| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Free Radical and Radiation Biology Program (G.D.G., F.E.D., M.E.C.R.), Department of Radiation Oncology and Department of Pathology (S.A.M.), University of Iowa, Iowa City, Iowa 52242
Address all correspondence and requests for reprints to: Mike E. C. Robbins, Ph.D., Department of Radiation Oncology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina 27157. E-mail: mrobbins{at}wfubmc.edu.
| ABSTRACT |
|---|
|
|
|---|
has been shown to decrease the inflammatory response via transrepression of proinflammatory transcription factors. However, the identity of PPAR
responsive genes that decrease the inflammatory response has remained elusive. Because generation of the reactive oxygen species hydrogen peroxide (H2O2) plays a role in the inflammatory process and activation of proinflammatory transcription factors, we wanted to determine whether the antioxidant enzyme catalase might be a PPAR
target gene. We identified a putative PPAR response element (PPRE) containing the canonical direct repeat 1 motif, AGGTGA-A-AGTTGA, in the rat catalase promoter. In vitro translated PPAR
and retinoic X receptor-
proteins were able to bind to the catalase PPRE. Promoter deletion analysis revealed that the PPRE was functional, and a heterologous promoter construct containing a multimerized catalase PPRE demonstrated that the PPRE was necessary and sufficient for PPAR
-mediated activation. Treatment of microvascular endothelial cells with PPAR
ligands led to increases in catalase mRNA and activity. These results demonstrate that PPAR
can alter catalase expression; this occurs via a PPRE in the rat catalase promoter. Thus, in addition to transrepression of proinflammatory transcription factors, PPAR
may also be modulating catalase expression, and hence down-regulating the inflammatory response via scavenging of reactive oxygen species. | INTRODUCTION |
|---|
|
|
|---|
(NR1C1), ß (also called
, NUC1, or FAAR) (NR1C2), and
(NR1C3) (3). In recent years much attention has been focused on PPAR
and its role in inflammation. Studies have demonstrated a down-regulation of the inflammatory response after treatment with various PPAR
agonists in a variety of different cell types and tissues (Refs. 4 and 5 ; see Ref. 2 for review). This protective antiinflammatory function has been shown to reflect the ability of PPAR
ligands to repress the expression of several proinflammatory genes and cytokines. One mechanism by which PPAR
accomplishes this appears to be regulated in part by down-regulation of nuclear factor-
B (NF-
B), activating protein-1 (AP-1), and signal transducers and activators of transcription-1 (STAT-1)-mediated transcription of proinflammatory genes via transrepression due to competition for transcriptional coactivators (5, 6). PPAR
-independent effects have also been observed with the natural PPAR
ligand 15-deoxy-
12,14-prostaglandin J2 via inhibition of I
B kinase through covalent modification (7, 8). In addition there is the potential that as yet unidentified PPAR
-responsive antiinflammatory genes may be responsible.
Reactive oxygen species (ROS) such as the superoxide radical, hydrogen peroxide (H2O2), and hydroxyl radical are generated during normal metabolism in all aerobic cells as well as after oxidative stress (9, 10). ROS have been shown to play a role in the pathogenesis and resultant morbidity of several different inflammatory disease states including rheumatoid arthritis, ischemia/reperfusion injury, and atherosclerosis. These effects are mediated in part via activation of NF-
B, STAT, and AP-1 transcription factors by ROS leading to an up-regulation of proinflammatory genes and cytokines (11, 12, 13, 14, 15). Cells have developed a number of protective antioxidant enzymes to scavenge these potentially toxic molecules. Catalase, along with the superoxide dismutases and glutathione peroxidases, plays an important role in protecting cells from oxidative stress.
Catalase is an antioxidant enzyme that catalyzes the dismutation of H2O2 to oxygen and water (16). In most mammalian tissues catalase is contained predominantly within peroxisomes, cellular organelles responsible for several important metabolic functions, including ß-oxidation of long-chain fatty acids (17). Because peroxisomal fatty acid ß-oxidation generates large amounts of H2O2, the presence of catalase is required to protect cells against this toxic ROS. In addition, recent evidence indicates that overexpression of catalase both in vitro and in vivo can inhibit NF-
B activation and protect cells and tissues from inflammatory and oxidant insults (18, 19).
