help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0020
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
16/12/2793    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Girnun, G. D.
Right arrow Articles by Robbins, M. E. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Girnun, G. D.
Right arrow Articles by Robbins, M. E. C.
Molecular Endocrinology 16 (12): 2793-2801
Copyright © 2002 by The Endocrine Society

Identification of a Functional Peroxisome Proliferator-Activated Receptor Response Element in the Rat Catalase Promoter

Geoffrey D. Girnun1, Frederick E. Domann, Steven A. Moore and Mike E. C. Robbins

Free Radical and Radiation Biology Program (G.D.G., F.E.D., M.E.C.R.), Department of Radiation Oncology and Department of Pathology (S.A.M.), University of Iowa, Iowa City, Iowa 52242

Address all correspondence and requests for reprints to: Mike E. C. Robbins, Ph.D., Department of Radiation Oncology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina 27157. E-mail: mrobbins{at}wfubmc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Peroxisomal proliferator-activated receptor (PPAR){gamma} has been shown to decrease the inflammatory response via transrepression of proinflammatory transcription factors. However, the identity of PPAR{gamma} responsive genes that decrease the inflammatory response has remained elusive. Because generation of the reactive oxygen species hydrogen peroxide (H2O2) plays a role in the inflammatory process and activation of proinflammatory transcription factors, we wanted to determine whether the antioxidant enzyme catalase might be a PPAR{gamma} target gene. We identified a putative PPAR response element (PPRE) containing the canonical direct repeat 1 motif, AGGTGA-A-AGTTGA, in the rat catalase promoter. In vitro translated PPAR{gamma} and retinoic X receptor-{alpha} proteins were able to bind to the catalase PPRE. Promoter deletion analysis revealed that the PPRE was functional, and a heterologous promoter construct containing a multimerized catalase PPRE demonstrated that the PPRE was necessary and sufficient for PPAR{gamma}-mediated activation. Treatment of microvascular endothelial cells with PPAR{gamma} ligands led to increases in catalase mRNA and activity. These results demonstrate that PPAR{gamma} can alter catalase expression; this occurs via a PPRE in the rat catalase promoter. Thus, in addition to transrepression of proinflammatory transcription factors, PPAR{gamma} may also be modulating catalase expression, and hence down-regulating the inflammatory response via scavenging of reactive oxygen species.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PEROXISOMAL PROLIFERATOR-ACTIVATED RECEPTORS (PPARs) are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors that heterodimerize with the retinoid X receptor (RXR) to regulate gene expression (as reviewed in Refs. 1 and 2). PPAR/RXR heterodimers bind to a DNA recognition motif composed of a direct repeat (DR) spaced by one nucleotide (DR1) with a consensus sequence of RGGTGA-A-AGGTCA. To date, three subtypes of PPARs have been identified: PPAR{alpha} (NR1C1), ß (also called {delta}, NUC1, or FAAR) (NR1C2), and {gamma} (NR1C3) (3). In recent years much attention has been focused on PPAR{gamma} and its role in inflammation. Studies have demonstrated a down-regulation of the inflammatory response after treatment with various PPAR{gamma} agonists in a variety of different cell types and tissues (Refs. 4 and 5 ; see Ref. 2 for review). This protective antiinflammatory function has been shown to reflect the ability of PPAR{gamma} ligands to repress the expression of several proinflammatory genes and cytokines. One mechanism by which PPAR{gamma} accomplishes this appears to be regulated in part by down-regulation of nuclear factor-{kappa}B (NF-{kappa}B), activating protein-1 (AP-1), and signal transducers and activators of transcription-1 (STAT-1)-mediated transcription of proinflammatory genes via transrepression due to competition for transcriptional coactivators (5, 6). PPAR{gamma}-independent effects have also been observed with the natural PPAR{gamma} ligand 15-deoxy-{Delta}12,14-prostaglandin J2 via inhibition of I{kappa}B kinase through covalent modification (7, 8). In addition there is the potential that as yet unidentified PPAR{gamma}-responsive antiinflammatory genes may be responsible.

Reactive oxygen species (ROS) such as the superoxide radical, hydrogen peroxide (H2O2), and hydroxyl radical are generated during normal metabolism in all aerobic cells as well as after oxidative stress (9, 10). ROS have been shown to play a role in the pathogenesis and resultant morbidity of several different inflammatory disease states including rheumatoid arthritis, ischemia/reperfusion injury, and atherosclerosis. These effects are mediated in part via activation of NF-{kappa}B, STAT, and AP-1 transcription factors by ROS leading to an up-regulation of proinflammatory genes and cytokines (11, 12, 13, 14, 15). Cells have developed a number of protective antioxidant enzymes to scavenge these potentially toxic molecules. Catalase, along with the superoxide dismutases and glutathione peroxidases, plays an important role in protecting cells from oxidative stress.

Catalase is an antioxidant enzyme that catalyzes the dismutation of H2O2 to oxygen and water (16). In most mammalian tissues catalase is contained predominantly within peroxisomes, cellular organelles responsible for several important metabolic functions, including ß-oxidation of long-chain fatty acids (17). Because peroxisomal fatty acid ß-oxidation generates large amounts of H2O2, the presence of catalase is required to protect cells against this toxic ROS. In addition, recent evidence indicates that overexpression of catalase both in vitro and in vivo can inhibit NF-{kappa}B activation and protect cells and tissues from inflammatory and oxidant insults (18, 19).

Catalase was among the first enzymes to be discovered, and its biochemical function has been extensively characterized. In contrast, little is known regarding transcriptional regulation of the catalase gene in mammalian cells (20, 21, 22, 23). Given that PPAR{gamma} has been shown to protect against inflammatory insult, we tested the hypothesis that PPAR{gamma} is involved in the regulation of catalase. We report here that PPAR{gamma} ligands can indeed increase catalase mRNA and activity, and this is mediated via a functional PPAR response element (PPRE) in the rat catalase promoter.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The Rat Catalase Promoter Contains a Putative PPRE
As a first step to determining the potential regulation of catalase by PPAR{gamma}, we examined the 5'-proximal promoter region (~5000 bp) of catalase for a potential PPRE using the GCG Wisconsin package. We identified a putative PPRE in the rat catalase promoter located at nucleotide (nt) -1027 to -1015 with respect to the translation start site (Fig. 1Go). The putative catalase PPRE has a DR1 sequence similar to the consensus PPRE for known PPAR target genes (Table 1Go).



