help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fan, M.
Right arrow Articles by Nephew, K. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fan, M.
Right arrow Articles by Nephew, K. P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*OMIM*Protein
*UniGene
Molecular Endocrinology 16 (2): 315-330
Copyright © 2002 by The Endocrine Society

The Activating Enzyme of NEDD8 Inhibits Steroid Receptor Function

Meiyun Fan1, Xinghua Long1, Jason A. Bailey, Chad A. Reed, Elizabeth Osborne, Edward A. Gize, Eric A. Kirk, Robert M. Bigsby and Kenneth P. Nephew

Medical Sciences (M.F., X.L., J.A.B., C.A.R., E.O., E.A.K., K.P.N.), Indiana University School of Medicine, Bloomington, Indiana 47405; and Department of Obstetrics & Gynecology (X.L., R.M.B., K.P.N.) and Department of Cellular and Integrative Physiology (E.A.G., R.M.B., K.P.N.), Indiana University School of Medicine, Indianapolis, Indiana 46202

Address all correspondence and requests for reprints to: Kenneth P. Nephew, Ph.D., Medical Sciences, Indiana University School of Medicine, 302 Jordan Hall, 1001 East Third Street, Bloomington, Indiana 47405-4401. E-mail: knephew{at}indiana.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Coregulator proteins, coactivators and corepressors, have a profound influence on steroid receptor activity and play a role in regulating receptor levels. To identify novel coregulators of nuclear receptors, we used the ligand-binding and hinge region of ER{alpha} as bait in a yeast two-hybrid screen of a cDNA library derived from rat uterine luminal epithelium. We report the cloning and characterization of a cDNA encoding a protein homologous to yeast and human ubiquitin-activating enzyme 3 (Uba3), the catalytic subunit of the activating enzyme of the ubiquitin-like NEDD8 (neural precursor cellexpressed developmentally down-regulated) conjugation pathway (known as neddylation). Sequence analysis revealed that Uba3 contains multiple nuclear receptor (NR)-interacting motifs (NR boxes), which are known to mediate interactions between coregulatory proteins and ligand-activated NRs. Yeast two-hybrid and glutathione-S-transferase pull-down assays demonstrated that Uba3 directly interacts with ligand-occupied ER{alpha} and ERß. Transient transfection of Uba3 in mammalian cells inhibited ER-mediated transactivation in a time-dependent fashion; Uba3 had no effect on the initial events of transcriptional activation by liganded ER, but it blocked the progressive increase in target gene expression during continuous stimulation. Uba3 also inhibited transactivation by AR and PR in mammalian cells but had no effect on a steroid receptor-independent transactivation pathway. An enzymatically silent form of Uba3 did not inhibit ER-induced transcription, and a Uba3-binding fragment of amyloid precursor protein-binding protein, the other subunit of the NEDD8-activating enzyme, partially overcame Uba3-mediated inhibition, demonstrating that the neddylation activity of Uba3 is required for its inhibition of steroid receptor transactivation. Thus, Uba3 inhibits transcription induced by steroid hormone receptors through a novel mechanism that involves the neddylation pathway. Understanding the mechanisms controlling hormone responsiveness of target tissues, such as the uterus and mammary gland, may lead to novel insights of therapeutic intervention.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE SEX STEROID hormones, estrogen, progesterone, and testosterone (T) regulate diverse biological processes by acting through their cognate nuclear hormone receptors, ER, PR, and AR. For example, estrogenic signals are transmitted by ER{alpha} and ERß, members of the NR superfamily related by structure and function (1, 2). Upon ligand binding, ER binds directly to its cognate estrogen-responsive element (ERE) and recruits coactivator proteins to stimulate expression of target genes (3, 4). Cellular response to estrogen is tightly controlled, and a large number of ER-interacting proteins have been described as coactivators or corepressors that modify ER transcriptional activity (4). Changes in expression or activity of coregulators can contribute to estrogen and antiestrogen responsiveness of target cells (5, 6), including breast cancer (7, 8, 9), presumably by influencing ER activity. Receptor levels and dynamics have also been shown to have a profound influence on target tissue responsiveness and sensitivity to estrogen (10). The primary regulator of cellular ER levels is the ligand itself. Estrogen induces a rapid down-regulation of ER protein and mRNA in a variety of cells and tissues, e.g. human breast cancer cells, rat fibroblasts, and rat uterus (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26). 4-Hydroxytamoxifen (Tam) also induces ER down-regulation in rat uterus, where it is an agonist of ER, but with much slower kinetics than E2 (27); however, in human breast cancer MCF-7 cells, where Tam is an antagonist, the antiestrogen had no effect on ER levels (28). Collectively, these observations suggest that ER transcriptional activity is related to receptor down-regulation.

Activation of NRs and other transcription factors appears to be coupled to degradation of these proteins by the ubiquitin-proteasome pathway (29, 30, 31, 32). Lonard et al. (33) reported that the 26S proteasome is essential for ER{alpha} transcription activity and degradation in response to E2. Furthermore, several components of the ubiquitin-proteasome pathway have been identified as NR-interacting proteins, including E6-AP, a ubiquitin-protein ligase (34), and suppressor for galactose (SUG1), a component of the PA700 proteasome-regulatory complex (35). Several recent studies demonstrated that BRCA1 interacts with ER{alpha} and suppresses ER-mediated transactivation activity (36, 37). Interestingly, BRCA1 has also been shown to possess intrinsic ubiquitin protein ligase activity (38), although the contribution of the ligase activity to BRCA1-mediated suppression on ER activity remains to be established. Together, these observations suggest that the ubiquitin-proteasome pathway may play an important role in regulating NR levels and restricting the duration and magnitude of receptor activity in response to hormones, but more than one mechanism may exist.

Components of the ubiquitin-proteasome pathway that modulate steroid hormone receptors, including E6-AP and SUG1, interact with the C-terminal domain region, which encompasses a ligand-dependent activation function (AF2). The model we have been using to study interactions of ER with ligands and coregulators (27, 39, 40) is the rat uterus, and we used the AF-2 and hinge region of ER{alpha} as bait in a yeast two-hybrid screen of a cDNA library derived from rat uterine luminal epithelium. Here we report the isolation and characterization of a cDNA clone encoding rat ubiquitin-activating enzyme 3 (Uba3). Uba3 is the catalytic subunit of the activating enzyme in the ubiquitin-like NEDD8 (neural precursor cell-expressed developmentally down-regulated) conjugation (neddylation) pathway (41). Using yeast two-hybrid and in vitro glutathione-S-transferase (GST) pull-down assays, we show that Uba3 directly interacts with ER{alpha} and ERß. In mammalian transfection assays, Uba3 suppresses ER-mediated transactivation in a time-dependent manner. Uba3 also inhibits the ability of AR and PR to transactivate reporter genes. Furthermore, we showed that neddylation activity is required for Uba3-mediated suppression on ER. Collectively, our observations implicate a potential role for the NEDD8 protein modification pathway in restricting steroid hormone receptor activity.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Identification of Uba3 as an ER- Interacting Protein
Using ER{alpha}AF2 as the bait, we performed yeast two-hybrid screening of a unique cDNA library made from the luminal epithelium of the rat uterus to identify novel steroid receptor-interacting proteins. We screened approximately 1 x 106 primary library transformants. More than 50 ER-interacting clones were identified by their ability to grow in the selection medium and to produce ß-galactosidase (ß-gal) due to the activation of HIS3 and LacZ reporter genes under the control of GAL1 promoter. Some of the positive clones turned out to be known NR-interacting proteins such as SUG1 and steroid receptor coactivator 3 (SRC-3)/receptor-associated coactivator 3 (RAC3)/amplified in breast cancer 1 (AIB1). A cDNA of 2,191 bp (Fig. 1Go) encoding a predicted protein of 462 amino acids was isolated, and a BLAST search of the entire database through the National Center for Biotechnology Information (Bethesda, MD) showed that it was 99% identical with human and mouse Uba3, a catalytic subunit of the NEDD8-activating enzyme, which is involved in a ubiquitin-like conjugation pathway (41). The rat Uba3 cDNA sequence was submitted to the GenBank (accession no. AF336829). The nucleotide and deduced amino acid sequences of rat, mouse, and human Uba3 are highly conserved, with only one amino acid difference between mouse and rat, and a difference of only five amino acids between rat and human (Fig. 2Go). A similar NEDD8-activating enzyme subunit has also been identified in yeast and plants (42, 43, 44), suggesting that Uba3 has an essential function(s) that is conserved during evolution.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide and Deduced Amino Acid Sequence of Rat Uba3

The nucleotide sequence was determined on both strands by automated sequencing. The asterisk indicates the stop codon. The deduced amino acid sequence is given below the nucleotide sequence in single-letter code. The nucleotide sequence has been submitted to the GenBank with accession no. AF322224.

 


View larger version (80K):
[in this window]
[in a new window]
 
Figure 2. Sequence Alignment and Conserved Structural Motifs of Rat (r), Mouse (m), and Human (h) Uba3

The two NR boxes (LXXLL motifs) are in bold; pseudo NR boxes are underlined; the ATP-binding region is in bold italic; * indicates amino acid differences among rat, mouse, and human.

 
The Uba3 amino acid sequence was analyzed for a structural motif that might mediate the observed Uba3-ER interaction. Notably, the analysis revealed that Uba3 contains two NR-interacting LXXLL motifs (referred to as the NR box, where L is leucine and X is any amino acid), located at amino acids 122–126 and 179–183, with additional nonconserved NR boxes also present, two at the N terminus, and two at the C terminus (Fig. 2Go). It has been well documented that the interaction of coactivators of SRC-1/p160 and CBP/p300 families with NRs occurs through the conserved LXXLL motifs (45), which bind to a hydrophobic cleft in the ligand-binding domain (LBD) formed as a result of ligand-mediated conformational change (46, 47). Whether these LXXLL motifs in Uba3 are essential for the interaction with ER is currently under investigation.

Uba3 Directly Interacts with ER{alpha} and ERß in the Presence of E2
The interaction between Uba3 and ER was further defined using yeast two-hybrid assays in agar plate and liquid culture. On the selective plate containing X-Gal, yeast transformed with control vector grew as small white colonies. Coexpression of pAD-Gal4-Uba3 and pBD-Gal4-ER{alpha} plasmids resulted in the development of large, blue colonies in the presence of E2 (Fig. 3AGo, inset, right), but not in the presence of vehicle (Fig. 3AGo, inset, top) or antiestrogen Tam (Fig. 3AGo, inset, bottom). To quantify the interaction of Uba3 with ER{alpha}, we measured ß-gal activity in liquid yeast culture. Yeast transformed with pBD-GAL4-ER{alpha}AF2 and pAD-GAL4 vector (negative control) produced low levels of ß-gal (Fig. 3AGo). However, yeast transformed with pBD-GAL4-ER{alpha} and pAD-GAL4-Uba3 displayed increased (P < 0.01) ß-gal activity in the presence of 10-8 M E2, which is 2-fold greater than that of ER{alpha} with SUG-1, a known ER-interacting protein (35). In contrast, Uba3 showed no interaction with ER{alpha} in the presence of 10-6 M Tam. Furthermore, when a pBD-GAL4 construct expressing the AF2 domain of PR (Fig. 3BGo) or AR (Fig. 3CGo) was used, no interaction with Uba3 was detected in the presence or absence of progesterone or T, respectively. In contrast, both PR and AR strongly interacted with SRC-3, a known coactivator of NR. These observations indicated that in yeast, Uba3 preferentially interacts with ER{alpha} in an estrogen-dependent manner.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Uba3 Interacts with ER{alpha}, but Not PR or AR, in Yeast Two-Hybrid System

The yeast stain J69–4A was transformed with pAD-GAL4-Uba3 and pBD-GAL4-constructs expressing the AF2 domain of ER{alpha}, PR, or AR, and grown in liquid yeast culture with appropriate hormone. The strength of the interaction of Uba3 with the receptors was determined by measuring ß-gal activity from three independent transformants. A, ß-gal activity represents the level of interaction between Uba3 and ER{alpha} in the absence or presence or of E2 (10-8 M) or Tam (10-6 M). SUG1 was used as a positive control. The inset shows the colonies of transformed yeast grown on selective plates. Large blue colonies were developed in the presence of 10-8 M E2 (right) due to the interaction of Uba3 with ER{alpha}, whereas small white colonies were observed in the presence of vehicle (top) or Tam (bottom) due to the absence of protein interaction. B, ß-gal activity represents the level of interaction between Uba3 and PR in the presence or absence of progesterone. C, ß-gal activity represents the level of interaction between Uba3 and AR in the presence or absence of T. SRC-3 was used as a positive control in panels B and C.

 
To further investigate the direct physical interaction between Uba3 and ER{alpha} and further examine the potential receptor specificity of Uba3, we performed in vitro GST pull-down assays. 35S-Labeled full-length ER{alpha}, generated by in vitro transcription and translation, was incubated with purified GST-Uba3 or the GST control bound to glutathione-Sepharose beads in the presence or absence of E2 or Tam. Uba3 interacted weakly with ER{alpha} in the absence of ligand, and the interaction was strongly stimulated by E2 but not Tam (Fig. 4AGo). No interaction between GST and ER{alpha} in the presence or absence of ligand was detected. We have also examined the interaction of Uba3 with full-length ERß, the recently described second ER (48) and PR. Uba3 interacted weakly with ERß in the absence of ligand, and the interaction was enhanced by E2, but to a lesser extent than that of Uba3 with ER{alpha} (Fig. 4BGo). No significant interaction was detected between Uba3 and PR with or without progesterone (Fig. 4CGo). These results were consistent with those from the yeast two-hybrid assay and suggested that Uba3 directly and perhaps preferentially interacts with E2-bound ER{alpha} and ERß.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 4. Uba3 Directly Interacts with ER{alpha} and ERß, but Not PR, in GST Pull-Down Assays

35S-Labeled full-length ER{alpha} (A), ERß (B), or PR (C) was incubated with GST-Uba3 bound to glutathione-Sepharose beads in the absence or presence of indicated ligands. After extensive washing, specific interacting protein was eluted and analyzed by SDS-PAGE and autoradiography. The input lanes show the amounts of receptor used for each reaction. E2, 10-8 M; Tam, 10-6 M.

 
Uba3 Suppresses Steroid Receptor-Mediated Transactivation in Mammalian Cells
Yeast two-hybrid and GST pull-down assays showed the ligand-dependent interaction of Uba3 with ER{alpha} and ERß, suggesting a potential role for Uba3 as an ER coregulator. To examine this hypothesis and investigate whether the Uba3-ER interaction had functional significance, transient transfection assays were carried out in mammalian cells. HeLa cells lack steroid receptors but, when transfected with exogenous receptor, these cells become competent for steroid signaling, indicated by ligand-stimulated expression of responsive reporter constructs (Fig. 5Go). In HeLa cells transfected with ER{alpha}, E2 induced ER activity approximately by 10-fold. Coexpression of Uba3 with ER{alpha} inhibited (P < 0.01) E2-induced transcriptional activity, and the inhibition was dependent upon the expression level of Uba3 (Fig. 5AGo). Uba3 exhibited no effect on expression of reporter gene in the absence of E2 (Fig. 5AGo). In HeLa cells transfected with ERß, E2 induced ER activity approximately by 3.5-fold. Coexpression of Uba3 also exhibited dose-dependent suppression on ERß activity (Fig. 5BGo).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Uba3 Suppresses Steroid Receptor-Mediated Transactivation in Mammalian Cells

Uba3 suppresses ER{alpha}- and ERß-mediated transactivation in HeLa cells. Cells were cotransfected with 10 ng pSG5-hER{alpha} (A) or pCMV-ERß (B), 250 ng 2xERE-pS2-Luc, with indicated amount of pcDNA-Uba3. The transfected cells were treated with E2 (10 nM, solid bars) or vehicle (open bars) for 24 h. C, Uba3 inhibits ER{alpha} activity in MDA-MB-231 cells. Cells were treated as described above. D, Uba3 inhibits ER{alpha}-mediated transactivation in HepG2 cells. Cells were cotransfected with 10 ng pSG5-hER{alpha}, 250 ng 2xERE-pS2-Luc, or C3-Luc promoter construct, along with or without 150 ng pcDNA-Uba3. pcDNA-REA (150 ng) was used as control to show the suppressive effect. The transfected cells were treated with E2 (10 nM, solid bars) or vehicle (open bars) for 16 h. E, Uba3 suppresses AR-mediated transactivation. HeLa cells were cotransfected with 250 ng Rous sarcoma virus-AR and 500 ng pSA61-Luc, along with increasing amount of pcDNA-Uba3 as indicated. Luciferase activity was determined 24 h after T (100 nM, solid bars) or vehicle (open bars) treatment. F, Uba3 suppresses PR-mediated transactivation. HeLa cells were cotransfected with the indicated amount of plasmid expressing human PR, 250 ng PRE-2xTK-Luc, along with or without 150 ng pcDNA-Uba3 as indicated. Luciferase activity was determined 24 h after progesterone (100 nM, solid bars) or vehicle (open bars) treatment. G, Uba3 had no effect on Elk-1-mediated transactivation in response to TGF{alpha}. Human breast cancer MDA-MB-231 cells were transfected with pFA2-Elk1, pFR-Luc, pCMV-ß-Gal, and the indicated amount of pcDNA-Uba3. After transfection, cells were treated with 10 ng/ml TGF{alpha} for 20 h. For all assays, 10 ng pCMV-ß-gal was used as internal control, and total plasmid amount was adjusted to 1 µg/well using pcDNA vector. Normalized luciferase activities [relative luciferase units (RLU)] are the means ± SD from three independent experiments. *, P < 0.05; and **, P < 0.01 compared with ligand-induced luciferase activity with receptor only.

 
To rule out the possibility that the observed suppressive effect of Uba3 on ER was specific to HeLa cells, the breast cancer MDA-MB-231 and liver carcinoma HepG2 cells were used in transient transfection assays. Consistent with the results obtained in HeLa cells, coexpression of Uba3 inhibited ER{alpha} activity in a dose-dependent manner in MDA-MB-231 cells (Fig. 5CGo). Uba3 also inhibited ER{alpha} in HepG2 cells, although to a lesser extent, using either the pS2 promoter (2xERE-pS2-Luc) or the complement C3 promoter (C3-Luc), another ER-responsive reporter construct (Fig. 5DGo). Together, these results suggest that the suppression of ER{alpha} activity by Uba3 is not cell type or promoter specific.

Although Uba3 did not interact with PR and AR in the yeast two-hybrid and in vitro GST pull-down assays, those systems do not contain the same receptor-interacting protein found in mammalian cells, some of which may be involved in the tripartite interactions between steroid receptors, coregulators, and ligand (1, 2, 3, 4). Thus, it was pertinent to know whether Uba3 could affect PR or AR activity in mammalian cells, and we examined the effect of Uba3 on AR- and PR-mediated transactivation in HeLa cells. Similar to ER, coexpression of increasing amounts of Uba3 resulted in a gradual suppression of AR-mediated gene expression in the presence of T (Fig. 5EGo). Uba3 also exhibited a significant inhibition of PR activity in the presence of progesterone (Fig. 5FGo). These results indicated that Uba3 might represent a mechanism to attenuate the transcription activities of steroid hormone receptors. In contrast to what was observed with the steroid hormone receptors, Uba3 had no effect on the transcriptional activity of TGF{alpha}-induced Elk-1 (Fig. 5GGo), a growth factor-regulated transcription factor (49), or expression of the control plasmid, pCMV-ß-gal (data not shown). Collectively, these observations suggest that Uba3 does not inhibit transcription in general.

To further explore the effect of Uba3 on steroid receptor function, we tested whether Uba3 could counteract the transcriptional enhancement mediated by known steroid receptor coactivator. HeLa cells were cotransfected with a constant amount of pcDNA-SRC-1 and increasing amounts of pcDNA-Uba3 (Fig. 6AGo) or vice versa (Fig. 6BGo). Estrogen-mediated reporter gene expression was enhanced up to 4- to 5-fold by SRC-1, confirming its coactivator activity and agreeing with previous reports on the effects of SRC-1 in this type of assay (50). Coexpression of increasing amounts of Uba3 inhibited (P < 0.01) ER transcriptional activity in the presence of SRC-1 (Fig. 6AGo). In contrast, increasing the dose of SRC-1 did not reverse the inhibitory effectiveness of Uba3 (Fig. 6BGo), suggesting that Uba3-mediated suppression on ER is not due to a simple competition with SRC-1 for ER binding.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 6. Uba3 Suppresses SRC-1-Mediated Enhancement of ER Transcriptional Activity

HeLa cells were transfected with 10 ng hER{alpha}, 250 ng 2xERE-pS2-Luc, and 10 ng pCMV-ß-gal, along with either a constant amount of pc-DNA-SRC-1 (100 ng) plus increasing amount of pcDNA-Uba3 as indicated (A) or a constant amount of Uba3 (150 ng) plus increasing amount of pcDNA-SRC-1 as indicated (B). Total plasmid amount was adjusted to 1 µg/well using pcDNA vector. The transfected cells were treated with 10 nM E2 or vehicle for 24 h and subjected to luciferase assay. Normalized luciferase activities [relative luciferase units (RLU)] are the means ± SD from three independent experiments. *, P < 0.05; and **, P < 0.01 compared with SRC-1-mediated enhancement of ER activity (black bars).

 
To study the dynamics of Uba3-mediated suppression of steroid receptor transactivation function, HeLa cells were cotransfected with 150 ng pcDNA-Uba3 in the absence or presence of 75 ng pcDNA-SRC-1, and luciferase assays were performed at various time points after E2 treatment. Expression of Uba3 resulted in a time-dependent suppression of ER-mediated transactivation (Fig. 7Go). At 12 h after estrogen treatment, Uba3 showed no effect on E2-induced reporter gene expression in the presence of SRC-1; however, at 18 and 24 h, a substantial suppressive effect of Uba3 was observed. In the absence of SRC-1, Uba3 inhibited estrogen-induced reporter gene expression by 20% at 12 h and 50% at 24 h. The effect of the known corepressor REA (repressor of ER) (51) was used for comparison in this experiment. REA is a specific corepressor of ligand-activated ER and at least partially inhibits ER transcriptional activity by competing with SRC-1 for ER interaction (52, 53). In contrast to what was observed for Uba3, REA completely inhibited ER{alpha} transcriptional activity in the presence of SRC-1 12, 18, and 24 h after E2 treatment. Collectively, results of transient transfection assays suggest that Uba3 inhibits steroid receptor-mediated gene expression by promoting the termination of transcription rather than interfering with the initiation of transactivation.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Time-Dependent Inhibition of ER Activity by Uba3

HeLa cells were cotransfected with 10 ng hER{alpha}, 250 ng 2xERE-pS2-Luc, and 10 ng pCMV-ß-gal, along with or without 75 ng SRC-1 and/or 150 ng Uba3 as indicated. Total plasmid amount was adjusted to 1 µg/well using pcDNA vector. Luciferase activity was determined 12 h, 18 h, and 24 h after E2 (10 nM) treatment. REA (150 ng) was used as a positive control to show the repressive effect. For all assays, normalized luciferase activity [relative luciferase units (RLU)] is the means ± SD from three independent experiments.

 
Neddylation Activity Is Required for Uba3-Mediated Suppression of ER Transactivation Function
Our observations in mammalian cells established that Uba3 can function as an inhibitor to suppress steroid receptor-mediated transactivation. Because Uba3 is the catalytic subunit of NEDD8-activating enzyme, we hypothesized that neddylation is involved in restricting receptor activity. We first examined whether the enzyme activity of Uba3 was required to suppress ER by expressing an inactive mutant of Uba3, Uba3C216S, which has a point mutation on the active cysteine that is essential for neddylation activity (54). In contrast to wild-type Uba3, Uba3C216S did not inhibit ER{alpha}mediated reporter gene expression in the absence (Fig. 8AGo) or presence of SRC-1 (Fig. 8BGo). To exclude the possibility that the absence of suppressive activity of Uba3C216S was due to the inefficient expression of the mutant protein, the expression of Uba3C216S, which is hemagglutinin (HA) tagged, was confirmed by immunoblotting (Fig. 8AGo, inset). These results suggested that the neddylation activity of Uba3 is required to suppress steroid receptor-mediated transcription.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 8. Neddylation Activity Is Required for Uba3 to Suppress ER-Mediated Transactivation

HeLa cells were cotransfected with 10 ng hER{alpha}, 250 ng 2xERE-pS2-Luc, and 10 ng pCMV-ß-gal, along with indicated amount of pcDNA-Uba3, pcDNA-HA-Uba3C216S, pcDNA-c-myc-APP-BP1, pcDNA-c-myc-APP-BP1 (443–534), or pcDNA-Ubc12. Total plasmid amount was adjusted to 1 µg/well using pcDNA vector. Luciferase activity was determined 24 h after E2 treatment. A, Uba3C216S does not suppress ER activity. Inset shows the expression of Uba3C216 by immunoblotting with anti-HA antibody. B, Uba3C216S does not affect SRC-1-mediated transcriptional enhancement. C, The 443–534 fragment of APP-BP1 reverses Uba3-mediated suppression of ER activity. D, Effect of Ubc12 on ER activity and Uba3 function. For all assays, normalized luciferase activity [relative luciferase units (RLU)] is the mean ± SD from three independent experiments.

 
Uba3 dimerizes with amyloid precursor protein-binding protein (APP-BP1) to form the heterodimeric activating enzyme of NEDD8. To further confirm the role of the neddylation pathway in Uba3-mediated suppression of steroid receptor activity, we performed cotransfection assays using full-length APP-BP1 as well as a fragment of APP-BP1 containing the putative binding site for Uba3. The 443–534 fragment of APP-BP1 has been reported to inhibit NEDD8 activation by competing with APP-BP1 to form an inactive complex with Uba3 (54). The expression of the 443–534 fragment alone had no effect on ER activity (Fig. 8CGo). However, when cotransfected with Uba3, the 443–534 fragment partially reversed Uba3 suppression of ER-mediated transactivation in a dose-dependent manner (Fig. 8C). In contrast, full-length APP-BP1, which slightly inhibited ER activity when expressed alone, had no effect on Uba3-mediated suppression of ER (Fig. 8C). The expression of full-length APP-BP1 and the 443–534 fragment, both of which were c-myc tagged, was confirmed by immunoblotting (Fig. 8CGo, inset). We also tested the effect of Ubc12, the only known conjugating enzyme for NEDD8 pathway (41), on ER-mediated transactivation. Expression of Ubc12 alone in HeLa cells inhibited ER activity in a dose-dependent manner (Fig. 8DGo), but to a lesser extent compared with Uba3, perhaps due to enhancement of the enzymatic activity of endogenous Uba3. When coexpressed with Uba3, Ubc12 had no effect on Uba3-mediated suppression of ER transactivation. Together, these results suggest that neddylation is involved in restricting steroid receptor activity, and receptor-Uba3 interactions appear to be a limiting factor.

Expression of Uba3 and NEDD8 in Tissues and Cell Lines
Expression of Uba3 and NEDD8 in various tissues was examined using Northern blot analysis. Uba3 was expressed as a single mRNA of 2.3 kb in all tissues examined; however, a differential expression pattern of Uba3 was observed among the tissues examined (Fig. 9Go, top), Uba3 mRNA levels varied, with higher expression in uterus, ovary, skeletal muscle, and neural tissues, and lower expression in kidney, intestine, stomach, and liver. NEDD8 mRNA was detected as a single 1.2-kb band in all tissues examined, with higher expression in ovary, skeletal muscle, and neural tissues and lower expression in intestine and stomach (Fig. 9Go, middle). We cloned Uba3 from the uterus, and it was of interest to investigate the cell type pattern of Uba3 expression in this tissue. In situ hybridization analysis showed silver grains corresponding to Uba3 mRNA in all three uterine compartments (epithelia, stroma, and myometrium); however, silver grains for Uba3 were more abundant in the luminal and glandular epithelial cells compared with the stroma and myometrium, indicating that Uba3 mRNA levels vary among the uterine compartments (Fig. 9Go, inset).



View larger version (68K):
[in this window]
[in a new window]
 
Figure 9. Expression of Uba3 and NEDD8 in Rat Tissues

Total RNA (20 µg) from indicated rat tissues was run on a denaturing gel, transferred to a nylon membrane, and hybridized with 32P-labeled cDNA fragments of rat Uba3 (top) and human NEDD8 (middle). Total RNA was visualized by staining with ethidium bromide (bottom panel). Inset (right) shows the localization of Uba3 mRNA in rat uterus using in situ hybridization. Distinct expression of Uba3 mRNA can be seen in the luminal and glandular epithelial endometrium.

 
Northern blotting was also used to examine Uba3 and NEDD8 expression in normal and cancer cell lines (Fig. 10Go). High expression of Uba3 mRNA levels was observed in the uterine cancer Ishikawa and HEC-1A cell lines and cervical cancer HeLa cells. Moderate expression of Uba3 was observed in normal human mammary epithelium MCF-10A, breast cancer MCF-7 and MDA-MB-231 cells, and liver cancer HepG2 cells. Low or no Uba3 expression was detected in breast cancer MDA-MB-435 and MDA-MB-468 cells. Interestingly, NEDD8 mRNA levels tended to follow a similar pattern as those of Uba3 in these cell lines.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 10. Expression of Uba3 and NEDD8 in Human Cell Lines

Total RNA (20 µg) from indicated human cell lines was run on a denaturing gel, transferred to a nylon membrane, and hybridized with 32P-labeled cDNA fragments of rat Uba3 (top) and human NEDD8 (middle). 36B4 probe was used as a loading control (bottom). The bar graph shows the relative expression levels of Uba3 and NEDD8 in different tumor cell lines compared with normal MCF-10A cells.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Proteins that interact with and decrease the transcriptional activity of agonist-activated steroid receptors have only recently been discovered (36, 51, 55, 56, 57). We have identified a new inhibitor of steroid receptor transactivation function, Uba3. Coexpression of Uba3 in mammalian cells significantly represses reporter gene expression mediated by steroid receptors, including ER, AR, and PR. In contrast, Uba3 had no effect on a growth factor-inducible transcription factor, Elk-1, or the expression of pCMV-ß-gal, thereby excluding the possibility that Uba3 inhibits transcription in general. Our observations on ER demonstrate that Uba3 does not interfere with the initiation of receptor-mediated transcriptional activity; rather, it inhibits receptor activity in a time-dependent fashion. Thus, we propose that Uba3 suppresses steroid receptor activity by promoting the termination of receptor-mediated gene transcription rather than interfering with the initial events, which would include receptor binding to the steroid hormone response element and subsequent functional interactions of activated receptor with necessary adapter and coactivator proteins (3).

Most known corepressors inhibit steroid receptor activity by blocking the initiation of receptor-mediated transactivation. For example, REA and FKHR inhibit the assembly of active ER transcription complex by competing with SRC-1 coactivators for ER binding (51, 53, 57), and MAT1 has been shown to silence ERE by recruiting histone deacetylases (56). The novel feature of Uba3, i.e. that it affects the duration but not the initiation of ER-mediated transactivation, indicates a distinct inhibitory mechanism. Uba3 possesses intrinsic enzyme activity involved in neddylation, a protein modification pathway that plays an important role in ubiquitin-mediated proteolysis (58, 59, 60). Our results show that neddylation activity is essential for Uba3-mediated suppression of ER, and we hypothesize that Uba3 and the neddylation pathway in general play a role in restricting steroid receptor action by promoting receptor turnover.

Like Uba3, several other steroid receptor-interacting proteins have enzymatic activities related to the ubiquitin-proteasome pathway, including E6-AP (34), SUG1 (61), and BRCA1 (36, 37, 38); however, the precise role of their ubiquitin-proteasome-related activities in regulation of steroid receptor function remains to be established. Both E6-AP and SUG1 have multiple separable functions and may regulate steroid receptor activity through nonproteolytic mechanisms. Studies with mutant forms of E6-AP showed that the ubiquitin-protein ligase activity is not required for E6-AP to coactivate PR (34). SUG1 has been shown to be an integral component of the polymerase II holoenzyme (62) and possess DNA helicase activity (35) that might mediate its coactivation activity. To date, the only established function of Uba3 is to activate NEDD8, and the targets of NEDD8, other than cullin family proteins, are unknown. Cullins are essential components of a group of E3 ubiquitin-protein ligases, including SCF (Skp1-Cdc53-F-box protein) (63, 64, 65) and von Hippel-Lindau tumor suppressor protein-elongin B-elongin C complex (66). Accumulated evidence suggests that NEDD8 modification of the cullin subunit plays a crucial role in regulating the ligase activity of cullin-based ubiquitin protein ligase complexes (58, 59, 60, 67, 68). Our results in HeLa cells (Figs. 5Go and 8Go) indicate that the level of Uba3 is the limiting factor in neddylation-associated suppression of receptor activity. We therefore hypothesize that, upon binding to ligand-activated steroid receptor, Uba3, together with APP-BP1 and Ubc12, recruits and activates a cullin-based ubiquitin-protein ligase, which, in turn, targets receptor for ubiquitin/proteasome degradation. Alternatively, Uba3, together with APP-BP1 and Ubc12, may catalyze the direct neddylation of ligand-activated steroid receptors, leading to a rapid attenuation of receptor transcriptional activity. An analogous finding that AR can be covalently modified by ubiquitin-like SUMO-1 and the sumoylation appears to inhibit the AR activity (69) supports the hypothesis. Ubiquitin-associated pathways (neddylation, sumoylation) may represent a general mechanism to attenuate steroid hormone receptor activity.

Lonard et al. (33) has reported that the coactivator-binding surface of ER is important for ligand-mediated degradation of the receptor. Consistent with this observation, two distinct NR-interacting domains or LXXLL motifs are found in Uba3, which could mediate the ligand-dependent interaction with ER. However, it seems likely that the binding site(s) for Uba3 in the LBD of ER is distinct from that used by SRC-1, because Uba3 has no apparent effect on the ER-SRC-1 interaction. Further studies are required to identify the sequences in both ER and Uba3 that are essential for Uba3-mediated suppression. Interestingly, although transient transfection experiments demonstrated that Uba3 also inhibited gene expression mediated by AR and PR, the results from yeast two-hybrid and in vitro GST pull-down assays did not suggest that Uba3 physically interacts with AR or PR. One possible explanation is that additional integrating proteins are required that are absent when using yeast or GST pull-down systems. Further experiments to determine whether Uba3 directly interacts with AR and PR in mammalian cells are necessary.

We observed Uba3 expression in several different rat tissue types; this observation is in agreement with the broad tissue distribution of human Uba3 (41). In the uterus, in situ hybridization analysis revealed distinct Uba3 expression in the uterine luminal epithelial cells, the same cell type in which ER{alpha} is rapidly degraded in response to estrogen stimulation (39). Expression of NEDD8 was also observed in all rat tissues examined, but NEDD8 mRNA levels varied and appeared to follow a similar pattern as Uba3. We also examined hormone-dependent human cancer cell lines for steady-state Uba3 and NEDD8 mRNA expression, and a further association of Uba3 and NEDD8 was evident. Interestingly, low to no Uba3 and NEDD8 expression was seen in two of the ER-negative breast cancer cells, whereas relatively higher expression was detected in ER-positive MCF-10, MCF-7, Hec-1A, and Ishikawa cells. Further studies on the correlation between the dynamics of steroid turnover and expression levels of Uba3 and NEDD8 will provide insights into the mechanism of neddylation in restricting steroid receptor activity.

In summary, our results suggest a potential role for ubiquitin-like NEDD8 pathway in restricting steroid receptor activity and thus steroid hormone action. Further studies on the biological relevance of Uba3 in hormone-dependent cell proliferation may reveal a role of Uba3 in the development and progression of cancers, including uterine and breast cancer. In addition, better understanding of neddylation in hormone action may lead to novel insights of therapeutic intervention.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals, Tissues, and Cell Lines
The local animal care and use committee approved use of and procedures performed on animals. Mature Sprague Dawley rats (n = 30) were ovariectomized under general anesthesia. Two weeks later, uterine horns were collected and trimmed of fat and mesentery. Epithelial RNA of the uterine horns was isolated as described previously (70). Polyadenylated RNA [poly(A)+] was enriched by using a Poly(A) Quick mRNA isolation kit (Stratagene, La Jolla, CA). Northern analysis confirmed that the RNA was highly enriched for epithelial transcripts, as indicated by its content of cytokeratin mRNA. The human cervical carcinoma cell line, HeLa, and the breast cancer cell lines, MCF-7 and MDA-MB-231, were purchased from ATCC (Manassas, VA). The MCF-10A cells, derived from fibrocystic neoplasia-free breast tissue from a donor with no familial history of breast cancer (71), were obtained from Dr. G. Sledge (Indiana University School of Medicine, Indianapolis, IN). The HepG2 liver carcinoma cells, Ishikawa, and HEC-1A uterine cancer cell lines were obtained from Dr. S. Hyder (University of Texas Health Sciences Center, Houston, TX). The breast cancer MDA-MB-435 and MDA-MB-468 cell lines were obtained from Dr. H. Nakshatri (Department of Surgery, Indiana University School of Medicine, Indianapolis, IN), and their growth conditions have been described previously (72). The remaining cell lines were maintained in DMEM supplemented with 10% FBS.

Plasmid Construction
A cDNA library was constructed from the uterine luminal epithelial poly (A)+ RNA and ligated into pAD-GAL4 phagemid of the HybridZAP Two-Hybrid cDNA Gigapack Cloning Kit (Stratagene) to generate the primary {lambda} library for amplification and screening. The Hybrid ZAP{lambda} library was converted to a pAD-GAL4 phagemid library by in vivo mass excision. The bait plasmid for the yeast two-hybrid system (pBD-GAL4-ER{alpha}AF2) was constructed by inserting rat ER{alpha}AF2 DNA fragment, corresponding to amino acids 290–600, into pBD-GAL4 Cam phagemid vector. The cDNA encoding the bait ER{alpha}AF2 was prepared by PCR (sequence from 944–1,876; GenBank accession no. X61098) with the following primer pair: RERARI944 5'-CGGAATTCATGAGAGCTGCCAACCTTTGG-3' (upper strand) and RERAXHO1876 5'-CCGCTCGAGCGGTCAGATGGTGTTGGGGAAGC-3' (lower strand). The plasmid was sequenced to confirm it was in the correct reading frame.

To generate the estrogen-responsive luciferase reporter construct for transient transfection assays in mammalian cells, a synthesized minimal promoter region of the pS2 gene, nucleotides -91 to +10 (73), was ligated into the HindIII site (blunted by Klenow reaction) of the pGL3 luciferase reporter vector (Promega Corp., Madison, WI). A double-stranded oligonucleotide containing two consensus ERE sites (GTACCAGGTCACAGTGACCTGATCAGCTAGTCAGGTCACAGTGACCTTCGTAC) was then ligated into the blunted KpnI site of the pS2-luc to make a 2xERE-pS2-luc reporter gene. The Uba3 expression plasmid was constructed by inserting full-length Uba3 cDNA into the EcoRI and XhoI sites of pcDNA3+ (Invitrogen, Carlsbad, CA). pCMV-ERß was generated using full-length cDNA cloned from rat prostate library (CLONTECH Laboratories, Inc., Palo Alto, CA). The ER-responsive C3 promoter construct (C3-Luc) and PR-responsive construct (PRE-2xTK-Luc) was obtained from Dr. D. P. McDonnell (Duke University Medical School, Durham, NC). The AR-responsive construct (pSA61-Luc) was from Dr. S. Khan (University of Cincinnati, Cincinnati, OH). The ER{alpha} (HEGO)- and human PRB-expressing plasmids were obtained from Dr. P. Chambon (Institut de Génétique et de Biologie Moléculaire et Cellulaire, Strasbourg, France). Rous sarcoma virus-AR was from Dr. C. Kao (Indiana University). pcDNA-SRC-1 was obtained from Dr. T-P. Yao (Dana-Farber Cancer Institute, Boston, MA). pcDNA-HA-Uba3C216S, pcDNA-c-myc-APP-BP1 and pcDNA-c-myc-APP-BP1443–534 were obtained from Dr. R. Neve (Harvard Medical School, Boston, MA). pcDNA-REA was obtained from Dr. B. Katzenellenbogen (University of Illinois, Champagne-Urbana, IL). Elk-response constructs (PathDetect Trans-Reporter, Stratagene) and pCMV-ß-gal (Promega Corp.) were purchased.

Yeast Two-Hybrid Reporter Assays
The yeast two-hybrid screening was conducted according to the manufacturer’s instructions (Hybrid cDNA Gigapack Cloning Kit, Stratagene). Briefly, the yeast strain J69–4A (Mat; trp1–901; leu2–3, 112; ura3–52; his3–200; gal4; gal80; Ade2::GAL2p-ADE2; LYS2::GAL1p-HIS3; met2::GAL7p-Lacz)was cotransformed with the pBD-GAL4-ER{alpha}AF2 and the cDNA pAD-Gal4 library plasmids by using the lithium acetate method. Approximately 1 x 106 yeast transformants were plated on synthetic minimal medium agar lacking leucine, tryptophan, histidine, and adenine for 6 d at 30 C. ER-interacting clones were identified by their ability to grow in the selective plates and to activate LacZ reporter gene as indicated by the expression of ß-gal.

To investigate ligand-dependent and -independent interaction between wild-type Uba3 with the AF2 domain of ER, AR, and PR, we used the yeast two-hybrid system, similar to what we described previously (74), except that vectors pAD-GAL4- and pBD-GAL4-(HybridZAP Two-Hybrid cDNA Gigapack Cloning Kit, Stratagene) were used. The full-length Uba3 cDNA was inserted into pAD-GAL4 vector. The yeast strain J69–4A was transformed with pBD-GAL4-ER{alpha}AF2 and pAD-GAL4-Uba3 and plated on SC/Leu,Trp,His,Ade/X-Gal agar plates containing 10-8 M E2, 10-6 M Tam, or vehicle. To measure the interaction of Uba3 with AR or PR, pBD-GAL4 construct expressing the AF2 domain of AR or PR was used instead of pBD-GAL4-ER{alpha}AF2 in J69–4A cells. cDNA of AR AF2 domain was cloned from a rat prostate library (CLONTECH Laboratories, Inc.) and that of the PR AF2 domain was cloned from the construct expressing the human full-length PR (Dr. P. Chambon). To measure the strength of the interaction of Uba3 with the receptors, the ß-gal expression levels in liquid yeast cultures from three independent transformants were determined using a chemiluminescent reporter assay (PE Applied Biosystems, Foster City, CA).

GST Pull-Down Assay
GST pull-down assays were performed as described by Shibata et al. (75). To fuse Uba3 with GST, the EcoRI-SalI fragment of Uba3 from pAD-GAL4-Uba3 was subcloned into plasmid pGEX-6P-1 (Amersham Pharmacia Biotech, Piscataway, NJ) and subjected to DNA sequencing to confirm it was in the correct reading frame. The GST-tagged Uba3 was expressed in DH5{alpha} cells and purified as described by Cavailles et al. (76). Briefly, overnight cultures of DH5{alpha} cells containing the plasmid pGEX-6P-1-GST-Uba3 were diluted (1:20), cultured in fresh medium for 2 h, and treated with 0.1 mM isopropyl ß-D-thiogalactoside for 3 h. The bacteria were collected by centrifugation and lysed in NETN buffer containing 0.5% Nonidet P-40, 1 mM EDTA, 20 mM Tris (pH 8.0), 100 mM NaCl, and protease inhibitors. GST-Uba3 was purified on glutathione-Sepharose beads (Amersham Pharmacia Biotech). The cDNAs for full-length ER{alpha}, ERß, and PR were subcloned into pGEM-7Z (Promega Corp.), and these were used in an in vitro translation kit (Promega Corp.) to produce protein labeled with [35S]methionine. The [35S]-labeled ER{alpha}, ERß, or PR was incubated with the glutathione-bound GST-Uba3 in binding buffer in the absence or presence of corresponding ligands, or vehicle overnight at 4 C. After intensive washing, Uba3-bound protein was eluted and separated on a 10% SDS-polyacrylamide gel. The [35S]-labeled proteins in the gel were visualized by autoradiography.

Transient Transfection Assays
HeLa, MDA-MB-231, and HepG2 cells were maintained in DMEM with 10% FBS. Two days before transfection, approximately 1 x 105 cells per well were seeded in 12-well dishes in phenol red-free DMEM containing 5% dextran-coated charcoal-stripped serum (HyClone Laboratories, Inc., Logan, UT). Cells were transfected with equal amount of total plasmid DNA (adjusted by corresponding empty vectors) by using LipofectAMINE Plus Reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer’s guidelines. Five hours later, the DNA/LipofectAMINE mixture was removed, and cells were placed in phenol red-free media containing 5% stripped serum and appropriate hormone or vehicle. Cell lysates were prepared 12–24 h after hormone treatment using reporter lysis buffer (Promega Corp.). Luciferase activity was determined using the Promega Corp. Luciferase Assay System and the T20/20 Luminometer (Turner Designs, Sunnyvale, CA). All cells were cotransfected with pCMV-ß-gal and normalized using ß-gal activity to correct for transfection efficiency. All experiments were performed in triplicate and repeated at least twice.

Northern Blot Analysis
Total cellular RNA was isolated from various rat organs and cultured cells using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH). Northern blot analysis for Uba3 and NEDD8 was performed as described previously (27) and repeated on two separate membranes. The 36B4 cDNA, a constitutively expressed gene encoding a ribosomal protein (77), was used to assess loading differences between samples.

In Situ Hybridization Analysis
Cryosections (10 µm) form rat uteri were mounted on slides, fixed in 4% paraformaldehyde in 1x PBS, dehydrated, dried, and stored at -80 C, as described previously (27, 78, 79, 80). 35S-Labeled antisense and sense cRNA (1 x 104 to 1 x 105 cpm/µl) probes in hybridization buffer were heat denatured and added to tissue sections (15 µl/coverslip). After incubation at a hybridization temperature of 55 C for 16 h, tissue sections were washed and treated with RNases to remove unhybridized cRNA probe, dried, dipped in Ilford Nuclear Research Emulsion K5 (Polysciences, Inc., Warrington, PA), and then stored at 4 C for 6 d.

Statistical Analyses
Assays were done in triplicate, and quantitation of three independent experiments was performed. Statistical analysis was done using ANOVA. When a significant P value (P < 0.01) was found, t tests assuming unequal variance were performed to compare individual treatment groups. All error bars represent SD from the mean.


    FOOTNOTES
 
This work was supported by NIH Grants CA-74748 (K.P.N.) and HD-37025 (R.M.B.), The Walther Cancer Institute, and funding for Students in Academic Medicine (2T35HL07584-16).

1 M.F. and X.L. contributed equally to this work. Back

Abbreviations: AF2, Activation function 2; AIB1, amplified in breast cancer 1; APP-BP1, amyloid precursor protein-binding protein; ERE, estrogen-responsive element; ß-gal, ß-galactosidase; GST, glutathione-S-transferase; HA, hemagglutinin; NEDD, neural precursor cell-expressed developmentally down-regulated; NR, nuclear receptor; RAC3, receptor-associated coactivator 3; REA, repressor of ER activity; SRC, steroid receptor coactivator; SUG, suppressor for galactose; T, testosterone; Tam, 4-hydroxytamoxifen; Uba, ubiquitin-activating enzyme.

Received for publication June 18, 2001. Accepted for publication October 22, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ham J, Parker MG 1989 Regulation of gene expression by nuclear hormone receptors. Curr Opin Cell Biol 1:503–511[CrossRef][Medline]
  2. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  3. Tsai MJ, O’Malley BW 1994 Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451–486[CrossRef][Medline]
  4. Klinge CM 2000 Estrogen receptor interaction with co-activators and co-repressors. Steroids 65:227–251[CrossRef][Medline]
  5. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O’Malley BW 1998 Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene. Science 279:1922–1925[Abstract/Free Full Text]
  6. Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz KB 1997 The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol 11:693–705[Abstract/Free Full Text]
  7. Kurebayashi J, Otsuki T, Kunisue H, Tanaka K, Yamamoto S, Sonoo H 2000 Expression levels of estrogen receptor-{alpha}, estrogen receptor-ß, coactivators, and corepressors in breast cancer. Clin Cancer Res 6:512–518[Abstract/Free Full Text]
  8. Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter, G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  9. List H-J, Lauritsen KJ, Reiter R, Powers C, Wellstein A, Riegel AT 2001 Ribozyme-targeting demonstrates that the nuclear receptor coactivator AIB1 is a rate limiting factor for estrogen-dependent growth of human MCF-7 breast cancer cells. J Biol Chem 276:23763–23768[Abstract/Free Full Text]
  10. Webb P, Lopez GN, Greene GL, Baxter JD, Kushner PJ 1992 The limits of the cellular capacity to mediate an estrogen response. Mol Endocrinol 6:157–167[Abstract]
  11. Cidlowski JA, Muldoon T 1974 Estrogenic regulation of cytoplasmic receptor populations in estrogen-responsive tissues of the rat. Endocrinology 95:1621–1629[Medline]
  12. Cidlowski JA, Muldoon TG 1978 The dynamics of intracellular estrogen receptor regulation as influenced by 17ß-estradiol. Biol Reprod 18:234–246[Abstract]
  13. Horwitz KB, McGuire WL 1978 Nuclear mechanisms of estrogen action. Effects of estradiol and anti-estrogens on estrogen receptors and nuclear receptor processing. J Biol Chem 253:8185–8191[Free Full Text]
  14. Copland JA, Smanik EJ, Muldoon TG 1987 Discrete early changes in cellular subpopulations of rat uterine and anterior pituitary estrogen receptors in response to acute exposure to exogenous estradiol. J Steroid Biochem 26:723–731[CrossRef][Medline]
  15. Saceda M, Lippman ME, Chambon P, Lindsey RL, Ponglikitmongkol M, Puente M, Martin MB 1988 Regulation of the estrogen receptor in MCF-7 cells by estradiol. Mol Endocrinol 2:1157–1162[Abstract]
  16. Saceda M, Lippman ME, Lindsey RK, Puente M, Martin MB 1989 Role of an estrogen receptor-dependent mechanism in the regulation of estrogen receptor mRNA in MCF-7 cells. Mol Endocrinol 3:1782–1787[Abstract]
  17. Read LD, Greene GL, Katzenellenbogen BS 1989 Regulation of estrogen receptor messenger ribonucleic acid and protein levels in human breast cancer cell lines by sex steroid hormones, their antagonists, and growth factors. Mol Endocrinol 3:295–304[Abstract]
  18. Ree AH, Landmark BF, Eskild W, Levy FO, Lahooti H, Jahnsen T, Aakvaag A, Hansson V 1989 Autologous down-regulation of messenger ribonucleic acid and protein levels for estrogen receptors in MCF-7 cells: an inverse correlation to progesterone receptor levels. Endocrinology 124:2577–2583[Abstract]
  19. Berthois Y, Dong XF, Roux-Dossetto M, Martin PM 1990 Expression of estrogen receptor and its messenger ribonucleic acid in the MCF-7 cell line: multiparametric analysis of its processing and regulation by estrogen. Mol Cell Endocrinol 74:11–20[CrossRef][Medline]
  20. Kaneko KJ, Furlow JD, Gorski J 1993 Involvement of the coding sequence for the estrogen receptor gene in autologous ligand-dependent down-regulation. Mol Endocrinol 7:879–888[Abstract]
  21. Rosser M, Chorich L, Howard E, Zamorano P, Mahesh VB 1993 Changes in rat uterine estrogen receptor messenger ribonucleic acid levels during estrogen- and progesterone-induced estrogen receptor depletion and subsequent replenishment. Biol Reprod 48:89–98[Abstract]
  22. Zhou Y, Chorich LP, Mahesh VB, Ogle TF 1993 Regulation of estrogen receptor protein and messenger ribonucleic acid by estradiol and progesterone in rat uterus. J Steroid Biochem Mol Biol 46:687–698[CrossRef][Medline]
  23. Borras, M, Hardy L, Lempereur F, el Khissiin AH, Legros N, Gol-Winkler R, Leclercq G 1994 Estradiol-induced down-regulation of estrogen receptor. Effect of various modulators of protein synthesis and expression. J Steroid Biochem Mol Biol 48:325–336[CrossRef][Medline]
  24. Pink JJ, Jordan VC 1996 Models of estrogen receptor regulation by estrogens and antiestrogens in breast cancer cell lines. Cancer Res 56:2321–2330[Abstract/Free Full Text]
  25. Santagati S, Gianazza E, Agrati P, Vegeto E, Patrone C, Pollio G, Maggi A 1997 Oligonucleotide squelching reveals the mechanism of estrogen receptor autologous down-regulation. Mol Endocrinol 11:938–949[Abstract/Free Full Text]
  26. Lee YJ, Gorski J 1998 Estrogen receptor down-regulation is regulated noncooperatively by estrogen at the transcription level. Mol Cell Endocrinol 137:85–92[CrossRef][Medline]
  27. Nephew KP, Ray S, Hlaing M, Ahluwalia A, Wu SD, Long X, Hyder SM, Bigsby RM 2000 Expression of estrogen receptor coactivators in the rat uterus. Biol Reprod 63:361–367[Abstract/Free Full Text]
  28. Stenoien DL, Patel K, Mancini MG, Dutertre M, Smith CL, O’Malley BW, Mancini MA 2001 FRAP reveals that mobility of oestrogen receptor-{alpha} is ligand- and proteasome-dependent. Nat Cell Biol 3:15–23[CrossRef][Medline]
  29. Molinari E, Gilman M, Natesan S 1999 Proteasomemediated degradation of transcriptional activators correlates with activation domain potency in vivo. EMBO J 18:6439–6447[CrossRef][Medline]
  30. Lange CA, Shen T, Horwitz KB 2000 Phosphorylation of human progesterone receptors at serine-294 by mitogen-activated protein kinase signals their degradation by the 26S proteasome. Proc Natl Acad Sci USA 97:1032–1037[Abstract/Free Full Text]
  31. Kopf E, Plassat JL, Vivat V, de The H, Chambon P, Rochette-Egly C 2000 Dimerization with retinoid X receptors and phosphorylation modulate the retinoic acidinduced degradation of retinoic acid receptors {alpha} and {gamma} through the ubiquitin-proteasome pathway. J Biol Chem 275:33280–33288[Abstract/Free Full Text]
  32. Nawaz Z, Lonard DM, Dennis AP, Smith CL, O’Malley BW 1999 Proteasome-dependent degradation of the human estrogen receptor. Proc Natl Acad Sci USA 96:1858–1862[Abstract/Free Full Text]
  33. Lonard DM, Nawaz Z, Smith CL, O’Malley BW 2000 The 26S proteasome is required for estrogen receptor-{alpha} and coactivator turnover and for efficient estrogen receptor-{alpha} transactivation. Mol Cell 5:939–948[CrossRef][Medline]
  34. Nawaz Z, Lonard DM, Smith CL, Lev-Lehman E, Tsai SY, Tsai MJ, O’Malley BW 1999 The Angelman syndrome-associated protein, E6-AP, is a coactivator for the nuclear hormone receptor superfamily. Mol Cell Biol 19:1182–1189[Abstract/Free Full Text]
  35. Fraser RA, Rossignol M, Heard DJ, Egly JM, Chambon P 1997 SUG1, a putative transcriptional mediator and subunit of the PA700 proteasome regulatory complex, is a DNA helicase. J Biol Chem 272:7122–7126[Abstract/Free Full Text]
  36. Fan S, Wang J, Yuan R, Ma Y, Meng Q, Erdos MR, Pestell RG, Yuan F, Auborn KJ, Goldberg ID, Rosen EM 1999 BRCA1 inhibition of estrogen receptor signaling in transfected cells. Science 284:1354–1356[Abstract/Free Full Text]
  37. Fan S, Ma YX, Wang C, Yuan RQ, Meng Q, Wang JA, Erdos M, Goldberg ID, Webb P, Kushner PJ, Pestell RG, Rosen EM 2001 Role of direct interaction in BRCA1 inhibition of estrogen receptor activity. Oncogene 20:77–87[CrossRef][Medline]
  38. Ruffner H, Joazeiro CA, Hemmati D, Hunter T, Verma IM 2001 Cancer-predisposing mutations within the RING domain of BRCA1: loss of ubiquitin protein ligase activity and protection from radiation hypersensitivity. Proc Natl Acad Sci USA 98:5134–5139[Abstract/Free Full Text]
  39. Nephew KP, Long X, Osborne E, Burke KA, Ahluwalia A, Bigsby RM 2000 Effect of estradiol on estrogen receptor expression in rat uterine cell types. Biol Reprod 62:168–177[Abstract/Free Full Text]
  40. Nephew KP, Osborne E, Lubet RA, Grubbs CJ, Khan SA 2000 Effects of oral administration of tamoxifen, toremifene, dehydroepiandrosterone, and vorozole on uterine histomorphology in the rat. Proc Soc Exp Biol Med 223:288–294[Abstract/Free Full Text]
  41. Gong L, Yeh ET 1999 Identification of the activating and conjugating enzymes of the NEDD8 conjugation pathway. J Biol Chem 274:12036–12041[Abstract/Free Full Text]
  42. Lammer D, Mathias N, Laplaza JM, Jiang W, Liu Y, Callis J, Goebl M, Estelle M 1998 Modification of yeast Cdc53p by the ubiquitin-related protein rub1p affects function of the SCFCdc4 complex. Genes Dev 12:914–926[Abstract/Free Full Text]
  43. Liakopoulos D, Doenges G, Matuschewski K, Jentsch S 1998 A novel protein modification pathway related to the ubiquitin system. EMBO J 17:2208–2214[CrossRef][Medline]
  44. Pozo JC, Timpte C, Tan S, Callis J, Estelle M 1998 The ubiquitin-related protein RUB1 and auxin response in Arabidopsis. Science 280:1760–1763[Abstract/Free Full Text]
  45. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  46. Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ, Baxter JD, Fletterick RJ, Yamamoto KR 1998 Structure and specificity of nuclear receptor-coactivator interactions. Genes Dev 12:3343–3356[Abstract/Free Full Text]
  47. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  48. Kuiper GJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  49. Marais R, Wynne J, Treisman R 1993 The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell 73:381–393[CrossRef][Medline]
  50. McInerney EM, Tsai MJ, O’Malley BW, Katzenellenbogen BS 1996 Analysis of estrogen receptor transcriptional enhancement by a nuclear hormone receptor coactivator. Proc Natl Acad Sci USA 93:10069–10073[Abstract/Free Full Text]
  51. Montano MM, Ekena K, Delage-Mourroux R, Chang W, Martini P, Katzenellenbogen BS 1999 An estrogen receptor-selective coregulator that potentiates the effectiveness of antiestrogens and represses the activity of estrogens. Proc Natl Acad Sci USA 96:6947–6952[Abstract/Free Full Text]
  52. Martini PG, Delage-Mourroux R, Kraichely DM, Katzenellenbogen BS 2000 Prothymosin {alpha} selectively enhances estrogen receptor transcriptional activity by interacting with a repressor of estrogen receptor activity. Mol Cell Biol 20:6224–6232[Abstract/Free Full Text]
  53. Delage-Mourroux R, Martini PG, Choi I, Kraichely DM, Hoeksema J, Katzenellenbogen BS 2000 Analysis of estrogen receptor interaction with a repressor of estrogen receptor activity (REA) and the regulation of estrogen receptor transcriptional activity by REA. J Biol Chem 275:35848–35856[Abstract/Free Full Text]
  54. Chen Y, McPhie DL, Hirschberg J, Neve RL 2000 The amyloid precursor protein-binding protein APP-BP1 drives the cell cycle through the S-M checkpoint and causes apoptosis in neurons. J Biol Chem 275:8929–8935[Abstract/Free Full Text]
  55. Oesterreich S, Zhang Q, Hopp T, Fuqua SA, Michaelis M, Zhao HH, Davie JR, Osborne CK, Lee AV 2000 Tamoxifen-bound estrogen receptor (ER) strongly interacts with the nuclear matrix protein HET/SAF-B, a novel inhibitor of ER-mediated transactivation. Mol Endocrinol 14:369–381[Abstract/Free Full Text]
  56. Mazumdar A, Wang RA, Mishra SK, Adam L, Bagheri-Yarmand R, Mandal M, Vadlamudi RK, Kumar R 2001 Transcriptional repression of oestrogen receptor by metastasis-associated protein 1 corepressor. Nat