Catalase was among the first enzymes to be discovered, and its biochemical function has been extensively characterized. In contrast, little is known regarding transcriptional regulation of the catalase gene in mammalian cells (20, 21, 22, 23). Given that PPAR
has been shown to protect against inflammatory insult, we tested the hypothesis that PPAR
is involved in the regulation of catalase. We report here that PPAR
ligands can indeed increase catalase mRNA and activity, and this is mediated via a functional PPAR response element (PPRE) in the rat catalase promoter.
| RESULTS |
|---|
|
|
|---|
, we examined the 5'-proximal promoter region (
5000 bp) of catalase for a potential PPRE using the GCG Wisconsin package. We identified a putative PPRE in the rat catalase promoter located at nucleotide (nt) -1027 to -1015 with respect to the translation start site (Fig. 1
|
|
and RXR
. Neither PPAR
nor RXR
alone bound to the catalase PPRE oligonucleotide (data not shown). However, PPAR
/RXR
heterodimers bound to the catalase PPRE oligonucleotide (Fig. 2
B) did not displace the labeled catalase PPRE oligonucleotide (Fig. 2
|
/RXR heterodimers are able to bind to the putative catalase PPRE, this does not demonstrate that the catalase PPRE is functional. To determine the functionality of the putative PPRE in the rat catalase promoter, we transfected a series of promoter deletion constructs (Fig. 3
2 expression vector and the PPAR
ligand rosiglitazone.
|
ligand (Fig. 4A
, we transfected the COS-1 cells with the rCTLS-1048 in the presence and absence of exogenous PPAR
using the PPAR
2 expression vector. Figure 4B
2. The addition of exogenous PPAR
2 greatly increased reporter activity, which was even further enhanced by the addition of rosiglitazone. This indicates that a region between nt -1048 and -938 is PPAR
responsive. Within this region is the PPRE we identified at nt -1027 to -1015.
|
forms heterodimers with RXRs and synergistically activates reporter genes when both receptors are activated by their respective ligands (24, 25). To determine whether the rat catalase PPRE could be similarly activated, we supplemented the transfected cells with rosiglitazone and the RXR-specific ligand LG268 either alone or together. As shown in Fig. 5
participates in the regulation of catalase expression.
|
-stimulated promoter activity, we constructed a heterologous promoter containing a tandem tripeat of the catalase PPRE (DR1x3). COS-1 cells were transfected with the DR1x3 or empty vector, PPAR
2, and cytomegalovirus-ß-galactosidase (CMV-ß-gal) expression vectors. The DR1x3 construct in the absence of ligand had significantly greater activity than the empty vector alone (Fig. 6
, there was not a significant increase in reporter activity. This indicates that the PPRE present in the rat catalase promoter is regulated by PPAR
, and that this PPRE is necessary and sufficient for PPAR
-mediated activity.
|
Agonists
to bind to and activate the PPRE in the catalase promoter, we wanted to determine whether PPAR
activation could alter catalase mRNA expression. For these experiments we used rat brain microvascular endothelial (RBMECs) cells, one of the cell types damaged during acute and chronic inflammatory responses as a result of ROS generation (26, 27). We performed immunoblotting for PPAR
in the RBMECs to determine whether PPAR
was present. Indeed, as shown in Fig. 7
2 isoform appears to be the main isoform present. While the expression of PPAR
2 has usually been associated with adipose tissue, studies have shown that other cell types such as endothelial cells express PPAR
2 (28, 29). RBMECs were then supplemented with either of two different PPAR
agonists: ciglitazone or rosiglitazone. Treatment of cells with 520 µM of the low-affinity PPAR
agonist, ciglitazone, caused a dose-dependent increase in catalase mRNA (Fig. 8A
agonist, rosiglitazone, increased catalase mRNA to a greater extent than the highest dose of ciglitazone. Catalase steady state mRNA levels increased 3-fold after 5 µM rosiglitazone, whereas 20 µM ciglitazone produced a 2-fold induction of catalase. Thus, two different PPAR
agonists can increase catalase mRNA expression. To determine the functionality of the catalase PPRE in this cell type, we transfected the RBMECs with the rCTLS-1048 fragment, without adding exogenous PPAR
expression vector and performed reporter assays. We observed a 2-fold increase in reporter activity in the absence of exogenously added RXR, once again demonstrating the functionality of the catalase PPRE and the presence of endogenous PPAR
(Fig. 8B
|
|
agonists are capable of increasing catalase promoter activity and mRNA levels. To determine whether this also leads to increased catalase function, catalase enzymatic activity assays were performed on RBMECs after rosiglitazone treatment. Catalase activity in control RBMECs was 110 ± 10.5 K/g protein. After treatment with 10 and 20 µM rosiglitazone for 48 h, activities increased significantly to 219 ± 7.1 and 277 ± 9.3 K/g protein, respectively (Fig. 9
ligands appear to increase not only the transcription of catalase mRNA, but also the enzymatic activity of the protein as well.