View larger version (76K):
[in this window]
[in a new window]
 
Figure 1. Identification of a Putative PPRE in the Rat Catalase Promoter

The PPRE is bold and underlined. The translation start site is in bold. See Ref. 21 for other putative transcription factor binding sites.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of Identified PPRE Sequences1

 
PPAR/RXR Heterodimers Bind to the Putative Catalase PPRE
To demonstrate direct binding of PPAR/RXR heterodimers to the putative catalase PPRE, we used EMSAs. A double-stranded oligonucleotide probe was end labeled with 32P and incubated with in vitro translated PPAR{gamma} and RXR{alpha}. Neither PPAR{gamma} nor RXR{alpha} alone bound to the catalase PPRE oligonucleotide (data not shown). However, PPAR{gamma}/RXR{alpha} heterodimers bound to the catalase PPRE oligonucleotide (Fig. 2Go, lane 2). This binding was specific as it could be competed out with unlabeled catalase PPRE oligonucleotide (Fig. 2Go, lanes 3–5) or incubation with a PPRE from the ACOX promoter (Fig. 2Go, lanes 6–8). In contrast, an excess of a nonspecific double-stranded oligonucleotide (NF-{kappa}B) did not displace the labeled catalase PPRE oligonucleotide (Fig. 2Go, lane 9).



View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. PPAR{gamma}/RXR{alpha} Heterodimers Bind to the Catalase PPRE

PPAR{gamma} and RXR{alpha} in vitro translated proteins were incubated with 32P-labeled catalase PPRE and electrophoresed on a 5% nondenaturing polyacylamide gel (lanes 2–9). Reactions were incubated with 5- to 25-fold excess cold catalase PPRE (lanes 3–5), and cold ACOX PPRE (lanes 6–8) and 25-fold excess cold NF-{kappa}B response element (lane 9) to determine affinity and specificity of binding. Gels were wrapped in plastic wrap and exposed to film at -80 C. UL, Unprogrammed lysate (lane 10).

 
The Rat Catalase Promoter Contains a Functional PPRE
Although PPAR{gamma}/RXR heterodimers are able to bind to the putative catalase PPRE, this does not demonstrate that the catalase PPRE is functional. To determine the functionality of the putative PPRE in the rat catalase promoter, we transfected a series of promoter deletion constructs (Fig. 3Go) into COS-1 cells in the presence of exogenous PPAR{gamma}2 expression vector and the PPAR{gamma} ligand rosiglitazone.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 3. Map of Promoter Deletions Cloned into the pGL3-Basic Reporter Vector

Numbers are given with reference to the translation start site.

 
The fragment containing the putative PPRE (rCTLS-1048) increased reporter gene activity by greater than 4-fold in the presence of PPAR{gamma} ligand (Fig. 4AGo). Indeed, deletion of the region containing the PPRE of the catalase promoter abolished the response to 5 µM rosiglitazone. To further establish the role of PPAR{gamma}, we transfected the COS-1 cells with the rCTLS-1048 in the presence and absence of exogenous PPAR{gamma} using the PPAR{gamma}2 expression vector. Figure 4BGo demonstrates that the rCTLS-1048 fragment was not capable of increasing reporter activity in the absence of exogenous PPAR{gamma}2. The addition of exogenous PPAR{gamma}2 greatly increased reporter activity, which was even further enhanced by the addition of rosiglitazone. This indicates that a region between nt -1048 and -938 is PPAR{gamma} responsive. Within this region is the PPRE we identified at nt -1027 to -1015.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. A PPAR{gamma}-Responsive Element Lies Between nt -1048 and -938 of the Rat Catalase Promoter

A, COS-1 cells were transfected with a PPAR{gamma}2 expression vector as well as the indicated reporter constructs followed by treatment with vehicle alone (dotted bars) or 5 µM rosiglitazone (solid bars). *, P < 0.005 vs. vehicle control containing the same reporter construct. B, COS-1 cells were transfected with the rCTLS-1048 construct in the presence or absence of a the PPAR{gamma}2 expression vector, followed by treatment with vehicle alone or 5 µM rosiglitazone. A CMV-ß-gal expression vector was used to control for transfection efficiency. Luciferase activity is normalized to ß-gal levels, and values are normalized to the activity of the pGL3-basic vector. Data are representative of at least two independent experiments, n = 3 ± SD. *, P < 0.01; **, P < 0.005 vs. vehicle control containing the same reporter construct.

 
PPAR{gamma} forms heterodimers with RXRs and synergistically activates reporter genes when both receptors are activated by their respective ligands (24, 25). To determine whether the rat catalase PPRE could be similarly activated, we supplemented the transfected cells with rosiglitazone and the RXR-specific ligand LG268 either alone or together. As shown in Fig. 5Go, LG268 increased reporter gene activity 50% (not statistically significant). Rosiglitazone on its own increased reporter gene activity 3-fold (similar to that seen in Fig. 4AGo compared with rCTLS-1048 fragment without ligand). However, the two ligands together increased reporter gene activity greater than 7-fold. These data provide further support for the hypothesis that PPAR{gamma} participates in the regulation of catalase expression.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 5. PPAR{gamma} and RXR Ligands Act Synergistically to Enhance Rat Catalase Promoter Activity

COS-1 cells were transfected with a PPAR{gamma}2 expression vector as well as the rCTLS-1048 reporter construct and treated with 5 µM rosiglitazone, 2.5 µM LG268, alone or together. CMV-ß-gal was used to control for transfection efficiency. Luciferase activity is normalized to ß-gal levels and to activity of the rCTLS-1048 reporter construct treated with vehicle alone. n = 3 ± SD; ANOVA; P< 0.0001; *, P < 0.005; **, P < 0.0001 vs. vehicle control.

