help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shen, J. H.-C.
Right arrow Articles by Ingraham, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, J. H.-C.
Right arrow Articles by Ingraham, H. A.
Molecular Endocrinology 16 (3): 529-540
Copyright © 2002 by The Endocrine Society

Regulation of the Orphan Nuclear Receptor Steroidogenic Factor 1 by Sox Proteins

Jennifer H.-C. Shen and Holly A. Ingraham

Department of Physiology (J.H.-C.S., H.A.I.), Graduate Programs in Biomedical Sciences (J.H.-C.S.) and Developmental Biology (J.H.-C.S., H.A.I.), University of California, San Francisco, San Francisco, California 94143-0444

Address all correspondence and requests for reprints to: Dr. Holly Ingraham, Department of Physiology, Box 0444, University of California, San Francisco, 513 Parnassus Avenue, San Francisco, California 94143-0444.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroidogenic factor 1 (SF-1) is an essential factor in endocrine proliferation and gene expression. Despite the fact that SF-1 expression is restricted to specialized cells within the endocrine system, the only identified regulatory factors of SF-1 are the ubiquitously expressed E-box proteins (upstream stimulatory factors 1 and 2). Sequence examination of the SF-1 proximal promoter revealed a conserved site of AACAAAG (Sox-BS1), which matches exactly the defined consensus Sox protein binding element. Among the approximately 20 known members of the Sox gene family, we focused on Sox3, Sox8, and Sox9, based on their coexpression with SF-1 in the embryonic testis. Indeed, all three of these Sox proteins were capable of binding the proximal Sox-BS1 within the SF-1 promoter (-110 to -104), albeit with differing affinities. Of the three Sox proteins, Sox9 exhibited high-affinity binding to the Sox-BS1 element and consistently activated SF-1 promoter-reporter constructs. Mutating the Sox-BS1 attenuated SF-1 promoter activity in both embryonic and postnatal Sertoli cells, as well as in the adrenocortical cell line, Y1. Our findings, taken together with the overlapping expression profiles of Sox9 and SF-1, and the similar intersex phenotypes associated with both SOX9 and SF-1 human mutations, suggest that Sox9 up-regulates SF-1 and accounts partially for the sexually dimorphic expression pattern of SF-1 observed during male gonadal differentiation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
STEROIDOGENIC FACTOR 1 (SF-1 or Ad4BP), officially designated as NR5A1, is an orphan nuclear receptor that was originally identified as a key regulator for steroid hormone biosynthesis (1, 2). Further studies have established that SF-1 regulates multiple genes throughout the hypothalamic-pituitary-adrenal or hypothalamic-pituitary-gonadal endocrine axes (3, 4, 5). In the adult animal, SF-1 helps to maintain homeostasis of both steroid and peptide hormone action by regulating key proteins in steroid synthesis, peptide hormones, and peptide hormone receptors (5, 6). The importance of SF-1 in the endocrine system is underscored by its expression in both steroidogenic and nonsteroidogenic cell types, including gonadotropes of the anterior pituitary, cortical cells of the adrenal glands, Sertoli and Leydig cells of the testis, and theca and granulosa cells of the ovary. During early stages of endocrine organ development [embryonic d 9 (E9)–E12], loss of SF-1 compromises development of the anterior pituitary (7) and leads to adrenal and gonadal agenesis in both sexes (8). SF-1 is one of the first molecular markers to define the adrenal-gonadal primordia and is expressed in the urogenital ridge at low levels before sexual differentiation (9). During mammalian gonadal development, SF-1 appears critical for male sexual differentiation (>E12) due to its role in regulating three important male hormones: T, Müllerian-inhibiting substance (MIS) [anti-Müllerian hormone (AMH)], and insulin-like factor 3 (Insl-3) (10, 11, 12, 13). In the case of MIS, SF-1 coordinates with several other factors such as Sox9, GATA-4, and WT1 to regulate MIS expression exclusively in males (14, 15, 16). During this period of development, Sox9, GATA-4, and SF-1 exhibit a sexually dimorphic pattern of expression and are all found to be expressed in males while being repressed in the embryonic female gonad (15, 17, 18, 19). Recent genetic studies describing XY patients that are phenotypically female as a consequence of SF-1 loss-of-function mutations illustrate the importance of maintaining adequate SF-1 expression for normal male sexual differentiation (20).

Although SF-1 clearly plays crucial roles in endocrine function and male gonadal differentiation, factors that provide cell type-specific expression of SF-1 are unknown. However, several in vitro studies using the proximal SF-1 TATA-less promoter have established the importance of an E-box element (-83 to -78), which is thought to be bound by the ubiquitously expressed basic helix-loop-helix transcription factors, upstream stimulatory factors 1 and 2 (USF1 and USF2) (21, 22, 23, 24, 25). Indeed, in a variety of cell types, maximal reporter activity is observed using SF-1 promoter fragments that contain approximately 250 bp upstream of the transcriptional start site; by contrast, little additional activation is noted when fragments as large as -8 kb are used (21, 22, 23, 24, 25). Limited studies have also implicated the CAAT-box and an SP1 site in the SF-1 proximal promoter as important regulatory elements. However, these ubiquitous factors or elements seem unlikely to account for the sexually dimorphic expression of SF-1 during gonadal development.

Because the molecular mechanisms underlying tissue and cell type specificity of SF-1 expression in development have yet to be determined, our initial approach was to identify regulatory sequences that potentially mediate SF-1 expression in embryonic Sertoli cells. Previous studies have revealed high conservation of SF-1 promoter sequences among different mammalian species. Within this region, we noted a consensus sequence (AACAAAG), which would be predicted to bind HMG-box-containing proteins, such as Sox9. Because expression profiles of SF-1 and Sox9 overlap both temporally and spatially, we hypothesized that Sox9 may regulate SF-1. Indeed, SF-1 and Sox9 are both expressed in somatic cells of the testis, where up-regulation of Sox9 (E12.5) is closely followed by the up-regulation of SF-1 [E13.5 (9, 15, 17, 18)]. Moreover, at birth, expression of both SF-1 and Sox9 diminishes and, likewise, are concomitantly up-regulated before puberty (15, 26). However, Sox3 and Sox8 are expressed in the embryonic testis as well and are therefore potential candidates in regulating SF-1 (27, 28). Here, we investigated the ability of Sox3, Sox8, and Sox9 to activate the proximal SF-1 promoter in cellular assays and found that only Sox9 specifically binds and activates SF-1 proximal promoter constructs. These collective data strongly support a role for Sox9 in the regulation of SF-1 expression in testicular Sertoli cells. We show further that this newly identified Sox binding site is critical for SF-1 expression in adrenocortical tumor Y1 cells, suggesting that regulation of SF-1 by Sox proteins is conserved in other endocrine cell types.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Conservation of SF-1 Proximal Promoter Sequence
Examination of the mouse SF-1 proximal promoter region suggested the presence of a Sox binding site. To investigate this further, published SF-1 promoter sequences of human, bovine, mouse, and rat were aligned (23, 24, 25). As predicted from previously published studies, this proximal region is highly conserved (80% identity, -454 to +1) and contains an essential E-box element required for in vitro SF-1 expression. Within this highly conserved proximal promoter, we noted a Sox binding site at position -104 (AACAAAG) located just upstream from the E-box element (Fig. 1AGo). In addition, a similar, but less-conserved, Sox binding element (AACAAG) was found at position -302 (Fig. 1AGo). To determine the relative contributions of these two potential sites, we first tested SF-1 promoter activity by creating luciferase reporter constructs containing either one or two of these potential Sox binding elements (-216 to +1 or -454 to +1). Equivalent activity was observed with both SF-1 promoter constructs when tested in two heterologous cell lines that do not contain endogenous SF-1 (JEG-3 and HEK-293S) (Fig. 1BGo). In the mouse embryonic carcinoma cell line P19, which expresses low levels of SF-1, the shorter SF-1 promoter construct (mSF1–216Luc) consistently yielded higher reporter activity (Fig. 1BGo). Our results are consistent with other studies showing high activity with the very proximal SF-1 promoter in cells expressing SF-1, such as the adrenocortical tumor cell line Y1 (22, 23, 24, 25), primary Sertoli cells (21), and in cell lines that do not express SF-1, such as JEG-3 or CV-1 cells (22).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Sequence Alignment Of Human, Bovine, Mouse, and Rat of the SF-1 Proximal Promoter Region

