help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richards, J. S.
Right arrow Articles by Lo, Y. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richards, J. S.
Right arrow Articles by Lo, Y. H.
Molecular Endocrinology 16 (3): 580-599
Copyright © 2002 by The Endocrine Society

Expression of FKHR, FKHRL1, and AFX Genes in the Rodent Ovary: Evidence for Regulation by IGF-I, Estrogen, and the Gonadotropins

JoAnne S. Richards, S. C. Sharma, Allison E. Falender and Yuet H. Lo

Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030

Address all correspondence and requests for reprints to: JoAnne S. Richards, Ph.D., Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: joanner{at}bcm.tmc.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Follicular development is dependent on both intraovarian growth regulatory factors, such as IGF-I and estrogen, as well as the pituitary gonadotropins, FSH and LH. Recently, we have shown that FSH impacts the IGF-I pathway via stimulation of the PI3K cascade leading to phosphorylation of protein kinase B (PKB)/Akt and the PKB-related kinase, Sgk. This study was undertaken to determine if during ovarian follicular development FSH regulates putative targets of PKB and Sgk, namely specific Forkhead transcription factor family members. Using in vivo and in vitro mouse and rat models, we show 1) that FKHR [Forkhead homolog of rhabdomysarcoma = Forkhead box binding protein (Foxo1), FKHRL1 (Forkhead-like protein-1 = Foxo3), and AFX (a Forkhead transcription factor = Foxo4); all defined according to the Human and Mouse Gene Nomenclature Committee) are expressed in the rodent ovary and 2) that FSH regulates transcription of the FKHR gene as well as phosphorylation of FKHR protein. Specifically, FSH/PMSG (primarily via E2) enhance expression of the FKHR gene in granulosa cells of developing follicles. Furthermore, E2 enhances expression of other IGF-I pathway components (IGF-1Rß and Glut-1), and IGF-I enhances expression of ERß, indicating that these two hormones comprise an autocrine regulatory network within growing follicles. In contrast, FSH and LH/human CG (via cAMP, PKA, and PI3K pathways) terminate FKHR expression as granulosa cells differentiate to luteal cells. In naïve granulosa cells, both FSH and IGF-I stimulate rapid phosphorylation of FKHR at multiple sites causing its redistribution from the nucleus to the cytoplasm in a PI3K-dependent manner. However, the effects of FSH and IGF-I differ markedly in differentiated granulosa cells in which FSH (but not IGF-I) induces Sgk and enhances phosphorylation of FKHR, PKB, and Sgk. The elevated expression of FKHR in granulosa cells of growing follicles indicates that FKHR may be linked to the proliferation of granulosa cells and that its phosphorylation by FSH, IGF-I, and other factors may impact its functional activity in this process. Thus, as a target of FSH (cAMP), E2 and IGF-I signaling in granulosa cells, FKHR likely coordinates numerous cell survival mechanisms.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
OVARIAN FOLLICULAR GROWTH is controlled by intraovarian production of local growth regulatory factors that include IGF-I, (1, 2, 3, 4, 5), steroids (6), members of the TGFß family (7), and the Wnt/Frizzled family (8, 9). These factors act by autocrine, paracrine, and intracrine mechanisms. In addition, follicular growth is controlled by endocrine factors such as the pituitary gonadotropins, FSH, and LH (6, 10). Although IGF-I and estrogen have been shown to act synergistically with FSH to enhance follicular growth, the specific mechanisms by which these regulatory pathways interact have remained elusive (2, 4, 5, 11, 12).