|
| DISCUSSION |
|---|
|
|
|---|
-mediated down-regulation of proinflammatory genes such as inducible nitric oxide synthase and cyclooxygenase-2 is attributed to squelching of coactivators, which leads to transrepression of the transcription factors AP-1, STAT-1, and NF-
B (5, 6). These previous studies elegantly demonstrated mechanisms by which PPAR
was antiinflammatory. However, they failed to identify a PPAR
-responsive gene that could protect cells from inflammatory conditions. Several proinflammatory genes such as inducible nitric oxide synthase and cyclooxygenase-2 and various cytokines are up-regulated by ROS (30, 31). The mechanism by which this is thought to occur is via redox regulation of proinflammatory transcriptions factors such as AP-1, NF-
B, and STAT-1 (11, 14, 15). Indeed, H2O2 has been implicated as playing a major role in these processes. Furthermore, it has been demonstrated that overexpression of catalase as well as other antioxidants can protect against these inflammatory events (18, 19, 32, 33).
In this report, we identify a functional PPRE in the rat catalase 5'-flanking region located between nt -1027 and -1015 with respect to the translation start site. This PPRE contained the canonical DR1 motif spaced by an adenine and varied from the consensus sequence by only three nucleotides. We also demonstrated the ability of two different PPAR
ligands to increase catalase mRNA expression. A PPAR
-specific effect is suggested because the induction with the higher affinity ligand, rosiglitazone, was greater than with the lower affinity ligand, ciglitazone (34). In support of our data demonstrating that in vitro PPAR
ligands can increase catalase expression, Way et al. (35) recently demonstrated in vivo that a nonthiazolidinedione PPAR
ligand can increase catalase expression in tissues that contain PPAR
. The full significance of the induction of catalase by PPAR
is evidenced by the dose-dependent increase in catalase enzymatic activity currently observed after incubation of RBMECs with rosiglitazone. While only a 2- to 3-fold increase in catalase activity was observed, the kinetics of H2O2 dismutation to water and oxygen by catalase are almost diffusion rate limited (36). Thus, a relatively small change in its activity would have a profound functional effect.
Little is known regarding transcriptional control of catalase expression in mammalian cells. The rat catalase gene is a single-copy gene with 13 exons and 12 introns spanning 33 kb that possesses multiple transcription initiation sites (37). The promoter region of the gene lacks a TATA box and an initiator consensus sequence. However, characteristic of promoters lacking a TATA box, there are multiple CCAAT boxes and GC boxes (38). Studies have shown that decreased catalase activity, protein, and mRNA are due to decreased transcription (39, 40). Regulatory mechanisms may involve response elements in the 5'-flanking region. The marked decrease in catalase activity observed in tumor cell lines is thought to reflect, in part, the presence of a silencer element present in the 5'-flanking region of the catalase gene (41). In addition, other negative and/or positive regulatory elements have also been hypothesized (20, 22). However, in addition to the identification of a functional stimulating protein 1 site, little is known regarding the function of cis-elements within the catalase promoter that participate in its transcriptional regulation (41).
