Molecular Endocrinology 16 (2): 253-270
Copyright © 2002 by The Endocrine Society
Reduction of Coactivator Expression by Antisense Oligodeoxynucleotides Inhibits ER
Transcriptional Activity and MCF-7 Proliferation
Ilaria T. R. Cavarretta1,
Ratna Mukopadhyay,
David M. Lonard,
Lex M. Cowsert,
C. Frank Bennett,
Bert W. OMalley and
Carolyn L. Smith
Department of Molecular and Cellular Biology (I.T.R.C., R.M.,
D.M.L, B.W.O., C.L.S.), Baylor College of Medicine, Houston, Texas
77030-3498; and ISIS Pharmaceuticals (L.M.C., C.F.B.), Carlsbad,
California 92008
Address all correspondence and requests for reprints to: Carolyn L. Smith, Ph.D., Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030-3498. E-mail: carolyns{at}bcm.tmc.edu
 |
ABSTRACT
|
|---|
Steroid receptor RNA activator (SRA) is a novel coactivator for
steroid receptors that acts as an RNA molecule, whereas steroid
receptor coactivator (SRC) family members, such as steroid receptor
coactivator-1 (SRC-1) and transcriptional intermediary factor 2 (TIF2)
exert their biological effects as proteins. Individual overexpression
of each of these coactivators, which can form multimeric complexes
in vivo, results in stimulated ER
transcriptional
activity in transient transfection assays. However there is no
information on the consequences of reducing SRC-1, TIF2, or SRA
expression, singly or in combination, on ER
transcriptional
activity. We therefore developed antisense oligodeoxynucleotides
(asODNs) to SRA, SRC-1, and TIF2 mRNAs, which
rapidly and specifically reduced the expression of each of these
coactivators. ER
-dependent gene expression was reduced in a
dose-dependent fashion by up to 80% in cells transfected with these
oligonucleotides. Furthermore, treatment of cells with combinations of
SRA, SRC-1, and TIF2 asODNs reduced ER
transcriptional activity to an extent greater than individual
asODN treatment alone, suggesting that these
coactivators cooperate, in at least an additive fashion, to activate
ER
-dependent target gene expression. Finally, treatment of MCF-7
cells with asODN against SRC-1 and TIF2 revealed a
requirement of these coactivators, but not SRA, for hormone-dependent
DNA synthesis and induction of estrogen-dependent pS2 gene expression,
indicating that SRA and SRC family coactivators can fulfill specific
functional roles. Taken together, we have developed a rapid method to
reduce endogenous coactivator expression that enables an assessment of
the in vivo role of specific coactivators on ER
biological action and avoids potential artifacts arising from
overexpression of coactivators in transient transfection assays.
 |
INTRODUCTION
|
|---|
THE ERs, ER
and ERß, are
ligand-regulated transcription factors and members of the nuclear
receptor superfamily (1, 2, 3, 4). They work by facilitating the
assembly of basal transcription factors into a stable preinitiation
complex at the promoter of estrogen-responsive target genes
(5). Two distinct activation functions (AFs) contribute to
the ERs transcriptional activity: the ligand-independent AF-1 located
in the amino-terminal region, and the hormone-dependent AF-2 situated
in the carboxyl-terminal, ligand binding domain. The relative
importance of AF-1 and AF-2 in mediating transcriptional activity
varies among different nuclear receptors (6, 7, 8) and
depends on ligand, cell type, and target gene promoter (9, 10). Maximal E2-stimulated activity in most cellular contexts
requires the synergistic activity of AF-1 and AF-2 domains
(11, 12, 13).
The activation domains of ER interact with either basal transcription
factors and/or specific cellular proteins that function as coactivators
(14, 15, 16, 17). Recently, a novel coactivator, termed steroid
receptor RNA activator (SRA), was isolated in a yeast two-hybrid screen
using the amino-terminal domain of the PR, another member of the
nuclear receptor superfamily, as bait (18). When
overexpressed in mammalian cells, SRA selectively enhances PR-, AR-,
GR-, and ER-mediated transcription of reporter genes containing the
corresponding hormone response elements without significantly enhancing
their basal transcriptional activity. SRA is unique because it appears
to exert its coactivator function as an RNA transcript, whereas all
other known coactivators exert their biological effects as proteins.
SRA is also unusual because it binds both to a positively acting
coactivator, p72 (19), as well as the transcriptional
repressor, Sharp (20).
The p160 coactivator, steroid receptor coactivator-1 [SRC-1;
(21)], a member of a gene family of coactivators that
also includes transcriptional intermediary factor-2 [TIF2; also called
GR-interacting protein 1 (GRIP-1) or SRC-2 (22, 23, 24)] and
receptor associated coactivator-3 [RAC3; also called SRC-3, TRAM1,
AIB1, ACTR, or p/CIP (25, 26, 27, 28, 29, 30)], was identified by virtue
of its ability to bind to the AF-2 domain of ligand-bound PR
(21). SRC-1, which exists in two different isoforms
[SRC-1a and SRC-1e (31)], interacts in a
ligand-dependent manner with the AF-2 domains of a broad range of
nuclear receptors including ER and increases their transcriptional
activity (21, 32). In addition, it has been shown that
SRC-1 interacts with the AF-1 domain of ER
and can mediate
functional interactions between the receptors two activation domains
(13, 33). TIF-2 has considerable sequence and functional
similarity to SRC-1; it can associate in vivo with
hormone-bound ER and coactivate its ligand-dependent transcriptional
activity (23, 24, 25, 34). Moreover, the mouse homolog of
TIF-2, GRIP-1, has been shown to bind to and enhance the activity of
both the AF-1 and AF-2 domains (35).
In vivo, there is evidence for a division between SRC-1 and
TIF2 vs. RAC3 functions. For instance, the expression of
RAC3 in some tissues and cells is higher compared with that of SRC-1
and TIF2 (36), and a differential expression pattern for
SRC-1 and RAC3 has been observed in SRC-1 and RAC3 knockout mice
(37, 38). Furthermore, in SRC-1 null mice, a compensatory
overexpression of TIF2, but not of RAC3, has been demonstrated
(38). Consistent with this, the inhibitory effects of an
anti-NCoA-1 (nuclear receptor coactivator-1; mouse SRC-1) IgG on RAR
activation can be reversed by coinjection of expression vectors for
NCoA-1 or NCoA-2 (mouse SRC-2) but not p/CIP
(p300/CBP/cointegrator-associated protein; mouse SRC-3)
(25). In contrast, in cell-free or transient
transfection experiments, which assess the effects of overexpressed
coactivators on receptor-dependent transcription of synthetic reporter
genes, SRC family members are similar with respect to enhancement of
nuclear receptor transcriptional activity (21, 24, 28, 39). However, these approaches do not reflect the
effective role of endogenous, physiological levels of coactivator
relative to other proteins in the cellular environment. Antibody
microinjection into single cells is another method used to assess
coactivator function. However, this technique yields limited
quantitative information and cannot distinguish between a block in the
activity of a specific protein and disruption of the function of a
preformed complex containing the targeted coactivator, possibly
through steric hindrance. As an alternative to these approaches, we
have developed the use of antisense oligonucleotide technology to
study the role of coactivators in ER
function. Antisense
oligodeoxynucleotides (asODNs) are short pieces of
synthetic, chemically modified nucleic acid oligomers designed to
hybridize to a specific mRNA using Watson-Crick base pairing rules and
reduce levels of the target mRNA (40, 41, 42). When correctly
and carefully used, they represent a fast and inexpensive alternative
to the generation of knockout animal models for investigating the roles
of specific proteins and can also facilitate the simultaneous
inhibition of the expression of two or more gene products. In addition,
possible compensatory mechanisms that may occur in knockout animals are
circumvented due to the rapid inhibition of expression obtained with an
asODNs approach.
In this report, we have demonstrated the efficacy and specificity of
asODNs with respect to inhibition of target gene mRNA
expression and then examined the effect of individually inhibiting SRA,
SRC-1, and TIF2 expression on ER
transcriptional activity.
Furthermore, because SRC-1 and TIF2 can associate with each other in
stable multimeric protein complexes in vivo
(43), and coimmunoprecipitation studies
indicate the existence of complexes that contain both SRC-1 and SRA or
GRIP-1 and SRA (18, 19), we investigated the ability of
these coactivators to cooperate in modulating ER transactivation of
target gene expression. We found that antisense
oligodeoxynucleotides against SRA, SRC-1, and TIF2 inhibited
estrogen-stimulated ER transcriptional activity in a dose-dependent
fashion. Furthermore, combinations of coactivator antisense
oligodeoxynucleotides reduced ER
action to an extent greater than
would be anticipated from individual antisense oligodeoxynucleotides
alone, indicating that these coactivators can exert their effects in a
cooperative manner. Finally, antisense oligodeoxynucleotides against
SRC-1 and TIF2, but not SRA, inhibited DNA synthesis and reduced
estrogen induction of the endogenous ER target gene, pS2, in the
estrogen-dependent MCF-7 breast cancer cell line, demonstrating the
utility of these antisense oligodeoxynucleotides for examining the role
of coactivators in mediating endogenous estrogen action.
 |
RESULTS
|
|---|
Assessment of Antisense Oligodeoxyribonucleotides on
Coactivator Expression
Before screening the efficacy of various oligodeoxynucleotides,
the transfection efficiency of a fluorescein isothiocyanate
(FITC)-labeled ODN was assessed. High ODN incorporation is important to
detect a significant difference in mRNA expression by Northern analysis
and to ensure that all cells in our transactivation assays have reduced
coactivator expression. Because of the large literature documenting
that the use of polycationic lipids improves the uptake of ODNs from
cells (44, 45), we transfected the ODNs using
LipofectAMINE. To test the efficiency of uptake, we observed the cell
fluorescence pattern after transfecting HeLa cells with a
fluorescein-conjugated ODN. Four hours after addition of the
LipofectAMINE/ODN mixture, virtually all the cells were positive for
FITC-ODN uptake (Fig. 1
, A and B).
Similar results were observed 48 h posttransfection (Fig. 1
, C and
D), indicating that ODN uptake by HeLa cells is efficient.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 1. Uptake of a FITC-Conjugated ODN by HeLa Cells
Cells were transfected with a fluorescein-conjugated ODN using
LipofectAMINE. The efficiency of transfection was evaluated by
observing the cell fluorescence pattern immediately after removal of
the LipofectAMINE/ODN mixture (A) and 48 h thereafter (C) and by
comparing the number of fluorescent cells to the total number of cells
observed by DIC-microscopy (B and D, respectively). Magnification,
40x.
|
|
A series of asODNs targeting different regions of SRA,
SRC-1, and TIF2 were synthesized and screened by RT-PCR for their
ability to reduce expression of their corresponding mRNA targets in the
T24 bladder tumor cell line (data not shown); the most effective
asODNs were selected for further study. One of the most
widely recognized mechanisms by which asODNs lead to the
degradation of specific mRNA targets involves the action of
ribonuclease H (RnaseH) (46), an endonuclease that
recognizes RNA/DNA duplexes and selectively cleaves the RNA strand
(47, 48, 49). The relative and absolute endogenous levels of
coactivators can vary substantially between cell lines as can the
interactions between coactivator RNA transcripts and proteins. This has
the potential to contribute to different accessibility of the
asODNs and RNaseH to the mRNA targets (40). As
a consequence, the same asODN may exhibit different
inhibitory activities depending on the cell type used. For this reason,
we also verified, by Northern analysis, to what extent the selected
asODNs were able to alter coactivator expression in the HeLa
cells used in our experiments.
Three SRA asODN targeting different regions of the SRA mRNA
were evaluated for their ability to reduce SRA mRNA expression in HeLa
cells. Twenty-four hours after transfection, cells were harvested and
total RNA was extracted and subjected to Northern analysis (Fig. 2A
). As a control to ensure that altered
expression of the coactivator was due to a sequence-dependent
interaction of the ODNs with their specific target mRNAs and not to
sequence-dependent or -independent interactions with other molecules
(50, 51, 52, 53, 54, 55), we used ODNs of the same length and base
composition but randomized in sequence (randomized ODNs,
rsODNs). Results obtained with the asODNs (nos.
30217, 30215, and 30145) are expressed as a percentage of those
obtained with equivalent amounts of their corresponding
rsODNs (nos. 104534, 104533, and 104535, respectively). The
levels of SRA mRNA, normalized to the level of cyclophilin, revealed
that all three asODNs used were able to inhibit SRA
expression, when compared with the corresponding rsODNs, but
that asODN 30217, which inhibited SRA expression by
approximately 90%, was most effective (Fig. 2B
). Consequently, the no.
30217 asODN and its corresponding control, 104534, were
selected for subsequent experiments.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 2. Inhibition of SRA mRNA Expression by Various
asODNs
A, Northern blot analysis of total RNA extracted from cells treated
with 200 pmol of nos. 30217, 30215, or 30145 SRA asODNs
or their corresponding rsODNs, nos. 104534, 104533, and
104535. SRA and cyclophilin mRNAs are indicated. B, Quantification of
the Northern blot by scanning laser densitometry. SRA mRNA levels in
the presence of each asODN are normalized to cyclophilin
mRNA levels and expressed as percentage of the SRA mRNA levels measured
in the presence of the corresponding rsODNs.
|
|
Another important index of an oligonucleotide sequence-dependent
inhibition is its dose dependence. To verify this essential condition,
we transfected into HeLa cells increasing quantities of the selected
SRA asODN (no. 30217) or equivalent amounts of the
corresponding SRA rsODN. Northern analysis was performed on
total RNA extracted 24 h later (Fig. 3A
). Quantification of the SRA Northern
blot and normalization to the level of cyclophilin mRNA demonstrated
that antisense ODN decreased SRA mRNA expression in a dose-dependent
manner (Fig. 3B
), but that asODN amounts greater than 100
pmol did not increase the extent of inhibition.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 3. Inhibition of SRA mRNA Expression by the
asODN 30217 Is Dose Dependent
A, Northern blot analysis of total RNA extracted from cells treated
with increasing amounts of the SRA asODN 30217 or
equivalent quantities of the corresponding rsODN. SRA
and cyclophilin mRNAs are indicated. B, Quantification of the Northern
blot by scanning laser densitometry. SRA mRNA levels in the presence of
the asODN (open bars) are normalized to
cyclophilin mRNA levels and expressed as percentage of the SRA mRNA
levels measured in the presence of equivalent amounts of the
corresponding rsODN (solid bars).
|
|
Transactivation experiments require inhibition of coactivator
expression for longer than 24 h. Therefore, a time course study
was performed to determine the duration of reductions in SRA mRNA by
SRA asODN. HeLa cells were transfected under the same
conditions as described above, and cells were harvested at 0, 6, 24,
48, and 72 h after the ODN/LipofectAMINE mixture was removed for
subsequent SRA mRNA analysis by Northern blot (Fig. 4A
). Densitometry revealed that
normalized levels of SRA mRNA decreased to approximately 25% of those
obtained with the corresponding control at t = 0 h (4 h after
start of ODN transfection) and further declined to almost undetectable
levels 6 h thereafter. Levels remained depressed for at least
72 h. Notably, more than 75% of SRA mRNA expression was still
repressed after 48 h (Fig. 4B
), corresponding to the duration of
our transactivation experiments (see below). These data show that a
single transfection under our experimental conditions significantly
inhibits target coactivator expression for at least 3 d.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 4. Time Course of SRA mRNA Expression in the Presence
of SRA asODN
A, Northern blot analysis of total RNA extracted from cells treated
with 200 pmol of SRA asODN (30217) or
rsODN (104534) for 4 h and harvested 0, 6, 24, 48,
or 72 h thereafter. SRA and cyclophilin mRNAs are indicated. B,
Quantification of the bands by scanner laser densitometry. SRA mRNA
levels in the presence of the asODN (open
bars) are normalized to mRNA cyclophilin and expressed as
percentage of the mRNA levels measured in the presence of equivalent
amounts of the corresponding rsODN (solid
bars).
|
|
Similar to the SRA experiments, three different asODNs for
SRC-1 were screened along with their rsODNs as controls.
Northern blot analysis showed that all the asODNs were able
to inhibit SRC-1 mRNA levels to a similar extent (data not shown). The
asODN chosen for further studies (no. 29912) decreased SRC-1
mRNA levels by approximately 75% when compared with the SRC-1 mRNA
levels obtained after treatment with the corresponding rsODN
(no. 104531) (Fig. 5
, A and B). Because
SRC-1 acts as a protein, we verified the extent and the duration of the
inhibition of its protein expression. Western analysis was performed on
protein extracts prepared from HeLa cells 1, 2, and 3 d after
transfection of SRC-1 asODN and rsODN (Fig. 5C
).
The asODN reduced SRC-1 protein levels by 78%, 55%, and
44% after 1, 2, and 3 d, respectively, in comparison to SRC-1
levels measured in the presence of equivalent amounts of the
rsODN (Fig. 5D
), indicating that a single antisense
transfection also is sufficient to decrease target coactivator protein
expression for at least 3 d. The efficacy of two different TIF2
asODNs also was tested by Northern analysis (data not shown)
and the asODN (no. 29977) that decreased TIF2 mRNA
expression to undetectable levels was chosen for subsequent use (see
Fig. 6A
). Collectively, these data
demonstrate that we are able to use the selected ODNs as an effective
research tool for decreasing coactivator mRNA and protein expression in
receptor transactivation experiments.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 5. Effect of SRC-1 asODN on SRC-1 mRNA
and Protein Expression
A, Northern blot analysis of total RNA extracted from cells treated for
4 h with 200 pmol of SRC-1 asODN (29912) or
rsODN (104531) and harvested 24 h later. SRC-1 and
cyclophilin mRNAs are indicated. B, Quantification of the Northern blot
by scanning laser densitometry. SRC-1 mRNA levels in the presence of
the asODN (open bar) are corrected to
cyclophilin mRNA levels and expressed as percentage of the SRC-1 mRNA
levels measured in the presence of an equivalent quantity of the
corresponding rsODN (solid bar). C,
Western blot analysis of proteins extracted from cells treated with 200
pmol SRC-1 asODN or rsODN for 4 h
and harvested 24, 48, or 72 h thereafter. SRC-1 and actin proteins
are indicated. D, Quantification of the Western blot by scanning laser
densitometry. SRC-1 protein levels in the presence of the
asODN (open bar) are corrected against
actin protein levels and expressed as percentage of the protein
levels measured in the presence of equivalent amounts of the
corresponding rsODN (solid bar).
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Figure 6. SRA, SRC-1, and TIF2 asODNs Are
Specific for Their mRNA/Protein Targets
A, Northern blot analysis of total RNA extracted from cells treated for
4 h with 100 pmol of asODN or rsODN
for SRA, SRC-1, or TIF2 and harvested 24 h later. TIF2 and
cyclophilin mRNAs are indicated. B, Cells treated with 200 pmol of the
same asODNs and rsODNs were similarly
subjected to Northern analysis for SRA expression. SRA and cyclophilin
mRNAs are indicated. C, Western analysis of proteins extracted from
cells treated for 4 h with 100 pmol of asODN or
rsODN for SRC-1 or TIF2 and harvested 24 h later.
SRC-1 and actin proteins are indicated. D, Western analysis of proteins
extracted from cells treated for 4 h with 50 pmol of SRC-1
asODN, SRC-1 rsODN, SRA
asODN, or SRA rsODN and harvested 24
h later. SRC-1 and actin proteins are indicated.
|
|
Specificity of asODNs for Their Target
Coactivators
To ensure that the asODNs used were specific for their
own target coactivator rather than cross-reacting with any of the other
targets studied, we transfected HeLa cells with asODN for
each of the three coactivators or their corresponding controls and
verified that each asODN reduced the expression of only the
appropriate target coactivator. This was particularly important to
ensure that the asODNs used in this study did not exhibit
affinity for other RNA molecules, particularly between SRC family
members that are closely related to each other. We found, by Northern
analysis, that neither the presence of SRA or SRC-1 asODNs affected the
levels of TIF2 mRNA (Fig. 6A
) using doses equal or higher than those
used in the proceeding transactivation experiments. Also, SRC-1 and
TIF2 asODNs do not reduce SRA expression measured in Northern
experiments (Fig. 6B
). When examined by Western analysis, the SRC-1
protein levels in the presence of TIF2 or SRA asODNs (Fig. 6
, C and D, respectively) were not reduced, indicating no
cross-reactivity of SRA and TIF2 asODNs for SRC-1 mRNA.
These data show that, at levels equal or higher than those used in our
experiments, each asODN was specific for its target
coactivator.
Inhibition of SRC-1, TIF2, and SRA Coactivator Expression Impairs
ER
Transcriptional Activity
Ligand binding promotes the association of nuclear receptors with
distinct subclasses of coregulators including SRC-1, TIF2, and SRA
(18, 21, 23, 24, 34, 43, 56, 57) and enhances their
transcriptional activation. To study the involvement of endogenous
levels of SRC-1, TIF2, and SRA on ER
transcriptional activity, we
quantified ER-dependent gene expression using our antisense ODN
technology. HeLa cells were transiently transfected with an expression
vector for human ER
along with a synthetic target gene consisting of
estrogen-responsive elements and a TATA box driving expression of
luciferase; increasing amounts of SRA, SRC-1, or TIF2 antisense or
rsODNs were added to cells at the same. To maximize the
efficiency of transfection of ODNs and plasmids into cells, a
replication-defective, poly-L-lysine modified,
adenovirus-mediated DNA delivery protocol was used
(58, 59, 60, 61, 62). Two hours after the
adenovirus/poly-L-lysine/ODN/plasmids mixture was
added to the cells, medium was replaced and 24 h thereafter cells
were treated with ethanol (vehicle) or 10-9
M E2 for 24 h. We found that
ligand-dependent ER
transcriptional activity was impaired, in a
dose-dependent manner, by adding increasing amounts of SRA, SRC-1, and
TIF2 asODNs (Fig. 7
, AC,
respectively). Although, for clarity, values presented are from
estrogen-treated samples, luciferase values obtained from cells treated
with ethanol alone were also measured and compared with those obtained
from cells treated with E2 to ensure that adequate induction of
transactivation by E2 occurred in each experiment. Generally, the fold
induction obtained was equal to or more than 5 (data not shown). The
consistency of these results with the known roles of the coactivators
and the dose-dependent asODN inhibition of ER
transactivation provide further confirmation of an antisense
sequence-dependent mechanism and demonstrates the involvement of
endogenous SRC-1, TIF2, and SRA in the modulation of ER-dependent
target gene expression.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 7. ER -Transcriptional Activity Is Impaired in a
Dose-Dependent Manner by the Presence of SRA, SRC-1, and TIF-2
asODNs
A, Cells were transfected for 2 h with 25, 50, 100, or 200 pmol of
SRA asODN (open bar) or with equivalent
quantities of the corresponding rsODN (solid
bar) along with pCMV5hER and a
3xERE-TATA-luciferase target gene, and treated with 1 nM
E2. Luciferase activity represents the mean of duplicate samples
obtained from cells treated with asODN expressed as a
percentage of the relative luciferase units (RLU) from cells treated
with the rsODN. Each plot represents one of at least
three independently repeated experiments. Values from cells treated
with asODN or rsODN for SRC-1 and with
the asODN or the rsODN for TIF2 are shown
in panels B and C, respectively.
|
|
SRA and SRC Family Coactivators Cooperate to Modulate ER
Transcriptional Activity
The association of SRC family members in multimeric complexes in
cells has been shown (43), and SRA has been found to
coexist in a ribonucleoprotein complex with SRC-1 (18). To
study the functional significance of these associations, we compared
the effect of inhibiting the expression of two different coactivators,
singly tested in the preceding experiments, to the effect of the
simultaneous inhibition of the same two coactivators on ER
transcriptional activity. To be able to measure an additive or greater
effect on reduction of ER
transactivation induced by the
simultaneous inhibition of the two coactivators, we used the lowest
doses of asODNs that had produced, based on pilot
experiments, a modest effect on the ligand-dependent ER
transcriptional activity. Cells were therefore exposed to the
adenovirus-mediated transfection mixture containing 6.25 pmol of SRC-1
antisense or rsODNs and 25 pmol of SRA antisense or
rsODNs (Fig. 8A
); higher
quantities of asODNs were tested in the same experiments to
confirm that inhibition of transactivation occurred in each experiment
(data not shown). When the cells were simultaneously exposed to SRC-1
and SRA asODNs, the decrease in estrogen-induced ER
transcriptional activity, measured as a percentage of the ER
transcriptional activity obtained in the presence of both
rsODNs, was approximately 70%, whereas SRC-1 and SRA
asODNs reduced target gene expression by only 10% and 20%,
respectively. The experiment was repeated at least three times,
confirming that the simultaneous presence of two asODNs
causes a reduction in target gene expression greater than anticipated
from either ODN treatment alone. Similar experiments were performed by
simultaneously inhibiting SRA and TIF2, and SRC-1 and TIF2 expression
(Fig. 8
, B and C, respectively), providing evidence for a more than
additive effect on ER
transcriptional activity by either combination
of coactivators. These results demonstrate that, in addition to
associating with each other, these coactivators can cooperate in the
modulation of estrogen-dependent ER
transactivation in HeLa
cells.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 8. SRA, SRC-1, and TIF-2 Coactivators Cooperate to
Modulate ER Transcriptional Activity
A, Cells were transfected for 2 h with the indicated
asODNs (6.25 pmol for SRC-1; 25 pmol for SRA;
open bars) or their corresponding rsODN
controls (solid bars) along with pCMV5hER
and 3xERE-TATA-Luciferase, and 24 h thereafter were treated with 1
nM E2. Relative luciferase units (RLU) values represent the
mean of duplicate samples obtained from cells treated with
asODNs expressed as percentage of the RLU from cells
treated with the corresponding rsODNs. This plot
represents one of at least three independently repeated experiments.
Values from cells simultaneously exposed to SRA and TIF2
asODNs (50 and 25 pmol, respectively) or SRC-1 and TIF2
asODNs (6.25 pmol each) are shown in panels B and C,
respectively (see panel A above).
|
|
SRC-1 and TIF2 asODNs Inhibit Estrogen-Dependent
Responses in MCF-7 Cells
MCF-7 cells express ER
and their growth is estrogen dependent
(63). Therefore, to determine whether any of the
coactivators examined in this study contributed to estrogen-mediated
growth, MCF-7 cells were transfected with the indicated quantity of
asODNs or their corresponding rsODNs, and 24
h thereafter cell proliferation was assessed by
[3H]thymidine incorporation. It is important to
note that these studies are possible because virtually all the cells
uptake ODN. In contrast, transient transfection efficiencies for
expression vectors generally are of insufficient magnitude to examine
endogenous biological responses. As shown in Fig. 9A
, asODNs to SRC-1 or TIF2
decreased cell proliferation in comparison to cells transfected with
equivalent levels of rsODN. Interestingly, SRA
asODN did not inhibit [3H]thymidine
incorporation in these cells but, instead, had a modest stimulatory
effect on DNA synthesis. These results were further substantiated in
cells grown in stripped serum in the absence or presence of 1
nM E2 to ensure that the asODN
inhibited estrogen-induced cell proliferation (Fig. 9B
). E2 stimulated
[3H]thymidine incorporation in SRA, SRC-1, or
TIF2 rsODN-treated cells by 4- to 5-fold. These increases in
DNA synthesis were attenuated in cells treated with asODNs
to either SRC-1 or TIF2, but not to SRA, a result similar to that
obtained for Fig. 9A
.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 9. Inhibition of MCF-7 DNA Synthesis by
asODNs Is Coactivator Specific
A, Cells grown in media containing 10% FBS were treated
with the indicated amounts of asODNs or with the
corresponding amounts of rsODN, and 24 h after
transfection, cell proliferation was assessed by
[3H]thymidine incorporation. Values are
calculated as the percentage of incorporated counts in
asODN-treated cultures in comparison to the counts obtained
in cultures transfected with the corresponding amount of
rsODN and are given as the mean ±
SEM for three to four independent experiments. B,
Cells grown in media containing 5% sFBS were transfected with 200 pmol
of rsODN or asODN for the indicated coactivators
and treated 24 h thereafter with ethanol vehicle (EtOH) or 1
nM E2 for 16 h to induce DNA synthesis.
Values are calculated relative to the percentage of incorporated counts
in rsODN- and E2-treated cultures (100%) for each
coactivator and are given as the mean ± SEM
for three to four independent experiments.
|
|
Based on the ability of SRA asODN to inhibit ER activity in
HeLa cells, it was surprising that they did not inhibit MCF-7 cell
proliferation. To ensure that this was not due to compensation by high
SRA levels in MCF-7 cells in comparison to HeLa cells, real-time RT-PCR
(64) was employed to examine the relative expression of
this coactivator in these two cell lines. Analysis of several
independent samples revealed that SRA mRNA levels were approximately
2-fold higher in HeLa than MCF-7 cells. The relative mRNA levels of SRC
family coactivators were also characterized, revealing that SRC-1
expression was similar between the two lines, whereas TIF2 mRNA levels
in MCF-7 cells were approximately twice that measured for HeLa cells.
In addition, RAC3 mRNA levels were measured in both cell lines and, as
expected (28), were found to be much greater (
30-fold)
in MCF-7 than in HeLa cells.
The effect of coactivator asODNs on induction of an
estrogen-regulated target gene, pS2 (65), was also
examined. Sixteen hours of E2 stimulation of MCF-7 cells treated with
rsODN to either SRA, SRC-1, or TIF2 resulted in a 4- to
6-fold induction of pS2 mRNA in comparison to levels measured for cells
treated with the appropriate rsODN and ethanol vehicle.
Similar to the results obtained for our DNA synthesis experiments,
asODN to both SRC-1 and TIF2 reduced E2-induced pS2 mRNA
levels, but the SRA asODN had no effect on the expression of
this target gene (Fig. 10A
). To ensure
that the lack of SRA response was not due to an inability of SRA
asODN to decrease the expression of its target coactivator
in MCF-7 cells, SRA mRNA transcripts in cells treated with either SRA
rsODN or asODN were quantitated. As shown in Fig. 10B
, SRA asODN reduced SRA mRNA expression by about 55%. We
also verified that SRC-1 and TIF2 asODN reduced the
expression of their corresponding mRNAs and found that they were
reduced by approximately 75% and 90%, respectively. Thus, although
these three asODN reduced expression of their respective
mRNAs, their ability to affect the expression of an endogenous ER
target gene was variable. Taken together, the
[3H]thymidine and pS2 results demonstrate that
asODNs are able to inhibit the ability of endogenous ER to
elicit biological responses. Furthermore, these results also indicate
that all coactivators are not functionally equivalent with respect to
biological responses in estrogen target cells.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 10. Inhibition of Estrogen-Induced pS2 mRNA Expression
by asODNs Is Coactivator Specific
A, MCF-7 cells grown in media containing 5% sFBS were transfected with
200 pmol of rsODN or asODN for the
indicated coactivators and treated 24 h thereafter with 0.1%
ethanol vehicle (EtOH) or 10 nM E2 for 16 h before
cells were harvested for RNA isolation and quantitative pS2 and 18S RNA
measurements by real-time RT-PCR. Values are presented relative to the
pS2 mRNA levels normalized to 18S RNA values determined for estrogen-
and rsODN-treated samples (100), and are given as
the mean ± SEM for three to five independent
experiments. B, Effect of asODN on coactivator mRNA
expression. MCF-7 cells were transfected with 200 pmol of
rsODN or asODN for the indicated
coactivators and harvested up to 40 h later for RNA isolation and
coactivator and 18S RNA measurements by real-time RT-PCR. Values are
presented relative to the coactivator levels normalized for 18S levels
determined for rsODN-treated samples (100), and are
given as the mean ± SEM for three to six independent
experiments.
|
|
 |
DISCUSSION
|
|---|
Estrogens are important for a variety of effects on growth,
development, and differentiation, and ER
and ERß are responsible
for mediating these effects in target tissues by acting as
ligand-dependent transcription factors (66, 67) the
activity of which is amplified by different classes of coactivators
including SRC family members and the novel steroid receptor
coactivator, SRA. The aim of the present study was to investigate the
involvement of these coactivators in modulating ER
transcriptional
activity using an approach that does not utilize overexpression of the
coactivators, which can result in artifactual results. Although all of
the SRC family members possess similar properties in terms of
interaction with nuclear receptors in vitro and enhancement
of their transcriptional activities in transient transfections, their
tissue distribution profiles are not completely overlapping (reviewed
in Ref. 39). Here we focused on SRC-1 and TIF2, which
share high homology and similar functional activities, whereas RAC3 has
been shown to exhibit functions and cell/tissue distributions distinct
from SRC-1/TIF2 (22, 39).
The relevance of the requirement of SRC-1 in mediating nuclear receptor
transcriptional activity has been substantiated in SRC-1 knockout mice
that develop a partial sex steroid (38) and thyroid
hormone resistance (68). Mouse knockout models for TIF2
and SRA are not yet available. In our search for a faster and cheaper,
but still reliable, way to explore the roles of these coactivators in
their endogenous environment, we inhibited their expression in
transient transfection assays using asODNs as a tool. The
only information required to synthesize asODNs is the
nucleic acid sequence of the target. This advantage makes antisense
technology a particularly useful approach for studying molecules that,
like SRA, act as RNA transcripts. It has been shown that
asODNs as long as 1520 bases are able to discriminate
between two gene products that differ by a single base
(69). This specificity is particularly important when the
targets share high homology with related molecules as is the case
between SRC family members (31). A similar approach using
asODNs of 23 bases has been successfully used to
discriminate between two other closely related cofactors, CREB binding
protein and p300, and their functional roles in RA-induced
differentiation of F9 cells (70).
To the best of our knowledge, functional roles of SRC-1 and TIF2 in
mediating nuclear receptor transactivation have never been investigated
using antisense ODNs in transfection experiments. A complementary
approach, in which a plasmid encoding full-length SRC-1 antisense mRNA
was stably transfected into human osteosarcoma (MG-63) cells, made it
possible to establish a biological role for SRC-1 with respect to
1,25-dihydroxyvitamin D3 stimulation of alkaline
phosphatase activity (71). Similarly, the inhibition of
endogenous GRIP-1 expression in myogenic (C2C12) cells, obtained by
stable transfection of a plasmid encoding full-length GRIP-1/TIF-2
antisense RNA, revealed a functional role for this coactivator in
skeletal differentiation (72). However, in both these
cases, growing cells in the continuous absence of target coactivators
could result in compensatory phenomena, as has been observed in SRC-1
knockout mice (38), which can be avoided with the rapid
inhibition obtained by transiently transfecting asODNs.
After assessing the reliability of asODNs as a research tool
in HeLa cells, we found that inhibiting the endogenous expression of
any one of the coactivators tested resulted in impairment of
ER
-mediated transactivation of a synthetic estrogen-responsive
target gene. These data are consistent with those obtained by
overexpressing the coactivators in transient transfection experiments
(13, 21, 24, 73, 74) but provide verification in a more
physiological manner. We also assessed the level of cooperation between
individual coactivators by simultaneously exposing the cells to two
different asODNs. The rationale for these experiments was
based on evidence that SRC family members are capable of forming
multimeric complexes in vivo. In particular, SRC-1 and TIF2
have been shown to associate in stable multimeric protein complexes
(43), and SRA coexists in a ribonucleoprotein complex
containing SRC-1 and/or TIF2 (18, 19). Although the
functional significance of these particular associations is unknown,
deletion of one of the DEAD-box motifs of the ER
AF-1 coactivator,
p72, blocks its ability to bind SRA and enhance ER
transactivation
(19). Our results revealed that the tested coactivators
contributed to ER
transcriptional activity in a more than additive
way and therefore provide evidence of intracellular cooperation between
SRC11, TIF2, and SRA, which is consistent with their coexpression in
the same cell line and/or tissue and with their demonstrated
intracellular associations.
It has been previously shown that MCF-7 cells engineered to stably
overexpress SRC-1 exhibit greater ER transcriptional activity measured
on target genes delivered via transient transfection (75).
These cells also grew better in response to estrogen treatment and
required greater concentrations of 4-hydroxytamoxifen to block
E2-stimulated cell growth than the parental cell line
(75), suggesting that the SRC-1 coactivator positively
contributes to the growth of this breast cancer cell line. Our results
are consistent with this finding and demonstrate that both SRC-1 and
TIF2 contribute to MCF-7 cell proliferation. However, differences in
the magnitude of the asODN effect on cell proliferation and
pS2 induction (see below) and ER
transactivation of a synthetic
reporter gene in HeLa cells were noted. These may be due to
cell-specific differences in coactivator function or expression
patterns (both SRC family and other coactivators) and/or reflect
differences in the promoters of the targets being examined
(e.g. simple vs. endogenous, complex target
genes, chromatin structure, and/or the number and sequence of the
estrogen response elements). Indeed, our analyses revealed much higher
levels of RAC3 mRNA in MCF-7 vs. HeLa cells, and it has been
demonstrated that the sequence of the estrogen response element (ERE)
influences the ability of ER
to recruit TIF2 to DNA
(76). Depletion of the p300 coactivator, which binds to ER
and SRC-1 (77, 78), by an p300 antisense expression vector
has also been shown to reduce DNA synthesis in MCF-10A nontransformed,
immortalized breast epithelial cells and MSU fibroblasts
(79), consistent with a role for coactivators in cell
proliferation. Intriguingly, under our experimental conditions, SRA
asODN did not inhibit [3H]thymidine
incorporation, suggesting that the role of SRA in cell proliferation,
if any, is distinct from that of SRC-1 and TIF2. Furthermore, this
result provides evidence that the responses elicited with our
asODN tools are specific to the coactivator under
study and are not a general artifact of oligonucleotide
transfection.
The inhibition of estrogen-induced pS2 mRNA expression by antisense
ODNs against SRC-1 and TIF2 is consistent with their ability to
decrease ER transactivation in HeLa cells and estrogen-dependent cell
proliferation in MCF-7 cells and suggests that these two coactivators
make contributions to the regulation of this ER target gene. Stable
expression of SRC-1 in MCF-7 cells has been shown to increase the
ability of E2 to stimulate pS2 mRNA expression (75),
further supporting a role for this coactivator in the regulation of
this target genes expression. Although there is no direct information
on SRA coactivation of pS2 gene expression, a deletion mutant of the
ER
coactivator, p72, that abolishes its ability to interact with
SRA, also blocks its ability to enhance estrogen induction of pS2 gene
expression when transiently overexpressed in MCF-7 cells
(19). Thus, the inability of our SRA asODNs to
inhibit estrogen induction of pS2 mRNA expression is somewhat
surprising and suggests that the mechanisms of SRA action are likely to
be complex.
Increases in SRA expression in breast tumor samples in comparison to
normal adjacent tissue have been noted in a recent study
(80), suggesting that SRA may play a role in cancer cells
unrelated to stimulating cell growth. Paradoxically, reducing SRA
expression may relieve ER from the influence of a corepressor in MCF-7
cells (20) and thereby increase ER activity. Sharp
(SMRT/HDAC-1-associated repressor protein) is a nuclear receptor
corepressor that can inhibit ER
transactivation in a SRA-dependent
manner. Furthermore, Sharp expression is estrogen inducible in MCF-7
cells (20). Thus, by reducing SRA expression, it is
possible that the ability of Sharp to negatively regulate ER
transcriptional activity, perhaps as part of the mechanism by which
cells attenuate estrogen signaling, may be lost. The lack of SRA
asODN influence may therefore represent loss of coactivation
balanced by loss of corepression. Alternatively, these data also
support a model in which endogenous SRA regulates ER activity in a cell
(HeLa vs. MCF-7)-, or promoter-specific manner; the latter
due either to differences in promoter DNA sequence or in chromatin
structure between transient reporter templates and endogenous
genes.
Taken together, these data demonstrate that asODN can be
used to examine the role of endogenous levels of coactivators. In so
doing, it is possible to examine coactivator function in a variety of
cell types while avoiding artifacts associated with overexpression of
exogenous coactivators or compensatory changes in gene expression.
These studies have also revealed that coactivators play specific roles
with respect to mediating the biological effects of ER
. More
detailed analysis of coactivator specificity with respect to steroid
receptor function promises to provide insight into the cell and
promoter specificity of ER
action and may ultimately provide the
basis to improve the target specificity of receptor-based endocrine
therapies.
 |
MATERIALS AND METHODS
|
|---|
Plasmids
The mammalian expression plasmids for human ER
(pCMV5hER
) (81), for SRA
(pSCT-SRA) (18), for SRC-1a (pCR3.1-hSRC-1a)
(73), and for TIF2 (pCR3.1-TIF2) (82) have
been described previously as has the estrogen-responsive reporter
plasmid, 3xERE-TATA-luciferase (83).
Oligodeoxyribonucleotides
Phosphorothioate oligonucleotides, 18 bases in length, were
synthesized by ISIS Pharmaceuticals (Carlsbad, CA). The
oligodeoxynucleotides designated nos. 29977, 117226, 29912, 104531,
30215, 104533, 30217, and 104534 are gapmers that consist of
2'methoxy-ethyl nucleotides phosphorothioated on each end (to improve
nuclease resistance and hybridization affinity of the oligomer for
complementary mRNAs) and 2'deoxynucleotides in the middle (to
support RNaseH activity). The 30145 and 104534 oligodeoxynucleotides
are phosphorothioate ODNs. The oligonucleotide sequence and region of
coactivator to which they bind are shown in Table 1
. The control oligonucleotides (nos.
117226, 104531, 104535, 104534, and 104533) have the same base
composition as nos. 29977, 29912, 30215, 30217, and 30145,
respectively, but the sequence has been randomized. The FITC-conjugated
ODN 21437 (GGTTATCCTTGGCTACATTA) is a gapmer labeled with a fluorescein
isothiocyanate group on its 5'-end.
Cell Culture and Transient Transfection Assay
HeLa (human cervical carcinoma) cells were routinely maintained
in DMEM supplemented with 10% FBS. Twenty-four hours before
transfections, 3 x 105 cells per well of a
six-well multiplate or 106 cells per 100-mm Petri
dish were plated in phenol red-free DMEM containing 5% dextran-coated
charcoal-stripped FBS (sFBS). Cells to be transfected with the
FITC-conjugated ODN were plated on glass coverslips.
For microscopy, Northern, and Western experiments, HeLa cells were
transfected by LipofectAMINE according to the manufacturers protocol
(Life Technologies, Inc., Gaithersburg, MD). MCF-7 studies
were also performed using LipofectAMINE transfection. Briefly, 24
h after plating, cells were exposed, in the presence of phenol red- and
serum-free medium, to the transfection mixture containing LipofectAMINE
and the ODNs. Four hours later, medium containing the LipofectAMINE/ODN
mixture was replaced with DMEM containing 5% sFBS until
harvesting.
For transactivation experiments, cells were transfected as previously
described (62) using the
poly-L-lysine-conjugated, replication-deficient adenovirus
dl312, at a multiplicity of infection of 500:1. Briefly, after 30 min
of incubation of the adenovirus with the
pCMV5hER
and 3xERE-TATA-luciferase plasmids
(0.4 and 80 ng per well, respectively) and the indicated amounts of
ODNs (see figure legends), poly-L-lysine was added to the
mixture for a second incubation in which
virus/ODN/poly-L-lysine complexes are formed and
subsequently added to cells in the presence of phenol red- and
serum-free medium. After 2 h of incubation, the medium was
replaced with phenol red-free DMEM containing 5% sFBS, and 24 h
later cells were treated with ethanol (vehicle) or
10-9 M E2 (Sigma, St.
Louis, MO) for 24 h. Cells were harvested in TEN (40
mM Tris, pH 8.0/1 mM EDTA/150 mM
NaCl), and cell extracts were assayed for luciferase activity using the
luciferase assay system (Promega Corp., Madison, WI) and a
Monolight 2010 Luminometer (Analytical Luminescence Laboratory, San Diego, CA); values were corrected for protein
content determined using the protein assay according to the
manufacturers protocol (Bio-Rad Laboratories, Inc.,
Hercules, CA).
Fluorescence and Differential Interference Contrast (DIC)
Microscopy
Immediately and 44 h after removal of the
LipofectAMINE/FITC-conjugated-ODN mixture, cells were washed several
times in PBS, mounted in VECTASHIELD medium for fluorescence
(Vector Laboratories, Inc., Burlingame, CA), and examined
by fluorescence and DIC microscopy with a AxioPhot microscope
(Carl Zeiss, Thornwood, NY) and a C5810 chilled three
change-coupled device camera (Hamamatsu Corp., Bridgewater, NJ)
to visualize the number of fluorescent and total cells,
respectively.
Northern Analysis
Twenty-four and forty-eight hours after removing the ODNs, with
the exception of the time course experiment (see Results),
HeLa cells were harvested and total RNA extracted using TRIzol reagent
according to the manufacturers protocol (Life Technologies, Inc.). Thirty micrograms per lane of total RNA were loaded on
1.2% formaldehyde/agarose gel and then transferred by capillary action
to nitrocellulose membrane (Osmonics, Inc., Westborough, MA).
The blots were probed under high-stringency conditions [overnight at
65 C in hybridization buffer consisting of 0.5% SDS, 6x SSC (1x = 3
M sodium chloride, 0.3 M
sodium citrate, pH 7.0) 5x Denhardts solution (84), and
100 µg/ml of salmon sperm DNA] with a
[32P]dCTP-labeled probe for SRA, SRC-1, TIF2,
or cyclophilin. The probes were prepared using the RadPrime DNA
labeling system (Life Technologies, Inc.) and fragments of
the hSRC-1a (nucleotides 8291,067) and TIF2 (nucleotides
4,2044,815) cDNAs, or full-length cDNAs for human SRA or mouse
cyclophilin (85) as templates. After washing,
radiolabeled blots were subjected to autoradiography at -80 C using
Kodak Biomax MS films (Eastman Kodak Co.,
Rochester, NY). Intensity of the bands was quantified by scanning
laser densitometry (Molecular Dynamics, Inc.,
Sunnyvale, CA).
Real-time RT-PCR Assays
Measurements for RNA samples prepared from MCF-7 cells were
performed using real-time RT-PCR and TaqMan chemistry
(64). Briefly, cells were harvested and RNA was isolated
by S.N.A.P. Total RNA Isolation kit (Invitrogen,
San Diego, CA) according to the manufacturers instructions. Total RNA
was analyzed by real-time RT-PCR using the ABI Prism 7700 Sequence
Analyzer (PE Applied Biosystems, Foster City, CA). Primers
and probes for pS2, SRC-1, TIF2 and SRA (Table 2
) were designed using Primer Express
software (PE Applied Biosystems), and target transcript
quantities were normalized against 18S rRNA using an 18S primer/probe
set purchased from PE Applied Biosystems. Probes were
fluorescently labeled with 6FAM (6-carboxy-fluorescein) and TAMRA
(6-carboxy-tetremethyl-rhodamine) on the 5'- and 3'-ends, respectively.
Assays were performed as 50-µl reactions using TaqMan One-Step
RT-PCR Master Mix reagents in MicroAmp 96-well plates (PE Applied Biosystems). Five microliters of MCF-7 total RNA (
100 ng)
were analyzed for pS2, SRC-1, TIF2, and SRA mRNA transcripts. For
normalization against the 18S transcript, each sample was diluted
100-fold so that approximately 1 ng of total RNA was analyzed in a
separate well. The RT reaction was incubated at 48 C for 30 min to
allow cDNA synthesis and terminated by heating for 10 min at 95 C. The
reaction was then PCR amplified for 40 cycles consisting of 25 sec at
95 C and 1 min at 60 C. Cycle threshold values for each reaction were
determined using TaqMan SDS analysis software and standardized against
a common total RNA sample obtained from MCF-7 cells grown in the
presence of 10% FCS.
Western Analysis
One, 2, or 3 d after the ODNs had been removed, HeLa cells
were harvested by scraping in cold PBS. Lysis of cells was performed by
resuspending the cell pellet in lysis buffer [50 mM Tris,
pH 7.4, containing 150 mM NaCl, 5 mM EDTA,
0.5% Nonidet P-40 (Accurate Chemical & Scientific Corp., Westbury, NY)
and protease inhibitors (1 µg/ml of leupeptin, antipain, aprotinin,
benzamidine-HCl, chymostatin, and pepstatin, and 0.5 mM
phenylmethylsulfonylfluoride], followed by 20 min of rocking at 4
C. The protein content of the cell lysate was determined by
Bio-Rad Laboratories, Inc. protein assay. Seventy
micrograms of protein per lane were resolved by 7.5% SDS-PAGE and
transferred to nitrocellulose membrane. Nonspecific sites were
saturated by incubating the blots in blocking buffer (20 mM
Tris, pH 7.5, containing 137 mM NaCl, 0.05% Tween-20, and
5% dried nonfat milk powder) overnight at 4 C. Incubations with SRC-1
(described in Ref. 56) or actin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) primary antibodies and
subsequent incubations with the horseradish peroxidase-conjugated
secondary antibodies were performed in 20 mM Tris, pH 7.5,
containing 137 mM NaCl, 0.05% Tween-20, and 2% dried
nonfat milk powder. Detection of specifically bound proteins was
carried out by ECL+PLUS according to the manufacturers protocol
(Amersham Pharmacia Biotech, Arlington Heights, IL).
Intensity of the bands was quantified by scanning laser
densitometry.
DNA Synthesis Assay
MCF-7 (human breast cancer) cells were routinely maintained in
DMEM and 10% FBS. Forty-eight hours before transfections, 1.5 x
105 cells were seeded per well of a six-well
multiplate. Cells were transfected with the indicated amounts of SRA,
SRC-1, or TIF2 antisense ODNs or with equivalent quantities of the
corresponding random sense ODNs by LipofectAMINE. Oligonucleotides were
removed 4 h thereafter, and 24 h after transfection, cells
were radiolabeled with 2 µCi/ml [3H]thymidine
(NEN Life Science Products, Boston, MA) for 2 h at 37
C, after which they were processed to determine tritium incorporation
(86), using a scintillation counter (Beckman Coulter, Inc., Fullerton, CA). For experiments examining the
effects of ODNs on estrogen-dependent DNA synthesis, MCF-7 cells were
maintained in media containing 5% sFBS for 48 h before
LipofectAMINE transfection with 200 pmol of the indicated ODNs.
Twenty-four hours thereafter, cells were treated for 24 h with
vehicle (0.1% ethanol) or 1 nM E2 and were radiolabeled
with [3H]thymidine for 2 h before
determination of tritium incorporation. All experiments were done in
triplicate, and results are shown as average ±
SEM.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Cheryl Parker, Hank Adams, and Frank Herbert for
technical assistance and Rainer Lanz for the pSCT-SRA.
 |
FOOTNOTES
|
|---|
This work was supported by an NIH grant (HD-08818) (to B.W.O.),
the American Heart Association (No. 9750078N), and NIH (DK-53002)
awards (to C.L.S.). I.T.R.C. was supported by funds from the Andrew W.
Mellon Foundation, and R.M. and D.M.L. were supported by an NIH
training Grant in Reproductive Biology (HD-07165).
1 Present address: Istituto di Endocrinologia, Universita di Milano,
Via Balzaretti, 9, 20133 Milano, Italy. 
Abbreviations: AF, Activation function; asODN,
antisense oligodeoxynucleotide; DIC, differential interference
contrast; ERE, estrogen response element; FITC, fluorescein
isothiocyante; GRIP, GR-interacting protein; HDAC, histone deacetylase;
NCoA, nuclear receptor coactivator; RNaseH, ribonuclease H;
rsODN, randomized oligodeoxynucleotide; sFBS,
dextran-coated, charcoal-stripped FBS; SRA, steroid receptor RNA
activator; SRC, steroid receptor coactivator; SMRT, silencing mediator
of retinoic acid and thyroid hormone receptors; TIF2, transcriptional
intermediary factor.
Received for publication February 16, 2001.
Accepted for publication October 9, 2001.
 |
REFERENCES
|
|---|
-
Smith CL 1998 Cross-talk between peptide growth factor
and estrogen receptor signaling pathways. Biol Reprod 58:627632[Abstract/Free Full Text]
-
Green S, Chambon P 1988 Nuclear receptors enhance our
understanding of transcription regulation. Trends Genet 4:309314[CrossRef][Medline]
-
Green S, Chambon P 1991 The oestrogen receptor: from
perception to mechanism. In: Parker MG, ed. Nuclear hormone receptors.
San Diego, CA: Academic Press Ltd; 1538
-
Freedman LP, Luisi BF 1993 On the mechanism of DNA binding by
nuclear hormone receptors: a structural and functional perspective.
J Cell Biochem 51:140150[CrossRef][Medline]
-
Klein-Hitpass L, Tsai SY, Weigel NL, Allan GF, Riley D,
Rodriguez R, Schrader WT, Tsai M-J, OMalley BW 1990 The progesterone
receptor stimulates cell-free transcription by enhancing the formation
of a stable preinitiation complex. Cell 60:247257[CrossRef][Medline]
-
Hadzic E, Desai-Yajnik V, Helmer E, Guo S, Wu S, Koudinova N,
Casanova J, Raaka BM, Samuels HH 1995 A 10-amino-acid sequence in the
N-terminal A/B domain of thyroid hormone receptor
is essential for
transcriptional activation and interaction with the general
transcription factor TFIIB. Mol Cell Biol 15:45074517[Abstract]
-
Jenster G, van der Korput JAGM, van Vroonhoven CCJ, Van Der
Kwast TH, Trapman J, Brinkman AO 1991 Domains of the human androgen
receptor involved in steroid binding, transcriptional activation, and
subcellular localization. Mol Endocrinol 5:13961404[Abstract]
-
Lees JA, Fawell SE, Parker MG 1989 Identification of two
transactivation domains in the mouse oestrogen receptor. Nucleic Acids
Res 17:54775487[Abstract/Free Full Text]
-
McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike JW 1995 Analysis of estrogen receptor function in vitro reveals
three distinct classes of antiestrogens. Mol Endocrinol 9:659669[Abstract]
-
Tzukerman MT, Esty A, Santiso-Mere D, Danielian P, Parker MG,
Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor
transactivational capacity is determined by both cellular and promoter
context and mediated by two functionally distinct intramolecular
regions. Mol Endocrinol 8:2130[Abstract]
-
Tora L, White JH, Brou C, Tasset DM, Webster NJG, Scheer E,
Chambon P 1989 The human estrogen receptor has two independent
nonacidic transcriptional activation functions. Cell 59:477487[CrossRef][Medline]
-
Lees JA, Fawell SE, Parker MG 1989 Identification of
constitutive and steroid-dependent transactivation domains in the mouse
oestrogen receptor. J Steroid Biochem 34:3339[CrossRef][Medline]
-
McInerney EM, Tsai M-J, OMalley BW, Katzenellenbogen BS 1996 Analysis of estrogen receptor transcriptional enhancement by a nuclear
hormone receptor coactivator. Proc Natl Acad Sci USA 93:1006910073[Abstract/Free Full Text]
-
Danielian PS, White R, Lees JA, Parker MG 1992 Identification
of a conserved region required for hormone dependent transcriptional
activation by steroid hormone receptors. EMBO J 11:10251033[Medline]
-
Godowski PJ, Picard D, Yamamoto KR 1988 Signal transduction
and transcriptional regulation by glucocorticoid receptor-lexA fusion
proteins. Science 241:812816[Abstract/Free Full Text]
-
Ham J, Parker MG 1989 Regulation of gene expression by nuclear
hormone receptors. Curr Opin Cell Biol 1:503511[CrossRef][Medline]
-
Klinge CM 2000 Estrogen receptor interaction with
co-activators and co-repressors. Steroids 65:227251[CrossRef][Medline]
-
Lanz RB, McKenna NJ, Onate SA, Albrecht U, Wong J, Tsai SY,
Tsai M-J, OMalley BW 1999 A steroid receptor coactivator, SRA,
functions as an RNA and is present in an SRC-1 complex. Cell 97:1727[CrossRef][Medline]
-
Watanabe M, Yanagisawa J, Kitagawa H, Takeyama K-I, Ogawa S,
Arao Y, Suzawa M, Kobayashi Y, Yano T, Yoshikawa H, Masuhiro Y, Kato S 2001 A subfamily of RNA-binding DEAD-box proteins acts as an estrogen
receptor
coactivator through the N-terminal activation domain
(AF-1) with an RNA coactivator, SRA. EMBO J 20:13411352[CrossRef][Medline]
-
Shi Y, Downes M, Xie W, Kao HY, Ordentlich P, Tsai C-C, Hon M,
Evans RM 2001 Sharp, an inducible cofactor that integrates nuclear
receptor repression and activation. Genes Dev 15:11401151[Abstract/Free Full Text]
-
Onate SA, Tsai SY, Tsai M-J, OMalley BW 1995 Sequence and
characterization of a coactivator for the steroid hormone receptor
superfamily. Science 270:13541357[Abstract/Free Full Text]
-
McKenna NJ, Lanz RB, OMalley BW 1999 Nuclear receptor
coregulators: cellular and molecular biology. Endocr Rev 20:321344[Abstract/Free Full Text]
-
Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional
coactivator in yeast for the hormone binding domains of steroid
receptors. Proc Natl Acad Sci USA 93:49484952[Abstract/Free Full Text]
-
Voegel JJ, Heine MJS, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent
activation function AF-2 of nuclear receptors. EMBO J 15:36673675[Medline]
-
Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK,
Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and
mediates nuclear-receptor function. Nature 387:677684[CrossRef][Medline]
-
Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear
receptor-associated coactivator that is related to SRC-1 and TIF2. Proc
Natl Acad Sci USA 94:84798484[Abstract/Free Full Text]
-
Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L,
Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator
ACTR is a novel histone acetyltransferase and forms a multimeric
activation complex with P/CAF and CBP/p300. Cell 90:569580[CrossRef][Medline]
-
Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan
XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid
receptor coactivator amplified in breast and ovarian cancer. Science 277:965968[Abstract/Free Full Text]
-
Takeshita A, Cardonna GR, Koibuchi N, Suen C-S, Chin WW 1997 TRAM-1, a novel 160-kDa thyroid hormone receptor activator molecule,
exhibits distinct properties from steroid receptor coactivator-1.
J Biol Chem 272:2762927634[Abstract/Free Full Text]
-
Suen C-S, Berrodin TJ, Mastroeni R, Cheskis BJ, Lyttle CR,
Frail DE 1998 A transcriptional coactivator, steroid receptor
coactivator-3, selectively augments steroid receptor transcriptional
activity. J Biol Chem 273:2764527653[Abstract/Free Full Text]
-
Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms
of steroid receptor co-activator 1 differ in their ability to
potentiate transcription by the oestrogen receptor. EMBO J 17:232243[CrossRef][Medline]
-
Zhu Y, Qi C, Calandra C, Rao MS, Reddy JK 1996 Cloning and
identification of mouse steroid receptor coactivator-1 (mSRC-1), as a
coactivator of peroxisome proliferator-activated receptor
. Gene
Express 6:185195[Medline]
-
Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen T-M,
Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne
CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways
modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc
Natl Acad Sci USA 95:29202925[Abstract/Free Full Text]
-
Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a
transcriptional coactivator for the AF-2 transactivation domain of
steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:27352744[Abstract]
-
Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP,
Chen D, Huang S-M, Subramanian S, McKinerney E, Katzenellenbogen
BS, Stallcup MR, Kushner PJ 1998 Estrogen receptor activation function
1 works by binding p160 coactivator proteins. Mol Endocrinol 12:16051618[Abstract/Free Full Text]
-
Li H, Chen JD 1998 The receptor-associated coactivator 3
activates transcription through CREB-binding protein recruitment and
autoregulation. J Biol Chem 273:59485954[Abstract/Free Full Text]
-
Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, OMalley BW 2000 The steroid receptor coactivator SRC-3
(p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty,
female reproductive function, and mammary gland development. Proc Natl
Acad Sci USA 97:63796384[Abstract/Free Full Text]
-
Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai M-J, OMalley BW 1998 Partial hormone resistance in mice with disruption of the steroid
receptor coactivator-1 (SRC-1) gene. Science 279:19221925[Abstract/Free Full Text]
-
Leo C, Chen JD 2000 The SRC family of nuclear receptor
coactivators. Gene 245:111[CrossRef][Medline]
-
Myers JJ, Dean NM 2000 Sensible use of antisense: how to use
oligonucleotides as research tools. Trends Pharmacol 21:1923[CrossRef][Medline]
-
Bennett CF 1998 Use of cationic lipid complexes for antisense
oligonucleotide delivery. In: Stein CA, Krieg AM, eds. New York:
Wiley-Liss, Inc.; 129145
-
Cooper SR, Taylor JK, Miraglia LJ, Dean NM 1999 Pharmacology
of antisense oligonucleotide inhibitors of protein expression.
Pharmacol Ther 82:427435[CrossRef][Medline]
-
McKenna NJ, Nawaz Z, Tsai SY, Tsai M-J, OMalley BW 1998 Distinct steady-state nuclear receptor coregulator complexes exist
in vivo. Proc Natl Acad Sci USA 95:1169711702[Abstract/Free Full Text]
-
Bennett CF, Chiang MY, Chan H, Shoemaker JE, Mirabelli CK 1992 Cationic lipids enhance cellular uptake and activity of
phosphorothioate antisense oligonucleotides. Mol Pharmacol 41:10231033[Abstract]
-
Gewirtz AM, Stein CA, Glazer PM 1996 Facilitating
oligonucleotide delivery: helping antisense deliver on its promise.