 
To determine whether the catalase PPRE alone was sufficient to enhance PPAR{gamma}-stimulated promoter activity, we constructed a heterologous promoter containing a tandem tripeat of the catalase PPRE (DR1x3). COS-1 cells were transfected with the DR1x3 or empty vector, PPAR{gamma}2, and cytomegalovirus-ß-galactosidase (CMV-ß-gal) expression vectors. The DR1x3 construct in the absence of ligand had significantly greater activity than the empty vector alone (Fig. 6Go). The addition of 0.1 or 1 µM rosiglitazone increased reporter activity more than 5- and 10-fold over the empty vector, respectively (2.5- and 4-fold compared with the DR1x3 vehicle control). However, in the absence of exogenous PPAR{gamma}, there was not a significant increase in reporter activity. This indicates that the PPRE present in the rat catalase promoter is regulated by PPAR{gamma}, and that this PPRE is necessary and sufficient for PPAR{gamma}-mediated activity.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. The Catalase PPRE Is a Functional DR1

The pTal-Luc empty reporter construct or a tandem tripeat of the catalase PPRE was fused to a minimal promoter reporter construct and transfected into COS-1 cells with or without PPAR{gamma}2 expression vector and CMV-ß-gal as an internal control. Cells were then treated with 0.1 or 1.0 µM rosiglitazone and luciferase activity was determined. n = 3 ± SD; *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. pTal-luc vehicle control.

 
Catalase mRNA Accumulation and Activity Are Induced by PPAR{gamma} Agonists
While the EMSAs and reporter assays demonstrate the ability of PPAR{gamma} to bind to and activate the PPRE in the catalase promoter, we wanted to determine whether PPAR{gamma} activation could alter catalase mRNA expression. For these experiments we used rat brain microvascular endothelial (RBMECs) cells, one of the cell types damaged during acute and chronic inflammatory responses as a result of ROS generation (26, 27). We performed immunoblotting for PPAR{gamma} in the RBMECs to determine whether PPAR{gamma} was present. Indeed, as shown in Fig. 7Go, the PPAR{gamma}2 isoform appears to be the main isoform present. While the expression of PPAR{gamma}2 has usually been associated with adipose tissue, studies have shown that other cell types such as endothelial cells express PPAR{gamma}2 (28, 29). RBMECs were then supplemented with either of two different PPAR{gamma} agonists: ciglitazone or rosiglitazone. Treatment of cells with 5–20 µM of the low-affinity PPAR{gamma} agonist, ciglitazone, caused a dose-dependent increase in catalase mRNA (Fig. 8AGo). The high-affinity PPAR{gamma} agonist, rosiglitazone, increased catalase mRNA to a greater extent than the highest dose of ciglitazone. Catalase steady state mRNA levels increased 3-fold after 5 µM rosiglitazone, whereas 20 µM ciglitazone produced a 2-fold induction of catalase. Thus, two different PPAR{gamma} agonists can increase catalase mRNA expression. To determine the functionality of the catalase PPRE in this cell type, we transfected the RBMECs with the rCTLS-1048 fragment, without adding exogenous PPAR{gamma} expression vector and performed reporter assays. We observed a 2-fold increase in reporter activity in the absence of exogenously added RXR, once again demonstrating the functionality of the catalase PPRE and the presence of endogenous PPAR{gamma} (Fig. 8BGo).



View larger version (8K):
[in this window]
[in a new window]
 
Figure 7. Presence of PPAR{gamma} Protein in RBMECs

Western blot for PPAR{gamma} from whole-cell lysates of RBMECs (lane 3). In vitro translated PPAR{gamma}1 (lane 1) and PPAR{gamma}2 (lane 2) were used as a control. Western blotting was performed as described in Materials and Methods.

 


View larger version (25K):
[in this window]
[in a new window]
 
Figure 8. Increased Catalase mRNA and Reporter Activity in RBMECs after Treatment with PPAR{gamma} Ligands

A, RBMECs were treated with vehicle, 5, 10, or 20 µM ciglitazone, or 5 µM rosiglitazone for 48 h. Total RNA (10 µg) was analyzed by Northern blot analysis for catalase and the housekeeping gene cyclophilin as described in Materials and Methods. Fold induction compared with vehicle control is shown under lanes. Representative of experiment performed at least two times. B, Endogenous PPAR{gamma} is capable of activating the CTLS-1048 reporter construct. RBMECs were transfected with the rCTLS-1048 deletion construct without additional expression vectors followed by treatment with vehicle alone or 5 µM rosiglitazone. A CMV-ß-gal expression vector was used to control for transfection efficiency. Luciferase activity is normalized to ß-gal levels. Data are representative of at least two independent experiments, n = 3 ± SD. *, P < 0.005 vs. vehicle control.

 
The data presented demonstrate that PPAR{gamma} agonists are capable of increasing catalase promoter activity and mRNA levels. To determine whether this also leads to increased catalase function, catalase enzymatic activity assays were performed on RBMECs after rosiglitazone treatment. Catalase activity in control RBMECs was 110 ± 10.5 K/g protein. After treatment with 10 and 20 µM rosiglitazone for 48 h, activities increased significantly to 219 ± 7.1 and 277 ± 9.3 K/g protein, respectively (Fig. 9Go). Thus, PPAR{gamma} ligands appear to increase not only the transcription of catalase mRNA, but also the enzymatic activity of the protein as well.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 9. PPAR{gamma} Activation Increases Catalase Enzymatic Activity

RBMECs were treated with 10 or 20 µM rosiglitazone or vehicle control for 48 h. Total cell lysates were isolated and catalase enzymatic activity was performed as described in Materials and Methods. n = 3 ± SD. *, P < 0.0005; **, P < 0.00005 vs. vehicle control.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Studies in recent years have demonstrated that PPAR{gamma}-mediated down-regulation of proinflammatory genes such as inducible nitric oxide synthase and cyclooxygenase-2 is attributed to squelching of coactivators, which leads to transrepression of the transcription factors AP-1, STAT-1, and NF-{kappa}B (5, 6). These previous studies elegantly demonstrated mechanisms by which PPAR{gamma} was antiinflammatory. However, they failed to identify a PPAR{gamma}-responsive gene that could protect cells from inflammatory conditions. Several proinflammatory genes such as inducible nitric oxide synthase and cyclooxygenase-2 and various cytokines are up-regulated by ROS (30, 31). The mechanism by which this is thought to occur is via redox regulation of proinflammatory transcriptions factors such as AP-1, NF-{kappa}B, and STAT-1 (11, 14, 15). Indeed, H2O2 has been implicated as playing a major role in these processes. Furthermore, it has been demonstrated that overexpression of catalase as well as other antioxidants can protect against these inflammatory events (18, 19, 32, 33).

In this report, we identify a functional PPRE in the rat catalase 5'-flanking region located between nt -1027 and -1015 with respect to the translation start site. This PPRE contained the canonical DR1 motif spaced by an adenine and varied from the consensus sequence by only three nucleotides. We also demonstrated the ability of two different PPAR{gamma} ligands to increase catalase mRNA expression. A PPAR{gamma}-specific effect is suggested because the induction with the higher affinity ligand, rosiglitazone, was greater than with the lower affinity ligand, ciglitazone (34). In support of our data demonstrating that in vitro PPAR{gamma} ligands can increase catalase expression, Way et al. (35) recently demonstrated in vivo that a nonthiazolidinedione PPAR{gamma} ligand can increase catalase expression in tissues that contain PPAR{gamma}. The full significance of the induction of catalase by PPAR{gamma} is evidenced by the dose-dependent increase in catalase enzymatic activity currently observed after incubation of RBMECs with rosiglitazone. While only a 2- to 3-fold increase in catalase activity was observed, the kinetics of H2O2 dismutation to water and oxygen by catalase are almost diffusion rate limited (36). Thus, a relatively small change in its activity would have a profound functional effect.

Little is known regarding transcriptional control of catalase expression in mammalian cells. The rat catalase gene is a single-copy gene with 13 exons and 12 introns spanning 33 kb that possesses multiple transcription initiation sites (37). The promoter region of the gene lacks a TATA box and an initiator consensus sequence. However, characteristic of promoters lacking a TATA box, there are multiple CCAAT boxes and GC boxes (38). Studies have shown that decreased catalase activity, protein, and mRNA are due to decreased transcription (39, 40). Regulatory mechanisms may involve response elements in the 5'-flanking region. The marked decrease in catalase activity observed in tumor cell lines is thought to reflect, in part, the presence of a silencer element present in the 5'-flanking region of the catalase gene (41). In addition, other negative and/or positive regulatory elements have also been hypothesized (20, 22). However, in addition to the identification of a functional stimulating protein 1 site, little is known regarding the function of cis-elements within the catalase promoter that participate in its transcriptional regulation (41).

The current data demonstrate that catalase is a PPAR{gamma} target gene and suggest an additional and complimentary mechanism by which PPAR{gamma} might exert antiinflammatory effects. Thus, in addition to transrepression of AP-1, NF-{kappa}B, or STAT-1 activities as demonstrated by others, PPAR{gamma} may exert a protective effect by increasing catalase expression, resulting in decreased intracellular H2O2, which itself can activate these transcription factors. Although further functional studies are needed, our findings have important implications not only for the mechanism(s) by which PPAR{gamma} can protect against inflammatory related diseases, but also in understanding the regulation of mammalian catalase.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
RBMECs were isolated from newborn Sprague Dawley rat pups (Harlan Sprague Dawley, Inc., Indianapolis, IN) as previously described (42). Cells were maintained in MEM (Life Technologies, Inc., Gaithersburg, MD) with 1% L-glutamine, 10% fetal bovine serum, and 6 g/liter glucose at 37 C. Cells were passaged once per week and used at passage 10–17. Cos-1 cells were maintained in DMEM with 1% L-glutamine and 10% fetal bovine serum.

RXR Expression Vector Generation
RT-PCR methodology was used to generate a full-length mouse RXR{alpha} expression vector from mouse liver RNA. The upstream primer, 5'-GGGCATGAGTTAGTCGCAG-3', and downstream primer, 5'-ACACTGCACCCCAAAGATC-3' (GenBank accession no. X66223), were used. PCR conditions were as follows: 94 C for 4 min, then 35 cycles of 94 C for 1 min, 62.5 C for 1 min, and 72 C for 1.5 min, and a final elongation step of 7 min at 72 C. The PCR products were analyzed on a 1% low-melting point agarose gel, and a single band corresponding to the expected size of the RXR{alpha} PCR product (1534 bp) was isolated using a QIAGEN (Chatsworth, CA) gel extraction kit. The RXR{alpha} cDNA was captured into the pTargeT mammalian expression vector (Promega Corp., Madison, WI) according to manufacturer’s directions, and the identity of the cDNA was verified by sequencing. The PPAR{gamma}2 cDNA was generously provided by Dr. Bruce Spiegelman (Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA).

Promoter Reporter Construction
Total genomic DNA was isolated from the RBMECs using DNAzol reagent (Life Technologies, Inc.) according to manufacturer’s directions, and restricted with EcoRI, and the DNA was isolated using the QIAGEN Qiamp Tissue Kit according to the manufacturer’s directions. For PCR the following primers were used: rCTLS-1048, ACAGCCCACA GCCCATAATC (3641–3660); rCTLS-938, ATTGATTAAAATGAAAAATAAGCGAC (3751–3776); rCTLS-592, CTGATGCTAGACACTCAACC (3997–4017). The number after rCTLS indicates length of the construct with respect to the translation start site, and the numbers in parentheses indicate location of primers designating the first nucleotide of the published sequence (GenBank accession no. M25669) as bp 1. A common downstream primer, CAGATGAAGCAGTGGAAGGA (4719–4738), was used with all the upstream primers. The translation start site is located at base 4689 (Fig. 1Go).