The current data demonstrate that catalase is a PPAR
target gene and suggest an additional and complimentary mechanism by which PPAR
might exert antiinflammatory effects. Thus, in addition to transrepression of AP-1, NF-
B, or STAT-1 activities as demonstrated by others, PPAR
may exert a protective effect by increasing catalase expression, resulting in decreased intracellular H2O2, which itself can activate these transcription factors. Although further functional studies are needed, our findings have important implications not only for the mechanism(s) by which PPAR
can protect against inflammatory related diseases, but also in understanding the regulation of mammalian catalase.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RXR Expression Vector Generation
RT-PCR methodology was used to generate a full-length mouse RXR
expression vector from mouse liver RNA. The upstream primer, 5'-GGGCATGAGTTAGTCGCAG-3', and downstream primer, 5'-ACACTGCACCCCAAAGATC-3' (GenBank accession no. X66223), were used. PCR conditions were as follows: 94 C for 4 min, then 35 cycles of 94 C for 1 min, 62.5 C for 1 min, and 72 C for 1.5 min, and a final elongation step of 7 min at 72 C. The PCR products were analyzed on a 1% low-melting point agarose gel, and a single band corresponding to the expected size of the RXR
PCR product (1534 bp) was isolated using a QIAGEN (Chatsworth, CA) gel extraction kit. The RXR
cDNA was captured into the pTargeT mammalian expression vector (Promega Corp., Madison, WI) according to manufacturers directions, and the identity of the cDNA was verified by sequencing. The PPAR
2 cDNA was generously provided by Dr. Bruce Spiegelman (Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA).
Promoter Reporter Construction
Total genomic DNA was isolated from the RBMECs using DNAzol reagent (Life Technologies, Inc.) according to manufacturers directions, and restricted with EcoRI, and the DNA was isolated using the QIAGEN Qiamp Tissue Kit according to the manufacturers directions. For PCR the following primers were used: rCTLS-1048, ACAGCCCACA GCCCATAATC (36413660); rCTLS-938, ATTGATTAAAATGAAAAATAAGCGAC (37513776); rCTLS-592, CTGATGCTAGACACTCAACC (39974017). The number after rCTLS indicates length of the construct with respect to the translation start site, and the numbers in parentheses indicate location of primers designating the first nucleotide of the published sequence (GenBank accession no. M25669) as bp 1. A common downstream primer, CAGATGAAGCAGTGGAAGGA (47194738), was used with all the upstream primers. The translation start site is located at base 4689 (Fig. 1
).
PCR was performed using the following conditions: 95 C for 4 min, and then 35 cycles of 94 C for 1 min, 60 C for 1 min, and 72 C for 1.5 min with a final elongation step of 72 C for 7 min. PCR products were ligated into a pCR2.1 TA-TOPO cloning vector according to the manufacturers directions (Invitrogen, San Diego, CA). The identities of the fragments were confirmed by sequencing. Sequences were identical to the published sequence (22, 37). The promoter fragments in the pCR2.1 vector were then directionally subcloned into the KpnI and XhoI sites of the pGL3-basic reporter constructs and then resequenced.
Construction of Heterologous Catalase DR1 Reporter Construct
An oligonucleotide containing three direct tandem repeats of TAATCAAGGTGAAAGTTGAGAAG (DR1x3) was synthesized with KpnI and XhoI restriction sites on its 5'- and 3'-ends, respectively, with 6-bp extensions beyond the restriction sites. The upstream and downstream DR1x3 was annealed and then restricted with KpnI and XhoI, gel isolated, and ligated into the Kpn/Xho sites of the pTal-luc minimal promoter reporter construct (CLONTECH Laboratories, Inc., Palo Alto, CA). Fidelity was confirmed by sequencing.
Western Blot Analysis
Total protein was isolated, separated on a 10% polyacrylamide gel, and transferred to nitrocellulose as previously described (43). Three microliters of in vitro translated PPAR
1 or PPAR
2 were used as a control. Membranes were blotted for PPAR
using a mouse monoclonal antibody for PPAR
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA) that recognizes both PPAR
1 and PPAR
2 and visualized using ECL reagent (Amersham Pharmacia Biotech, Arlington Heights, IL).
