help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cavarretta, I. T. R.
Right arrow Articles by Smith, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cavarretta, I. T. R.
Right arrow Articles by Smith, C. L.
Molecular Endocrinology 16 (2): 253-270
Copyright © 2002 by The Endocrine Society

Reduction of Coactivator Expression by Antisense Oligodeoxynucleotides Inhibits ER{alpha} Transcriptional Activity and MCF-7 Proliferation

Ilaria T. R. Cavarretta1, Ratna Mukopadhyay, David M. Lonard, Lex M. Cowsert, C. Frank Bennett, Bert W. O’Malley and Carolyn L. Smith

Department of Molecular and Cellular Biology (I.T.R.C., R.M., D.M.L, B.W.O., C.L.S.), Baylor College of Medicine, Houston, Texas 77030-3498; and ISIS Pharmaceuticals (L.M.C., C.F.B.), Carlsbad, California 92008

Address all correspondence and requests for reprints to: Carolyn L. Smith, Ph.D., Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030-3498. E-mail: carolyns{at}bcm.tmc.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroid receptor RNA activator (SRA) is a novel coactivator for steroid receptors that acts as an RNA molecule, whereas steroid receptor coactivator (SRC) family members, such as steroid receptor coactivator-1 (SRC-1) and transcriptional intermediary factor 2 (TIF2) exert their biological effects as proteins. Individual overexpression of each of these coactivators, which can form multimeric complexes in vivo, results in stimulated ER{alpha} transcriptional activity in transient transfection assays. However there is no information on the consequences of reducing SRC-1, TIF2, or SRA expression, singly or in combination, on ER{alpha} transcriptional activity. We therefore developed antisense oligodeoxynucleotides (asODNs) to SRA, SRC-1, and TIF2 mRNAs, which rapidly and specifically reduced the expression of each of these coactivators. ER{alpha}-dependent gene expression was reduced in a dose-dependent fashion by up to 80% in cells transfected with these oligonucleotides. Furthermore, treatment of cells with combinations of SRA, SRC-1, and TIF2 asODNs reduced ER{alpha} transcriptional activity to an extent greater than individual asODN treatment alone, suggesting that these coactivators cooperate, in at least an additive fashion, to activate ER{alpha}-dependent target gene expression. Finally, treatment of MCF-7 cells with asODN against SRC-1 and TIF2 revealed a requirement of these coactivators, but not SRA, for hormone-dependent DNA synthesis and induction of estrogen-dependent pS2 gene expression, indicating that SRA and SRC family coactivators can fulfill specific functional roles. Taken together, we have developed a rapid method to reduce endogenous coactivator expression that enables an assessment of the in vivo role of specific coactivators on ER{alpha} biological action and avoids potential artifacts arising from overexpression of coactivators in transient transfection assays.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE ERs, ER{alpha} and ERß, are ligand-regulated transcription factors and members of the nuclear receptor superfamily (1, 2, 3, 4). They work by facilitating the assembly of basal transcription factors into a stable preinitiation complex at the promoter of estrogen-responsive target genes (5). Two distinct activation functions (AFs) contribute to the ER’s transcriptional activity: the ligand-independent AF-1 located in the amino-terminal region, and the hormone-dependent AF-2 situated in the carboxyl-terminal, ligand binding domain. The relative importance of AF-1 and AF-2 in mediating transcriptional activity varies among different nuclear receptors (6, 7, 8) and depends on ligand, cell type, and target gene promoter (9, 10). Maximal E2-stimulated activity in most cellular contexts requires the synergistic activity of AF-1 and AF-2 domains (11, 12, 13).

The activation domains of ER interact with either basal transcription factors and/or specific cellular proteins that function as coactivators (14, 15, 16, 17). Recently, a novel coactivator, termed steroid receptor RNA activator (SRA), was isolated in a yeast two-hybrid screen using the amino-terminal domain of the PR, another member of the nuclear receptor superfamily, as bait (18). When overexpressed in mammalian cells, SRA selectively enhances PR-, AR-, GR-, and ER-mediated transcription of reporter genes containing the corresponding hormone response elements without significantly enhancing their basal transcriptional activity. SRA is unique because it appears to exert its coactivator function as an RNA transcript, whereas all other known coactivators exert their biological effects as proteins. SRA is also unusual because it binds both to a positively acting coactivator, p72 (19), as well as the transcriptional repressor, Sharp (20).

The p160 coactivator, steroid receptor coactivator-1 [SRC-1; (21)], a member of a gene family of coactivators that also includes transcriptional intermediary factor-2 [TIF2; also called GR-interacting protein 1 (GRIP-1) or SRC-2 (22, 23, 24)] and receptor associated coactivator-3 [RAC3; also called SRC-3, TRAM1, AIB1, ACTR, or p/CIP (25, 26, 27, 28, 29, 30)], was identified by virtue of its ability to bind to the AF-2 domain of ligand-bound PR (21). SRC-1, which exists in two different isoforms [SRC-1a and SRC-1e (31)], interacts in a ligand-dependent manner with the AF-2 domains of a broad range of nuclear receptors including ER and increases their transcriptional activity (21, 32). In addition, it has been shown that SRC-1 interacts with the AF-1 domain of ER{alpha} and can mediate functional interactions between the receptor’s two activation domains (13, 33). TIF-2 has considerable sequence and functional similarity to SRC-1; it can associate in vivo with hormone-bound ER and coactivate its ligand-dependent transcriptional activity (23, 24, 25, 34). Moreover, the mouse homolog of TIF-2, GRIP-1, has been shown to bind to and enhance the activity of both the AF-1 and AF-2 domains (35).

In vivo, there is evidence for a division between SRC-1 and TIF2 vs. RAC3 functions. For instance, the expression of RAC3 in some tissues and cells is higher compared with that of SRC-1 and TIF2 (36), and a differential expression pattern for SRC-1 and RAC3 has been observed in SRC-1 and RAC3 knockout mice (37, 38). Furthermore, in SRC-1 null mice, a compensatory overexpression of TIF2, but not of RAC3, has been demonstrated (38). Consistent with this, the inhibitory effects of an anti-NCoA-1 (nuclear receptor coactivator-1; mouse SRC-1) IgG on RAR activation can be reversed by coinjection of expression vectors for NCoA-1 or NCoA-2 (mouse SRC-2) but not p/CIP (p300/CBP/cointegrator-associated protein; mouse SRC-3) (25). In contrast, in cell-free or transient transfection experiments, which assess the effects of overexpressed coactivators on receptor-dependent transcription of synthetic reporter genes, SRC family members are similar with respect to enhancement of nuclear receptor transcriptional activity (21, 24, 28, 39). However, these approaches do not reflect the effective role of endogenous, physiological levels of coactivator relative to other proteins in the cellular environment. Antibody microinjection into single cells is another method used to assess coactivator function. However, this technique yields limited quantitative information and cannot distinguish between a block in the activity of a specific protein and disruption of the function of a preformed complex containing the targeted coactivator, possibly through steric hindrance. As an alternative to these approaches, we have developed the use of antisense oligonucleotide technology to study the role of coactivators in ER{alpha} function. Antisense oligodeoxynucleotides (asODNs) are short pieces of synthetic, chemically modified nucleic acid oligomers designed to hybridize to a specific mRNA using Watson-Crick base pairing rules and reduce levels of the target mRNA (40, 41, 42). When correctly and carefully used, they represent a fast and inexpensive alternative to the generation of knockout animal models for investigating the roles of specific proteins and can also facilitate the simultaneous inhibition of the expression of two or more gene products. In addition, possible compensatory mechanisms that may occur in knockout animals are circumvented due to the rapid inhibition of expression obtained with an asODNs approach.

In this report, we have demonstrated the efficacy and specificity of asODNs with respect to inhibition of target gene mRNA expression and then examined the effect of individually inhibiting SRA, SRC-1, and TIF2 expression on ER{alpha} transcriptional activity. Furthermore, because SRC-1 and TIF2 can associate with each other in stable multimeric protein complexes in vivo (43), and coimmunoprecipitation studies indicate the existence of complexes that contain both SRC-1 and SRA or GRIP-1 and SRA (18, 19), we investigated the ability of these coactivators to cooperate in modulating ER transactivation of target gene expression. We found that antisense oligodeoxynucleotides against SRA, SRC-1, and TIF2 inhibited estrogen-stimulated ER transcriptional activity in a dose-dependent fashion. Furthermore, combinations of coactivator antisense oligodeoxynucleotides reduced ER{alpha} action to an extent greater than would be anticipated from individual antisense oligodeoxynucleotides alone, indicating that these coactivators can exert their effects in a cooperative manner. Finally, antisense oligodeoxynucleotides against SRC-1 and TIF2, but not SRA, inhibited DNA synthesis and reduced estrogen induction of the endogenous ER target gene, pS2, in the estrogen-dependent MCF-7 breast cancer cell line, demonstrating the utility of these antisense oligodeoxynucleotides for examining the role of coactivators in mediating endogenous estrogen action.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Assessment of Antisense Oligodeoxyribonucleotides on Coactivator Expression
Before screening the efficacy of various oligodeoxynucleotides, the transfection efficiency of a fluorescein isothiocyanate (FITC)-labeled ODN was assessed. High ODN incorporation is important to detect a significant difference in mRNA expression by Northern analysis and to ensure that all cells in our transactivation assays have reduced coactivator expression. Because of the large literature documenting that the use of polycationic lipids improves the uptake of ODNs from cells (44, 45), we transfected the ODNs using LipofectAMINE. To test the efficiency of uptake, we observed the cell fluorescence pattern after transfecting HeLa cells with a fluorescein-conjugated ODN. Four hours after addition of the LipofectAMINE/ODN mixture, virtually all the cells were positive for FITC-ODN uptake (Fig. 1Go, A and B). Similar results were observed 48 h posttransfection (Fig. 1Go, C and D), indicating that ODN uptake by HeLa cells is efficient.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Uptake of a FITC-Conjugated ODN by HeLa Cells

Cells were transfected with a fluorescein-conjugated ODN using LipofectAMINE. The efficiency of transfection was evaluated by observing the cell fluorescence pattern immediately after removal of the LipofectAMINE/ODN mixture (A) and 48 h thereafter (C) and by comparing the number of fluorescent cells to the total number of cells observed by DIC-microscopy (B and D, respectively). Magnification, 40x.

 
A series of asODNs targeting different regions of SRA, SRC-1, and TIF2 were synthesized and screened by RT-PCR for their ability to reduce expression of their corresponding mRNA targets in the T24 bladder tumor cell line (data not shown); the most effective asODNs were selected for further study. One of the most widely recognized mechanisms by which asODNs lead to the degradation of specific mRNA targets involves the action of ribonuclease H (RnaseH) (46), an endonuclease that recognizes RNA/DNA duplexes and selectively cleaves the RNA strand (47, 48, 49). The relative and absolute endogenous levels of coactivators can vary substantially between cell lines as can the interactions between coactivator RNA transcripts and proteins. This has the potential to contribute to different accessibility of the asODNs and RNaseH to the mRNA targets (40). As a consequence, the same asODN may exhibit different inhibitory activities depending on the cell type used. For this reason, we also verified, by Northern analysis, to what extent the selected asODNs were able to alter coactivator expression in the HeLa cells used in our experiments.

Three SRA asODN targeting different regions of the SRA mRNA were evaluated for their ability to reduce SRA mRNA expression in HeLa cells. Twenty-four hours after transfection, cells were harvested and total RNA was extracted and subjected to Northern analysis (Fig. 2AGo). As a control to ensure that altered expression of the coactivator was due to a sequence-dependent interaction of the ODNs with their specific target mRNAs and not to sequence-dependent or -independent interactions with other molecules (50, 51, 52, 53, 54, 55), we used ODNs of the same length and base composition but randomized in sequence (randomized ODNs, rsODNs). Results obtained with the asODNs (nos. 30217, 30215, and 30145) are expressed as a percentage of those obtained with equivalent amounts of their corresponding rsODNs (nos. 104534, 104533, and 104535, respectively). The levels of SRA mRNA, normalized to the level of cyclophilin, revealed that all three asODNs used were able to inhibit SRA expression, when compared with the corresponding rsODNs, but that asODN 30217, which inhibited SRA expression by approximately 90%, was most effective (Fig. 2BGo). Consequently, the no. 30217 asODN and its corresponding control, 104534, were selected for subsequent experiments.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Inhibition of SRA mRNA Expression by Various asODNs

A, Northern blot analysis of total RNA extracted from cells treated with 200 pmol of nos. 30217, 30215, or 30145 SRA asODNs or their corresponding rsODNs, nos. 104534, 104533, and 104535. SRA and cyclophilin mRNAs are indicated. B, Quantification of the Northern blot by scanning laser densitometry. SRA mRNA levels in the presence of each asODN are normalized to cyclophilin mRNA levels and expressed as percentage of the SRA mRNA levels measured in the presence of the corresponding rsODNs.

 
Another important index of an oligonucleotide sequence-dependent inhibition is its dose dependence. To verify this essential condition, we transfected into HeLa cells increasing quantities of the selected SRA asODN (no. 30217) or equivalent amounts of the corresponding SRA rsODN. Northern analysis was performed on total RNA extracted 24 h later (Fig. 3AGo). Quantification of the SRA Northern blot and normalization to the level of cyclophilin mRNA demonstrated that antisense ODN decreased SRA mRNA expression in a dose-dependent manner (Fig. 3BGo), but that asODN amounts greater than 100 pmol did not increase the extent of inhibition.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Inhibition of SRA mRNA Expression by the asODN 30217 Is Dose Dependent

A, Northern blot analysis of total RNA extracted from cells treated with increasing amounts of the SRA asODN 30217 or equivalent quantities of the corresponding rsODN. SRA and cyclophilin mRNAs are indicated. B, Quantification of the Northern blot by scanning laser densitometry. SRA mRNA levels in the presence of the asODN (open bars) are normalized to cyclophilin mRNA levels and expressed as percentage of the SRA mRNA levels measured in the presence of equivalent amounts of the corresponding rsODN (solid bars).

 
Transactivation experiments require inhibition of coactivator expression for longer than 24 h. Therefore, a time course study was performed to determine the duration of reductions in SRA mRNA by SRA asODN. HeLa cells were transfected under the same conditions as described above, and cells were harvested at 0, 6, 24, 48, and 72 h after the ODN/LipofectAMINE mixture was removed for subsequent SRA mRNA analysis by Northern blot (Fig. 4AGo). Densitometry revealed that normalized levels of SRA mRNA decreased to approximately 25% of those obtained with the corresponding control at t = 0 h (4 h after start of ODN transfection) and further declined to almost undetectable levels 6 h thereafter. Levels remained depressed for at least 72 h. Notably, more than 75% of SRA mRNA expression was still repressed after 48 h (Fig. 4BGo), corresponding to the duration of our transactivation experiments (see below). These data show that a single transfection under our experimental conditions significantly inhibits target coactivator expression for at least 3 d.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. Time Course of SRA mRNA Expression in the Presence of SRA asODN

A, Northern blot analysis of total RNA extracted from cells treated with 200 pmol of SRA asODN (30217) or rsODN (104534) for 4 h and harvested 0, 6, 24, 48, or 72 h thereafter. SRA and cyclophilin mRNAs are indicated. B, Quantification of the bands by scanner laser densitometry. SRA mRNA levels in the presence of the asODN (open bars) are normalized to mRNA cyclophilin and expressed as percentage of the mRNA levels measured in the presence of equivalent amounts of the corresponding rsODN (solid bars).

 
Similar to the SRA experiments, three different asODNs for SRC-1 were screened along with their rsODNs as controls. Northern blot analysis showed that all the asODNs were able to inhibit SRC-1 mRNA levels to a similar extent (data not shown). The asODN chosen for further studies (no. 29912) decreased SRC-1 mRNA levels by approximately 75% when compared with the SRC-1 mRNA levels obtained after treatment with the corresponding rsODN (no. 104531) (Fig. 5Go, A and B). Because SRC-1 acts as a protein, we verified the extent and the duration of the inhibition of its protein expression. Western analysis was performed on protein extracts prepared from HeLa cells 1, 2, and 3 d after transfection of SRC-1 asODN and rsODN (Fig. 5CGo). The asODN reduced SRC-1 protein levels by 78%, 55%, and 44% after 1, 2, and 3 d, respectively, in comparison to SRC-1 levels measured in the presence of equivalent amounts of the rsODN (Fig. 5DGo), indicating that a single antisense transfection also is sufficient to decrease target coactivator protein expression for at least 3 d. The efficacy of two different TIF2 asODNs also was tested by Northern analysis (data not shown) and the asODN (no. 29977) that decreased TIF2 mRNA expression to undetectable levels was chosen for subsequent use (see Fig. 6AGo). Collectively, these data demonstrate that we are able to use the selected ODNs as an effective research tool for decreasing coactivator mRNA and protein expression in receptor transactivation experiments.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 5. Effect of SRC-1 asODN on SRC-1 mRNA and Protein Expression

A, Northern blot analysis of total RNA extracted from cells treated for 4 h with 200 pmol of SRC-1 asODN (29912) or rsODN (104531) and harvested 24 h later. SRC-1 and cyclophilin mRNAs are indicated. B, Quantification of the Northern blot by scanning laser densitometry. SRC-1 mRNA levels in the presence of the asODN (open bar) are corrected to cyclophilin mRNA levels and expressed as percentage of the SRC-1 mRNA levels measured in the presence of an equivalent quantity of the corresponding rsODN (solid bar). C, Western blot analysis of proteins extracted from cells treated with 200 pmol SRC-1 asODN or rsODN for 4 h and harvested 24, 48, or 72 h thereafter. SRC-1 and actin proteins are indicated. D, Quantification of the Western blot by scanning laser densitometry. SRC-1 protein levels in the presence of the asODN (open bar) are corrected against actin protein levels and expressed as percentage of the protein levels measured in the presence of equivalent amounts of the corresponding rsODN (solid bar).

 


View larger version (30K):
[in this window]
[in a new window]
 
Figure 6. SRA, SRC-1, and TIF2 asODNs Are Specific for Their mRNA/Protein Targets

A, Northern blot analysis of total RNA extracted from cells treated for 4 h with 100 pmol of asODN or rsODN for SRA, SRC-1, or TIF2 and harvested 24 h later. TIF2 and cyclophilin mRNAs are indicated. B, Cells treated with 200 pmol of the same asODNs and rsODNs were similarly subjected to Northern analysis for SRA expression. SRA and cyclophilin mRNAs are indicated. C, Western analysis of proteins extracted from cells treated for 4 h with 100 pmol of asODN or rsODN for SRC-1 or TIF2 and harvested 24 h later. SRC-1 and actin proteins are indicated. D, Western analysis of proteins extracted from cells treated for 4 h with 50 pmol of SRC-1 asODN, SRC-1 rsODN, SRA asODN, or SRA rsODN and harvested 24 h later. SRC-1 and actin proteins are indicated.

 
Specificity of asODNs for Their Target Coactivators
To ensure that the asODNs used were specific for their own target coactivator rather than cross-reacting with any of the other targets studied, we transfected HeLa cells with asODN for each of the three coactivators or their corresponding controls and verified that each asODN reduced the expression of only the appropriate target coactivator. This was particularly important to ensure that the asODNs used in this study did not exhibit affinity for other RNA molecules, particularly between SRC family members that are closely related to each other. We found, by Northern analysis, that neither the presence of SRA or SRC-1 asODNs affected the levels of TIF2 mRNA (Fig. 6AGo) using doses equal or higher than those used in the proceeding transactivation experiments. Also, SRC-1 and TIF2 asODNs do not reduce SRA expression measured in Northern experiments (Fig. 6BGo). When examined by Western analysis, the SRC-1 protein levels in the presence of TIF2 or SRA asODNs (Fig. 6Go, C and D, respectively) were not reduced, indicating no cross-reactivity of SRA and TIF2 asODNs for SRC-1 mRNA. These data show that, at levels equal or higher than those used in our experiments, each asODN was specific for its target coactivator.

Inhibition of SRC-1, TIF2, and SRA Coactivator Expression Impairs ER{alpha} Transcriptional Activity
Ligand binding promotes the association of nuclear receptors with distinct subclasses of coregulators including SRC-1, TIF2, and SRA (18, 21, 23, 24, 34, 43, 56, 57) and enhances their transcriptional activation. To study the involvement of endogenous levels of SRC-1, TIF2, and SRA on ER{alpha} transcriptional activity, we quantified ER-dependent gene expression using our antisense ODN technology. HeLa cells were transiently transfected with an expression vector for human ER{alpha} along with a synthetic target gene consisting of estrogen-responsive elements and a TATA box driving expression of luciferase; increasing amounts of SRA, SRC-1, or TIF2 antisense or rsODNs were added to cells at the same. To maximize the efficiency of transfection of ODNs and plasmids into cells, a replication-defective, poly-L-lysine modified, adenovirus-mediated DNA delivery protocol was used (58, 59, 60, 61, 62). Two hours after the adenovirus/poly-L-lysine/ODN/plasmids mixture was added to the cells, medium was replaced and 24 h thereafter cells were treated with ethanol (vehicle) or 10-9 M E2 for 24 h. We found that ligand-dependent ER{alpha} transcriptional activity was impaired, in a dose-dependent manner, by adding increasing amounts of SRA, SRC-1, and TIF2 asODNs (Fig. 7Go, A–C, respectively). Although, for clarity, values presented are from estrogen-treated samples, luciferase values obtained from cells treated with ethanol alone were also measured and compared with those obtained from cells treated with E2 to ensure that adequate induction of transactivation by E2 occurred in each experiment. Generally, the fold induction obtained was equal to or more than 5 (data not shown). The consistency of these results with the known roles of the coactivators and the dose-dependent asODN inhibition of ER{alpha} transactivation provide further confirmation of an antisense sequence-dependent mechanism and demonstrates the involvement of endogenous SRC-1, TIF2, and SRA in the modulation of ER-dependent target gene expression.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 7. ER{alpha}-Transcriptional Activity Is Impaired in a Dose-Dependent Manner by the Presence of SRA, SRC-1, and TIF-2 asODNs

A, Cells were transfected for 2 h with 25, 50, 100, or 200 pmol of SRA asODN (open bar) or with equivalent quantities of the corresponding rsODN (solid bar) along with pCMV5hER{alpha} and a 3xERE-TATA-luciferase target gene, and treated with 1 nM E2. Luciferase activity represents the mean of duplicate samples obtained from cells treated with asODN expressed as a percentage of the relative luciferase units (RLU) from cells treated with the rsODN. Each plot represents one of at least three independently repeated experiments. Values from cells treated with asODN or rsODN for SRC-1 and with the asODN or the rsODN for TIF2 are shown in panels B and C, respectively.

 
SRA and SRC Family Coactivators Cooperate to Modulate ER{alpha} Transcriptional Activity
The association of SRC family members in multimeric complexes in cells has been shown (43), and SRA has been found to coexist in a ribonucleoprotein complex with SRC-1 (18). To study the functional significance of these associations, we compared the effect of inhibiting the expression of two different coactivators, singly tested in the preceding experiments, to the effect of the simultaneous inhibition of the same two coactivators on ER transcriptional activity. To be able to measure an additive or greater effect on reduction of ER{alpha} transactivation induced by the simultaneous inhibition of the two coactivators, we used the lowest doses of asODNs that had produced, based on pilot experiments, a modest effect on the ligand-dependent ER{alpha} transcriptional activity. Cells were therefore exposed to the adenovirus-mediated transfection mixture containing 6.25 pmol of SRC-1 antisense or rsODNs and 25 pmol of SRA antisense or rsODNs (Fig. 8AGo); higher quantities of asODNs were tested in the same experiments to confirm that inhibition of transactivation occurred in each experiment (data not shown). When the cells were simultaneously exposed to SRC-1 and SRA asODNs, the decrease in estrogen-induced ER{alpha} transcriptional activity, measured as a percentage of the ER{alpha} transcriptional activity obtained in the presence of both rsODNs, was approximately 70%, whereas SRC-1 and SRA asODNs reduced target gene expression by only 10% and 20%, respectively. The experiment was repeated at least three times, confirming that the simultaneous presence of two asODNs causes a reduction in target gene expression greater than anticipated from either ODN treatment alone. Similar experiments were performed by simultaneously inhibiting SRA and TIF2, and SRC-1 and TIF2 expression (Fig. 8Go, B and C, respectively), providing evidence for a more than additive effect on ER{alpha} transcriptional activity by either combination of coactivators. These results demonstrate that, in addition to associating with each other, these coactivators can cooperate in the modulation of estrogen-dependent ER{alpha} transactivation in HeLa cells.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 8. SRA, SRC-1, and TIF-2 Coactivators Cooperate to Modulate ER{alpha} Transcriptional Activity

A, Cells were transfected for 2 h with the indicated asODNs (6.25 pmol for SRC-1; 25 pmol for SRA; open bars) or their corresponding rsODN controls (solid bars) along with pCMV5hER{alpha} and 3xERE-TATA-Luciferase, and 24 h thereafter were treated with 1 nM E2. Relative luciferase units (RLU) values represent the mean of duplicate samples obtained from cells treated with asODNs expressed as percentage of the RLU from cells treated with the corresponding rsODNs. This plot represents one of at least three independently repeated experiments. Values from cells simultaneously exposed to SRA and TIF2 asODNs (50 and 25 pmol, respectively) or SRC-1 and TIF2 asODNs (6.25 pmol each) are shown in panels B and C, respectively (see panel A above).

 
SRC-1 and TIF2 asODNs Inhibit Estrogen-Dependent Responses in MCF-7 Cells
MCF-7 cells express ER{alpha} and their growth is estrogen dependent (63). Therefore, to determine whether any of the coactivators examined in this study contributed to estrogen-mediated growth, MCF-7 cells were transfected with the indicated quantity of asODNs or their corresponding rsODNs, and 24 h thereafter cell proliferation was assessed by [3H]thymidine incorporation. It is important to note that these studies are possible because virtually all the cells uptake ODN. In contrast, transient transfection efficiencies for expression vectors generally are of insufficient magnitude to examine endogenous biological responses. As shown in Fig. 9AGo, asODNs to SRC-1 or TIF2 decreased cell proliferation in comparison to cells transfected with equivalent levels of rsODN. Interestingly, SRA asODN did not inhibit [3H]thymidine incorporation in these cells but, instead, had a modest stimulatory effect on DNA synthesis. These results were further substantiated in cells grown in stripped serum in the absence or presence of 1 nM E2 to ensure that the asODN inhibited estrogen-induced cell proliferation (Fig. 9BGo). E2 stimulated [3H]thymidine incorporation in SRA, SRC-1, or TIF2 rsODN-treated cells by 4- to 5-fold. These increases in DNA synthesis were attenuated in cells treated with asODNs to either SRC-1 or TIF2, but not to SRA, a result similar to that obtained for Fig. 9AGo.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 9. Inhibition of MCF-7 DNA Synthesis by asODNs Is Coactivator Specific

A, Cells grown in media containing 10% FBS were treated with the indicated amounts of asODNs or with the corresponding amounts of rsODN, and 24 h after transfection, cell proliferation was assessed by [3H]thymidine incorporation. Values are calculated as the percentage of incorporated counts in asODN-treated cultures in comparison to the counts obtained in cultures transfected with the corresponding amount of rsODN and are given as the mean ± SEM for three to four independent experiments. B, Cells grown in media containing 5% sFBS were transfected with 200 pmol of rsODN or asODN for the indicated coactivators and treated 24 h thereafter with ethanol vehicle (EtOH) or 1 nM E2 for 16 h to induce DNA synthesis. Values are calculated relative to the percentage of incorporated counts in rsODN- and E2-treated cultures (100%) for each coactivator and are given as the mean ± SEM for three to four independent experiments.

 
Based on the ability of SRA asODN to inhibit ER activity in HeLa cells, it was surprising that they did not inhibit MCF-7 cell proliferation. To ensure that this was not due to compensation by high SRA levels in MCF-7 cells in comparison to HeLa cells, real-time RT-PCR (64) was employed to examine the relative expression of this coactivator in these two cell lines. Analysis of several independent samples revealed that SRA mRNA levels were approximately 2-fold higher in HeLa than MCF-7 cells. The relative mRNA levels of SRC family coactivators were also characterized, revealing that SRC-1 expression was similar between the two lines, whereas TIF2 mRNA levels in MCF-7 cells were approximately twice that measured for HeLa cells. In addition, RAC3 mRNA levels were measured in both cell lines and, as expected (28), were found to be much greater (~30-fold) in MCF-7 than in HeLa cells.

The effect of coactivator asODNs on induction of an estrogen-regulated target gene, pS2 (65), was also examined. Sixteen hours of E2 stimulation of MCF-7 cells treated with rsODN to either SRA, SRC-1, or TIF2 resulted in a 4- to 6-fold induction of pS2 mRNA in comparison to levels measured for cells treated with the appropriate rsODN and ethanol vehicle. Similar to the results obtained for our DNA synthesis experiments, asODN to both SRC-1 and TIF2 reduced E2-induced pS2 mRNA levels, but the SRA asODN had no effect on the expression of this target gene (Fig. 10AGo). To ensure that the lack of SRA response was not due to an inability of SRA asODN to decrease the expression of its target coactivator in MCF-7 cells, SRA mRNA transcripts in cells treated with either SRA rsODN or asODN were quantitated. As shown in Fig. 10BGo, SRA asODN reduced SRA mRNA expression by about 55%. We also verified that SRC-1 and TIF2 asODN reduced the expression of their corresponding mRNAs and found that they were reduced by approximately 75% and 90%, respectively. Thus, although these three asODN reduced expression of their respective mRNAs, their ability to affect the expression of an endogenous ER target gene was variable. Taken together, the [3H]thymidine and pS2 results demonstrate that asODNs are able to inhibit the ability of endogenous ER to elicit biological responses. Furthermore, these results also indicate that all coactivators are not functionally equivalent with respect to biological responses in estrogen target cells.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 10. Inhibition of Estrogen-Induced pS2 mRNA Expression by asODNs Is Coactivator Specific

A, MCF-7 cells grown in media containing 5% sFBS were transfected with 200 pmol of rsODN or asODN for the indicated coactivators and treated 24 h thereafter with 0.1% ethanol vehicle (EtOH) or 10 nM E2 for 16 h before cells were harvested for RNA isolation and quantitative pS2 and 18S RNA measurements by real-time RT-PCR. Values are presented relative to the pS2 mRNA levels normalized to 18S RNA values determined for estrogen- and rsODN-treated samples (100), and are given as the mean ± SEM for three to five independent experiments. B, Effect of asODN on coactivator mRNA expression. MCF-7 cells were transfected with 200 pmol of rsODN or asODN for the indicated coactivators and harvested up to 40 h later for RNA isolation and coactivator and 18S RNA measurements by real-time RT-PCR. Values are presented relative to the coactivator levels normalized for 18S levels determined for rsODN-treated samples (100), and are given as the mean ± SEM for three to six independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogens are important for a variety of effects on growth, development, and differentiation, and ER{alpha} and ERß are responsible for mediating these effects in target tissues by acting as ligand-dependent transcription factors (66, 67) the activity of which is amplified by different classes of coactivators including SRC family members and the novel steroid receptor coactivator, SRA. The aim of the present study was to investigate the involvement of these coactivators in modulating ER{alpha} transcriptional activity using an approach that does not utilize overexpression of the coactivators, which can result in artifactual results. Although all of the SRC family members possess similar properties in terms of interaction with nuclear receptors in vitro and enhancement of their transcriptional activities in transient transfections, their tissue distribution profiles are not completely overlapping (reviewed in Ref. 39). Here we focused on SRC-1 and TIF2, which share high homology and similar functional activities, whereas RAC3 has been shown to exhibit functions and cell/tissue distributions distinct from SRC-1/TIF2 (22, 39).

The relevance of the requirement of SRC-1 in mediating nuclear receptor transcriptional activity has been substantiated in SRC-1 knockout mice that develop a partial sex steroid (38) and thyroid hormone resistance (68). Mouse knockout models for TIF2 and SRA are not yet available. In our search for a faster and cheaper, but still reliable, way to explore the roles of these coactivators in their endogenous environment, we inhibited their expression in transient transfection assays using asODNs as a tool. The only information required to synthesize asODNs is the nucleic acid sequence of the target. This advantage makes antisense technology a particularly useful approach for studying molecules that, like SRA, act as RNA transcripts. It has been shown that asODNs as long as 15–20 bases are able to discriminate between two gene products that differ by a single base (69). This specificity is particularly important when the targets share high homology with related molecules as is the case between SRC family members (31). A similar approach using asODNs of 23 bases has been successfully used to discriminate between two other closely related cofactors, CREB binding protein and p300, and their functional roles in RA-induced differentiation of F9 cells (70).

To the best of our knowledge, functional roles of SRC-1 and TIF2 in mediating nuclear receptor transactivation have never been investigated using antisense ODNs in transfection experiments. A complementary approach, in which a plasmid encoding full-length SRC-1 antisense mRNA was stably transfected into human osteosarcoma (MG-63) cells, made it possible to establish a biological role for SRC-1 with respect to 1,25-dihydroxyvitamin D3 stimulation of alkaline phosphatase activity (71). Similarly, the inhibition of endogenous GRIP-1 expression in myogenic (C2C12) cells, obtained by stable transfection of a plasmid encoding full-length GRIP-1/TIF-2 antisense RNA, revealed a functional role for this coactivator in skeletal differentiation (72). However, in both these cases, growing cells in the continuous absence of target coactivators could result in compensatory phenomena, as has been observed in SRC-1 knockout mice (38), which can be avoided with the rapid inhibition obtained by transiently transfecting asODNs.

After assessing the reliability of asODNs as a research tool in HeLa cells, we found that inhibiting the endogenous expression of any one of the coactivators tested resulted in impairment of ER{alpha}-mediated transactivation of a synthetic estrogen-responsive target gene. These data are consistent with those obtained by overexpressing the coactivators in transient transfection experiments (13, 21, 24, 73, 74) but provide verification in a more physiological manner. We also assessed the level of cooperation between individual coactivators by simultaneously exposing the cells to two different asODNs. The rationale for these experiments was based on evidence that SRC family members are capable of forming multimeric complexes in vivo. In particular, SRC-1 and TIF2 have been shown to associate in stable multimeric protein complexes (43), and SRA coexists in a ribonucleoprotein complex containing SRC-1 and/or TIF2 (18, 19). Although the functional significance of these particular associations is unknown, deletion of one of the DEAD-box motifs of the ER{alpha} AF-1 coactivator, p72, blocks its ability to bind SRA and enhance ER{alpha} transactivation (19). Our results revealed that the tested coactivators contributed to ER{alpha} transcriptional activity in a more than additive way and therefore provide evidence of intracellular cooperation between SRC1–1, TIF2, and SRA, which is consistent with their coexpression in the same cell line and/or tissue and with their demonstrated intracellular associations.

It has been previously shown that MCF-7 cells engineered to stably overexpress SRC-1 exhibit greater ER transcriptional activity measured on target genes delivered via transient transfection (75). These cells also grew better in response to estrogen treatment and required greater concentrations of 4-hydroxytamoxifen to block E2-stimulated cell growth than the parental cell line (75), suggesting that the SRC-1 coactivator positively contributes to the growth of this breast cancer cell line. Our results are consistent with this finding and demonstrate that both SRC-1 and TIF2 contribute to MCF-7 cell proliferation. However, differences in the magnitude of the asODN effect on cell proliferation and pS2 induction (see below) and ER{alpha} transactivation of a synthetic reporter gene in HeLa cells were noted. These may be due to cell-specific differences in coactivator function or expression patterns (both SRC family and other coactivators) and/or reflect differences in the promoters of the targets being examined (e.g. simple vs. endogenous, complex target genes, chromatin structure, and/or the number and sequence of the estrogen response elements). Indeed, our analyses revealed much higher levels of RAC3 mRNA in MCF-7 vs. HeLa cells, and it has been demonstrated that the sequence of the estrogen response element (ERE) influences the ability of ER{alpha} to recruit TIF2 to DNA (76). Depletion of the p300 coactivator, which binds to ER and SRC-1 (77, 78), by an p300 antisense expression vector has also been shown to reduce DNA synthesis in MCF-10A nontransformed, immortalized breast epithelial cells and MSU fibroblasts (79), consistent with a role for coactivators in cell proliferation. Intriguingly, under our experimental conditions, SRA asODN did not inhibit [3H]thymidine incorporation, suggesting that the role of SRA in cell proliferation, if any, is distinct from that of SRC-1 and TIF2. Furthermore, this result provides evidence that the responses elicited with our asODN tools are specific to the coactivator under study and are not a general artifact of oligonucleotide transfection.

The inhibition of estrogen-induced pS2 mRNA expression by antisense ODNs against SRC-1 and TIF2 is consistent with their ability to decrease ER transactivation in HeLa cells and estrogen-dependent cell proliferation in MCF-7 cells and suggests that these two coactivators make contributions to the regulation of this ER target gene. Stable expression of SRC-1 in MCF-7 cells has been shown to increase the ability of E2 to stimulate pS2 mRNA expression (75), further supporting a role for this coactivator in the regulation of this target gene’s expression. Although there is no direct information on SRA coactivation of pS2 gene expression, a deletion mutant of the ER{alpha} coactivator, p72, that abolishes its ability to interact with SRA, also blocks its ability to enhance estrogen induction of pS2 gene expression when transiently overexpressed in MCF-7 cells (19). Thus, the inability of our SRA asODNs to inhibit estrogen induction of pS2 mRNA expression is somewhat surprising and suggests that the mechanisms of SRA action are likely to be complex.

Increases in SRA expression in breast tumor samples in comparison to normal adjacent tissue have been noted in a recent study (80), suggesting that SRA may play a role in cancer cells unrelated to stimulating cell growth. Paradoxically, reducing SRA expression may relieve ER from the influence of a corepressor in MCF-7 cells (20) and thereby increase ER activity. Sharp (SMRT/HDAC-1-associated repressor protein) is a nuclear receptor corepressor that can inhibit ER{alpha} transactivation in a SRA-dependent manner. Furthermore, Sharp expression is estrogen inducible in MCF-7 cells (20). Thus, by reducing SRA expression, it is possible that the ability of Sharp to negatively regulate ER transcriptional activity, perhaps as part of the mechanism by which cells attenuate estrogen signaling, may be lost. The lack of SRA asODN influence may therefore represent loss of coactivation balanced by loss of corepression. Alternatively, these data also support a model in which endogenous SRA regulates ER activity in a cell (HeLa vs. MCF-7)-, or promoter-specific manner; the latter due either to differences in promoter DNA sequence or in chromatin structure between transient reporter templates and endogenous genes.

Taken together, these data demonstrate that asODN can be used to examine the role of endogenous levels of coactivators. In so doing, it is possible to examine coactivator function in a variety of cell types while avoiding artifacts associated with overexpression of exogenous coactivators or compensatory changes in gene expression. These studies have also revealed that coactivators play specific roles with respect to mediating the biological effects of ER{alpha}. More detailed analysis of coactivator specificity with respect to steroid receptor function promises to provide insight into the cell and promoter specificity of ER{alpha} action and may ultimately provide the basis to improve the target specificity of receptor-based endocrine therapies.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
The mammalian expression plasmids for human ER{alpha} (pCMV5hER{alpha}) (81), for SRA (pSCT-SRA) (18), for SRC-1a (pCR3.1-hSRC-1a) (73), and for TIF2 (pCR3.1-TIF2) (82) have been described previously as has the estrogen-responsive reporter plasmid, 3xERE-TATA-luciferase (83).

Oligodeoxyribonucleotides
Phosphorothioate oligonucleotides, 18 bases in length, were synthesized by ISIS Pharmaceuticals (Carlsbad, CA). The oligodeoxynucleotides designated nos. 29977, 117226, 29912, 104531, 30215, 104533, 30217, and 104534 are gapmers that consist of 2'methoxy-ethyl nucleotides phosphorothioated on each end (to improve nuclease resistance and hybridization affinity of the oligomer for complementary mRNAs) and 2'deoxynucleotides in the middle (to support RNaseH activity). The 30145 and 104534 oligodeoxynucleotides are phosphorothioate ODNs. The oligonucleotide sequence and region of coactivator to which they bind are shown in Table 1Go. The control oligonucleotides (nos. 117226, 104531, 104535, 104534, and 104533) have the same base composition as nos. 29977, 29912, 30215, 30217, and 30145, respectively, but the sequence has been randomized. The FITC-conjugated ODN 21437 (GGTTATCCTTGGCTACATTA) is a gapmer labeled with a fluorescein isothiocyanate group on its 5'-end.


View this table:
[in this window]
[in a new window]
 
Table 1. Sequences of Antisense Oligodeoxynucleotides

 
Cell Culture and Transient Transfection Assay
HeLa (human cervical carcinoma) cells were routinely maintained in DMEM supplemented with 10% FBS. Twenty-four hours before transfections, 3 x 105 cells per well of a six-well multiplate or 106 cells per 100-mm Petri dish were plated in phenol red-free DMEM containing 5% dextran-coated charcoal-stripped FBS (sFBS). Cells to be transfected with the FITC-conjugated ODN were plated on glass coverslips.

For microscopy, Northern, and Western experiments, HeLa cells were transfected by LipofectAMINE according to the manufacturer’s protocol (Life Technologies, Inc., Gaithersburg, MD). MCF-7 studies were also performed using LipofectAMINE transfection. Briefly, 24 h after plating, cells were exposed, in the presence of phenol red- and serum-free medium, to the transfection mixture containing LipofectAMINE and the ODNs. Four hours later, medium containing the LipofectAMINE/ODN mixture was replaced with DMEM containing 5% sFBS until harvesting.

For transactivation experiments, cells were transfected as previously described (62) using the poly-L-lysine-conjugated, replication-deficient adenovirus dl312, at a multiplicity of infection of 500:1. Briefly, after 30 min of incubation of the adenovirus with the pCMV5hER{alpha} and 3xERE-TATA-luciferase plasmids (0.4 and 80 ng per well, respectively) and the indicated amounts of ODNs (see figure legends), poly-L-lysine was added to the mixture for a second incubation in which virus/ODN/poly-L-lysine complexes are formed and subsequently added to cells in the presence of phenol red- and serum-free medium. After 2 h of incubation, the medium was replaced with phenol red-free DMEM containing 5% sFBS, and 24 h later cells were treated with ethanol (vehicle) or 10-9 M E2 (Sigma, St. Louis, MO) for 24 h. Cells were harvested in TEN (40 mM Tris, pH 8.0/1 mM EDTA/150 mM NaCl), and cell extracts were assayed for luciferase activity using the luciferase assay system (Promega Corp., Madison, WI) and a Monolight 2010 Luminometer (Analytical Luminescence Laboratory, San Diego, CA); values were corrected for protein content determined using the protein assay according to the manufacturer’s protocol (Bio-Rad Laboratories, Inc., Hercules, CA).

Fluorescence and Differential Interference Contrast (DIC) Microscopy
Immediately and 44 h after removal of the LipofectAMINE/FITC-conjugated-ODN mixture, cells were washed several times in PBS, mounted in VECTASHIELD medium for fluorescence (Vector Laboratories, Inc., Burlingame, CA), and examined by fluorescence and DIC microscopy with a AxioPhot microscope (Carl Zeiss, Thornwood, NY) and a C5810 chilled three change-coupled device camera (Hamamatsu Corp., Bridgewater, NJ) to visualize the number of fluorescent and total cells, respectively.

Northern Analysis
Twenty-four and forty-eight hours after removing the ODNs, with the exception of the time course experiment (see Results), HeLa cells were harvested and total RNA extracted using TRIzol reagent according to the manufacturer’s protocol (Life Technologies, Inc.). Thirty micrograms per lane of total RNA were loaded on 1.2% formaldehyde/agarose gel and then transferred by capillary action to nitrocellulose membrane (Osmonics, Inc., Westborough, MA). The blots were probed under high-stringency conditions [overnight at 65 C in hybridization buffer consisting of 0.5% SDS, 6x SSC (1x = 3 M sodium chloride, 0.3 M sodium citrate, pH 7.0) 5x Denhardt’s solution (84), and 100 µg/ml of salmon sperm DNA] with a [32P]dCTP-labeled probe for SRA, SRC-1, TIF2, or cyclophilin. The probes were prepared using the RadPrime DNA labeling system (Life Technologies, Inc.) and fragments of the hSRC-1a (nucleotides 829–1,067) and TIF2 (nucleotides 4,204–4,815) cDNAs, or full-length cDNAs for human SRA or mouse cyclophilin (85) as templates. After washing, radiolabeled blots were subjected to autoradiography at -80 C using Kodak Biomax MS films (Eastman Kodak Co., Rochester, NY). Intensity of the bands was quantified by scanning laser densitometry (Molecular Dynamics, Inc., Sunnyvale, CA).

Real-time RT-PCR Assays
Measurements for RNA samples prepared from MCF-7 cells were performed using real-time RT-PCR and TaqMan chemistry (64). Briefly, cells were harvested and RNA was isolated by S.N.A.P. Total RNA Isolation kit (Invitrogen, San Diego, CA) according to the manufacturer’s instructions. Total RNA was analyzed by real-time RT-PCR using the ABI Prism 7700 Sequence Analyzer (PE Applied Biosystems, Foster City, CA). Primers and probes for pS2, SRC-1, TIF2 and SRA (Table 2Go) were designed using Primer Express software (PE Applied Biosystems), and target transcript quantities were normalized against 18S rRNA using an 18S primer/probe set purchased from PE Applied Biosystems. Probes were fluorescently labeled with 6FAM (6-carboxy-fluorescein) and TAMRA (6-carboxy-tetremethyl-rhodamine) on the 5'- and 3'-ends, respectively. Assays were performed as 50-µl reactions using TaqMan One-Step RT-PCR Master Mix reagents in MicroAmp 96-well plates (PE Applied Biosystems). Five microliters of MCF-7 total RNA (~100 ng) were analyzed for pS2, SRC-1, TIF2, and SRA mRNA transcripts. For normalization against the 18S transcript, each sample was diluted 100-fold so that approximately 1 ng of total RNA was analyzed in a separate well. The RT reaction was incubated at 48 C for 30 min to allow cDNA synthesis and terminated by heating for 10 min at 95 C. The reaction was then PCR amplified for 40 cycles consisting of 25 sec at 95 C and 1 min at 60 C. Cycle threshold values for each reaction were determined using TaqMan SDS analysis software and standardized against a common total RNA sample obtained from MCF-7 cells grown in the presence of 10% FCS.


View this table:
[in this window]
[in a new window]
 
Table 2. Primer and Probe Oligonucleotide Sequences Used for Real-Time RT-PCR Assays

 
Western Analysis
One, 2, or 3 d after the ODNs had been removed, HeLa cells were harvested by scraping in cold PBS. Lysis of cells was performed by resuspending the cell pellet in lysis buffer [50 mM Tris, pH 7.4, containing 150 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40 (Accurate Chemical & Scientific Corp., Westbury, NY) and protease inhibitors (1 µg/ml of leupeptin, antipain, aprotinin, benzamidine-HCl, chymostatin, and pepstatin, and 0.5 mM phenylmethylsulfonylfluoride], followed by 20 min of rocking at 4 C. The protein content of the cell lysate was determined by Bio-Rad Laboratories, Inc. protein assay. Seventy micrograms of protein per lane were resolved by 7.5% SDS-PAGE and transferred to nitrocellulose membrane. Nonspecific sites were saturated by incubating the blots in blocking buffer (20 mM Tris, pH 7.5, containing 137 mM NaCl, 0.05% Tween-20, and 5% dried nonfat milk powder) overnight at 4 C. Incubations with SRC-1 (described in Ref. 56) or actin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) primary antibodies and subsequent incubations with the horseradish peroxidase-conjugated secondary antibodies were performed in 20 mM Tris, pH 7.5, containing 137 mM NaCl, 0.05% Tween-20, and 2% dried nonfat milk powder. Detection of specifically bound proteins was carried out by ECL+PLUS according to the manufacturer’s protocol (Amersham Pharmacia Biotech, Arlington Heights, IL). Intensity of the bands was quantified by scanning laser densitometry.

DNA Synthesis Assay
MCF-7 (human breast cancer) cells were routinely maintained in DMEM and 10% FBS. Forty-eight hours before transfections, 1.5 x 105 cells were seeded per well of a six-well multiplate. Cells were transfected with the indicated amounts of SRA, SRC-1, or TIF2 antisense ODNs or with equivalent quantities of the corresponding random sense ODNs by LipofectAMINE. Oligonucleotides were removed 4 h thereafter, and 24 h after transfection, cells were radiolabeled with 2 µCi/ml [3H]thymidine (NEN Life Science Products, Boston, MA) for 2 h at 37 C, after which they were processed to determine tritium incorporation (86), using a scintillation counter (Beckman Coulter, Inc., Fullerton, CA). For experiments examining the effects of ODNs on estrogen-dependent DNA synthesis, MCF-7 cells were maintained in media containing 5% sFBS for 48 h before LipofectAMINE transfection with 200 pmol of the indicated ODNs. Twenty-four hours thereafter, cells were treated for 24 h with vehicle (0.1% ethanol) or 1 nM E2 and were radiolabeled with [3H]thymidine for 2 h before determination of tritium incorporation. All experiments were done in triplicate, and results are shown as average ± SEM.


    ACKNOWLEDGMENTS
 
We thank Cheryl Parker, Hank Adams, and Frank Herbert for technical assistance and Rainer Lanz for the pSCT-SRA.


    FOOTNOTES
 
This work was supported by an NIH grant (HD-08818) (to B.W.O.), the American Heart Association (No. 9750078N), and NIH (DK-53002) awards (to C.L.S.). I.T.R.C. was supported by funds from the Andrew W. Mellon Foundation, and R.M. and D.M.L. were supported by an NIH training Grant in Reproductive Biology (HD-07165).

1 Present address: Istituto di Endocrinologia, Universita’ di Milano, Via Balzaretti, 9, 20133 Milano, Italy. Back

Abbreviations: AF, Activation function; asODN, antisense oligodeoxynucleotide; DIC, differential interference contrast; ERE, estrogen response element; FITC, fluorescein isothiocyante; GRIP, GR-interacting protein; HDAC, histone deacetylase; NCoA, nuclear receptor coactivator; RNaseH, ribonuclease H; rsODN, randomized oligodeoxynucleotide; sFBS, dextran-coated, charcoal-stripped FBS; SRA, steroid receptor RNA activator; SRC, steroid receptor coactivator; SMRT, silencing mediator of retinoic acid and thyroid hormone receptors; TIF2, transcriptional intermediary factor.

Received for publication February 16, 2001. Accepted for publication October 9, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Smith CL 1998 Cross-talk between peptide growth factor and estrogen receptor signaling pathways. Biol Reprod 58:627–632[Abstract/Free Full Text]
  2. Green S, Chambon P 1988 Nuclear receptors enhance our understanding of transcription regulation. Trends Genet 4:309–314[CrossRef][Medline]
  3. Green S, Chambon P 1991 The oestrogen receptor: from perception to mechanism. In: Parker MG, ed. Nuclear hormone receptors. San Diego, CA: Academic Press Ltd; 15–38
  4. Freedman LP, Luisi BF 1993 On the mechanism of DNA binding by nuclear hormone receptors: a structural and functional perspective. J Cell Biochem 51:140–150[CrossRef][Medline]
  5. Klein-Hitpass L, Tsai SY, Weigel NL, Allan GF, Riley D, Rodriguez R, Schrader WT, Tsai M-J, O’Malley BW 1990 The progesterone receptor stimulates cell-free transcription by enhancing the formation of a stable preinitiation complex. Cell 60:247–257[CrossRef][Medline]
  6. Hadzic E, Desai-Yajnik V, Helmer E, Guo S, Wu S, Koudinova N, Casanova J, Raaka BM, Samuels HH 1995 A 10-amino-acid sequence in the N-terminal A/B domain of thyroid hormone receptor {alpha} is essential for transcriptional activation and interaction with the general transcription factor TFIIB. Mol Cell Biol 15:4507–4517[Abstract]
  7. Jenster G, van der Korput JAGM, van Vroonhoven CCJ, Van Der Kwast TH, Trapman J, Brinkman AO 1991 Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5:1396–1404[Abstract]
  8. Lees JA, Fawell SE, Parker MG 1989 Identification of two transactivation domains in the mouse oestrogen receptor. Nucleic Acids Res 17:5477–5487[Abstract/Free Full Text]
  9. McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike JW 1995 Analysis of estrogen receptor function in vitro reveals three distinct classes of antiestrogens. Mol Endocrinol 9:659–669[Abstract]
  10. Tzukerman MT, Esty A, Santiso-Mere D, Danielian P, Parker MG, Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol Endocrinol 8:21–30[Abstract]
  11. Tora L, White JH, Brou C, Tasset DM, Webster NJG, Scheer E, Chambon P 1989 The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477–487[CrossRef][Medline]
  12. Lees JA, Fawell SE, Parker MG 1989 Identification of constitutive and steroid-dependent transactivation domains in the mouse oestrogen receptor. J Steroid Biochem 34:33–39[CrossRef][Medline]
  13. McInerney EM, Tsai M-J, O’Malley BW, Katzenellenbogen BS 1996 Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc Natl Acad Sci USA 93:10069–10073[Abstract/Free Full Text]
  14. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  15. Godowski PJ, Picard D, Yamamoto KR 1988 Signal transduction and transcriptional regulation by glucocorticoid receptor-lexA fusion proteins. Science 241:812–816[Abstract/Free Full Text]
  16. Ham J, Parker MG 1989 Regulation of gene expression by nuclear hormone receptors. Curr Opin Cell Biol 1:503–511[CrossRef][Medline]
  17. Klinge CM 2000 Estrogen receptor interaction with co-activators and co-repressors. Steroids 65:227–251[CrossRef][Medline]
  18. Lanz RB, McKenna NJ, Onate SA, Albrecht U, Wong J, Tsai SY, Tsai M-J, O’Malley BW 1999 A steroid receptor coactivator, SRA, functions as an RNA and is present in an SRC-1 complex. Cell 97:17–27[CrossRef][Medline]
  19. Watanabe M, Yanagisawa J, Kitagawa H, Takeyama K-I, Ogawa S, Arao Y, Suzawa M, Kobayashi Y, Yano T, Yoshikawa H, Masuhiro Y, Kato S 2001 A subfamily of RNA-binding DEAD-box proteins acts as an estrogen receptor {alpha} coactivator through the N-terminal activation domain (AF-1) with an RNA coactivator, SRA. EMBO J 20:1341–1352[CrossRef][Medline]
  20. Shi Y, Downes M, Xie W, Kao HY, Ordentlich P, Tsai C-C, Hon M, Evans RM 2001 Sharp, an inducible cofactor that integrates nuclear receptor repression and activation. Genes Dev 15:1140–1151[Abstract/Free Full Text]
  21. Onate SA, Tsai SY, Tsai M-J, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  22. McKenna NJ, Lanz RB, O’Malley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321–344[Abstract/Free Full Text]
  23. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  24. Voegel JJ, Heine MJS, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  25. Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684[CrossRef][Medline]
  26. Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484[Abstract/Free Full Text]
  27. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  28. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  29. Takeshita A, Cardonna GR, Koibuchi N, Suen C-S, Chin WW 1997 TRAM-1, a novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:27629–27634[Abstract/Free Full Text]
  30. Suen C-S, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR, Frail DE 1998 A transcriptional coactivator, steroid receptor coactivator-3, selectively augments steroid receptor transcriptional activity. J Biol Chem 273:27645–27653[Abstract/Free Full Text]
  31. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  32. Zhu Y, Qi C, Calandra C, Rao MS, Reddy JK 1996 Cloning and identification of mouse steroid receptor coactivator-1 (mSRC-1), as a coactivator of peroxisome proliferator-activated receptor {gamma}. Gene Express 6:185–195[Medline]
  33. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T-M, Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  34. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract]
  35. Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang S-M, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR, Kushner PJ 1998 Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol Endocrinol 12:1605–1618[Abstract/Free Full Text]
  36. Li H, Chen JD 1998 The receptor-associated coactivator 3 activates transcription through CREB-binding protein recruitment and autoregulation. J Biol Chem 273:5948–5954[Abstract/Free Full Text]
  37. Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, O’Malley BW 2000 The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc Natl Acad Sci USA 97:6379–6384[Abstract/Free Full Text]
  38. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai M-J, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925[Abstract/Free Full Text]
  39. Leo C, Chen JD 2000 The SRC family of nuclear receptor coactivators. Gene 245:1–11[CrossRef][Medline]
  40. Myers JJ, Dean NM 2000 Sensible use of antisense: how to use oligonucleotides as research tools. Trends Pharmacol 21:19–23[CrossRef][Medline]
  41. Bennett CF 1998 Use of cationic lipid complexes for antisense oligonucleotide delivery. In: Stein CA, Krieg AM, eds. New York: Wiley-Liss, Inc.; 129–145
  42. Cooper SR, Taylor JK, Miraglia LJ, Dean NM 1999 Pharmacology of antisense oligonucleotide inhibitors of protein expression. Pharmacol Ther 82:427–435[CrossRef][Medline]
  43. McKenna NJ, Nawaz Z, Tsai SY, Tsai M-J, O’Malley BW 1998 Distinct steady-state nuclear receptor coregulator complexes exist in vivo. Proc Natl Acad Sci USA 95:11697–11702[Abstract/Free Full Text]
  44. Bennett CF, Chiang MY, Chan H, Shoemaker JE, Mirabelli CK 1992 Cationic lipids enhance cellular uptake and activity of phosphorothioate antisense oligonucleotides. Mol Pharmacol 41:1023–1033[Abstract]
  45. Gewirtz AM, Stein CA, Glazer PM 1996 Facilitating oligonucleotide delivery: helping antisense deliver on its promise.