PCR was performed using the following conditions: 95 C for 4 min, and then 35 cycles of 94 C for 1 min, 60 C for 1 min, and 72 C for 1.5 min with a final elongation step of 72 C for 7 min. PCR products were ligated into a pCR2.1 TA-TOPO cloning vector according to the manufacturer’s directions (Invitrogen, San Diego, CA). The identities of the fragments were confirmed by sequencing. Sequences were identical to the published sequence (22, 37). The promoter fragments in the pCR2.1 vector were then directionally subcloned into the KpnI and XhoI sites of the pGL3-basic reporter constructs and then resequenced.

Construction of Heterologous Catalase DR1 Reporter Construct
An oligonucleotide containing three direct tandem repeats of TAATCAAGGTGAAAGTTGAGAAG (DR1x3) was synthesized with KpnI and XhoI restriction sites on its 5'- and 3'-ends, respectively, with 6-bp extensions beyond the restriction sites. The upstream and downstream DR1x3 was annealed and then restricted with KpnI and XhoI, gel isolated, and ligated into the Kpn/Xho sites of the pTal-luc minimal promoter reporter construct (CLONTECH Laboratories, Inc., Palo Alto, CA). Fidelity was confirmed by sequencing.

Western Blot Analysis
Total protein was isolated, separated on a 10% polyacrylamide gel, and transferred to nitrocellulose as previously described (43). Three microliters of in vitro translated PPAR{gamma}1 or PPAR{gamma}2 were used as a control. Membranes were blotted for PPAR{gamma} using a mouse monoclonal antibody for PPAR{gamma} (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) that recognizes both PPAR{gamma}1 and PPAR{gamma}2 and visualized using ECL reagent (Amersham Pharmacia Biotech, Arlington Heights, IL).

Northern Blot Analysis
RBMECs were grown in 100-mm dishes until 70% confluent and then supplemented with ciglitazone (BIOMOL Research Laboratories, Inc., Plymouth Meeting, PA) or rosiglitazone (a kind gift from Dr. Richard Heyman, Ligand Pharmaceuticals, Inc., San Diego, CA). Total RNA was isolated using RNA STAT-60 isolation reagent (Tel-Test "B") according to manufacturer’s directions (Tel-Test, Friendswood, TX). A rat catalase partial cDNA was constructed by RT-PCR of total RNA from RBMECs using the sense primer 5'-AAACCCGATGTCCTGACCAG-3' and antisense primer 5'-CCTTTGCCTTGGAGTATCTGG-3' with the Expand HiFi PCR System (Roche Molecular Biochemicals, Indianapolis, IN). The following PCR conditions were used: 94 C for 5 min, and then 35 cycles of 94 C for 1 min, 64 C for 30 sec, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min. The resulting 228-bp fragment was ligated into a pCR2.1 TA cloning vector (Invitrogen) according to the manufacturer’s directions. The identity of the PCR fragment was confirmed by sequencing (DNA Core Facility, University of Iowa). 32P-labeled catalase cDNA probe was made by random-primer labeling of 50 ng of rat catalase cDNA EcoRI fragment. Total RNA (10 µg) was subjected to Northern blotting as previously described (43). Membranes were stripped and reprobed with the housekeeping gene cyclophilin as a control for loading and transfer. Blots were quantified by densitometry performed at the Image Analysis Facility at the University of Iowa.

Nuclear Protein Isolation and EMSA
Nuclear extracts were isolated by a modified method of Dignam and colleagues (44, 45). Cells were rinsed in cold 1x PBS and then scraped into ice-cold buffer A [10 mM HEPES, 1.5 mM MgCl2, 10 mM dithiothreitol (DTT)] and incubated on ice for 20 min. Cells were then Dounce homogenized and checked microscopically for cell lysis. Nuclei were then isolated by centrifugation at 5000 rpm for 30 sec at 4 C and supernatant was removed (performed twice). The nuclear pellets were resuspended in ice-cold buffer C [20 mM HEPES, 25% glycerol (vol/vol), 0.42 NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonylfluoride, 0.5 mM DTT] and incubated on ice for 15 min. The suspensions were centrifuged at 10,000 x g for 5 min and supernatants were removed and diluted into ice-cold buffer D (20 mM HEPES, 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonylfluoride, 0.5 mM DTT). Nuclear extracts were then stored at -80 C.

In vitro translation of PPAR{gamma}2 and RXR{alpha} were carried out with the Promega Corp. TNT-coupled system according to manufacturer’s directions. The reaction was also carried out in the presence of 35S-methionine, separated by SDS-PAGE, gel dried, and exposed to film to verify translation of the correct size protein (data not shown). For EMSA the following upstream and downstream oligonucleotides were used: acyl-coenzyme A oxidase PPRE (ACOX-PPRE) (46): 5'-AGCTGGGACCAGGACAAAGGTCACGTT-3', 5'-GATCAACGTGACCTTTGTCCTGGTCCC-3'; rat catalase putative DR-1: 5'-AGCTTAATCAAGGTGAAAGTTGAGAAG-3', GATCCTTCTCAACTTTCACCTTGATTA, and an NF{kappa}B response element: 5'-AGCTAACTCGGGGCTTTCTGC-3', 5'-GATCGCAGAAAGCCCCGAGTT-3'. The imperfect PPREs are underlined as well as the NF-{kappa}B site. Probes for EMSA were made as previously described (45). Nuclear extracts (1–10 µg) or 1 µl of in vitro transcribed/translated protein were incubated with 1 µg poly(deoxyinosine-deoxycytidine) (Pharmacia Biotech, Piscataway, NJ), gel shift buffer (10 mM Tris, pH 7.5; 4% glycerol; 50 mM NaCl; 1 mM MgCl2; 0.5 mM EDTA; 0.5 mM DTT) and 32P-labeled probes. Bound DNA complexes were separated from free probe by PAGE on a 5% native gel at 15 mA for 1 h in 1x Tris-buffered EDTA. Gels were wrapped in Saran wrap and exposed to x-ray film at -80 C.

Transfections and Reporter Assays
COS-1 cells were seeded into six-well culture plates (Corning, Inc., Corning, NY). Cells were then transfected with 200 ng of the various catalase promoter deletions or empty pGL3 vector using Superfect according to manufacturer’s directions (QIAGEN). PCMV-ß-gal plasmid (100 ng) was included in each transfection to control for transfection efficiency. Except where noted, 100 ng of PPAR{gamma}2 were also cotransfected. The cells were treated for 36 h with the rosiglitazone and/or LG268 (a kind gift from Dr. Richard Heyman, Ligand Pharmaceuticals, Inc.). Luciferase activity was measured on a luminometer (Lumat LB 9507, EG&G Berthold, Oak Ridge, TN) and ß-galactosidase (ß-gal) activity was determined according to the manufacturer’s specifications (Promega Corp.). Luciferase activity was normalized to ß-gal activity.

COS-1 cells were also transfected with PPAR{gamma}2 expression vector and CMV-ß-gal along with pTal-luc empty vector or vector containing the catalase DR1x3, as described above. Cells were treated with vehicle control, 0.1 µM or 1.0 µM rosiglitazone, and assayed after 24 h on a luminometer. Luciferase activity was normalized to ß-gal activity.

Catalase Activity Analysis
RBMECs were supplemented with 10 or 20 µM rosiglitazone for 48 h. Whole-cell extracts were isolated as previously described (47). Catalase activity was performed as described by Clairborne (48). In brief, 200 µg of protein were added to a cuvette containing 50 mM phosphate buffer (pH 7.8), and H2O2 was added to a final concentration of 10 mM. The disappearance of H2O2, as determined by its absorbance at 240 nM, was measured immediately at 30-sec intervals for 1 min. Activity was expressed as units per gram of protein (K/g).


    FOOTNOTES
 
This work was supported by American Institute for Cancer Research Grant 99BB094 and National Cancer Institute Grant CA-82722 (to M.E.C.R.); NIH Grants CA-73612 and CA-66081 (to F.E.D.); and Grant NS-24621 (National Institute of Neurological Diseases and Stroke; to S.A.M.).

1 Current Address: Geoffrey Girnun, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, Massachusetts 02115. Back

Abbreviations: AP-1, Activator protein 1; CMV-ß-gal, cytomegalovirus-ß-galactosidase; DR, direct repeat; DR1, DR spaced by one nt; DTT, dithiothreitol; NF-{kappa}B, nuclear factor-{kappa}B; nt, nucleotide; PPAR, peroxisomal proliferator-activated receptor; PPRE, PPAR response elemet; RBMECs, rat brain microvascular endothelial cells; ROS, reactive oxygen species; RXR, retinoid X receptor; STAT, signal transducer and activator of transcription.

Received for publication January 15, 2002. Accepted for publication August 16, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Lemberger T, Desvergne B, Wahli W 1996 Peroxisome proliferator-activated receptors: a nuclear receptor signaling pathway in lipid physiology. Annu Rev Cell Dev Biol 12:335–363[CrossRef][Medline]
  2. Delerive P, Fruchart JC, Staels B 2001 Peroxisome proliferator-activated receptors in inflammation control. J Endocrinol 169:453–459[Abstract]
  3. Nuclear Receptors Nomenclature Committee 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161–163[CrossRef][Medline]
  4. Jiang C, Ting AT, Seed B 1998 PPAR-{gamma} agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82–86[CrossRef][Medline]
  5. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK 1998 The peroxisome proliferator-activated receptor-{gamma} is a negative regulator of macrophage activation. Nature 391:79–82[CrossRef][Medline]
  6. Li M, Pascual G, Glass CK 2000 Peroxisome proliferator-activated receptor {gamma}-dependent repression of the inducible nitric oxide synthase gene. Mol Cell Biol 20:4699–4707[Abstract/Free Full Text]
  7. Rossi A, Kapahi P, Natoli G, Takahashi T, Chen Y, Karin M, Santoro MG 2000 Anti-inflammatory cyclopentanone prostaglandins are direct inhibitors of I{kappa}B kinase. Nature 403:103–108[CrossRef][Medline]
  8. Straus DS, Pascual G, Li M, Welch JS, Ricote M, Hsiang CH, Sengchanthalangsy LL, Ghosh G, Glass CK 2000 15-Deoxy-{Delta}12,14-prostaglandin J2 inhibits multiple steps in the NF-{kappa}B signalling pathway. Proc Natl Acad Sci USA 97:4844–4849[Abstract/Free Full Text]
  9. Halliwell B, Gutteridge JMC 1989 Free radicals in biology and medicine. New York: Clarendon Press
  10. Ames BN, Shigenaga MK, Hagen TM 1994 Oxidants, antioxidants, and the degenerative diseases of aging. Proc Natl Acad Sci USA 90:7915–7922[Abstract/Free Full Text]
  11. Sun Y, Oberley LW 1996 Redox regulation of transcriptional activators. Free Radic Biol Med 21:335–348[CrossRef][Medline]
  12. Janssen-Heininger YM, Poynter ME, Baeuerle PA 2000 Recent advances towards understanding redox mechanisms in the activation of nuclear factor {kappa}B. Free Radic Biol Med 28:1317–1327[CrossRef][Medline]
  13. Flohe L, Brigelius-Flohé R, Saliou C, Traber MG, Packer L 1997 Redox regulation of NF-{kappa}B activation. Free Radic Biol Med 22:1115–1126[CrossRef][Medline]
  14. Schmidt KN, Amstad PA, Cerutti P, Baeuerle PA 1995 The roles of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF-{kappa}B. Chem Biol 2:13–22[CrossRef][Medline]
  15. Simon AR, Rai U, Fanburg BL, Cochran BH 1998 Activation of the JAK-STAT pathway by reactive oxygen species. Am J Physiol 275:C1640–C1652
  16. Aebi H 1984 Catalase in vitro. Methods Enzymol 105:121–126[Medline]
  17. Kunau W-H, Dommes V, Schulz H 1995 ß-Oxidation of fatty acids in mitochondria, peroxisomes, and bacteria: a century of continued progress. Prog Lipid Res 34:267–342[CrossRef][Medline]
  18. Nilakantan V, Spear BT, Glauert HP 1998 Liver specific catalase expression in transgenic mice inhibits NF-{kappa}B activation and DNA synthesis induced by peroxisome proliferator ciprofibrate. Carcinogenesis 19:631–637[Abstract/Free Full Text]
  19. Benhamou PY, Moriscot C, Richard MJ, Beatrix O, Badet L, Pattou F, Kerr-Conte J, Chroboczek J, Lemarchand P, Halimi S 1998 Adenovirus-mediated catalase gene transfer reduces oxidant stress in human, porcine and rat pancreatic islets. Diabetologia 41:1093–1100[CrossRef][Medline]
  20. Toda H, Takeuchi T, Hori N, Ito K, Sato K 1997 Inverted repeats in the TATA-less promoter of the rat catalase gene. J Biochem 121:1035–1040[Abstract/Free Full Text]
  21. Sato K, Ito K, Kohara H, Yamaguchi Y, Adachi K, Endo H 1992 Negative regulation of catalase gene expression in hepatoma cells. Mol Cell Biol 12:2525–2533[Abstract/Free Full Text]
  22. Van Remmen H, Williams MD, Yang H, Walter CA, Richardson A 1998 Analysis of the transcriptional activity of the 5'-flanking region of the rat catalase gene in transiently transfected cells and in transgenic mice. J Cell Physiol 174:18–26[CrossRef][Medline]
  23. Reimer DL, Bailley J, Singh SM 1994 Complete cDNA and 5' genomic sequences and multilevel regulation of the mouse catalase gene. Genomics 21:325–336[CrossRef][Medline]
  24. Schulman IG, Shao G, Heyman RA 1998 Transactivation by retinoid X receptor-peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) heterodimers: intermolecular synergy requires only the PPAR{gamma} hormone-dependent activation function. Mol Cell Biol 18:3483–3494[Abstract/Free Full Text]
  25. Kliewer SA, Umesono K, Noonan DJ, Heyman RA, Evans RM 1992 Convergence of 9-cis retinoic acid and peroxisome proliferator signalling pathways through heterodimer formation of their receptors. Nature 358:771–774[CrossRef][Medline]
  26. Lum H, Roebuck KA 2001 Oxidant stress and endothelial cell dysfunction. Am J Physiol 280:C719–C741
  27. Stevens T, Garcia JG, Shasby DM, Bhattacharya J, Malik AB 2000 Mechanisms regulating endothelial cell barrier function. Am J Physiol 279:L419–L422
  28. Xin X, Yang S, Kowalski J, Gerritsen ME 1999 Peroxisome proliferator-activated receptor {gamma} ligands are potent inhibitors of angiogenesis in vitro and in vivo. J Biol Chem 274:9116–9121[Abstract/Free Full Text]
  29. Marx N, Bourcier T, Sukhova GK, Libby P, Plutzky J 1999 PPAR{gamma} activation in human endothelial cells increases plasminogen activator inhibitor type-1 expression: PPAR{gamma} as a potential mediator in vascular disease. Arterioscler Thromb Vasc Biol 19:546–551[Abstract/Free Full Text]
  30. Lander HM 1997 An essential role for free radicals and derived species in signal transduction. FASEB J 11:118–124[Abstract]
  31. Milligan SA, Owens MW, Grisham MB 1996 Augmentation of cytokine-induced nitric oxide synthesis by hydrogen peroxide. Am J Physiol 271:L114–L120
  32. Wong GH, Elwell JH, Oberley LW, Goedel DV 1989 Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor. Cell 58:923–931[CrossRef][Medline]
  33. Hirose K, Longo DL, Oppenheim JJ, Matsushima K 1993 Overexpression of mitochondrial manganese superoxide dismutase promotes the survival of tumor cells exposed to interleukin-1, tumor necrosis factor, selected anticancer drugs, and ionizing radiation. FASEB J 7:361–368[Abstract]
  34. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  35. Way JM, Harrington WW, Brown KK, Gottschalk WK, Sundseth SS, Mansfield TA, Ramachandran RK, Willson TM, Kliewer SA 2001 Comprehensive messenger ribonucleic acid profiling reveals that peroxisome proliferator-activated receptor {gamma} activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142:1269–1277[Abstract/Free Full Text]
  36. Chance B, Oshino N 1971 Kinetics and mechanism of catalase in peroxisomes of the mitochondrial fraction. Biochem J 122:225–233[Medline]
  37. Nakashimi H, Yamamoto M, Goto K, Osumi T, Hashimoto T, Endo H 1989 Isolation and characterization of the rat catalase-encoding gene. Gene 79:279–288[CrossRef][Medline]
  38. Blake MC, Jambou RC, Swick AG, Kahn JW, Azizkhan JC 1990 Transcriptional initiation is controlled by upstream GC-box interactions in a TATA-less promoter. Mol Cell Biol 10:6632–6641[Abstract/Free Full Text]
  39. Yamaguchi Y, Sato, K, Endo H 1992 Depression of catalase gene expression in the liver of tumor bearing nude mice. Biochem Biophys Res Commun 189:1084–1089[CrossRef][Medline]
  40. Sun Y, Colburn NH, Oberley LW 1993 Depression of catalase gene expression after immortalization and transformation of mouse liver cells. Carcinogenesis 14:1505–1510[Abstract/Free Full Text]
  41. Tate DJ, Miceli M.V, Newsome DA 1997 Zinc induces catalase expression in cultured fetal human retinal pigment epithelial cells. Curr Eye Res 16:1017–1023[CrossRef][Medline]
  42. Moore SA, Yoder E, Spector AA 1990 Role of blood-brain barrier in the formation of long-chain {omega}-3 and {omega}-6 fatty acids from essential fatty acid precursors. J Neurochem 55:391–402[CrossRef][Medline]
  43. Rich G, Yoder EJ, Moore SA 1998 Regulation of prostaglandin H synthase-2 expression in cerebromicrovascular smooth muscle by serum and epidermal growth factor. J Cell Physiol 176:495–505[CrossRef][Medline]
  44. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  45. Peng J, Bowden GT, Domann FE 1997 Activation of AP-1 by okadaic acid in mouse keratinocytes associated with hyperphosphorylation of c-jun. Mol Carcinog 18:37–43[CrossRef][Medline]
  46. Tugwood JD, Issemann I, Anderson RG, Bundell KR, McPheat WL, Green S 1992 The mouse peroxisome proliferator activated receptor recognizes a response element in the 5' flanking sequence of the rat acyl CoA oxidase gene. EMBO J 11:433–439[Medline]
  47. Preuss M, Girnun GD, Darby CJ, Khoo N, Spector AA, Robbins ME 2000 Role of antioxidant enzyme expression in the selective cytotoxic response of glioma cells to {gamma}-linolenic acid supplementation. Free Radic Biol Med 28:1143–1156[CrossRef][Medline]
  48. Clairborne A 1985 Catalase activity. In: Greenwald RA, ed. Handbook of methods for oxygen radical research. Boca Raton, FL: CRC Press Inc.; 283–284
  49. Frohnert BI, Hui TY, Bernlohr DA 1999 Identification of a functional peroxisome proliferator-responsive element in the murine fatty acid transport protein gene. J Biol Chem 274:3970–3977[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   PPARγ  |  RXRα
Ligands:   LGD 100268  |  Rosiglitazone



This article has been cited by other articles:


Home page
Circ. Res.Home page
A. M. Beyer, W. J. de Lange, C. M. Halabi, M. L. Modrick, H. L. Keen, F. M. Faraci, and C. D. Sigmund
Endothelium-Specific Interference With Peroxisome Proliferator Activated Receptor Gamma Causes Cerebral Vascular Dysfunction in Response to a High-Fat Diet
Circ. Res., September 12, 2008; 103(6): 654 - 661.
[Abstract] [Full Text] [PDF]


Home page
Therapeutic Advances in Cardiovascular DiseaseHome page
M. Collino, N. S.A. Patel, and C. Thiemermann
Review: PPARs as new therapeutic targets for the treatment of cerebral ischemia/reperfusion injury
Therapeutic Advances in Cardiovascular Disease, June 1, 2008; 2(3): 179 - 197.
[Abstract] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Fujita, N. Maeda, M. Sonoda, K. Ohashi, T. Hibuse, H. Nishizawa, M. Nishida, A. Hiuge, A. Kurata, S. Kihara, et al.
Adiponectin Protects Against Angiotensin II-Induced Cardiac Fibrosis Through Activation of PPAR-{alpha}
Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 863 - 870.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
A. H. Remels, H. R. Gosker, P. Schrauwen, R. C. Langen, and A. M. Schols
Peroxisome proliferator-activated receptors: a therapeutic target in COPD?
Eur. Respir. J., March 1, 2008; 31(3): 502 - 508.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Fan, Y. Wang, Z. Tang, H. Zhang, X. Qin, Y. Zhu, Y. Guan, X. Wang, B. Staels, S. Chien, et al.
Suppression of Pro-inflammatory Adhesion Molecules by PPAR-{delta} in Human Vascular Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 315 - 321.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Y. Kamijo, K. Hora, K. Kono, K. Takahashi, M. Higuchi, T. Ehara, K. Kiyosawa, H. Shigematsu, F. J. Gonzalez, and T. Aoyama
PPAR{alpha} Protects Proximal Tubular Cells from Acute Fatty Acid Toxicity
J. Am. Soc. Nephrol., December 1, 2007; 18(12): 3089 - 3100.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Ding, M. Fu, Q. Qin, W. Lewis, H. W. Kim, T. Fukai, M. Bacanamwo, Y. E. Chen, M. D. Schneider, D. J. Mangelsdorf, et al.
Cardiac peroxisome proliferator-activated receptor {delta} is essential in protecting cardiomyocytes from oxidative damage
Cardiovasc Res, November 1, 2007; 76(2): 269 - 279.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. Kronke, A. Kadl, E. Ikonomu, S. Bluml, A. Furnkranz, I. J. Sarembock, V. N. Bochkov, M. Exner, B. R. Binder, and N. Leitinger
Expression of Heme Oxygenase-1 in Human Vascular Cells Is Regulated by Peroxisome Proliferator-Activated Receptors
Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1276 - 1282.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Y. Kamijo, K. Hora, T. Nakajima, K. Kono, K. Takahashi, Y. Ito, M. Higuchi, K. Kiyosawa, H. Shigematsu, F. J. Gonzalez, et al.
Peroxisome Proliferator-Activated Receptor {alpha} Protects against Glomerulonephritis Induced by Long-Term Exposure to the Plasticizer Di-(2-Ethylhexyl)Phthalate
J. Am. Soc. Nephrol., January 1, 2007; 18(1): 176 - 188.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-H. Jo, C. Yang, Q. Miao, M. Marzec, M. A. Wasik, P. Lu, and Y. L. Wang
Peroxisome Proliferator-Activated Receptor {gamma} Promotes Lymphocyte Survival through Its Actions on Cellular Metabolic Activities
J. Immunol., September 15, 2006; 177(6): 3737 - 3745.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G.-H. Liu, J. Qu, and X. Shen
Thioredoxin-mediated Negative Autoregulation of Peroxisome Proliferator-activated Receptor {alpha} Transcriptional Activity
Mol. Biol. Cell, April 1, 2006; 17(4): 1822 - 1833.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Pesant, S. Sueur, P. Dutartre, M. Tallandier, P. A. Grimaldi, L. Rochette, and J.-L. Connat
Peroxisome proliferator-activated receptor {delta} (PPAR{delta}) activation protects H9c2 cardiomyoblasts from oxidative stress-induced apoptosis
Cardiovasc Res, February 1, 2006; 69(2): 440 - 449.
[Abstract] [Full Text] [PDF]