Northern Blot Analysis
RBMECs were grown in 100-mm dishes until 70% confluent and then supplemented with ciglitazone (BIOMOL Research Laboratories, Inc., Plymouth Meeting, PA) or rosiglitazone (a kind gift from Dr. Richard Heyman, Ligand Pharmaceuticals, Inc., San Diego, CA). Total RNA was isolated using RNA STAT-60 isolation reagent (Tel-Test "B") according to manufacturers directions (Tel-Test, Friendswood, TX). A rat catalase partial cDNA was constructed by RT-PCR of total RNA from RBMECs using the sense primer 5'-AAACCCGATGTCCTGACCAG-3' and antisense primer 5'-CCTTTGCCTTGGAGTATCTGG-3' with the Expand HiFi PCR System (Roche Molecular Biochemicals, Indianapolis, IN). The following PCR conditions were used: 94 C for 5 min, and then 35 cycles of 94 C for 1 min, 64 C for 30 sec, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min. The resulting 228-bp fragment was ligated into a pCR2.1 TA cloning vector (Invitrogen) according to the manufacturers directions. The identity of the PCR fragment was confirmed by sequencing (DNA Core Facility, University of Iowa). 32P-labeled catalase cDNA probe was made by random-primer labeling of 50 ng of rat catalase cDNA EcoRI fragment. Total RNA (10 µg) was subjected to Northern blotting as previously described (43). Membranes were stripped and reprobed with the housekeeping gene cyclophilin as a control for loading and transfer. Blots were quantified by densitometry performed at the Image Analysis Facility at the University of Iowa.
Nuclear Protein Isolation and EMSA
Nuclear extracts were isolated by a modified method of Dignam and colleagues (44, 45). Cells were rinsed in cold 1x PBS and then scraped into ice-cold buffer A [10 mM HEPES, 1.5 mM MgCl2, 10 mM dithiothreitol (DTT)] and incubated on ice for 20 min. Cells were then Dounce homogenized and checked microscopically for cell lysis. Nuclei were then isolated by centrifugation at 5000 rpm for 30 sec at 4 C and supernatant was removed (performed twice). The nuclear pellets were resuspended in ice-cold buffer C [20 mM HEPES, 25% glycerol (vol/vol), 0.42 NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonylfluoride, 0.5 mM DTT] and incubated on ice for 15 min. The suspensions were centrifuged at 10,000 x g for 5 min and supernatants were removed and diluted into ice-cold buffer D (20 mM HEPES, 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonylfluoride, 0.5 mM DTT). Nuclear extracts were then stored at -80 C.
In vitro translation of PPAR
2 and RXR
were carried out with the Promega Corp. TNT-coupled system according to manufacturers directions. The reaction was also carried out in the presence of 35S-methionine, separated by SDS-PAGE, gel dried, and exposed to film to verify translation of the correct size protein (data not shown). For EMSA the following upstream and downstream oligonucleotides were used: acyl-coenzyme A oxidase PPRE (ACOX-PPRE) (46): 5'-AGCTGGGACCAGGACAAAGGTCACGTT-3', 5'-GATCAACGTGACCTTTGTCCTGGTCCC-3'; rat catalase putative DR-1: 5'-AGCTTAATCAAGGTGAAAGTTGAGAAG-3', GATCCTTCTCAACTTTCACCTTGATTA, and an NF
B response element: 5'-AGCTAACTCGGGGCTTTCTGC-3', 5'-GATCGCAGAAAGCCCCGAGTT-3'. The imperfect PPREs are underlined as well as the NF-
B site. Probes for EMSA were made as previously described (45). Nuclear extracts (110 µg) or 1 µl of in vitro transcribed/translated protein were incubated with 1 µg poly(deoxyinosine-deoxycytidine) (Pharmacia Biotech, Piscataway, NJ), gel shift buffer (10 mM Tris, pH 7.5; 4% glycerol; 50 mM NaCl; 1 mM MgCl2; 0.5 mM EDTA; 0.5 mM DTT) and 32P-labeled probes. Bound DNA complexes were separated from free probe by PAGE on a 5% native gel at 15 mA for 1 h in 1x Tris-buffered EDTA. Gels were wrapped in Saran wrap and exposed to x-ray film at -80 C.
