| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Transcriptional Activity and MCF-7 Proliferation
Department of Molecular and Cellular Biology (I.T.R.C., R.M., D.M.L, B.W.O., C.L.S.), Baylor College of Medicine, Houston, Texas 77030-3498; and ISIS Pharmaceuticals (L.M.C., C.F.B.), Carlsbad, California 92008
Address all correspondence and requests for reprints to: Carolyn L. Smith, Ph.D., Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030-3498. E-mail: carolyns{at}bcm.tmc.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
transcriptional
activity in transient transfection assays. However there is no
information on the consequences of reducing SRC-1, TIF2, or SRA
expression, singly or in combination, on ER transcriptional
activity. We therefore developed antisense oligodeoxynucleotides
(asODNs) to SRA, SRC-1, and TIF2 mRNAs, which
rapidly and specifically reduced the expression of each of these
coactivators. ER-dependent gene expression was reduced in a
dose-dependent fashion by up to 80% in cells transfected with these
oligonucleotides. Furthermore, treatment of cells with combinations of
SRA, SRC-1, and TIF2 asODNs reduced ER
transcriptional activity to an extent greater than individual
asODN treatment alone, suggesting that these
coactivators cooperate, in at least an additive fashion, to activate
ER-dependent target gene expression. Finally, treatment of MCF-7
cells with asODN against SRC-1 and TIF2 revealed a
requirement of these coactivators, but not SRA, for hormone-dependent
DNA synthesis and induction of estrogen-dependent pS2 gene expression,
indicating that SRA and SRC family coactivators can fulfill specific
functional roles. Taken together, we have developed a rapid method to
reduce endogenous coactivator expression that enables an assessment of
the in vivo role of specific coactivators on ER
biological action and avoids potential artifacts arising from
overexpression of coactivators in transient transfection assays. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and ERß, are
ligand-regulated transcription factors and members of the nuclear
receptor superfamily (1, 2, 3, 4). They work by facilitating the
assembly of basal transcription factors into a stable preinitiation
complex at the promoter of estrogen-responsive target genes
(5). Two distinct activation functions (AFs) contribute to
the ER’s transcriptional activity: the ligand-independent AF-1 located
in the amino-terminal region, and the hormone-dependent AF-2 situated
in the carboxyl-terminal, ligand binding domain. The relative
importance of AF-1 and AF-2 in mediating transcriptional activity
varies among different nuclear receptors (6, 7, 8) and
depends on ligand, cell type, and target gene promoter (9, 10). Maximal E2-stimulated activity in most cellular contexts
requires the synergistic activity of AF-1 and AF-2 domains
(11, 12, 13). The activation domains of ER interact with either basal transcription factors and/or specific cellular proteins that function as coactivators (14, 15, 16, 17). Recently, a novel coactivator, termed steroid receptor RNA activator (SRA), was isolated in a yeast two-hybrid screen using the amino-terminal domain of the PR, another member of the nuclear receptor superfamily, as bait (18). When overexpressed in mammalian cells, SRA selectively enhances PR-, AR-, GR-, and ER-mediated transcription of reporter genes containing the corresponding hormone response elements without significantly enhancing their basal transcriptional activity. SRA is unique because it appears to exert its coactivator function as an RNA transcript, whereas all other known coactivators exert their biological effects as proteins. SRA is also unusual because it binds both to a positively acting coactivator, p72 (19), as well as the transcriptional repressor, Sharp (20).
The p160 coactivator, steroid receptor coactivator-1 [SRC-1;
(21)], a member of a gene family of coactivators that
also includes transcriptional intermediary factor-2 [TIF2; also called
GR-interacting protein 1 (GRIP-1) or SRC-2 (22, 23, 24)] and
receptor associated coactivator-3 [RAC3; also called SRC-3, TRAM1,
AIB1, ACTR, or p/CIP (25, 26, 27, 28, 29, 30)], was identified by virtue
of its ability to bind to the AF-2 domain of ligand-bound PR
(21). SRC-1, which exists in two different isoforms
[SRC-1a and SRC-1e (31)], interacts in a
ligand-dependent manner with the AF-2 domains of a broad range of
nuclear receptors including ER and increases their transcriptional
activity (21, 32). In addition, it has been shown that
SRC-1 interacts with the AF-1 domain of ER and can mediate
functional interactions between the receptor’s two activation domains
(13, 33). TIF-2 has considerable sequence and functional
similarity to SRC-1; it can associate in vivo with
hormone-bound ER and coactivate its ligand-dependent transcriptional
activity (23, 24, 25, 34). Moreover, the mouse homolog of
TIF-2, GRIP-1, has been shown to bind to and enhance the activity of
both the AF-1 and AF-2 domains (35).
In vivo, there is evidence for a division between SRC-1 and
TIF2 vs. RAC3 functions. For instance, the expression of
RAC3 in some tissues and cells is higher compared with that of SRC-1
and TIF2 (36), and a differential expression pattern for
SRC-1 and RAC3 has been observed in SRC-1 and RAC3 knockout mice
(37, 38). Furthermore, in SRC-1 null mice, a compensatory
overexpression of TIF2, but not of RAC3, has been demonstrated
(38). Consistent with this, the inhibitory effects of an
anti-NCoA-1 (nuclear receptor coactivator-1; mouse SRC-1) IgG on RAR
activation can be reversed by coinjection of expression vectors for
NCoA-1 or NCoA-2 (mouse SRC-2) but not p/CIP
(p300/CBP/cointegrator-associated protein; mouse SRC-3)
(25). In contrast, in cell-free or transient
transfection experiments, which assess the effects of overexpressed
coactivators on receptor-dependent transcription of synthetic reporter
genes, SRC family members are similar with respect to enhancement of
nuclear receptor transcriptional activity (21, 24, 28, 39). However, these approaches do not reflect the
effective role of endogenous, physiological levels of coactivator
relative to other proteins in the cellular environment. Antibody
microinjection into single cells is another method used to assess
coactivator function. However, this technique yields limited
quantitative information and cannot distinguish between a block in the
activity of a specific protein and disruption of the function of a
preformed complex containing the targeted coactivator, possibly
through steric hindrance. As an alternative to these approaches, we
have developed the use of antisense oligonucleotide technology to
study the role of coactivators in ER function. Antisense
oligodeoxynucleotides (asODNs) are short pieces of
synthetic, chemically modified nucleic acid oligomers designed to
hybridize to a specific mRNA using Watson-Crick base pairing rules and
reduce levels of the target mRNA (40, 41, 42). When correctly
and carefully used, they represent a fast and inexpensive alternative
to the generation of knockout animal models for investigating the roles
of specific proteins and can also facilitate the simultaneous
inhibition of the expression of two or more gene products. In addition,
possible compensatory mechanisms that may occur in knockout animals are
circumvented due to the rapid inhibition of expression obtained with an
asODNs approach.
In this report, we have demonstrated the efficacy and specificity of
asODNs with respect to inhibition of target gene mRNA
expression and then examined the effect of individually inhibiting SRA,
SRC-1, and TIF2 expression on ER transcriptional activity.
Furthermore, because SRC-1 and TIF2 can associate with each other in
stable multimeric protein complexes in vivo
(43), and coimmunoprecipitation studies
indicate the existence of complexes that contain both SRC-1 and SRA or
GRIP-1 and SRA (18, 19), we investigated the ability of
these coactivators to cooperate in modulating ER transactivation of
target gene expression. We found that antisense
oligodeoxynucleotides against SRA, SRC-1, and TIF2 inhibited
estrogen-stimulated ER transcriptional activity in a dose-dependent
fashion. Furthermore, combinations of coactivator antisense
oligodeoxynucleotides reduced ER action to an extent greater than
would be anticipated from individual antisense oligodeoxynucleotides
alone, indicating that these coactivators can exert their effects in a
cooperative manner. Finally, antisense oligodeoxynucleotides against
SRC-1 and TIF2, but not SRA, inhibited DNA synthesis and reduced
estrogen induction of the endogenous ER target gene, pS2, in the
estrogen-dependent MCF-7 breast cancer cell line, demonstrating the
utility of these antisense oligodeoxynucleotides for examining the role
of coactivators in mediating endogenous estrogen action.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, A and B).
Similar results were observed 48 h posttransfection (Fig. 1, C and
D), indicating that ODN uptake by HeLa cells is efficient.
|
Three SRA asODN targeting different regions of the SRA mRNA
were evaluated for their ability to reduce SRA mRNA expression in HeLa
cells. Twenty-four hours after transfection, cells were harvested and
total RNA was extracted and subjected to Northern analysis (Fig. 2A). As a control to ensure that altered
expression of the coactivator was due to a sequence-dependent
interaction of the ODNs with their specific target mRNAs and not to
sequence-dependent or -independent interactions with other molecules
(50, 51, 52, 53, 54, 55), we used ODNs of the same length and base
composition but randomized in sequence (randomized ODNs,
rsODNs). Results obtained with the asODNs (nos.
30217, 30215, and 30145) are expressed as a percentage of those
obtained with equivalent amounts of their corresponding
rsODNs (nos. 104534, 104533, and 104535, respectively). The
levels of SRA mRNA, normalized to the level of cyclophilin, revealed
that all three asODNs used were able to inhibit SRA
expression, when compared with the corresponding rsODNs, but
that asODN 30217, which inhibited SRA expression by
approximately 90%, was most effective (Fig. 2B). Consequently, the no.
30217 asODN and its corresponding control, 104534, were
selected for subsequent experiments.
|
). Quantification of the SRA Northern
blot and normalization to the level of cyclophilin mRNA demonstrated
that antisense ODN decreased SRA mRNA expression in a dose-dependent
manner (Fig. 3B), but that asODN amounts greater than 100
pmol did not increase the extent of inhibition.
|
). Densitometry revealed that
normalized levels of SRA mRNA decreased to approximately 25% of those
obtained with the corresponding control at t = 0 h (4 h after
start of ODN transfection) and further declined to almost undetectable
levels 6 h thereafter. Levels remained depressed for at least
72 h. Notably, more than 75% of SRA mRNA expression was still
repressed after 48 h (Fig. 4B), corresponding to the duration of
our transactivation experiments (see below). These data show that a
single transfection under our experimental conditions significantly
inhibits target coactivator expression for at least 3 d.
|
, A and B). Because
SRC-1 acts as a protein, we verified the extent and the duration of the
inhibition of its protein expression. Western analysis was performed on
protein extracts prepared from HeLa cells 1, 2, and 3 d after
transfection of SRC-1 asODN and rsODN (Fig. 5C).
The asODN reduced SRC-1 protein levels by 78%, 55%, and
44% after 1, 2, and 3 d, respectively, in comparison to SRC-1
levels measured in the presence of equivalent amounts of the
rsODN (Fig. 5D), indicating that a single antisense
transfection also is sufficient to decrease target coactivator protein
expression for at least 3 d. The efficacy of two different TIF2
asODNs also was tested by Northern analysis (data not shown)
and the asODN (no. 29977) that decreased TIF2 mRNA
expression to undetectable levels was chosen for subsequent use (see
Fig. 6A). Collectively, these data
demonstrate that we are able to use the selected ODNs as an effective
research tool for decreasing coactivator mRNA and protein expression in
receptor transactivation experiments.
|
|
) using doses equal or higher than those
used in the proceeding transactivation experiments. Also, SRC-1 and
TIF2 asODNs do not reduce SRA expression measured in Northern
experiments (Fig. 6B). When examined by Western analysis, the SRC-1
protein levels in the presence of TIF2 or SRA asODNs (Fig. 6, C and D, respectively) were not reduced, indicating no
cross-reactivity of SRA and TIF2 asODNs for SRC-1 mRNA.
These data show that, at levels equal or higher than those used in our
experiments, each asODN was specific for its target
coactivator.
Inhibition of SRC-1, TIF2, and SRA Coactivator Expression Impairs
ER Transcriptional Activity
Ligand binding promotes the association of nuclear receptors with
distinct subclasses of coregulators including SRC-1, TIF2, and SRA
(18, 21, 23, 24, 34, 43, 56, 57) and enhances their
transcriptional activation. To study the involvement of endogenous
levels of SRC-1, TIF2, and SRA on ER transcriptional activity, we
quantified ER-dependent gene expression using our antisense ODN
technology. HeLa cells were transiently transfected with an expression
vector for human ER along with a synthetic target gene consisting of
estrogen-responsive elements and a TATA box driving expression of
luciferase; increasing amounts of SRA, SRC-1, or TIF2 antisense or
rsODNs were added to cells at the same. To maximize the
efficiency of transfection of ODNs and plasmids into cells, a
replication-defective, poly-L-lysine modified,
adenovirus-mediated DNA delivery protocol was used
(58, 59, 60, 61, 62). Two hours after the
adenovirus/poly-L-lysine/ODN/plasmids mixture was
added to the cells, medium was replaced and 24 h thereafter cells
were treated with ethanol (vehicle) or 10-9
M E2 for 24 h. We found that
ligand-dependent ER transcriptional activity was impaired, in a
dose-dependent manner, by adding increasing amounts of SRA, SRC-1, and
TIF2 asODNs (Fig. 7, A–C,
respectively). Although, for clarity, values presented are from
estrogen-treated samples, luciferase values obtained from cells treated
with ethanol alone were also measured and compared with those obtained
from cells treated with E2 to ensure that adequate induction of
transactivation by E2 occurred in each experiment. Generally, the fold
induction obtained was equal to or more than 5 (data not shown). The
consistency of these results with the known roles of the coactivators
and the dose-dependent asODN inhibition of ER
transactivation provide further confirmation of an antisense
sequence-dependent mechanism and demonstrates the involvement of
endogenous SRC-1, TIF2, and SRA in the modulation of ER-dependent
target gene expression.
|
Transcriptional Activity transactivation induced by the
simultaneous inhibition of the two coactivators, we used the lowest
doses of asODNs that had produced, based on pilot
experiments, a modest effect on the ligand-dependent ER
transcriptional activity. Cells were therefore exposed to the
adenovirus-mediated transfection mixture containing 6.25 pmol of SRC-1
antisense or rsODNs and 25 pmol of SRA antisense or
rsODNs (Fig. 8A); higher
quantities of asODNs were tested in the same experiments to
confirm that inhibition of transactivation occurred in each experiment
(data not shown). When the cells were simultaneously exposed to SRC-1
and SRA asODNs, the decrease in estrogen-induced ER
transcriptional activity, measured as a percentage of the ER
transcriptional activity obtained in the presence of both
rsODNs, was approximately 70%, whereas SRC-1 and SRA
asODNs reduced target gene expression by only 10% and 20%,
respectively. The experiment was repeated at least three times,
confirming that the simultaneous presence of two asODNs
causes a reduction in target gene expression greater than anticipated
from either ODN treatment alone. Similar experiments were performed by
simultaneously inhibiting SRA and TIF2, and SRC-1 and TIF2 expression
(Fig. 8, B and C, respectively), providing evidence for a more than
additive effect on ER transcriptional activity by either combination
of coactivators. These results demonstrate that, in addition to
associating with each other, these coactivators can cooperate in the
modulation of estrogen-dependent ER transactivation in HeLa
cells.
|
and their growth is estrogen dependent
(63). Therefore, to determine whether any of the
coactivators examined in this study contributed to estrogen-mediated
growth, MCF-7 cells were transfected with the indicated quantity of
asODNs or their corresponding rsODNs, and 24
h thereafter cell proliferation was assessed by
[3H]thymidine incorporation. It is important to
note that these studies are possible because virtually all the cells
uptake ODN. In contrast, transient transfection efficiencies for
expression vectors generally are of insufficient magnitude to examine
endogenous biological responses. As shown in Fig. 9A, asODNs to SRC-1 or TIF2
decreased cell proliferation in comparison to cells transfected with
equivalent levels of rsODN. Interestingly, SRA
asODN did not inhibit [3H]thymidine
incorporation in these cells but, instead, had a modest stimulatory
effect on DNA synthesis. These results were further substantiated in
cells grown in stripped serum in the absence or presence of 1
nM E2 to ensure that the asODN
inhibited estrogen-induced cell proliferation (Fig. 9B). E2 stimulated
[3H]thymidine incorporation in SRA, SRC-1, or
TIF2 rsODN-treated cells by 4- to 5-fold. These increases in
DNA synthesis were attenuated in cells treated with asODNs
to either SRC-1 or TIF2, but not to SRA, a result similar to that
obtained for Fig. 9A.
|
30-fold)
in MCF-7 than in HeLa cells.
The effect of coactivator asODNs on induction of an
estrogen-regulated target gene, pS2 (65), was also
examined. Sixteen hours of E2 stimulation of MCF-7 cells treated with
rsODN to either SRA, SRC-1, or TIF2 resulted in a 4- to
6-fold induction of pS2 mRNA in comparison to levels measured for cells
treated with the appropriate rsODN and ethanol vehicle.
Similar to the results obtained for our DNA synthesis experiments,
asODN to both SRC-1 and TIF2 reduced E2-induced pS2 mRNA
levels, but the SRA asODN had no effect on the expression of
this target gene (Fig. 10A). To ensure
that the lack of SRA response was not due to an inability of SRA
asODN to decrease the expression of its target coactivator
in MCF-7 cells, SRA mRNA transcripts in cells treated with either SRA
rsODN or asODN were quantitated. As shown in Fig. 10B, SRA asODN reduced SRA mRNA expression by about 55%. We
also verified that SRC-1 and TIF2 asODN reduced the
expression of their corresponding mRNAs and found that they were
reduced by approximately 75% and 90%, respectively. Thus, although
these three asODN reduced expression of their respective
mRNAs, their ability to affect the expression of an endogenous ER
target gene was variable. Taken together, the
[3H]thymidine and pS2 results demonstrate that
asODNs are able to inhibit the ability of endogenous ER to
elicit biological responses. Furthermore, these results also indicate
that all coactivators are not functionally equivalent with respect to
biological responses in estrogen target cells.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and ERß are responsible
for mediating these effects in target tissues by acting as
ligand-dependent transcription factors (66, 67) the
activity of which is amplified by different classes of coactivators
including SRC family members and the novel steroid receptor
coactivator, SRA. The aim of the present study was to investigate the
involvement of these coactivators in modulating ER transcriptional
activity using an approach that does not utilize overexpression of the
coactivators, which can result in artifactual results. Although all of
the SRC family members possess similar properties in terms of
interaction with nuclear receptors in vitro and enhancement
of their transcriptional activities in transient transfections, their
tissue distribution profiles are not completely overlapping (reviewed
in Ref. 39). Here we focused on SRC-1 and TIF2, which
share high homology and similar functional activities, whereas RAC3 has
been shown to exhibit functions and cell/tissue distributions distinct
from SRC-1/TIF2 (22, 39). The relevance of the requirement of SRC-1 in mediating nuclear receptor transcriptional activity has been substantiated in SRC-1 knockout mice that develop a partial sex steroid (38) and thyroid hormone resistance (68). Mouse knockout models for TIF2 and SRA are not yet available. In our search for a faster and cheaper, but still reliable, way to explore the roles of these coactivators in their endogenous environment, we inhibited their expression in transient transfection assays using asODNs as a tool. The only information required to synthesize asODNs is the nucleic acid sequence of the target. This advantage makes antisense technology a particularly useful approach for studying molecules that, like SRA, act as RNA transcripts. It has been shown that asODNs as long as 15–20 bases are able to discriminate between two gene products that differ by a single base (69). This specificity is particularly important when the targets share high homology with related molecules as is the case between SRC family members (31). A similar approach using asODNs of 23 bases has been successfully used to discriminate between two other closely related cofactors, CREB binding protein and p300, and their functional roles in RA-induced differentiation of F9 cells (70).
To the best of our knowledge, functional roles of SRC-1 and TIF2 in mediating nuclear receptor transactivation have never been investigated using antisense ODNs in transfection experiments. A complementary approach, in which a plasmid encoding full-length SRC-1 antisense mRNA was stably transfected into human osteosarcoma (MG-63) cells, made it possible to establish a biological role for SRC-1 with respect to 1,25-dihydroxyvitamin D3 stimulation of alkaline phosphatase activity (71). Similarly, the inhibition of endogenous GRIP-1 expression in myogenic (C2C12) cells, obtained by stable transfection of a plasmid encoding full-length GRIP-1/TIF-2 antisense RNA, revealed a functional role for this coactivator in skeletal differentiation (72). However, in both these cases, growing cells in the continuous absence of target coactivators could result in compensatory phenomena, as has been observed in SRC-1 knockout mice (38), which can be avoided with the rapid inhibition obtained by transiently transfecting asODNs.
After assessing the reliability of asODNs as a research tool
in HeLa cells, we found that inhibiting the endogenous expression of
any one of the coactivators tested resulted in impairment of
ER-mediated transactivation of a synthetic estrogen-responsive
target gene. These data are consistent with those obtained by
overexpressing the coactivators in transient transfection experiments
(13, 21, 24, 73, 74) but provide verification in a more
physiological manner. We also assessed the level of cooperation between
individual coactivators by simultaneously exposing the cells to two
different asODNs. The rationale for these experiments was
based on evidence that SRC family members are capable of forming
multimeric complexes in vivo. In particular, SRC-1 and TIF2
have been shown to associate in stable multimeric protein complexes
(43), and SRA coexists in a ribonucleoprotein complex
containing SRC-1 and/or TIF2 (18, 19). Although the
functional significance of these particular associations is unknown,
deletion of one of the DEAD-box motifs of the ER AF-1 coactivator,
p72, blocks its ability to bind SRA and enhance ER transactivation
(19). Our results revealed that the tested coactivators
contributed to ER transcriptional activity in a more than additive
way and therefore provide evidence of intracellular cooperation between
SRC1–1, TIF2, and SRA, which is consistent with their coexpression in
the same cell line and/or tissue and with their demonstrated
intracellular associations.
It has been previously shown that MCF-7 cells engineered to stably
overexpress SRC-1 exhibit greater ER transcriptional activity measured
on target genes delivered via transient transfection (75).
These cells also grew better in response to estrogen treatment and
required greater concentrations of 4-hydroxytamoxifen to block
E2-stimulated cell growth than the parental cell line
(75), suggesting that the SRC-1 coactivator positively
contributes to the growth of this breast cancer cell line. Our results
are consistent with this finding and demonstrate that both SRC-1 and
TIF2 contribute to MCF-7 cell proliferation. However, differences in
the magnitude of the asODN effect on cell proliferation and
pS2 induction (see below) and ER transactivation of a synthetic
reporter gene in HeLa cells were noted. These may be due to
cell-specific differences in coactivator function or expression
patterns (both SRC family and other coactivators) and/or reflect
differences in the promoters of the targets being examined
(e.g. simple vs. endogenous, complex target
genes, chromatin structure, and/or the number and sequence of the
estrogen response elements). Indeed, our analyses revealed much higher
levels of RAC3 mRNA in MCF-7 vs. HeLa cells, and it has been
demonstrated that the sequence of the estrogen response element (ERE)
influences the ability of ER to recruit TIF2 to DNA
(76). Depletion of the p300 coactivator, which binds to ER
and SRC-1 (77, 78), by an p300 antisense expression vector
has also been shown to reduce DNA synthesis in MCF-10A nontransformed,
immortalized breast epithelial cells and MSU fibroblasts
(79), consistent with a role for coactivators in cell
proliferation. Intriguingly, under our experimental conditions, SRA
asODN did not inhibit [3H]thymidine
incorporation, suggesting that the role of SRA in cell proliferation,
if any, is distinct from that of SRC-1 and TIF2. Furthermore, this
result provides evidence that the responses elicited with our
asODN tools are specific to the coactivator under
study and are not a general artifact of oligonucleotide
transfection.
The inhibition of estrogen-induced pS2 mRNA expression by antisense
ODNs against SRC-1 and TIF2 is consistent with their ability to
decrease ER transactivation in HeLa cells and estrogen-dependent cell
proliferation in MCF-7 cells and suggests that these two coactivators
make contributions to the regulation of this ER target gene. Stable
expression of SRC-1 in MCF-7 cells has been shown to increase the
ability of E2 to stimulate pS2 mRNA expression (75),
further supporting a role for this coactivator in the regulation of
this target gene’s expression. Although there is no direct information
on SRA coactivation of pS2 gene expression, a deletion mutant of the
ER coactivator, p72, that abolishes its ability to interact with
SRA, also blocks its ability to enhance estrogen induction of pS2 gene
expression when transiently overexpressed in MCF-7 cells
(19). Thus, the inability of our SRA asODNs to
inhibit estrogen induction of pS2 mRNA expression is somewhat
surprising and suggests that the mechanisms of SRA action are likely to
be complex.
Increases in SRA expression in breast tumor samples in comparison to
normal adjacent tissue have been noted in a recent study
(80), suggesting that SRA may play a role in cancer cells
unrelated to stimulating cell growth. Paradoxically, reducing SRA
expression may relieve ER from the influence of a corepressor in MCF-7
cells (20) and thereby increase ER activity. Sharp
(SMRT/HDAC-1-associated repressor protein) is a nuclear receptor
corepressor that can inhibit ER transactivation in a SRA-dependent
manner. Furthermore, Sharp expression is estrogen inducible in MCF-7
cells (20). Thus, by reducing SRA expression, it is
possible that the ability of Sharp to negatively regulate ER
transcriptional activity, perhaps as part of the mechanism by which
cells attenuate estrogen signaling, may be lost. The lack of SRA
asODN influence may therefore represent loss of coactivation
balanced by loss of corepression. Alternatively, these data also
support a model in which endogenous SRA regulates ER activity in a cell
(HeLa vs. MCF-7)-, or promoter-specific manner; the latter
due either to differences in promoter DNA sequence or in chromatin
structure between transient reporter templates and endogenous
genes.
Taken together, these data demonstrate that asODN can be
used to examine the role of endogenous levels of coactivators. In so
doing, it is possible to examine coactivator function in a variety of
cell types while avoiding artifacts associated with overexpression of
exogenous coactivators or compensatory changes in gene expression.
These studies have also revealed that coactivators play specific roles
with respect to mediating the biological effects of ER. More
detailed analysis of coactivator specificity with respect to steroid
receptor function promises to provide insight into the cell and
promoter specificity of ER action and may ultimately provide the
basis to improve the target specificity of receptor-based endocrine
therapies.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
(pCMV5hER) (81), for SRA
(pSCT-SRA) (18), for SRC-1a (pCR3.1-hSRC-1a)
(73), and for TIF2 (pCR3.1-TIF2) (82) have
been described previously as has the estrogen-responsive reporter
plasmid, 3xERE-TATA-luciferase (83).
Oligodeoxyribonucleotides
Phosphorothioate oligonucleotides, 18 bases in length, were
synthesized by ISIS Pharmaceuticals (Carlsbad, CA). The
oligodeoxynucleotides designated nos. 29977, 117226, 29912, 104531,
30215, 104533, 30217, and 104534 are gapmers that consist of
2'methoxy-ethyl nucleotides phosphorothioated on each end (to improve
nuclease resistance and hybridization affinity of the oligomer for
complementary mRNAs) and 2'deoxynucleotides in the middle (to
support RNaseH activity). The 30145 and 104534 oligodeoxynucleotides
are phosphorothioate ODNs. The oligonucleotide sequence and region of
coactivator to which they bind are shown in Table 1. The control oligonucleotides (nos.
117226, 104531, 104535, 104534, and 104533) have the same base
composition as nos. 29977, 29912, 30215, 30217, and 30145,
respectively, but the sequence has been randomized. The FITC-conjugated
ODN 21437 (GGTTATCCTTGGCTACATTA) is a gapmer labeled with a fluorescein
isothiocyanate group on its 5'-end.
|
For microscopy, Northern, and Western experiments, HeLa cells were transfected by LipofectAMINE according to the manufacturer’s protocol (Life Technologies, Inc., Gaithersburg, MD). MCF-7 studies were also performed using LipofectAMINE transfection. Briefly, 24 h after plating, cells were exposed, in the presence of phenol red- and serum-free medium, to the transfection mixture containing LipofectAMINE and the ODNs. Four hours later, medium containing the LipofectAMINE/ODN mixture was replaced with DMEM containing 5% sFBS until harvesting.
For transactivation experiments, cells were transfected as previously
described (62) using the
poly-L-lysine-conjugated, replication-deficient adenovirus
dl312, at a multiplicity of infection of 500:1. Briefly, after 30 min
of incubation of the adenovirus with the
pCMV5hER and 3xERE-TATA-luciferase plasmids
(0.4 and 80 ng per well, respectively) and the indicated amounts of
ODNs (see figure legends), poly-L-lysine was added to the
mixture for a second incubation in which
virus/ODN/poly-L-lysine complexes are formed and
subsequently added to cells in the presence of phenol red- and
serum-free medium. After 2 h of incubation, the medium was
replaced with phenol red-free DMEM containing 5% sFBS, and 24 h
later cells were treated with ethanol (vehicle) or
10-9 M E2 (Sigma, St.
Louis, MO) for 24 h. Cells were harvested in TEN (40
mM Tris, pH 8.0/1 mM EDTA/150 mM
NaCl), and cell extracts were assayed for luciferase activity using the
luciferase assay system (Promega Corp., Madison, WI) and a
Monolight 2010 Luminometer (Analytical Luminescence Laboratory, San Diego, CA); values were corrected for protein
content determined using the protein assay according to the
manufacturer’s protocol (Bio-Rad Laboratories, Inc.,
Hercules, CA).
Fluorescence and Differential Interference Contrast (DIC)
Microscopy
Immediately and 44 h after removal of the
LipofectAMINE/FITC-conjugated-ODN mixture, cells were washed several
times in PBS, mounted in VECTASHIELD medium for fluorescence
(Vector Laboratories, Inc., Burlingame, CA), and examined
by fluorescence and DIC microscopy with a AxioPhot microscope
(Carl Zeiss, Thornwood, NY) and a C5810 chilled three
change-coupled device camera (Hamamatsu Corp., Bridgewater, NJ)
to visualize the number of fluorescent and total cells,
respectively.
Northern Analysis
Twenty-four and forty-eight hours after removing the ODNs, with
the exception of the time course experiment (see Results),
HeLa cells were harvested and total RNA extracted using TRIzol reagent
according to the manufacturer’s protocol (Life Technologies, Inc.). Thirty micrograms per lane of total RNA were loaded on
1.2% formaldehyde/agarose gel and then transferred by capillary action
to nitrocellulose membrane (Osmonics, Inc., Westborough, MA).
The blots were probed under high-stringency conditions [overnight at
65 C in hybridization buffer consisting of 0.5% SDS, 6x SSC (1x = 3
M sodium chloride, 0.3 M
sodium citrate, pH 7.0) 5x Denhardt’s solution (84), and
100 µg/ml of salmon sperm DNA] with a
[32P]dCTP-labeled probe for SRA, SRC-1, TIF2,
or cyclophilin. The probes were prepared using the RadPrime DNA
labeling system (Life Technologies, Inc.) and fragments of
the hSRC-1a (nucleotides 829–1,067) and TIF2 (nucleotides
4,204–4,815) cDNAs, or full-length cDNAs for human SRA or mouse
cyclophilin (85) as templates. After washing,
radiolabeled blots were subjected to autoradiography at -80 C using
Kodak Biomax MS films (Eastman Kodak Co.,
Rochester, NY). Intensity of the bands was quantified by scanning
laser densitometry (Molecular Dynamics, Inc.,
Sunnyvale, CA).
Real-time RT-PCR Assays
Measurements for RNA samples prepared from MCF-7 cells were
performed using real-time RT-PCR and TaqMan chemistry
(64). Briefly, cells were harvested and RNA was isolated
by S.N.A.P. Total RNA Isolation kit (Invitrogen,
San Diego, CA) according to the manufacturer’s instructions. Total RNA
was analyzed by real-time RT-PCR using the ABI Prism 7700 Sequence
Analyzer (PE Applied Biosystems, Foster City, CA). Primers
and probes for pS2, SRC-1, TIF2 and SRA (Table 2) were designed using Primer Express
software (PE Applied Biosystems), and target transcript
quantities were normalized against 18S rRNA using an 18S primer/probe
set purchased from PE Applied Biosystems. Probes were
fluorescently labeled with 6FAM (6-carboxy-fluorescein) and TAMRA
(6-carboxy-tetremethyl-rhodamine) on the 5'- and 3'-ends, respectively.
Assays were performed as 50-µl reactions using TaqMan One-Step
RT-PCR Master Mix reagents in MicroAmp 96-well plates (PE Applied Biosystems). Five microliters of MCF-7 total RNA (100 ng)
were analyzed for pS2, SRC-1, TIF2, and SRA mRNA transcripts. For
normalization against the 18S transcript, each sample was diluted
100-fold so that approximately 1 ng of total RNA was analyzed in a
separate well. The RT reaction was incubated at 48 C for 30 min to
allow cDNA synthesis and terminated by heating for 10 min at 95 C. The
reaction was then PCR amplified for 40 cycles consisting of 25 sec at
95 C and 1 min at 60 C. Cycle threshold values for each reaction were
determined using TaqMan SDS analysis software and standardized against
a common total RNA sample obtained from MCF-7 cells grown in the
presence of 10% FCS.
|
DNA Synthesis Assay
MCF-7 (human breast cancer) cells were routinely maintained in
DMEM and 10% FBS. Forty-eight hours before transfections, 1.5 x
105 cells were seeded per well of a six-well
multiplate. Cells were transfected with the indicated amounts of SRA,
SRC-1, or TIF2 antisense ODNs or with equivalent quantities of the
corresponding random sense ODNs by LipofectAMINE. Oligonucleotides were
removed 4 h thereafter, and 24 h after transfection, cells
were radiolabeled with 2 µCi/ml [3H]thymidine
(NEN Life Science Products, Boston, MA) for 2 h at 37
C, after which they were processed to determine tritium incorporation
(86), using a scintillation counter (Beckman Coulter, Inc., Fullerton, CA). For experiments examining the
effects of ODNs on estrogen-dependent DNA synthesis, MCF-7 cells were
maintained in media containing 5% sFBS for 48 h before
LipofectAMINE transfection with 200 pmol of the indicated ODNs.
Twenty-four hours thereafter, cells were treated for 24 h with
vehicle (0.1% ethanol) or 1 nM E2 and were radiolabeled
with [3H]thymidine for 2 h before
determination of tritium incorporation. All experiments were done in
triplicate, and results are shown as average ±
SEM.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Present address: Istituto di Endocrinologia, Universita’ di Milano,
Via Balzaretti, 9, 20133 Milano, Italy. 
Abbreviations: AF, Activation function; asODN, antisense oligodeoxynucleotide; DIC, differential interference contrast; ERE, estrogen response element; FITC, fluorescein isothiocyante; GRIP, GR-interacting protein; HDAC, histone deacetylase; NCoA, nuclear receptor coactivator; RNaseH, ribonuclease H; rsODN, randomized oligodeoxynucleotide; sFBS, dextran-coated, charcoal-stripped FBS; SRA, steroid receptor RNA activator; SRC, steroid receptor coactivator; SMRT, silencing mediator of retinoic acid and thyroid hormone receptors; TIF2, transcriptional intermediary factor.
Received for publication February 16, 2001. Accepted for publication October 9, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
is essential for
transcriptional activation and interaction with the general
transcription factor TFIIB. Mol Cell Biol 15:4507–4517[Abstract]
coactivator through the N-terminal activation domain
(AF-1) with an RNA coactivator, SRA. EMBO J 20:1341–1352[CrossRef][Medline]
. Gene
Express 6:185–195[Medline]
and coactivator
turn-over and for efficient estrogen receptor- transactivation. Mol
Cell 5:939–948[CrossRef][Medline]
and ß. Mol Cell Biol 19:8226–8239This article has been cited by other articles:
 |
|
 |
|
  S. Karmakar, E. A. Foster, and C. L. Smith Unique Roles of p160 Coactivators for Regulation of Breast Cancer Cell Proliferation and Estrogen Receptor-{alpha} Transcriptional Activity Endocrinology, April 1, 2009; 150(4): 1588 - 1596. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Naughton, K. MacLeod, B. Kuske, R. Clarke, D. A. Cameron, and S. P. Langdon Progressive Loss of Estrogen Receptor {alpha} Cofactor Recruitment in Endocrine Resistance Mol. Endocrinol., November 1, 2007; 21(11): 2615 - 2626. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Peterson, S. Karmakar, M. C. Pace, T. Gao, and C. L. Smith The Silencing Mediator of Retinoic Acid and Thyroid Hormone Receptor (SMRT) Corepressor Is Required for Full Estrogen Receptor {alpha} Transcriptional Activity Mol. Cell. Biol., September 1, 2007; 27(17): 5933 - 5948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. U. Agoulnik, A. Vaid, M. Nakka, M. Alvarado, W. E. Bingman III, H. Erdem, A. Frolov, C. L. Smith, G. E. Ayala, M. M. Ittmann, et al. Androgens Modulate Expression of Transcription Intermediary Factor 2, an Androgen Receptor Coactivator whose Expression Level Correlates with Early Biochemical Recurrence in Prostate Cancer Cancer Res., November 1, 2006; 66(21): 10594 - 10602. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yano, K. Imai, A. Shimizu, and T. Hanashita A new method for gene discovery in large-scale microarray data Nucleic Acids Res., March 14, 2006; 34(5): 1532 - 1539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Fowler, N. M. Solodin, C. C. Valley, and E. T. Alarid Altered Target Gene Regulation Controlled by Estrogen Receptor-{alpha} Concentration Mol. Endocrinol., February 1, 2006; 20(2): 291 - 301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Hussein-Fikret, P. J. Fuller, and C. E. Gargett Expression of Steroid Receptor Coactivators in Cultured Cells From Paired Myometrial and Fibroid Tissues Reproductive Sciences, September 1, 2005; 12(6): 445 - 451. [Abstract] [PDF]
|
|
|
|
|
|
I. U. Agoulnik, A. Vaid, W. E. Bingman III, H. Erdeme, A. Frolov, C. L. Smith, G. Ayala, M. M. Ittmann, and N. L. Weigel Role of SRC-1 in the Promotion of Prostate Cancer Cell Growth and Tumor Progression Cancer Res., September 1, 2005; 65(17): 7959 - 7967. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.-C. Wu, C. L. Smith, and B. W. O'Malley Transcriptional Regulation by Steroid Receptor Coactivator Phosphorylation Endocr. Rev., May 1, 2005; 26(3): 393 - 399. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Labhart, S. Karmakar, E. M. Salicru, B. S. Egan, V. Alexiadis, B. W. O'Malley, and C. L. Smith Identification of target genes in breast cancer cells directly regulated by the SRC-3/AIB1 coactivator PNAS, February 1, 2005; 102(5): 1339 - 1344. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Pineda Torra, L. P. Freedman, and M. J. Garabedian Identification of DRIP205 as a Coactivator for the Farnesoid X Receptor J. Biol. Chem., August 27, 2004; 279(35): 36184 - 36191. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Smith and B. W. O'Malley Coregulator Function: A Key to Understanding Tissue Specificity of Selective Receptor Modulators Endocr. Rev., February 1, 2004; 25(1): 45 - 71. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Tzortzakaki, C. Spilianakis, E. Zika, A. Kretsovali, and J. Papamatheakis Steroid Receptor Coactivator 1 Links the Steroid and Interferon {gamma} Response Pathways Mol. Endocrinol., December 1, 2003; 17(12): 2509 - 2518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. Molenda, C. P. Kilts, R. L. Allen, and M. J. Tetel Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior Biol Reprod, November 1, 2003; 69(5): 1449 - 1457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Xu and Q. Li Review of the in Vivo Functions of the p160 Steroid Receptor Coactivator Family Mol. Endocrinol., September 1, 2003; 17(9): 1681 - 1692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Dutertre and C. L. Smith Ligand-Independent Interactions of p160/Steroid Receptor Coactivators and CREB-Binding Protein (CBP) with Estrogen Receptor-{alpha}: Regulation by Phosphorylation Sites in the A/B Region Depends on Other Receptor Domains Mol. Endocrinol., July 1, 2003; 17(7): 1296 - 1314. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Shiozawa, H.-C. Shih, T. Miyamoto, Y.-Z. Feng, J. Uchikawa, K. Itoh, and I. Konishi Cyclic Changes in the Expression of Steroid Receptor Coactivators and Corepressors in the Normal Human Endometrium J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 871 - 878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Lanz, B. Razani, A. D. Goldberg, and B. W. O'Malley Distinct RNA motifs are important for coactivation of steroid hormone receptors by steroid receptor RNA activator (SRA) PNAS, December 10, 2002; 99(25): 16081 - 16086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Apostolakis, M. Ramamurphy, D. Zhou, S. Onate, and B. W. O'Malley Acute Disruption of Select Steroid Receptor Coactivators Prevents Reproductive Behavior in Rats and Unmasks Genetic Adaptation in Knockout Mice Mol. Endocrinol., July 1, 2002; 16(7): 1511 - 1523. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