A, A schematic of the SF-1 proximal promoter is shown with the two Sox protein binding sites (solid circles), the E-box (closed box), the transcriptional initiation site (+1), and the first three exons of SF-1 gene (open boxes). The proximal Sox-protein binding site (Sox-BS1), AACAAAG at position -104 to -110, and the less conserved distal Sox-protein binding site (Sox-BS2) of AACAAG, located at -302 to -307 are bold. The other conserved element critical for SF-1 transcription, the E-box (-78 to -83) is also bold. B, Luciferase activity of two SF-1 promoter constructs, -216 (black bars) and -454 (gray bars), is indicated as fold activation (-36pLuc, taken to be 1-fold) for three cell lines, HEK-293S, JEG-3, and P19. Activity for the control plasmid vector (-36pLuc) is also shown (white bars).

 
Sox3, Sox8, and Sox9 Are Expressed in Sertoli Cells, But Not Leydig Cells
To begin investigating which Sox proteins might regulate SF-1, we chose to focus on three rodent Sox proteins, Sox3, Sox8, and Sox9, all of which are known to be expressed in the developing gonad and adult testis (17, 18, 27, 28). Consistent with previously published data, we observed that Sox8 and Sox9 expression are restricted to Sertoli cells in developing or mature seminiferous tubules with no detectable expression noted in the interstitial Leydig cell type (Fig. 2Go). While others have detected Sox3 transcripts in the embryonic testis (27), we show here that the cellular expression of this X-linked Sox protein is colocalized with Sox8 and Sox9 and is restricted to the Sertoli cell lineage (Fig. 2Go).



View larger version (161K):
[in this window]
[in a new window]
 
Figure 2. Expression of Sox Transcripts in Mouse Testes

In situ hybridization of Sox3, Sox8, and Sox9 in embryonic male gonads (E16.5 or 16.5 d post coitus) and P35 testes is shown as dark purple staining. Sox gene expression is visualized in the developing embryonic testicular cords and in Sertoli cells of the adult seminiferous tubules (black arrows). Expression of all three Sox genes in the interstitial region containing steroidogenic Leydig cells is low or absent (white arrows).

 
Sox Proteins Bind and Activate the SF-1 Proximal Sox Binding Element
To examine whether these three Sox proteins bind to the conserved Sox binding site within the SF-1 proximal promoter, we carried out DNA binding studies using in vitro translated Sox proteins (Fig. 3AGo). DNA binding studies revealed that all three Sox proteins bound a fragment of the SF-1 promoter that spans the proximal Sox element (Sox-BS1). Whereas Sox9 bound most avidly, followed by Sox3, binding of Sox8 was barely detectable despite the high identity (>98%) in the HMG domain shared between Sox8 and Sox9 (Fig. 3BGo). Sox9 most likely binds the Sox-BS1 as a monomer given the absence of an intermediate species when wild-type and truncated Sox9 proteins are mixed in the same binding reaction (Fig. 3BGo). The ability to supershift the DNA-protein complex confirmed the authenticity of the DNA-Sox9 protein complex (Fig. 3BGo, last lane).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Binding and Activities of Sox Proteins to the Proximal SF-1 Promoter Sox-BS1 Element

A, In vitro translated Sox proteins are shown for mouse Sox3 (40 kDa), mouse Sox8 (51 kDa), and rat Sox9 (64 kDa). B, Gel mobility shift assays of Sox proteins and the SF-1 proximal promoter Sox binding site (Sox-BS1) are shown for Sox3, Sox8, and Sox9. The position of the dominant DNA-protein complex is indicated (black arrowhead), and compared with nonspecific binding with nonreacted rabbit reticulocyte lysate (Control, far left lane). Truncated Sox9 protein (Sox9tr), containing the DNA binding HMG-box (amino acids 1–216), but excluding the carboxyl transactivation domain, binds the Sox-BS1 (black arrowhead). Equal amounts of full-length and truncated Sox9 failed to exhibit an intermediate species when mixed (Sox9/Sox9tr). Supershifted Sox9-DNA complex after incubation with an anti-Flag antibody is indicated (white arrowhead). Free unbound probe is shown at the bottom. C, Relative luciferase activity of either the control luciferase reporter (-36pLuc, 0.1 µg, white bars) or the Sox-BS1 luciferase construct (SoxBS1–36pLuc, 0.1 µg, black bars) is shown after cotransfection of pCDNA3 (-) or increasing amount of Sox3, Sox8, and Sox9 (0.1, 0.3, 0.5 µg) in HEK-293S cells.

 
Next, we examined how these different binding affinities of Sox3, Sox8, and Sox9 to the Sox-BS1 correlated with functional activation. Transient transfection assays using the HEK-293S cell line, which does not express SF-1, showed no specific activation of the Sox-BS1 reporter by Sox3 or Sox8. Despite the strong activation of the SF-1 reporter construct (SoxBS1–36pLuc) observed with increasing amount of Sox8 expression plasmid, a similar and robust activation of the parent vector (-36pLuc) was also observed. Therefore, Sox8 activation of the SF-1 reporter was not dependent on the presence of the Sox-BS1 element. In contrast, significant activation of the Sox-BS1 reporter was observed with increasing amounts of Sox9 (Fig. 3CGo).

To further examine the role of Sox9 in activating the SF-1 promoter, we used endogenous SF-1 promoter sequences in cellular transfection assays. Similar to the Sox9-mediated activation of the Sox-BS1 reporter, full-length Sox9 activated the -216-bp SF-1 promoter construct (mSF1–216Luc); however, no activation was observed after addition of truncated Sox9 deleted for its transactivation domain (Sox9tr, Fig. 4AGo). We also noted weak activation of the parent reporter vector (-36pLuc) by Sox9; this is most likely due to three poorly conserved Sox binding sites located within the parent vector. To assess whether addition of the upstream Sox binding site at -302 would enhance Sox9 activation of the SF-1 promoter, we tested Sox9 activation of either the mSF1–216 or mSF1–454 reporter constructs in two cell lines, HEK-293S and JEG-3. Sox9 consistently activated SF-1 promoter constructs in both cells, but no additional activation was observed in longer SF-1 promoter constructs (Fig. 4BGo). Given that Sox3, Sox8, and Sox9 are coexpressed in embryonic Sertoli cells of the testis, we also tested the combined effects of Sox3, Sox8, and Sox9 on the SF-1 promoter. We first verified that little or no endogenous Sox3, Sox8, and Sox9 transcripts are present in HEK-293S and JEG-3 cells (Fig. 4CGo). No obvious interaction or synergism was noted after cotransfection of both Sox8 and Sox9 (Fig. 4DGo), consistent with the apparent absence of a Sox8/Sox9 heterodimer complex (data not shown). However, we observed that increasing concentrations of Sox3 antagonized Sox9-mediated activation of the SF-1 promoter, suggesting that Sox3 can compete for Sox9 binding to the SF-1 promoter. This suggestion is consistent with the fact that Sox3 lacks a strong transcription activation domain (31) but is able to bind the Sox-BS1 with relatively high affinity (refer to Fig. 3BGo).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Sox9-Mediated Activation on the SF-1 Promoter Constructs

A, The control reporter (-36pLuc, 0.1 µg, white bars) and the SF-1 promoter construct (mSF1–216Luc, 0.1 µg, black bars) were cotransfected with increasing amounts (0.1, 0.3, 0.5 µg) of full-length Sox9, truncated Sox9 (Sox9tr) in HEK-293S cells. Luciferase activity of cells transected with control expression plasmid, pCDNA3 (-), is taken as 1-fold. B, Two different mouse SF-1 promoter constructs, containing either -216 bp (mSF1–216Luc, 0.1 µg, black bars) or a longer fragment of -454 bp (mSF1–454Luc, 0.1 µg, gray bars) were cotransfected with Sox9 (0.5 µg) in either HEK-293S or JEG-3 cells. The longer SF-1 promoter construct (mSF1–454Luc) contains the additional potential Sox binding site (Sox-BS2) at position -307 to -302. C, RT-PCR results of Sox3, Sox8, and Sox9 (see Materials and Methods for primers used and conditions) are shown for HEK-293S and JEG-3 cells. RT-PCR products for ß-actin indicate the relative RNA input for each sample, and control reactions lacking cDNA template are also shown in the far right lane (-). D, SF-1 proximal promoter (mSF1–216Luc, 0.1 µg) was cotransfected with Sox3, Sox8, Sox9 (0.2 µg each), or Sox9 together with increasing amounts (0.05, 0.1, 0.2 µg) of Sox3 or Sox8 in JEG-3 cells.

 
SF-1 Promoter Mutant Activity Decreases in Primary Sertoli Cells and Y1 Cells
To confirm the importance of the proximal Sox binding site (Sox-BS1) in the SF-1 promoter, mutant reporter constructs were analyzed first in gel mobility shift assays and then in cellular transfection assays (Fig. 5Go). Two mutant sites were created: the first mutant included a point mutation (MutS1) of a critical cytidene residue within the Sox-BS1, while the second mutant introduced multiple base changes (6 of 7) in this site (MutS2) (Fig. 5AGo). As expected, competitive gel shift assays demonstrated little to no Sox9 binding to the MutS2 mutant and reduced Sox9 binding to the MutS1 (Fig. 5BGo). Next we tested the effects of Sox9 on the Sox binding site mutant reporter (MutS2) in JEG-3 cells and found that activation of the SF-1 promoter by Sox9 was markedly diminished (Fig. 5CGo). Reduction in basal activity with this same SF-1 mutant reporter construct was also observed, implying that endogenous Sox proteins contribute to basal activation of this promoter construct. Similar results were obtained in HEK-293S cells (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. The Sox-BS1 Is Required for SF-1 Promoter Activity in Both Sertoli and Adrenocortical Cells

A, Nucleotide sequences of three different mutant constructs used in our studies are shown compared with the wild-type SF-1 promoter sequence. All mutations introduced into the Sox binding site (bold) or the E-box (bold) within the SF-1 proximal promoter (MutS1, MutS2, and MutE-box) are underlined. B, Competitive gel mobility shift assays are shown using in vitro translated Sox9 protein and radioactive Sox-BS1, without (left lane) or with an excess of unlabeled wild-type, MutS1, or MutS2 double-stranded DNA. C, Relative luciferase activity is shown after cotransfection of Sox9 (0.2 µg) with wild-type Sox-BS1 (mSF1–216Luc, black bars) or a mutated Sox-BS1 (MutS2, white bars) reporter constructs (0.1 µg each) in JEG-3 cells. D, Relative reporter activities are shown for the wild-type SF-1 proximal promoter (mSF1–216Luc, taken to be 100%) and the three SF-1 promoter mutant constructs (MutS1, MutS2, and MutE-box) after transfecting primary rat Sertoli cells (E19, black bars, or P15, white bars) or Y1 adrenocortical tumor cells (gray bars).

 
Subsequently, we wanted to examine our SF-1 promoter constructs in more relevant cell lines that normally express SF-1, including embryonic and postnatal primary rat Sertoli cells, and the Y1 adrenocortical tumor cell line. In all cells tested, SF-1 promoter activity decreased significantly with both MutS1 and MutS2 reporter constructs compared with the wild-type construct, mSF1–216Luc (Fig. 5DGo). An even greater reduction in activity was noted after mutation of the E-box, as predicted from previous studies (21, 22, 23, 24, 25). These results confirm the critical role of the Sox binding site for full SF-1 activity in primary Sertoli cells and Y1 adrenocortical tumor cells.

To further identify the Sox proteins present in SF-1 expressing cells, RT-PCR was used to analyze expression of Sox3, Sox8, and Sox9 in two immortalized Leydig cell lines (MA10, R2C), adrenocortical Y1 cells, and pituitary gonadotrope cells {alpha}T3. All three of these Sox proteins are expressed in the testis and in Sertoli cells, as shown in Fig. 6Go. While Sox3 expression was not observed in any of the immortalized cell lines, Sox8 and Sox9 transcripts were found in most cell lines tested. Interestingly, Sox8 transcripts were found in rat Leydig cells, R2C, but not in mouse Leydig cells, MA10. The presence of Sox8 and Sox9 in these immortalized Leydig cells is unexpected given previous reports showing these Sox proteins to be restricted to testicular cords or tubules (17, 18, 26, 28). Our findings are most likely due to the transformed phenotype of these immortalized cells. Nonetheless, the high correlation between SF-1 and Sox9 expression in these immortalized cell lines, together with our cellular transfection data, strongly suggest Sox9 as the most likely candidate in activating SF-1.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 6. RT-PCR Analysis of Sox3, Sox8, and Sox9 in Tissues or Cell Lines Expressing SF-1

Results of RT-PCR analysis of Sox3, Sox8, and Sox9 are shown for testicular tissues and cell lines: mouse adult testes (Te), primary rat Sertoli cells (SC), rodent tumor Leydig cells (mouse MA10, rat R2C), adrenocortical tumor cells (Y1), and mouse pituitary-derived cells ({alpha}T3). RT-PCR results for ß-actin (lower panel) indicate the relative RNA input for each sample, and control reactions lacking cDNA template are also shown for each primer set in the far right lane (-).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The orphan nuclear receptor SF-1 participates in the regulation of many endocrine hormones and is essential for adrenal gland and gonadal development. Therefore, identifying factors that regulate the temporal and spatial aspects of SF-1 expression is likely to provide insight into the genetic pathways leading to endocrine organ development. To date, no cell type-specific factors have been defined to account for the complexity of SF-1 expression in the embryo or in the adult. In this study, we provide evidence that a newly identified Sox protein-binding site in the SF-1 proximal promoter is required for full SF-1 reporter expression in both immortalized cell lines and in primary Sertoli cells. Additional studies suggest that the Sox protein, Sox9, is likely to be a primary factor responsible for SF-1 transcription in embryonic testicular Sertoli cells during the early stages of male sexual differentiation.

Disruption of the conserved Sox protein-binding site (Sox-BS1) sharply attenuates the activity of SF-1 promoter reporters in postnatal and embryonic Sertoli cells where SF-1 is known to colocalize with at least three Sox proteins, Sox3, Sox8, and Sox9. In urogenital development, the precise expression profiles of Sox3 and Sox8 are unknown; however, it is established that Sox9 and SF-1 are closely linked during testicular development. For example, in mice, before sexual differentiation, SF-1 is expressed at E9 in both male and female adrenogonadal primordia and precedes Sox9 expression by several days (9, 15, 17, 18). After Sry initiates mouse testis determination at E10.5, both Sox9 and SF-1 are up-regulated in males at E12.5 and E13.5, respectively. Up-regulation of Sox9 and SF-1 precedes MIS expression and, thus, Müllerian duct regression. The suggestion that Sox9 regulates SF-1 may help to account for the precise timing of Müllerian duct regression, given their roles in MIS production, with Sox9 binding to one site and SF-1 binding to two sites within the small proximal promoter of MIS (32). Thus, aside from MIS, SF-1 would now be the second downstream target identified for Sox9 in the male sexual differentiation pathway. Interestingly, the tightly coupled expression profile of Sox9 and SF-1 observed in mammalian species is not found in the embryonic chick testis, where Sox9 expression follows that of SF-1 (33). Consistent with this finding, the Sox-BS1 conserved in all mammalian SF-1 genes is absent in the chicken SF-1 promoter (34).

That Sox9 is a likely candidate in regulating SF-1 is consistent with genetic studies that demonstrate its importance in mammalian sex determination. Human patients with SOX9 mutations are afflicted with campomelic dysplasia, and the majority of XY individuals are phenotypically female (35, 36). In contrast, a dominant insertional mutation upstream of the mouse Sox9 gene locus results in Sox9 overexpression and leads to XX phenotypic male mice (37). The intersex phenotype associated with both SOX9 and SF-1 mutations suggest that each of these gene products acts in the same or parallel genetic pathways during male sexual differentiation. Our in vitro findings together with genetic evidence strongly implicate Sox9 as a cell-specific regulator for SF-1 gene expression in the embryonic Sertoli cell. The proposal that Sox9 acts upstream of SF-1 in the male sexual differentiation pathway implies that overexpression of SF-1 would override female development as observed with the Sox9 gain-of-function study in mice and humans (37 37A ).

Our studies have also investigated the potential role of Sox3 and Sox8 in regulating SF-1 since they also colocalize with SF-1 in the developing embryonic testicular cords. In the case of Sox8, it shares considerable gene organization and protein identity with Sox9 (53%). Furthermore, their overlapping expression patterns may suggest some degree of functional redundancy, as suggested for Sox1, Sox2, and Sox3 in lens induction (31, 38). However, to date, we have been unable to show a convincing role for Sox8 in SF-1 regulation. For instance, we observe very poor binding of Sox8 to the Sox-BS1 consistent with the inability of Sox8 to activate specifically the proximal SF-1 promoter. Furthermore, a recent study reported that Sox8-deficient mice exhibit normal gonadal development, implying that Sox9, SF-1, and other genes required for male sexual development, are unaffected by the loss of Sox8 (39). The other Sox-protein candidate, Sox3, is also unlikely to regulate SF-1 in embryonic Sertoli cells based on several lines of evidence. First, we find that Sox3 does not transactivate SF-1 promoter constructs in vitro. Second, expression of Sox3 is found in both male and female genital ridges (27), and thus, is unlikely to account for the sexual dimorphic expression of SF-1 during testis differentiation. Finally, a single patient deleted for the X-linked SOX3 locus exhibits normal testicular development and therefore does not phenocopy the SF-1 human patient (40), suggesting that Sox3 is not directly upstream of SF-1 in a genetic pathway. However, it is possible that Sox3 competes for Sox9 binding on the SF-1 promoter based on the fact that Sox3 is colocalized with Sox9, binds the Sox-BS1 within the SF-1 promoter, and antagonizes Sox9-mediated activation. This suggestion predicts that overexpression of Sox3 may impair testis development by effectively reducing SF-1 levels. It has also been postulated that Sox3 inhibits Sox9 function in females, whereas in males, Sry inhibits Sox3 and allows Sox9 to be up-regulated for proper testicular development (41). Genetic disruption studies and detailed embryonic expression profiles of Sox3 will certainly provide insights into its role in gonadal differentiation.

Sox proteins are capable of bending DNA when bound to their cognate element (42, 43, 44). This feature may result in altered gene expression by conferring local changes in chromatin structure, which may be also accompanied by increased proximity of other bound transcription factors. An interesting arrangement of binding elements exists within the SF-1 proximal promoter whereby a conserved E-box element (-83 to -78) and a conserved GATA protein binding site [-176 to -172, (21)] flank the Sox-BS1. While E-box binding proteins have been proposed to regulate SF-1 (21, 22), the importance of the GATA site has not been confirmed. Nonetheless, because Sox9 does bend DNA (45), it is tempting to speculate that Sox9 functions in SF-1 transcription by facilitating the assembly of a multiprotein complex on the SF-1 promoter. In addition to these architectural features, Sox proteins also regulate gene expression through heterodimeric complexes or by multiple members of this family binding to adjacent Sox binding elements (46, 47). For example, during chondrocyte differentiation, Sox5, Sox6, and Sox9 are proposed to activate the type II collagen gene (Col2a1) cooperatively by binding multiple Sox binding sites within a 48-bp enhancer region (35). In our case, while two Sox binding sites can be identified in the SF-1 promoter (refer to Fig. 1Go), the less-conserved site (Sox-BS2) does not seem to be crucial for SF-1 activity in vitro based on our results and previous studies. Moreover, our preliminary data indicate that Sox9 does not heterodimerize readily with either Sox3 or Sox8 proteins (data not shown). Further studies of the SF-1 promoter are needed to characterize the exact relationship between Sox9 and other factors, such as USF1 and USF2, in regulating SF-1.

Although our data strongly support Sox9 regulation of SF-1 in Sertoli cells, we do not know if and which Sox proteins regulate SF-1 at the earliest stages of adrenal-gonadal development before Sox9 expression (<E12.5). A similar question can be posed for other SF-1-expressing adult tissues or cell types, such as adrenal, pituitary, ventral medial hypothalamus, and Leydig cells. Despite our RT-PCR data showing Sox9 expression in immortalized Leydig cell lines, both in situ hybridization and immunostaining studies demonstrate that Sox9 is not present in normal Leydig cells (17, 18, 26). In searching for possible Sox genes that might contribute to SF-1 expression in steroidogenic cells of the testis, Sox15 stands out as a potential candidate based on its prominent expression in adult Leydig cells (Shen, J., unpublished data). For other major SF-1-expressing tissues such as the adrenal cortex, regulation of SF-1 by Sox proteins is inferred from our data showing the importance of Sox-BS1 in SF-1 promoter activity in adrenocortical Y1 cells. As such, it will be of future interest to identify and examine the potential role of other Sox genes in SF-1 gene regulation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Constructs
Based on published sequences for the mouse, rat, and human SF-1 genes, conserved -216-bp and -454-bp promoter fragments were obtained by PCR from mouse genomic DNA with forward (-216: 5'-CAGTGCCTTGGCCTCTGC; -454: 5'-CCACACTAGCCATTCTGACTCC) and reverse (5'-CTTCGAAGCCTGACGTTTGAC) primers and verified by sequencing. Luciferase reporters were made as follows: the -216-bp and -454-bp mSF1 fragment were subcloned into -36Prl plasmid [-36pLuc, (29)], with the minimal PRL promoter sequence removed using BamHI and HindIII restriction sites. Site-directed mutagenesis was used to generate all mutant SF-1 promoter constructs, which were verified by DNA sequencing. Mutants were generated in pBluescript KS(-) and subcloned into -36pLuc plasmid as described above. The Sox-BS1 luciferase reporter was generated by inserting a 38-bp double stranded oligonucleotide containing the Sox-BS1 of the mSF-1 promoter (-123 to -92) into the -36pLuc parent vector. Mammalian expression plasmids containing rSox9, mSox3, and mSox8 cDNAs were obtained by RT-PCR, TOPO-TA cloned, and subcloned into pCDNA3 at the unique EcoRI site. Rat Sox9 cDNA plasmid was isolated by RT-PCR from rat postnatal day (P)15 Sertoli cell RNA (forward primer: 5'-GTCCGCGTATGAATCTCCTGGACC; reverse: 5'-TTTCTCTTCTCAGGGTCTGGTGAC). Flag-tagged rSox9-pCDNA3 was generated by PCR using a flag-tagged forward primer (5'-CATGGACTACAAGGACGACGATGACAAAATGAATCTCCTGGACCCCTTC). Digesting Sox9 cDNA at the unique SmaI restriction site just 3' of the HMG box generated a truncated flag-tagged rat Sox9 (amino acids 1–216). Mouse Sox3 and Sox8 cDNA plasmids were generated by RT-PCR from mouse testes total RNA using the following primers; for Sox3: 5'-GCGATGTACAGCCTGCTGGAGACTG and 5'-TCAGATGTGGGTCAGCGGCACCGTT; for Sox8: 5'-CGATGCTGGACATGAGTGAGGCCCGCG and 5'-GCCTCAGGGTCGGGTCA-GGGTGGTGTA).

Gel Shift Assays
Rodent Sox proteins were synthesized by in vitro transcription/translation of full-length mSox3, mSox8, and rSox9 cDNA in pCDNA3, using the TNT T7 Quick Coupled Transcription/Translation system (Promega Corp., Madison, WI). The same double-stranded annealed oligonucleotide that was used to construct Sox-BS1 reporter was used in gel shift assays. Wild-type (5'-TCGAGGAAGAGAAACACCAACAAAGGAGGAGAAAGGCC) and mutated oligonucleotides corresponding to the conserved Sox binding site were purified, annealed, and end labeled with [{gamma}-32P]-ATP using T4 polynucleotide kinase. Labeled double-stranded oligonucleotides were used at approximately 1 ng/µl per reaction. In each binding reaction, 3–5 µl of in vitro-translated protein (Promega Corp.) were mixed with labeled probes in a 20 µl volume of 20 mM HEPES (pH 7.9), 60 mM KCl, 0.6 mM EDTA, 4 mM Tris-Cl (pH 8.0), 10% glycerol, 5 mM dithiothreitol, 50 µg/ml BSA, 0.25% nonfat milk, 5 µg/ml poly(dG-dC), 0.5 mM phenylmethylsulfonylfluoride, and 5 ng/µl salmon sperm DNA and resolved on a 5% nondenaturing polyacrylamide gel. For all competitive gel shift assays, approximately 200-fold excess of unlabeled oligonucleotides (as measured by Hoechst dye using a TKO 100 Fluorometer (Hoefer Scientific, San Francisco, CA) were added to binding reactions and resolved as described above.

Embryonic and Postnatal Primary Sertoli Cell Preparations
P15 Sertoli cells were prepared from dissected, decapsulated testes from Sprague Dawley rat pups (Simonsen, Gilroy, CA). The resulting seminiferous tubules were minced and digested with 0.5 mg/ml of collagenase A and 0.1 mg/ml deoxyribonuclease I (DNase I) in M199 media at 32 C for 30 min, followed by dispersal and incubation at 37 C for 15 min. After digestion, tubules were allowed to settle by gravity, washed three times with Ca2+, Mg2+ free HBSS to remove interstitial cells, and treated with 0.5 mg/ml of hyaluronidase in HBSS at 37 C for 15 min. Digested tubules were collected after centrifugation (1,000 rpm) for 15 min and plated onto Matrigel-coated plates (1:20 dilution, Collaborative Biomedical, Bedford, MA) in serum-free medium (DMEM H21/F12, 0.5 µg/ml insulin, 0.5 µg/ml transferrin, penicillin/streptomycin, and fungizone). The following day, fresh medium was added to Sertoli cells after washing three times with Ca2+-, Mg2+-free HBSS. For embryonic Sertoli cells, testes were dissected, minced, and digested with 0.5 mg/ml of collagenase A and 0.1 mg/ml DNase I in M199 media at 37 C for 20 min. After digestion, tubules were allowed to settle by gravity, washed once with Ca2+, Mg2+ free HBSS, and treated with 0.5 mg/ml of hyaluronidase in HBSS at 37 C for 10 min. Digested tubules were plated onto Matrigel-coated plates (1:2 dilution) in the same serum-free medium used above. The next day, plated Sertoli cells were washed gently one time with Ca2+, Mg2+ free HBSS. The purity of cultured cells was verified by cellular morphology and by oil red O staining for Sertoli cells, and alkaline phosphatase staining for germ cell and peritubular cell contamination (30). In our Sertoli-enriched preparations, 5–8% of the cells demonstrated alkaline phosphatase activity after 3 d of culture (data not shown).

Cell Transfections
HEK-293S and JEG-3 cells were maintained and transfected in DMEM with 5% calf serum and 5% FBS. Luciferase reporter plasmids and Sox-pCDNA3 expression plasmids were introduced by the calcium phosphate method according to manufacturer’s protocol (Specialty Media). For primary Sertoli cells, Y1, and P19 cells, transfections were performed with FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, IN) after plating cells for 12–20 h. Cells were harvested 48 h after transfection, and luciferase activity was measured as previously described (29). All transfections were performed in triplicate and normalized with ß-galactosidase activities for transfection efficiency. Error bars indicated standard deviations within each triplicate set. Reporter activity shown in all figures represents at least three independent transfection experiments.

In Situ Hybridization
Five-week-old and E16.5 male mouse testes were embedded in OCT compound (Tissue-Tek, Torrance, CA) and sectioned (12 µm) after overnight treatment with fixative 4% paraformaldehyde and cryoprotected in 30% sucrose in PBS at 4 C. Antisense and sense digoxigenin-labeled RNA probes were generated from the coding region of Sox3 [1–1,150 nucleotides (nt)], Sox8 (793–1,422 nt), and Sox9 (993–1,524 nt) using a labeling mix (Roche Molecular Biochemicals). Sectioned tissues were incubated in hybridization buffer (50% formamide, 300 mM NaCl, 20 mM Tris, pH 8, 5 mM EDTA, 1x Denhardt’s, 10 mM NaH2PO4, 10% dextran sulfate, 0.5 mg/ml yeast tRNA) overnight at 61 C. After extensive washing and blocking (30 min in DAKO antibody diluent, DAKO Corp., Carpinteria, CA), tissues were incubated overnight at 4 C with antidigoxigenin antibody (1:1,000, Roche Molecular Biochemicals). After washing, color development was performed using nitroblue tetrazolium/BCIP (5-bromo-4-chloro-3- indolylphosphate) stock solution (1:50, Roche Molecular Biochemicals) for 3–5 h at room temperature.

RT-PCR Analysis
Total RNA from testes, primary Sertoli cells, MA10, R2C, {alpha}T3, Y1, HEK-293S, and JEG-3 cells was prepared with RNeasy kit (QIAGEN, Chatsworth, CA). RNA was subsequently treated with RQ1 ribonuclease-free DNase (Promega Corp.) to remove any contaminating DNA. cDNA was generated using 4–5 µg of total RNA, 2.5 µg of oligo-dT primer, and mouse Moloney leukemia virus reverse transcriptase [ribonuclease H minus (Promega Corp.)] at 42 C for 1 h. Total cDNA (1/20 of the reaction) was used as template for PCR analysis of Sox3, Sox8, Sox9, and SF-1. RT-PCR of ß-actin was used to control for RNA input and for the absence of contaminating genomic DNA. PCR conditions were optimized with buffers from PCRx enhancer system (Life Technologies, Inc., Gaithersburg, MD). Cycling programs are 95 C for 2 min followed by 30 or 35 cycles of 95 C for 30 sec (60 C for ß-actin, 62 C for SF-1, 53 C for Sox3) for 30 sec, 72 C for 1 min, with a final extension of 5 min at 72 C. ß-Actin primers (forward: 5'-GCAATGCCTGGGTACATGGTGG; reverse: 5'-GTCGTACCACAGGCATTGTGATGG); SF-1 primers (forward: 5'-CGGAAATTCGAGGACCAGGTGCGC; reverse: 5'-AGGAGTCT-TCTCGAGGCAGTGGCA), Sox3 primers (forward: 5'-CCTGCAGTACAGCCCCATGA; reverse: 5'-AGCGGCACCGTTCCATTGAC); Sox8 and Sox9 primers and their PCR conditions are as described (18, 28). All oligomer PCR primer pairs span at least one exon-intron junction, except for Sox3, which is intronless.


    ACKNOWLEDGMENTS
 
We thank Lori Roberts and Debra VanHouten for initial contributions to this study and are especially grateful to Dr. M. Wegner for the generous gift of Sox2, Sox4, Sox5, Sox6, Sox10, Sox11, Sox13, and Sox21 cDNAs.


    FOOTNOTES
 
This work was supported by University of California San Francisco Graduate Division (Graduate Opportunity Predoctoral Fellowship to J.H.S.) and NIH-NICHD Grant RO1, RCDA (to H.A.I.).

Abbreviations: AMH, Anti-Müllerian hormone; DNase, deoxyribonuclease; E (followed by a number), embryonic day; Insl-3, insulin-like factor 3; MIS, Müllerian-inhibiting substance; nt, nucleotides; P (followed by a number), postnatal day; SF-1, steroidogenic factor 1; USF, upstream stimulatory factor.

Received for publication July 5, 2001. Accepted for publication November 8, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Ikeda Y, Lala DS, Luo XR, Kim E, Moisan MP, Parker KL 1993 Characterization of the mouse Ftz-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol Endocrinol 7:852–860[Abstract]
  2. Morohashi K, Zanger UM, Honda S, Hara M, Waterman MR, Omura T 1993 Activation of Cyp11a and Cyp11b gene promoters by the steroidogenic cell-specific transcription factor, Ad4bp. Mol Endocrinol 7:1196–1204[Abstract]
  3. Ikeda Y, Luo XR, Abbud R, Nilson JH, Parker KL 1995 The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol Endocrinol 9:478–486[Abstract]
  4. Ingraham HA, Lala DS, Ikeda Y, Luo XR, Shen WH, Nachtigal MW, Abbud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–2312[Abstract/Free Full Text]
  5. Parker KL, Schimmer BP 1997 Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr Rev 18:361–377[Abstract/Free Full Text]
  6. Hammer GD, Ingraham HA 1999 Steroidogenic factor-1: its role in endocrine organ development and differentiation. Front Neuroendocrinol 20:199–223[CrossRef][Medline]
  7. Zhao LP, Bakke M, Krimkevich Y, Cushman LJ, Parlow AF, Camper SA, Parker KL 2001 Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development 128:147–154[Abstract]
  8. Luo XR, Ikeda YY, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490[CrossRef][Medline]
  9. Ikeda Y, Shen WH, Ingraham HA, Parker KL 1994 Developmental expression of mouse steroidogenic factor-1, an essential regulator of the steroid hydroxylases. Mol Endocrinol 8:654–662[Abstract]
  10. Parker KL, Schimmer BP, Schedl A 1999 Genes essential for early events in gonadal development. Cell Mol Life Sci 55:831–838[CrossRef][Medline]
  11. Roberts LM, Shen J, Ingraham HA 1999 New solutions to an ancient riddle: defining the differences between Adam and Eve. Am J Hum Genet 65:933–942[CrossRef][Medline]
  12. Zimmermann S, Schwarzler A, Buth S, Engel W, Adham IM 1998 Transcription of the Leydig insulin-like gene is mediated by steroidogenic factor-1. Mol Endocrinol 12:706–713[Abstract/Free Full Text]
  13. Zimmermann S, Steding G, Emmen JMA, Brinkmann AO, Nayernia K, Holstein AF, Engel W, Adham IM 1999 Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol 13:681–691[Abstract/Free Full Text]
  14. de Santa Barbara P, Bonneaud N, Boizet B, Desclozeaux M, Moniot B, Sudbeck P, Scherer G, Poulat F, Berta P 1998 Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Mullerian hormone gene. Mol Cell Biol 18:6653–6665[Abstract/Free Full Text]
  15. Shen WH, Moore CCD, Ikeda Y, Parker KL, Ingraham HA 1994 Nuclear receptor steroidogenic factor 1 regulates the Mullerian inhibiting substance gene—a link to the sex determination cascade. Cell 77:651–661[CrossRef][Medline]
  16. Tremblay JJ, Viger RS 1999 Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13:1388–1401[Abstract/Free Full Text]
  17. da Silva SM, Hacker A, Harley V, Goodfellow P, Swain A, Lovell-Badge R 1996 Sox9 Expression during gonadal development implies a conserved role for the gene in testis differentiation in mammals and birds. Nat Genet 14:62–68[CrossRef][Medline]
  18. Kent J, Wheatley SC, Andrews JE, Sinclair AH, Koopman P 1996 A male-specific role for Sox9 in vertebrate sex determination. Development 122:2813–2822[Abstract]
  19. Viger RS, Mertineit C, Trasler JM, Nemer M 1998 Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Mullerian inhibiting substance promoter. Development 125:2665–2675[Abstract]
  20. Achermann JC, Ito M, Hindmarsh PC, Jameson JL 1999 A mutation in the gene encoding steroidogenic factor-1 causes XY sex reversal and adrenal failure in humans. Nat Genet 22:125–126[CrossRef][Medline]
  21. Daggett MAF, Rice DA, Heckert LL 2000 Expression of steroidogenic factor 1 in the testis requires an E box and CCAAT box in its promoter proximal region. Biol Reprod 62:670–679[Abstract/Free Full Text]
  22. Harris AN, Mellon PL 1998 The basic helix-loop-helix, leucine zipper transcription factor, USF (upstream stimulatory factor), is a key regulator of SF-1 (steroidogenic factor-1) gene expression in pituitary gonadotrope and steroidogenic cells. Mol Endocrinol 12:714–726[Abstract/Free Full Text]
  23. Nomura M, Bartsch S, Nawata H, Omura T, Morohashi K 1995 An E box element is required for the expression of the Ad4bp gene, a mammalian homologue of Ftz-F1 gene, which is essential for adrenal and gonadal development. J Biol Chem 270:7453–7461[Abstract/Free Full Text]
  24. Oba K, Yanase T, Ichino I, Goto K, Takayanagi R, Nawata H 2000 Transcriptional regulation of the human FTZ-F1 gene encoding Ad4BP/SF-1. J Biochem Tokyo 128:517–528[Abstract/Free Full Text]
  25. Woodson KG, Crawford PA, Sadovsky Y, Milbrandt J 1997 Characterization of the promoter of SF-1, an orphan nuclear receptor required for adrenal and gonadal development. Mol Endocrinol 11:117–126[Abstract/Free Full Text]
  26. Fröjdman K, Harley VR, Pelliniemi LJ 2000 Sox9 protein in rat Sertoli cells is age and stage dependent. Histochem Cell Biol 113:31–36[CrossRef][Medline]
  27. Collignon J, Sockanathan S, Hacker A, Cohentannoudji M, Norris D, Rastan S, Stevanovic M, Goodfellow PN, Lovell-Badge R 1996 A comparison of the properties of Sox-3 with Sry and two related genes, Sox-1 and Sox-2. Development 122:509–520[Abstract]
  28. Schepers GE, Bullejos M, Hosking BM, Koopman P 2000 Cloning and characterisation of the Sry-related transcription factor gene Sox8. Nucleic Acids Res 28:1473–1480[Abstract/Free Full Text]
  29. Ingraham HA, Flynn SE, Voss JW, Albert VR, Kapiloff MS, Wilson L, Rosenfeld MG 1990 The Pou-specific domain of Pit-1 is essential for sequence-specific, high affinity DNA binding and DNA-dependent Pit-1-Pit-1 interactions. Cell 61:1021–1033[CrossRef][Medline]
  30. Chapin RE, Phelps JL, Miller BE, Gray TJ 1987 Alkaline phosphatase histochemistry discriminates peritubular cells in primary rat testicular cell culture. J Androl 8:155–61[Abstract/Free Full Text]
  31. Kamachi Y, Uchikawa M, Collignon J, Lovell-Badge R, Kondoh H 1998 Involvement of Sox1, 2 and 3 in the early and subsequent molecular events of lens induction. Development 125:2521–2532[Abstract]
  32. Watanabe K, Clarke TR, Lane AH, Wang XZ, Donahoe PK 2000 Endogenous expression of Mullerian inhibiting substance in early postnatal rat Sertoli cells requires multiple steroidogenic factor-1 and GATA-4-binding sites. Proc Natl Acad Sci USA 97:1624–1629[Abstract/Free Full Text]
  33. Smith CA, Smith MJ, Sinclair AH 1999 Gene expression during gonadogenesis in the chicken embryo. Gene 234:395–402[CrossRef][Medline]
  34. Kudo T, Sutou S 1999 Structural characterization of the chicken SF-1/Ad4BP gene. Gene 231:33–40[CrossRef][Medline]
  35. Foster JW 1996 Mutations in Sox9 cause both autosomal sex reversal and campomelic dysplasia. Acta Paediat Jpn 38:405–411
  36. Wagner T, Wirth J, Meyer J, Zabel B, Held M, Zimmer J, Pasantes J, Bricarelli FD, Keutel J, Hustert E, Wolf U, Tommerup N, Schempp W, Scherer G 1994 Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the Sry-related gene Sox9. Cell 79:1111–1120[CrossRef][Medline]
  37. Bishop CE, Whitworth DJ, Qin YJ, Agoulnik AI, Agoulnik IU, Harrison WR, Behringer RR, Overbeek PA 2000 A transgenic insertion upstream of Sox9 is associated with dominant XX sex reversal in the mouse. Nat Genet 26:490–494[CrossRef][Medline]
  38. Huang B, Wang SB, Ning Y, Lamb AN, Bartley J 1999 Autosomal XX sex reversal caused by duplication of SOX9. Am J Med Genet 87:349–353[CrossRef][Medline]
  39. Kamachi Y, Sockanathan S, Liu QR, Breitman M, Lovell-Badge R, Kondoh H 1995 Involvement of Sox proteins in lens-specific activation of crystallin genes. EMBO J 14:3510–3519[Medline]
  40. Sock E, Schmidt K, Hermanns-Borgmeyer I, Bösl MR, Wegner M 2001 Idiopathic weight reduction in mice deficient in the high-mobility-group transcription factor Sox8. Mol Cell Biol 21:6951[Abstract/Free Full Text]
  41. Stevanovic M, Lovell-Badge R, Collignon J, Goodfellow PN 1993 Sox3 is an X-linked gene related to Sry. Hum Mol Genet 2:2013–2018[Abstract/Free Full Text]
  42. Graves JAM 1998 Interactions between SRY and SOX genes in mammalian sex determination. Bioessays 20:264–269[CrossRef][Medline]
  43. Conner F, Cary PD, Read CM, Preston NS, Driscoll PC, Denny P, Cranerobinson C, Ashworth A 1994 DNA binding and bending properties of the postmeiotically expressed Sry-related protein Sox-5. Nucleic Acids Res 22:3339–3346[Abstract/Free Full Text]
  44. Giese K, Kingsley C, Kirshner JR, Grosschedl R 1995 Assembly and Function of a Tcr-{alpha} enhancer complex is dependent on Lef-1-induced DNA bending and multiple protein-protein interactions. Genes Dev 9:995–1008[Abstract/Free Full Text]
  45. Peirano RI, Wegner M 2000 The glial transcription factor Sox10 binds to DNA both as monomer and dimer with different functional consequences. Nucleic Acids Res 28:3047–3055[Abstract/Free Full Text]
  46. Lefebvre V, Huang WD, Harley VR, Goodfellow PN, de Crombrugghe B 1997 SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro {alpha} 1(II) collagen gene. Mol Cell Biol 17:2336–2346[Abstract]
  47. Dailey L, Basilico C 2001 Coevolution of HMG domains and homeodomains and the generation of transcriptional regulation by Sox/POU complexes. J Cell Physiol 186:315–328[CrossRef][Medline]
  48. Peirano RI, Goerich DE, Riethmacher D, Wegner M 2000 Protein zero gene expression is regulated by the glial transcription factor Sox10. Mol Cell Biol 20:3198–3209[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
N. Sakai, H. Terami, S. Suzuki, M. Haga, K. Nomoto, N. Tsuchida, K.-i. Morohashi, N. Saito, M. Asada, M. Hashimoto, et al.
Identification of NR5A1 (SF-1/AD4BP) gene expression modulators by large-scale gain and loss of function studies
J. Endocrinol., September 1, 2008; 198(3): 489 - 497.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Utsunomiya, Y.-H. Cheng, Z. Lin, S. Reierstad, P. Yin, E. Attar, Q. Xue, G. Imir, S. Thung, E. Trukhacheva, et al.
Upstream Stimulatory Factor-2 Regulates Steroidogenic Factor-1 Expression in Endometriosis
Mol. Endocrinol., April 1, 2008; 22(4): 904 - 914.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Q. Xue, Z. Lin, P. Yin, M. P. Milad, Y.-H. Cheng, E. Confino, S. Reierstad, and S. E. Bulun
Transcriptional Activation of Steroidogenic Factor-1 by Hypomethylation of the 5' CpG Island in Endometriosis
J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3261 - 3267.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
D. Wilhelm, S. Palmer, and P. Koopman
Sex Determination and Gonadal Development in Mammals
Physiol Rev, January 1, 2007; 87(1): 1 - 28.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Zubair, S. Ishihara, S. Oka, K. Okumura, and K.-i. Morohashi
Two-Step Regulation of Ad4BP/SF-1 Gene Transcription during Fetal Adrenal Development: Initiation by a Hox-Pbx1-Prep1 Complex and Maintenance via Autoregulation by Ad4BP/SF-1.
Mol. Cell. Biol., June 1, 2006; 26(11): 4111 - 4121.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. K. Rao, J. Pham, J. S. Imam, J. A. MacLean, D. Murali, Y. Furuta, A. P. Sinha-Hikim, and M. F. Wilkinson
Tissue-specific RNAi reveals that WT1 expression in nurse cells controls germ cell survival and spermatogenesis
Genes & Dev., January 15, 2006; 20(2): 147 - 152.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Katoh-Fukui, A. Owaki, Y. Toyama, M. Kusaka, Y. Shinohara, M. Maekawa, K. Toshimori, and K.-i. Morohashi
Mouse Polycomb M33 is required for splenic vascular and adrenal gland formation through regulating Ad4BP/SF1 expression
Blood, September 1, 2005; 106(5): 1612 - 1620.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Wilson, P. Jeyasuria, K. L. Parker, and P. Koopman
The Transcription Factors Steroidogenic Factor-1 and SOX9 Regulate Expression of Vanin-1 during Mouse Testis Development
J. Biol. Chem., February 18, 2005; 280(7): 5917 - 5923.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S. Gondo, T. Yanase, T. Okabe, T. Tanaka, H. Morinaga, M. Nomura, K. Goto, and H. Nawata
SF-1/Ad4BP transforms primary long-term cultured bone marrow cells into ACTH-responsive steroidogenic cells
Genes Cells, December 1, 2004; 9(12): 1239 - 1247.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Raverot, H. Lejeune, T. Kotlar, M. Pugeat, and J. L. Jameson
X-Linked Sex-Determining Region Y Box 3 (SOX3) Gene Mutations Are Uncommon in Men with Idiopathic Oligoazoospermic Infertility
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4146 - 4148.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M.-C. Chaboissier, A. Kobayashi, V. I. P. Vidal, S. Lutzkendorf, H. J. G. van de Kant, M. Wegner, D. G. de Rooij, R. R. Behringer, and A. Schedl
Functional analysis of Sox8 and Sox9 during sex determination in the mouse
Development, May 1, 2004; 131(9): 1891 - 1901.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Weiss, J. J. Meeks, L. Hurley, G. Raverot, A. Frassetto, and J. L. Jameson
Sox3 Is Required for Gonadal Function, but Not Sex Determination, in Males and Females
Mol. Cell. Biol., November 15, 2003; 23(22): 8084 - 8091.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y.-W. Liu, W. Gao, H.-L. Teh, J.-H. Tan, and W.-K. Chan
Prox1 Is a Novel Coregulator of Ff1b and Is Involved in the Embryonic Development of the Zebra Fish Interrenal Primordium
Mol. Cell. Biol., October 15, 2003; 23(20): 7243 - 7255.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. K. Jordan, J. H.-C. Shen, R. Olaso, H. A. Ingraham, and E. Vilain
Wnt4 overexpression disrupts normal testicular vasculature and inhibits testosterone synthesis by repressing steroidogenic factor 1/{beta}-catenin synergy
PNAS, September 16, 2003; 100(19): 10866 - 10871.
[Abstract] [Full Text] [PDF]


Home page