Transfections and Reporter Assays
COS-1 cells were seeded into six-well culture plates (Corning, Inc., Corning, NY). Cells were then transfected with 200 ng of the various catalase promoter deletions or empty pGL3 vector using Superfect according to manufacturers directions (QIAGEN). PCMV-ß-gal plasmid (100 ng) was included in each transfection to control for transfection efficiency. Except where noted, 100 ng of PPAR
2 were also cotransfected. The cells were treated for 36 h with the rosiglitazone and/or LG268 (a kind gift from Dr. Richard Heyman, Ligand Pharmaceuticals, Inc.). Luciferase activity was measured on a luminometer (Lumat LB 9507, EG&G Berthold, Oak Ridge, TN) and ß-galactosidase (ß-gal) activity was determined according to the manufacturers specifications (Promega Corp.). Luciferase activity was normalized to ß-gal activity.
COS-1 cells were also transfected with PPAR
2 expression vector and CMV-ß-gal along with pTal-luc empty vector or vector containing the catalase DR1x3, as described above. Cells were treated with vehicle control, 0.1 µM or 1.0 µM rosiglitazone, and assayed after 24 h on a luminometer. Luciferase activity was normalized to ß-gal activity.
Catalase Activity Analysis
RBMECs were supplemented with 10 or 20 µM rosiglitazone for 48 h. Whole-cell extracts were isolated as previously described (47). Catalase activity was performed as described by Clairborne (48). In brief, 200 µg of protein were added to a cuvette containing 50 mM phosphate buffer (pH 7.8), and H2O2 was added to a final concentration of 10 mM. The disappearance of H2O2, as determined by its absorbance at 240 nM, was measured immediately at 30-sec intervals for 1 min. Activity was expressed as units per gram of protein (K/g).
| FOOTNOTES |
|---|
1 Current Address: Geoffrey Girnun, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, Massachusetts 02115. ![]()
Abbreviations: AP-1, Activator protein 1; CMV-ß-gal, cytomegalovirus-ß-galactosidase; DR, direct repeat; DR1, DR spaced by one nt; DTT, dithiothreitol; NF-
B, nuclear factor-
B; nt, nucleotide; PPAR, peroxisomal proliferator-activated receptor; PPRE, PPAR response elemet; RBMECs, rat brain microvascular endothelial cells; ROS, reactive oxygen species; RXR, retinoid X receptor; STAT, signal transducer and activator of transcription.
Received for publication January 15, 2002. Accepted for publication August 16, 2002.
| REFERENCES |
|---|
|
|
|---|
agonists inhibit production of monocyte inflammatory cytokines. Nature 391:8286[CrossRef][Medline]
is a negative regulator of macrophage activation. Nature 391:7982[CrossRef][Medline]
-dependent repression of the inducible nitric oxide synthase gene. Mol Cell Biol 20:46994707
B kinase. Nature 403:103108[CrossRef][Medline]
12,14-prostaglandin J2 inhibits multiple steps in the NF-
B signalling pathway. Proc Natl Acad Sci USA 97:48444849
B. Free Radic Biol Med 28:13171327[CrossRef][Medline]
B activation. Free Radic Biol Med 22:11151126[CrossRef][Medline]
B. Chem Biol 2:1322[CrossRef][Medline]
B activation and DNA synthesis induced by peroxisome proliferator ciprofibrate. Carcinogenesis 19:631637
(PPAR
) heterodimers: intermolecular synergy requires only the PPAR
hormone-dependent activation function. Mol Cell Biol 18:34833494
ligands are potent inhibitors of angiogenesis in vitro and in vivo. J Biol Chem 274:91169121
activation in human endothelial cells increases plasminogen activator inhibitor type-1 expression: PPAR
as a potential mediator in vascular disease. Arterioscler Thromb Vasc Biol 19:546551
(PPAR
). J Biol Chem 270:1295312956
activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142:12691277
-3 and
-6 fatty acids from essential fatty acid precursors. J Neurochem 55:391402[CrossRef][Medline]
-linolenic acid supplementation. Free Radic Biol Med 28:11431156[CrossRef][Medline]
NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
X. Zhao, R. Strong, J. Zhang, G. Sun, J. Z. Tsien, Z. Cui, J. C. Grotta, and J. Aronowski Neuronal PPAR{gamma} Deficiency Increases Susceptibility to Brain Damage after Cerebral Ischemia J. Neurosci., May 13, 2009; 29(19): 6186 - 6195. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Chung, M. Kim, B.-S. Youn, N. S. Lee, J. W. Park, I. K. Lee, Y. S. Lee, J. B. Kim, Y. M. Cho, H. K. Lee, et al. Glutathione Peroxidase 3 Mediates the Antioxidant Effect of Peroxisome Proliferator-Activated Receptor {gamma} in Human Skeletal Muscle Cells Mol. Cell. Biol., January 1, 2009; 29(1): 20 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. H. Smeets, H. M. de Vogel-van den Bosch, P. H. M. Willemsen, A. P. Stassen, T. Ayoubi, G. J. van der Vusse, and M. van Bilsen Transcriptomic analysis of PPAR{alpha}-dependent alterations during cardiac hypertrophy Physiol Genomics, December 12, 2008; 36(1): 15 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Beyer, W. J. de Lange, C. M. Halabi, M. L. Modrick, H. L. Keen, F. M. Faraci, and C. D. Sigmund Endothelium-Specific Interference With Peroxisome Proliferator Activated Receptor Gamma Causes Cerebral Vascular Dysfunction in Response to a High-Fat Diet Circ. Res., September 12, 2008; 103(6): 654 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Collino, N. S.A. Patel, and C. Thiemermann Review: PPARs as new therapeutic targets for the treatment of cerebral ischemia/reperfusion injury Therapeutic Advances in Cardiovascular Disease, June 1, 2008; 2(3): 179 - 197. [Abstract] [PDF] |
||||
![]() |
K. Fujita, N. Maeda, M. Sonoda, K. Ohashi, T. Hibuse, H. Nishizawa, M. Nishida, A. Hiuge, A. Kurata, S. Kihara, et al. Adiponectin Protects Against Angiotensin II-Induced Cardiac Fibrosis Through Activation of PPAR-{alpha} Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 863 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Remels, H. R. Gosker, P. Schrauwen, R. C. Langen, and A. M. Schols Peroxisome proliferator-activated receptors: a therapeutic target in COPD? Eur. Respir. J., March 1, 2008; 31(3): 502 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fan, Y. Wang, Z. Tang, H. Zhang, X. Qin, Y. Zhu, Y. Guan, X. Wang, B. Staels, S. Chien, et al. Suppression of Pro-inflammatory Adhesion Molecules by PPAR-{delta} in Human Vascular Endothelial Cells Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 315 - 321. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kamijo, K. Hora, K. Kono, K. Takahashi, M. Higuchi, T. Ehara, K. Kiyosawa, H. Shigematsu, F. J. Gonzalez, and T. Aoyama PPAR{alpha} Protects Proximal Tubular Cells from Acute Fatty Acid Toxicity J. Am. Soc. Nephrol., December 1, 2007; 18(12): 3089 - 3100. [Full Text] [PDF] |
||||
![]() |
G. Ding, M. Fu, Q. Qin, W. Lewis, H. W. Kim, T. Fukai, M. Bacanamwo, Y. E. Chen, M. D. Schneider, D. J. Mangelsdorf, et al. Cardiac peroxisome proliferator-activated receptor {delta} is essential in protecting cardiomyocytes from oxidative damage Cardiovasc Res, November 1, 2007; 76(2): 269 - 279. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Kronke, A. Kadl, E. Ikonomu, S. Bluml, A. Furnkranz, I. J. Sarembock, V. N. Bochkov, M. Exner, B. R. Binder, and N. Leitinger Expression of Heme Oxygenase-1 in Human Vascular Cells Is Regulated by Peroxisome Proliferator-Activated Receptors Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1276 - 1282. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kamijo, K. Hora, T. Nakajima, K. Kono, K. Takahashi, Y. Ito, M. Higuchi, K. Kiyosawa, H. Shigematsu, F. J. Gonzalez, et al. Peroxisome Proliferator-Activated Receptor {alpha} Protects against Glomerulonephritis Induced by Long-Term Exposure to the Plasticizer Di-(2-Ethylhexyl)Phthalate J. Am. Soc. Nephrol., January 1, 2007; 18(1): 176 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Jo, C. Yang, Q. Miao, M. Marzec, M. A. Wasik, P. Lu, and Y. L. Wang Peroxisome Proliferator-Activated Receptor {gamma} Promotes Lymphocyte Survival through Its Actions on Cellular Metabolic Activities J. Immunol., September 15, 2006; 177(6): 3737 - 3745. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-H. Liu, J. Qu, and X. Shen Thioredoxin-mediated Negative Autoregulation of Peroxisome Proliferator-activated Receptor {alpha} Transcriptional Activity Mol. Biol. Cell, April 1, 2006; 17(4): 1822 - 1833. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pesant, S. Sueur, P. Dutartre, M. Tallandier, P. A. Grimaldi, L. Rochette, and J.-L. Connat Peroxisome proliferator-activated receptor {delta} (PPAR{delta}) activation protects H9c2 cardiomyoblasts from oxidative stress-induced apoptosis Cardiovasc Res, February 1, 2006; 69(2): 440 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jitrapakdee, M. Slawik, G. Medina-Gomez, M. Campbell, J. C. Wallace, J. K. Sethi, S. O'Rahilly, and A. J. Vidal-Puig The Peroxisome Proliferator-activated Receptor-{gamma} Regulates Murine Pyruvate Carboxylase Gene Expression in Vivo and in Vitro J. Biol. Chem., July 22, 2005; 280(29): 27466 - 27476. [Abstract] [Full Text] [PDF] |
||||
![]() |
K M Eny, A El-Sohemy, M C Cornelis, Y-K Sung, and S-C Bae Catalase and PPARg2 genotype and risk of systemic lupus erythematosus in Koreans Lupus, May 1, 2005; 14(5): 351 - 355. [Abstract] [PDF] |
||||
![]() |
J. Hwang, D. J. Kleinhenz, B. Lassegue, K. K. Griendling, S. Dikalov, and C. M. Hart Peroxisome proliferator-activated receptor-{gamma} ligands regulate endothelial membrane superoxide production Am J Physiol Cell Physiol, April 1, 2005; 288(4): C899 - C905. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chu, H. Lim, L. Brumfield, H. Liu, C. Herring, P. Ulintz, J. K. Reddy, and M. Davison Protein Profiling of Mouse Livers with Peroxisome Proliferator-Activated Receptor {alpha} Activation Mol. Cell. Biol., July 15, 2004; 24(14): 6288 - 6297. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Keen, M. J. Ryan, A. Beyer, S. Mathur, T. E. Scheetz, B. D. Gackle, F. M. Faraci, T. L. Casavant, and C. D. Sigmund Gene expression profiling of potential PPAR{gamma} target genes in mouse aorta Physiol Genomics, June 17, 2004; 18(1): 33 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ammerschlaeger, J. Beigel, K.-U. Klein, and S. O. Mueller Characterization of the Species-Specificity of Peroxisome Proliferators in Rat and Human Hepatocytes Toxicol. Sci., April 1, 2004; 78(2): 229 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Bagi, A. Koller, and G. Kaley PPAR{gamma} activation, by reducing oxidative stress, increases NO bioavailability in coronary arterioles of mice with Type 2 diabetes Am J Physiol Heart Circ Physiol, February 1, 2004; 286(2): H742 - H748. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Q. O'Malley, K. J. Reszka, G. T. Rasmussen, M. Y. Abdalla, G. M. Denning, and B. E. Britigan The Pseudomonas secretory product pyocyanin inhibits catalase activity in human lung epithelial cells Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1077 - L1086. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Meerarani, G. Reiterer, M. Toborek, and B. Hennig Zinc Modulates PPAR{gamma} Signaling and Activation of Porcine Endothelial Cells J. Nutr., October 1, 2003; 133(10): 3058 - 3064. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |