
  59. Zhang Y, Bai W, Allgood VE, Weigel NL 1994 Multiple signaling pathways activate the chicken progesterone receptor. Mol Endocrinol 8:577–584[Abstract/Free Full Text]
  60. Guex N, Peitsch MC 1997 SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714–2723[CrossRef][Medline]
  61. van Gunsteren WF, Beredsen HJC 1987 Groningen molecular simulation (GROMOS) library manual. Groningen: Biomos
  62. Surles MC, Richardson JS, Richardson DC, Brooks Jr FP 1994 Sculpting proteins interactively: continual energy minimization embedded in a graphical modeling system. Protein Sci 3:198–210[Medline]
  63. White NB http://www.scripps.edu/~nwhite/B

NURSA Molecule Pages Link:

Nuclear Receptors:   AR
Ligands:   Dihydrotestosterone  |  R1881



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
O. A. O'Mahony, M. P. Steinkamp, M. A. Albertelli, M. Brogley, H. Rehman, and D. M. Robins
Profiling Human Androgen Receptor Mutations Reveals Treatment Effects in a Mouse Model of Prostate Cancer
Mol. Cancer Res., November 1, 2008; 6(11): 1691 - 1701.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. U. Agoulnik, A. Vaid, W. E. Bingman III, H. Erdeme, A. Frolov, C. L. Smith, G. Ayala, M. M. Ittmann, and N. L. Weigel
Role of SRC-1 in the Promotion of Prostate Cancer Cell Growth and Tumor Progression
Cancer Res., September 1, 2005; 65(17): 7959 - 7967.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
Z Culig, H Steiner, G Bartsch, and A Hobisch
Mechanisms of endocrine therapy-responsive and -unresponsive prostate tumours
Endocr. Relat. Cancer, June 1, 2005; 12(2): 229 - 244.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Yamamoto, N. K. Shevde, A. Warrier, L. A. Plum, H. F. DeLuca, and J. W. Pike
2-Methylene-19-nor-(20S)-1,25-dihydroxyvitamin D3 Potently Stimulates Gene-specific DNA Binding of the Vitamin D Receptor in Osteoblasts
J. Biol. Chem., August 22, 2003; 278(34): 31756 - 31765.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by James, A. J.
Right arrow Articles by Weigel, N. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by James, A. J.
Right arrow Articles by Weigel, N. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals