| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Medical Sciences (M.F., X.L., J.A.B., C.A.R., E.O., E.A.K., K.P.N.), Indiana University School of Medicine, Bloomington, Indiana 47405; and Department of Obstetrics & Gynecology (X.L., R.M.B., K.P.N.) and Department of Cellular and Integrative Physiology (E.A.G., R.M.B., K.P.N.), Indiana University School of Medicine, Indianapolis, Indiana 46202
Address all correspondence and requests for reprints to: Kenneth P. Nephew, Ph.D., Medical Sciences, Indiana University School of Medicine, 302 Jordan Hall, 1001 East Third Street, Bloomington, Indiana 47405-4401. E-mail: knephew{at}indiana.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
as bait
in a yeast two-hybrid screen of a cDNA library derived from rat uterine
luminal epithelium. We report the cloning and characterization of a
cDNA encoding a protein homologous to yeast and human
ubiquitin-activating enzyme 3 (Uba3), the catalytic subunit of the
activating enzyme of the ubiquitin-like NEDD8 (neural precursor
cellexpressed developmentally down-regulated)
conjugation pathway (known as neddylation). Sequence analysis
revealed that Uba3 contains multiple nuclear receptor (NR)-interacting
motifs (NR boxes), which are known to mediate interactions between
coregulatory proteins and ligand-activated NRs. Yeast two-hybrid and
glutathione-S-transferase pull-down assays demonstrated
that Uba3 directly interacts with ligand-occupied ER and ERß.
Transient transfection of Uba3 in mammalian cells inhibited ER-mediated
transactivation in a time-dependent fashion; Uba3 had no effect on the
initial events of transcriptional activation by liganded ER, but it
blocked the progressive increase in target gene expression during
continuous stimulation. Uba3 also inhibited transactivation by AR and
PR in mammalian cells but had no effect on a steroid
receptor-independent transactivation pathway. An enzymatically silent
form of Uba3 did not inhibit ER-induced transcription, and a
Uba3-binding fragment of amyloid precursor protein-binding protein, the
other subunit of the NEDD8-activating enzyme, partially overcame
Uba3-mediated inhibition, demonstrating that the neddylation activity
of Uba3 is required for its inhibition of steroid receptor
transactivation. Thus, Uba3 inhibits transcription induced by steroid
hormone receptors through a novel mechanism that involves the
neddylation pathway. Understanding the mechanisms controlling hormone
responsiveness of target tissues, such as the uterus and mammary gland,
may lead to novel insights of therapeutic intervention. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and ERß, members of the NR superfamily related by structure and
function (1, 2). Upon ligand binding, ER binds directly to
its cognate estrogen-responsive element (ERE) and recruits coactivator
proteins to stimulate expression of target genes (3, 4).
Cellular response to estrogen is tightly controlled, and a large number
of ER-interacting proteins have been described as coactivators or
corepressors that modify ER transcriptional activity (4).
Changes in expression or activity of coregulators can contribute to
estrogen and antiestrogen responsiveness of target cells (5, 6), including breast cancer (7, 8, 9), presumably by
influencing ER activity. Receptor levels and dynamics have also been
shown to have a profound influence on target tissue responsiveness and
sensitivity to estrogen (10). The primary regulator of
cellular ER levels is the ligand itself. Estrogen induces a rapid
down-regulation of ER protein and mRNA in a variety of cells and
tissues, e.g. human breast cancer cells, rat fibroblasts,
and rat uterus (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26). 4-Hydroxytamoxifen (Tam)
also induces ER down-regulation in rat uterus, where it is an agonist
of ER, but with much slower kinetics than E2 (27);
however, in human breast cancer MCF-7 cells, where Tam is an
antagonist, the antiestrogen had no effect on ER levels
(28). Collectively, these observations suggest that ER
transcriptional activity is related to receptor down-regulation.
Activation of NRs and other transcription factors appears to be
coupled to degradation of these proteins by the ubiquitin-proteasome
pathway (29, 30, 31, 32). Lonard et al.
(33) reported that the 26S proteasome is essential for
ER transcription activity and degradation in response to E2.
Furthermore, several components of the ubiquitin-proteasome pathway
have been identified as NR-interacting proteins, including E6-AP, a
ubiquitin-protein ligase (34), and suppressor for
galactose (SUG1), a component of the PA700 proteasome-regulatory
complex (35). Several recent studies demonstrated that
BRCA1 interacts with ER and suppresses ER-mediated transactivation
activity (36, 37). Interestingly, BRCA1 has also been
shown to possess intrinsic ubiquitin protein ligase activity
(38), although the contribution of the ligase activity to
BRCA1-mediated suppression on ER activity remains to be established.
Together, these observations suggest that the ubiquitin-proteasome
pathway may play an important role in regulating NR levels and
restricting the duration and magnitude of receptor activity in response
to hormones, but more than one mechanism may exist.
Components of the ubiquitin-proteasome pathway that modulate
steroid hormone receptors, including E6-AP and SUG1, interact with the
C-terminal domain region, which encompasses a ligand-dependent
activation function (AF2). The model we have been using to study
interactions of ER with ligands and coregulators (27, 39, 40) is the rat uterus, and we used the AF-2 and hinge region of
ER as bait in a yeast two-hybrid screen of a cDNA library derived
from rat uterine luminal epithelium. Here we report the isolation and
characterization of a cDNA clone encoding rat ubiquitin-activating
enzyme 3 (Uba3). Uba3 is the catalytic subunit of the activating enzyme
in the ubiquitin-like NEDD8 (neural precursor cell-expressed
developmentally down-regulated) conjugation (neddylation) pathway
(41). Using yeast two-hybrid and in vitro
glutathione-S-transferase (GST) pull-down assays, we show
that Uba3 directly interacts with ER and ERß. In mammalian
transfection assays, Uba3 suppresses ER-mediated transactivation in a
time-dependent manner. Uba3 also inhibits the ability of AR and PR
to transactivate reporter genes. Furthermore, we showed that
neddylation activity is required for Uba3-mediated suppression on ER.
Collectively, our observations implicate a potential role for the NEDD8
protein modification pathway in restricting steroid hormone receptor
activity.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
AF2 as the bait, we performed yeast two-hybrid
screening of a unique cDNA library made from the luminal epithelium of
the rat uterus to identify novel steroid receptor-interacting proteins.
We screened approximately 1 x 106 primary
library transformants. More than 50 ER-interacting clones were
identified by their ability to grow in the selection medium and to
produce ß-galactosidase (ß-gal) due to the activation of
HIS3 and LacZ reporter genes under the control of
GAL1 promoter. Some of the positive clones turned out to be known
NR-interacting proteins such as SUG1 and steroid receptor
coactivator 3 (SRC-3)/receptor-associated coactivator 3
(RAC3)/amplified in breast cancer 1 (AIB1). A cDNA of 2,191 bp
(Fig. 1
) encoding a predicted protein of
462 amino acids was isolated, and a BLAST search of the entire database
through the National Center for Biotechnology Information (Bethesda,
MD) showed that it was 99% identical with human and mouse Uba3, a
catalytic subunit of the NEDD8-activating enzyme, which is involved in
a ubiquitin-like conjugation pathway (41). The rat Uba3
cDNA sequence was submitted to the GenBank (accession no.
AF336829). The nucleotide and deduced amino acid sequences of
rat, mouse, and human Uba3 are highly conserved, with only one amino
acid difference between mouse and rat, and a difference of only five
amino acids between rat and human (Fig. 2). A similar NEDD8-activating enzyme
subunit has also been identified in yeast and plants
(42, 43, 44), suggesting that Uba3 has an essential
function(s) that is conserved during evolution.
|
|
). It has been well documented that the
interaction of coactivators of SRC-1/p160 and CBP/p300 families with
NRs occurs through the conserved LXXLL motifs (45), which
bind to a hydrophobic cleft in the ligand-binding domain (LBD) formed
as a result of ligand-mediated conformational change (46, 47). Whether these LXXLL motifs in Uba3 are essential for the
interaction with ER is currently under investigation.
Uba3 Directly Interacts with ER and ERß in the Presence of
E2
The interaction between Uba3 and ER was further defined using
yeast two-hybrid assays in agar plate and liquid culture. On the
selective plate containing X-Gal, yeast transformed with control
vector grew as small white colonies. Coexpression of pAD-Gal4-Uba3 and
pBD-Gal4-ER plasmids resulted in the development of large, blue
colonies in the presence of E2 (Fig. 3A, inset, right), but not in the presence of vehicle (Fig. 3A, inset, top) or antiestrogen Tam (Fig. 3A, inset,
bottom). To quantify the interaction of Uba3 with ER, we
measured ß-gal activity in liquid yeast culture. Yeast transformed
with pBD-GAL4-ERAF2 and pAD-GAL4 vector (negative control) produced
low levels of ß-gal (Fig. 3A). However, yeast transformed with
pBD-GAL4-ER and pAD-GAL4-Uba3 displayed increased (P
< 0.01) ß-gal activity in the presence of
10-8 M E2, which is 2-fold
greater than that of ER with SUG-1, a known ER-interacting protein
(35). In contrast, Uba3 showed no interaction with ER
in the presence of 10-6 M
Tam. Furthermore, when a pBD-GAL4 construct expressing the AF2 domain
of PR (Fig. 3B) or AR (Fig. 3C) was used, no interaction with Uba3 was
detected in the presence or absence of progesterone or T, respectively.
In contrast, both PR and AR strongly interacted with SRC-3, a known
coactivator of NR. These observations indicated that in yeast, Uba3
preferentially interacts with ER in an estrogen-dependent
manner.
|
and further examine the potential receptor specificity of Uba3,
we performed in vitro GST pull-down assays.
35S-Labeled full-length ER, generated by
in vitro transcription and translation, was incubated with
purified GST-Uba3 or the GST control bound to glutathione-Sepharose
beads in the presence or absence of E2 or Tam. Uba3 interacted weakly
with ER in the absence of ligand, and the interaction was strongly
stimulated by E2 but not Tam (Fig. 4A).
No interaction between GST and ER in the presence or absence of
ligand was detected. We have also examined the interaction of Uba3 with
full-length ERß, the recently described second ER (48)
and PR. Uba3 interacted weakly with ERß in the absence of ligand, and
the interaction was enhanced by E2, but to a lesser extent than that of
Uba3 with ER (Fig. 4B). No significant interaction was detected
between Uba3 and PR with or without progesterone (Fig. 4C). These
results were consistent with those from the yeast two-hybrid assay and
suggested that Uba3 directly and perhaps preferentially interacts with
E2-bound ER and ERß.
|
and ERß, suggesting a
potential role for Uba3 as an ER coregulator. To examine this
hypothesis and investigate whether the Uba3-ER interaction had
functional significance, transient transfection assays were carried out
in mammalian cells. HeLa cells lack steroid receptors but, when
transfected with exogenous receptor, these cells become competent for
steroid signaling, indicated by ligand-stimulated expression of
responsive reporter constructs (Fig. 5).
In HeLa cells transfected with ER, E2 induced ER activity
approximately by 10-fold. Coexpression of Uba3 with ER inhibited
(P < 0.01) E2-induced transcriptional activity, and
the inhibition was dependent upon the expression level of Uba3 (Fig. 5A). Uba3 exhibited no effect on expression of reporter gene in the
absence of E2 (Fig. 5A). In HeLa cells transfected with ERß, E2
induced ER activity approximately by 3.5-fold. Coexpression of Uba3
also exhibited dose-dependent suppression on ERß activity (Fig. 5B).
|
activity in a dose-dependent manner in MDA-MB-231
cells (Fig. 5C). Uba3 also inhibited ER in HepG2 cells, although to
a lesser extent, using either the pS2 promoter (2xERE-pS2-Luc) or the
complement C3 promoter (C3-Luc), another ER-responsive reporter
construct (Fig. 5D). Together, these results suggest that the
suppression of ER activity by Uba3 is not cell type or promoter
specific.
Although Uba3 did not interact with PR and AR in the yeast two-hybrid
and in vitro GST pull-down assays, those systems do not
contain the same receptor-interacting protein found in mammalian cells,
some of which may be involved in the tripartite interactions between
steroid receptors, coregulators, and ligand (1, 2, 3, 4). Thus,
it was pertinent to know whether Uba3 could affect PR or AR activity in
mammalian cells, and we examined the effect of Uba3 on AR- and
PR-mediated transactivation in HeLa cells. Similar to ER, coexpression
of increasing amounts of Uba3 resulted in a gradual suppression of
AR-mediated gene expression in the presence of T (Fig. 5E). Uba3 also
exhibited a significant inhibition of PR activity in the presence of
progesterone (Fig. 5F). These results indicated that Uba3 might
represent a mechanism to attenuate the transcription activities of
steroid hormone receptors. In contrast to what was observed with the
steroid hormone receptors, Uba3 had no effect on the transcriptional
activity of TGF-induced Elk-1 (Fig. 5G), a growth factor-regulated
transcription factor (49), or expression of the control
plasmid, pCMV-ß-gal (data not shown). Collectively, these
observations suggest that Uba3 does not inhibit transcription in
general.
To further explore the effect of Uba3 on steroid receptor function, we
tested whether Uba3 could counteract the transcriptional enhancement
mediated by known steroid receptor coactivator. HeLa cells were
cotransfected with a constant amount of pcDNA-SRC-1 and increasing
amounts of pcDNA-Uba3 (Fig. 6A) or vice
versa (Fig. 6B). Estrogen-mediated reporter gene expression was
enhanced up to 4- to 5-fold by SRC-1, confirming its coactivator
activity and agreeing with previous reports on the effects of SRC-1 in
this type of assay (50). Coexpression of increasing
amounts of Uba3 inhibited (P < 0.01) ER
transcriptional activity in the presence of SRC-1 (Fig. 6A). In
contrast, increasing the dose of SRC-1 did not reverse the inhibitory
effectiveness of Uba3 (Fig. 6B), suggesting that Uba3-mediated
suppression on ER is not due to a simple competition with SRC-1 for ER
binding.
|
).
At 12 h after estrogen treatment, Uba3 showed no effect on
E2-induced reporter gene expression in the presence of SRC-1; however,
at 18 and 24 h, a substantial suppressive effect of
Uba3 was observed. In the absence of SRC-1, Uba3
inhibited estrogen-induced reporter gene expression by 20% at 12
h and 50% at 24 h. The effect of the known corepressor REA
(repressor of ER) (51) was used for comparison in this
experiment. REA is a specific corepressor of ligand-activated ER and at
least partially inhibits ER transcriptional activity by competing with
SRC-1 for ER interaction (52, 53). In contrast to what was
observed for Uba3, REA completely inhibited ER transcriptional
activity in the presence of SRC-1 12, 18, and 24 h after E2
treatment. Collectively, results of transient transfection assays
suggest that Uba3 inhibits steroid receptor-mediated gene
expression by promoting the termination of transcription
rather than interfering with the initiation of transactivation.
|
mediated reporter gene expression in the absence (Fig. 8A) or presence of SRC-1 (Fig. 8B). To
exclude the possibility that the absence of suppressive activity of
Uba3C216S was due to the inefficient expression of the mutant protein,
the expression of Uba3C216S, which is hemagglutinin (HA) tagged, was
confirmed by immunoblotting (Fig. 8A, inset). These results
suggested that the neddylation activity of Uba3 is required to suppress
steroid receptor-mediated transcription.
|
). However, when cotransfected with Uba3, the
443–534 fragment partially reversed Uba3 suppression of ER-mediated
transactivation in a dose-dependent manner (Fig. 8C).
In contrast, full-length APP-BP1, which slightly inhibited
ER activity when expressed alone, had no effect on
Uba3-mediated suppression of ER (Fig. 8C). The expression of
full-length APP-BP1 and the 443–534 fragment, both of which were
c-myc tagged, was confirmed by immunoblotting (Fig. 8C, inset). We also tested the effect of Ubc12, the only known
conjugating enzyme for NEDD8 pathway (41), on ER-mediated
transactivation. Expression of Ubc12 alone in HeLa cells inhibited ER
activity in a dose-dependent manner (Fig. 8D), but to a lesser extent
compared with Uba3, perhaps due to enhancement of the enzymatic
activity of endogenous Uba3. When coexpressed with Uba3, Ubc12 had no
effect on Uba3-mediated suppression of ER transactivation. Together,
these results suggest that neddylation is involved in restricting
steroid receptor activity, and receptor-Uba3 interactions appear to be
a limiting factor.
Expression of Uba3 and NEDD8 in Tissues and Cell Lines
Expression of Uba3 and NEDD8 in various tissues was examined
using Northern blot analysis. Uba3 was expressed as a single mRNA of
2.3 kb in all tissues examined; however, a differential expression
pattern of Uba3 was observed among the tissues examined (Fig. 9, top), Uba3 mRNA levels
varied, with higher expression in uterus, ovary, skeletal muscle, and
neural tissues, and lower expression in kidney, intestine, stomach, and
liver. NEDD8 mRNA was detected as a single 1.2-kb band in all
tissues examined, with higher expression in ovary, skeletal muscle, and
neural tissues and lower expression in intestine and stomach (Fig. 9, middle). We cloned Uba3 from the uterus, and it was of
interest to investigate the cell type pattern of Uba3 expression in
this tissue. In situ hybridization analysis showed silver
grains corresponding to Uba3 mRNA in all three uterine compartments
(epithelia, stroma, and myometrium); however, silver grains for Uba3
were more abundant in the luminal and glandular epithelial cells
compared with the stroma and myometrium, indicating that Uba3 mRNA
levels vary among the uterine compartments (Fig. 9, inset).
|
).
High expression of Uba3 mRNA levels was observed in the uterine cancer
Ishikawa and HEC-1A cell lines and cervical cancer HeLa cells. Moderate
expression of Uba3 was observed in normal human mammary epithelium
MCF-10A, breast cancer MCF-7 and MDA-MB-231 cells, and liver cancer
HepG2 cells. Low or no Uba3 expression was detected in breast cancer
MDA-MB-435 and MDA-MB-468 cells. Interestingly, NEDD8 mRNA levels
tended to follow a similar pattern as those of Uba3 in these cell
lines.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Most known corepressors inhibit steroid receptor activity by blocking the initiation of receptor-mediated transactivation. For example, REA and FKHR inhibit the assembly of active ER transcription complex by competing with SRC-1 coactivators for ER binding (51, 53, 57), and MAT1 has been shown to silence ERE by recruiting histone deacetylases (56). The novel feature of Uba3, i.e. that it affects the duration but not the initiation of ER-mediated transactivation, indicates a distinct inhibitory mechanism. Uba3 possesses intrinsic enzyme activity involved in neddylation, a protein modification pathway that plays an important role in ubiquitin-mediated proteolysis (58, 59, 60). Our results show that neddylation activity is essential for Uba3-mediated suppression of ER, and we hypothesize that Uba3 and the neddylation pathway in general play a role in restricting steroid receptor action by promoting receptor turnover.
Like Uba3, several other steroid receptor-interacting proteins have
enzymatic activities related to the ubiquitin-proteasome pathway,
including E6-AP (34), SUG1 (61), and BRCA1
(36, 37, 38); however, the precise role of their
ubiquitin-proteasome-related activities in regulation of steroid
receptor function remains to be established. Both E6-AP and SUG1 have
multiple separable functions and may regulate steroid receptor activity
through nonproteolytic mechanisms. Studies with mutant forms of E6-AP
showed that the ubiquitin-protein ligase activity is not required for
E6-AP to coactivate PR (34). SUG1 has been shown to be an
integral component of the polymerase II holoenzyme (62)
and possess DNA helicase activity (35) that might mediate
its coactivation activity. To date, the only established function of
Uba3 is to activate NEDD8, and the targets of NEDD8, other than cullin
family proteins, are unknown. Cullins are essential components of a
group of E3 ubiquitin-protein ligases, including SCF (Skp1-Cdc53-F-box
protein) (63, 64, 65) and von Hippel-Lindau tumor suppressor
protein-elongin B-elongin C complex (66).
Accumulated evidence suggests that NEDD8 modification of the cullin
subunit plays a crucial role in regulating the ligase activity of
cullin-based ubiquitin protein ligase complexes (58, 59, 60, 67, 68). Our results in HeLa cells (Figs. 5 and 8) indicate that the
level of Uba3 is the limiting factor in neddylation-associated
suppression of receptor activity. We therefore hypothesize that, upon
binding to ligand-activated steroid receptor, Uba3, together with
APP-BP1 and Ubc12, recruits and activates a cullin-based
ubiquitin-protein ligase, which, in turn, targets receptor for
ubiquitin/proteasome degradation. Alternatively, Uba3, together with
APP-BP1 and Ubc12, may catalyze the direct neddylation of
ligand-activated steroid receptors, leading to a rapid attenuation of
receptor transcriptional activity. An analogous finding that AR can be
covalently modified by ubiquitin-like SUMO-1 and the sumoylation
appears to inhibit the AR activity (69) supports the
hypothesis. Ubiquitin-associated pathways (neddylation, sumoylation)
may represent a general mechanism to attenuate steroid hormone receptor
activity.
Lonard et al. (33) has reported that the coactivator-binding surface of ER is important for ligand-mediated degradation of the receptor. Consistent with this observation, two distinct NR-interacting domains or LXXLL motifs are found in Uba3, which could mediate the ligand-dependent interaction with ER. However, it seems likely that the binding site(s) for Uba3 in the LBD of ER is distinct from that used by SRC-1, because Uba3 has no apparent effect on the ER-SRC-1 interaction. Further studies are required to identify the sequences in both ER and Uba3 that are essential for Uba3-mediated suppression. Interestingly, although transient transfection experiments demonstrated that Uba3 also inhibited gene expression mediated by AR and PR, the results from yeast two-hybrid and in vitro GST pull-down assays did not suggest that Uba3 physically interacts with AR or PR. One possible explanation is that additional integrating proteins are required that are absent when using yeast or GST pull-down systems. Further experiments to determine whether Uba3 directly interacts with AR and PR in mammalian cells are necessary.
We observed Uba3 expression in several different rat tissue types; this
observation is in agreement with the broad tissue distribution of human
Uba3 (41). In the uterus, in situ
hybridization analysis revealed distinct Uba3 expression in the uterine
luminal epithelial cells, the same cell type in which ER is rapidly
degraded in response to estrogen stimulation (39).
Expression of NEDD8 was also observed in all rat tissues examined, but
NEDD8 mRNA levels varied and appeared to follow a similar pattern as
Uba3. We also examined hormone-dependent human cancer cell lines for
steady-state Uba3 and NEDD8 mRNA expression, and a further association
of Uba3 and NEDD8 was evident. Interestingly, low to no Uba3 and NEDD8
expression was seen in two of the ER-negative breast cancer cells,
whereas relatively higher expression was detected in ER-positive
MCF-10, MCF-7, Hec-1A, and Ishikawa cells. Further studies on the
correlation between the dynamics of steroid turnover and expression
levels of Uba3 and NEDD8 will provide insights into the mechanism of
neddylation in restricting steroid receptor activity.
In summary, our results suggest a potential role for ubiquitin-like NEDD8 pathway in restricting steroid receptor activity and thus steroid hormone action. Further studies on the biological relevance of Uba3 in hormone-dependent cell proliferation may reveal a role of Uba3 in the development and progression of cancers, including uterine and breast cancer. In addition, better understanding of neddylation in hormone action may lead to novel insights of therapeutic intervention.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Plasmid Construction
A cDNA library was constructed from the uterine luminal
epithelial poly (A)+ RNA and ligated into
pAD-GAL4 phagemid of the HybridZAP Two-Hybrid cDNA Gigapack Cloning Kit
(Stratagene) to generate the primary 
library for
amplification and screening. The Hybrid ZAP library was converted to
a pAD-GAL4 phagemid library by in vivo mass excision. The
bait plasmid for the yeast two-hybrid system (pBD-GAL4-ERAF2) was
constructed by inserting rat ERAF2 DNA fragment, corresponding to
amino acids 290–600, into pBD-GAL4 Cam phagemid vector. The cDNA
encoding the bait ERAF2 was prepared by PCR (sequence from
944–1,876; GenBank accession no. X61098) with the following primer
pair: RERARI944 5'-CGGAATTCATGAGAGCTGCCAACCTTTGG-3' (upper strand) and
RERAXHO1876 5'-CCGCTCGAGCGGTCAGATGGTGTTGGGGAAGC-3' (lower strand). The
plasmid was sequenced to confirm it was in the correct reading
frame.
To generate the estrogen-responsive luciferase reporter construct
for transient transfection assays in mammalian cells, a synthesized
minimal promoter region of the pS2 gene, nucleotides -91 to +10
(73), was ligated into the HindIII site
(blunted by Klenow reaction) of the pGL3 luciferase reporter vector
(Promega Corp., Madison, WI). A double-stranded
oligonucleotide containing two consensus ERE sites
(GTACCAGGTCACAGTGACCTGATCAGCTAGTCAGGTCACAGTGACCTTCGTAC)
was then ligated into the blunted KpnI site of the pS2-luc
to make a 2xERE-pS2-luc reporter gene. The Uba3 expression plasmid was
constructed by inserting full-length Uba3 cDNA into the
EcoRI and XhoI sites of pcDNA3+
(Invitrogen, Carlsbad, CA). pCMV-ERß was generated using
full-length cDNA cloned from rat prostate library (CLONTECH Laboratories, Inc., Palo Alto, CA). The ER-responsive C3
promoter construct (C3-Luc) and PR-responsive construct (PRE-2xTK-Luc)
was obtained from Dr. D. P. McDonnell (Duke University Medical
School, Durham, NC). The AR-responsive construct (pSA61-Luc) was from
Dr. S. Khan (University of Cincinnati, Cincinnati, OH). The ER
(HEGO)- and human PRB-expressing plasmids were obtained from Dr. P.
Chambon (Institut de Génétique et de Biologie
Moléculaire et Cellulaire, Strasbourg, France). Rous
sarcoma virus-AR was from Dr. C. Kao (Indiana University). pcDNA-SRC-1
was obtained from Dr. T-P. Yao (Dana-Farber Cancer Institute, Boston,
MA). pcDNA-HA-Uba3C216S, pcDNA-c-myc-APP-BP1 and
pcDNA-c-myc-APP-BP1443–534 were obtained from Dr. R. Neve
(Harvard Medical School, Boston, MA). pcDNA-REA was obtained from Dr.
B. Katzenellenbogen (University of Illinois, Champagne-Urbana, IL).
Elk-response constructs (PathDetect Trans-Reporter,
Stratagene) and pCMV-ß-gal (Promega Corp.)
were purchased.
Yeast Two-Hybrid Reporter Assays
The yeast two-hybrid screening was conducted according to the
manufacturer’s instructions (Hybrid cDNA Gigapack Cloning Kit,
Stratagene). Briefly, the yeast strain J69–4A (Mat;
trp1–901; leu2–3, 112; ura3–52; his3–200; gal4; gal80;
Ade2::GAL2p-ADE2; LYS2::GAL1p-HIS3;
met2::GAL7p-Lacz)was cotransformed with the pBD-GAL4-ERAF2 and
the cDNA pAD-Gal4 library plasmids by using the lithium acetate method.
Approximately 1 x 106 yeast transformants
were plated on synthetic minimal medium agar lacking leucine,
tryptophan, histidine, and adenine for 6 d at 30 C. ER-interacting
clones were identified by their ability to grow in the selective plates
and to activate LacZ reporter gene as indicated by the
expression of ß-gal.
To investigate ligand-dependent and -independent interaction between
wild-type Uba3 with the AF2 domain of ER, AR, and PR, we used the yeast
two-hybrid system, similar to what we described previously
(74), except that vectors pAD-GAL4- and
pBD-GAL4-(HybridZAP Two-Hybrid cDNA Gigapack Cloning Kit,
Stratagene) were used. The full-length Uba3 cDNA was
inserted into pAD-GAL4 vector. The yeast strain J69–4A was transformed
with pBD-GAL4-ERAF2 and pAD-GAL4-Uba3 and plated on
SC/Leu,Trp,His,Ade/X-Gal agar plates containing
10-8 M E2,
10-6 M Tam, or vehicle. To measure
the interaction of Uba3 with AR or PR, pBD-GAL4 construct expressing
the AF2 domain of AR or PR was used instead of pBD-GAL4-ERAF2 in
J69–4A cells. cDNA of AR AF2 domain was cloned from a rat prostate
library (CLONTECH Laboratories, Inc.) and that of the PR
AF2 domain was cloned from the construct expressing the human
full-length PR (Dr. P. Chambon). To measure the strength of the
interaction of Uba3 with the receptors, the ß-gal expression levels
in liquid yeast cultures from three independent transformants were
determined using a chemiluminescent reporter assay (PE Applied Biosystems, Foster City, CA).
GST Pull-Down Assay
GST pull-down assays were performed as described by Shibata
et al. (75). To fuse Uba3 with GST, the
EcoRI-SalI fragment of Uba3 from pAD-GAL4-Uba3
was subcloned into plasmid pGEX-6P-1 (Amersham Pharmacia Biotech, Piscataway, NJ) and subjected to DNA sequencing to
confirm it was in the correct reading frame. The GST-tagged Uba3 was
expressed in DH5 cells and purified as described by Cavailles
et al. (76). Briefly, overnight cultures of
DH5 cells containing the plasmid pGEX-6P-1-GST-Uba3 were diluted
(1:20), cultured in fresh medium for 2 h, and treated with 0.1
mM isopropyl
ß-D-thiogalactoside for 3 h. The bacteria
were collected by centrifugation and lysed in NETN buffer containing
0.5% Nonidet P-40, 1 mM EDTA, 20
mM Tris (pH 8.0), 100 mM
NaCl, and protease inhibitors. GST-Uba3 was purified on
glutathione-Sepharose beads (Amersham Pharmacia Biotech).
The cDNAs for full-length ER, ERß, and PR were subcloned into
pGEM-7Z (Promega Corp.), and these were used in an
in vitro translation kit (Promega Corp.) to
produce protein labeled with [35S]methionine.
The [35S]-labeled ER, ERß, or PR was
incubated with the glutathione-bound GST-Uba3 in binding buffer in the
absence or presence of corresponding ligands, or vehicle overnight at 4
C. After intensive washing, Uba3-bound protein was eluted and separated
on a 10% SDS-polyacrylamide gel. The
[35S]-labeled proteins in the gel were
visualized by autoradiography.
Transient Transfection Assays
HeLa, MDA-MB-231, and HepG2 cells were maintained in DMEM with
10% FBS. Two days before transfection, approximately 1 x
105 cells per well were seeded in 12-well dishes
in phenol red-free DMEM containing 5% dextran-coated charcoal-stripped
serum (HyClone Laboratories, Inc., Logan, UT).
Cells were transfected with equal amount of total plasmid DNA (adjusted
by corresponding empty vectors) by using LipofectAMINE Plus Reagent
(Life Technologies, Inc., Gaithersburg, MD) according to
the manufacturer’s guidelines. Five hours later, the DNA/LipofectAMINE
mixture was removed, and cells were placed in phenol red-free media
containing 5% stripped serum and appropriate hormone or vehicle. Cell
lysates were prepared 12–24 h after hormone treatment using reporter
lysis buffer (Promega Corp.). Luciferase activity was
determined using the Promega Corp. Luciferase Assay System
and the T20/20 Luminometer (Turner Designs, Sunnyvale, CA). All cells
were cotransfected with pCMV-ß-gal and normalized using ß-gal
activity to correct for transfection efficiency. All experiments were
performed in triplicate and repeated at least twice.
Northern Blot Analysis
Total cellular RNA was isolated from various rat organs and
cultured cells using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH). Northern blot analysis for Uba3 and NEDD8
was performed as described previously (27) and repeated on
two separate membranes. The 36B4 cDNA, a constitutively expressed gene
encoding a ribosomal protein (77), was used to assess
loading differences between samples.
In Situ Hybridization Analysis
Cryosections (10 µm) form rat uteri were mounted on slides,
fixed in 4% paraformaldehyde in 1x PBS, dehydrated, dried, and stored
at -80 C, as described previously (27, 78, 79, 80).
35S-Labeled antisense and sense cRNA (1 x
104 to 1 x 105
cpm/µl) probes in hybridization buffer were heat denatured and added
to tissue sections (15 µl/coverslip). After incubation at a
hybridization temperature of 55 C for 16 h, tissue sections were
washed and treated with RNases to remove unhybridized cRNA probe,
dried, dipped in Ilford Nuclear Research Emulsion K5 (Polysciences,
Inc., Warrington, PA), and then stored at 4 C for 6 d.
Statistical Analyses
Assays were done in triplicate, and quantitation of three
independent experiments was performed. Statistical analysis was done
using ANOVA. When a significant P value (P
< 0.01) was found, t tests assuming unequal variance were
performed to compare individual treatment groups. All error bars
represent SD from the mean.
|
FOOTNOTES |
|---|
1 M.F. and X.L. contributed equally to this work. 
Abbreviations: AF2, Activation function 2; AIB1, amplified in breast cancer 1; APP-BP1, amyloid precursor protein-binding protein; ERE, estrogen-responsive element; ß-gal, ß-galactosidase; GST, glutathione-S-transferase; HA, hemagglutinin; NEDD, neural precursor cell-expressed developmentally down-regulated; NR, nuclear receptor; RAC3, receptor-associated coactivator 3; REA, repressor of ER activity; SRC, steroid receptor coactivator; SUG, suppressor for galactose; T, testosterone; Tam, 4-hydroxytamoxifen; Uba, ubiquitin-activating enzyme.
Received for publication June 18, 2001. Accepted for publication October 22, 2001.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
, estrogen
receptor-ß, coactivators, and corepressors in breast cancer. Clin
Cancer Res 6:512–518 is ligand- and proteasome-dependent. Nat Cell Biol 3:15–23[CrossRef][Medline]
and 
through the ubiquitin-proteasome
pathway. J Biol Chem 275:33280–33288 and coactivator
turnover and for efficient estrogen receptor- transactivation. Mol
Cell 5:939–948[CrossRef][Medline]
selectively enhances estrogen receptor
transcriptional activity by interacting with a repressor of estrogen
receptor activity. Mol Cell Biol 20:6224–6232
B. Mol Cell Biol 20:2326–2333B. Mol Cell 3:527–533[CrossRef][Medline]
B activation and interleukin 6 production in fibroblasts by
estrogen receptor-negative breast cancer cell-derived interleukin 1.
Proc Natl Acad Sci USA 95:6971–6976This article has been cited by other articles:
 |
|
 |
|
  X. Long, M. Fan, R. M. Bigsby, and K. P. Nephew Apigenin inhibits antiestrogen-resistant breast cancer cell growth through estrogen receptor-{alpha}-dependent and estrogen receptor-{alpha}-independent mechanisms Mol. Cancer Ther., July 1, 2008; 7(7): 2096 - 2108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Tan, X. Long, H. Nakshatri, K. P Nephew, and R. M Bigsby Striatin-3{gamma} inhibits estrogen receptor activity by recruiting a protein phosphatase J. Mol. Endocrinol., May 1, 2008; 40(5): 199 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. V. Heemers and D. J. Tindall Androgen Receptor (AR) Coregulators: A Diversity of Functions Converging on and Regulating the AR Transcriptional Complex Endocr. Rev., December 1, 2007; 28(7): 778 - 808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Lanvin, S. Bianco, N. Kersual, D. Chalbos, and J.-M. Vanacker Potentiation of ICI182,780 (Fulvestrant)-induced Estrogen Receptor-{alpha} Degradation by the Estrogen Receptor-related Receptor-{alpha} Inverse Agonist XCT790 J. Biol. Chem., September 28, 2007; 282(39): 28328 - 28334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Fan, P. S. Yan, C. Hartman-Frey, L. Chen, H. Paik, S. L. Oyer, J. D. Salisbury, A. S.L. Cheng, L. Li, P. H. Abbosh, et al. Diverse Gene Expression and DNA Methylation Profiles Correlate with Differential Adaptation of Breast Cancer Cells to the Antiestrogens Tamoxifen and Fulvestrant Cancer Res., December 15, 2006; 66(24): 11954 - 11966. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Long and K. P. Nephew Fulvestrant (ICI 182,780)-dependent Interacting Proteins Mediate Immobilization and Degradation of Estrogen Receptor-{alpha} J. Biol. Chem., April 7, 2006; 281(14): 9607 - 9615. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Fan, A. Park, and K. P. Nephew CHIP (Carboxyl Terminus of Hsc70-Interacting Protein) Promotes Basal and Geldanamycin-Induced Degradation of Estrogen Receptor-{alpha} Mol. Endocrinol., December 1, 2005; 19(12): 2901 - 2914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pascual-Le Tallec and M. Lombes The Mineralocorticoid Receptor: A Journey Exploring Its Diversity and Specificity of Action Mol. Endocrinol., September 1, 2005; 19(9): 2211 - 2221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Callige, I. Kieffer, and H. Richard-Foy CSN5/Jab1 Is Involved in Ligand-Dependent Degradation of Estrogen Receptor {alpha} by the Proteasome Mol. Cell. Biol., June 1, 2005; 25(11): 4349 - 4358. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fan, H. Nakshatri, and K. P. Nephew Inhibiting Proteasomal Proteolysis Sustains Estrogen Receptor-{alpha} Activation Mol. Endocrinol., November 1, 2004; 18(11): 2603 - 2615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Verma, A. Ismail, X. Gao, G. Fu, X. Li, B. W. O'Malley, and Z. Nawaz The Ubiquitin-Conjugating Enzyme UBCH7 Acts as a Coactivator for Steroid Hormone Receptors Mol. Cell. Biol., October 1, 2004; 24(19): 8716 - 8726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Shao, E. K. Keeton, D. P. McDonnell, and M. Brown Coactivator AIB1 links estrogen receptor transcriptional activity and stability PNAS, August 10, 2004; 101(32): 11599 - 11604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Nawaz and B. W. O'Malley Urban Renewal in the Nucleus: Is Protein Turnover by Proteasomes Absolutely Required for Nuclear Receptor-Regulated Transcription? Mol. Endocrinol., March 1, 2004; 18(3): 493 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Smith and B. W. O'Malley Coregulator Function: A Key to Understanding Tissue Specificity of Selective Receptor Modulators Endocr. Rev., February 1, 2004; 25(1): 45 - 71. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H. Melner, N. A. Ducharme, A. R. Brash, V. P. Winfrey, and G. E. Olson Differential Expression of Genes in the Endometrium at Implantation: Upregulation of a Novel Member of the E2 Class of Ubiquitin-Conjugating Enzymes Biol Reprod, February 1, 2004; 70(2): 406 - 414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. van der Spuy, J. H. Kim, Y. S. Yu, A. Szel, P. J. Luthert, B. J. Clark, and M. E. Cheetham The Expression of the Leber Congenital Amaurosis Protein AIPL1 Coincides with Rod and Cone Photoreceptor Development Invest. Ophthalmol. Vis. Sci., December 1, 2003; 44(12): 5396 - 5403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fan, R. M. Bigsby, and K. P. Nephew The NEDD8 Pathway Is Required for Proteasome-Mediated Degradation of Human Estrogen Receptor (ER)-{alpha} and Essential for the Antiproliferative Activity of ICI 182,780 in ER{alpha}-Positive Breast Cancer Cells Mol. Endocrinol., March 1, 2003; 17(3): 356 - 365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Antenos, R. F. Casper, and T. J. Brown Interaction with Nedd8, a Ubiquitin-like Protein, Enhances the Transcriptional Activity of the Aryl Hydrocarbon Receptor J. Biol. Chem., November 8, 2002; 277(46): 44028 - 44034. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