IGF-I via its cognate receptor and the insulin receptor substrates (IRS-1/2) impacts multiple signaling cascades. One cascade that is highly conserved from Caenorhabditis elegans to mammals includes PI3K, phosphoinositide-induced kinases (PDK1/2) and protein kinase B (PKB)/Akt (13, 14, 15). PI3K generates phosphoinositides that activate PDK1/2. PDK1/2 as well as other kinases phosphorylate and activate PKB in a hierarchial and complex manner (16, 17). In contrast, many substrates that are phosphorylated by PKB are inactivated and/or degraded, such as GSK-3ß, BAD, and caspase 9 as well as members of the Forkhead homolog in rhabdomysarcoma (FKHR) winged-helix transcription factor family (14). Three members of the Forkhead family have been identified in the mouse: FKHR (Foxo1), FKHRL1 (Foxo3), and AFX (Foxo4) (18, 19). A current model of IGF-I action indicates that phosphorylation of Forkhead proteins by PKB (and related kinases) restricts the nuclear localization of these factors thereby providing a mechanism to regulate the transcriptional activation of Forkhead target genes (16, 20). Three genes thought to be regulated by FKHR, FKHRL1, and AFX are Fas ligand (FasL), an inducer of apoptosis (21), p27KIP, an inhibitor of cell cycle progression (22) and IGFBP-1, a presumed inhibitor of IGF-I (4, 5, 23). Each of these is hormonally regulated in the ovary; FasL being expressed in follicles (24, 25) and IGFBP-1 and p27KIP being increased in corpora lutea (CL) (4, 26). Lack of IGF-I in mice causes severe growth retardation, including follicular growth in the ovary (1, 2, 27, 28). Mice lacking IRS-2 also exhibit impaired fertility with small anovulatory follicles (3). In contrast, although mice null for GH exhibit reduced growth rates and have low serum levels of IGF-I, ovarian functions are not dramatically altered (29). This is likely a consequence of some GH-independent production of IGF-I by granulosa cells within the ovary (30) (2).

New aspects to FSH-mediated cell signaling cascades have also been documented recently. In the classical pathway, FSH binds its cognate seven-pass membrane receptor to activate adenylyl cyclase thereby increasing intracellular cAMP that activates cAMP-dependent PKA. Downstream targets of PKA phosphorylation include cAMP response element binding protein (CREB), CREB binding protein, and CREB-regulated genes, such as aromatase (12). FSH and cAMP also impact the PI3K pathway in granulosa cells by inducing serum and glucocorticoid-induced kinase (Sgk) (31, 32). Sgk is a PKB-related kinase that like PKB is phosphorylated and activated by the PI3K/PDK1 pathway in response to IGF-I (33, 34, 35) as well as FSH (12, 36). Expression of Sgk has been related to cell proliferation (37, 38) and cell survival pathways in mammalian cells (39) and Yeast (40). The identification of cAMP-regulated guanine nucleotide exchange factors, cAMP-GEFs (41, 42), provides a potential new link between FSH stimulation of adenylyl cyclase and activation of PI3K via Ras-related small GTPases. Functional links between the FSH and IGF-I signal pathways are supported by the observations that IGF-I, IGF-I receptor and FSH receptor colocalize to granulosa cells of small growing follicles and preovulatory follicles (2, 30). In mice null for the FSH receptor or the FSHß subunit follicular growth is impaired beyond the preantral stage (43, 44, 45) and expression of many genes including Sgk is impaired (46).

The steroid hormone E2 acts via two ER subtypes, the classical ER{alpha} and the more recently discovered ERß (47), to enhance granulosa cell proliferation (26, 48) and the fate of granulosa cell differentiation (6, 49). The mechanisms by which estrogen alters the response of granulosa cells to FSH has remained elusive but could involve the regulation of components of the IGF-I signaling cascade, including Forkhead transcription factors. Recent studies have shown by two-hybrid screening that FKHRL1 interacts with ER and can act as a bifunctional repressor or activator of nuclear hormone receptor activity (50, 51). Therefore, it is possible that FSH as well as IGF-I regulate the expression and function of ER subtypes in the ovary.

Based on these observations, the following studies were undertaken to determine which of the Forkhead molecules is expressed in the rodent ovary, is hormonally regulated in a cell or stage specific manner during follicular development and is a target of E2, FSH, and/or IGF-I action. For these studies, we have used hormonally primed immature mouse and rat models in which follicles and CL can be analyzed at specific stages of development and in which granulosa cells can be isolated and cultured in the presence of selected hormones. RT-PCR and in situ hybridization were used to provide semiquantitative analyses for the temporal expression and cellular localization patterns, respectively, for FKHR, FKHRL1, and AFX. Hormone-regulated expression of IGF-I, Sgk, and ERß were also analyzed to determine which if any might impact expression of Forkhead molecules. Western blots were used to analyze the relative amounts and temporal changes in levels of FKHR, phospho-FKHR and FKHRL1, PKB, phospho-PKB, Sgk, IGF-I receptor ß (IGF-1Rß), and Glut-1 in granulosa cells of growing follicles. Immunocytochemical studies were done to determine the subcellular localization of FKHR and PKB in granulosa cells under defined conditions.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
FKHR, FKHRL1, and AFX Are Differentially Expressed in the Mouse Ovary
The first experiments were done to determine if FKHR, FKHRL1, or AFX mRNA is expressed and hormonally regulated in the mouse ovary. Total RNA was isolated from ovaries of immature female mice before or 48 h after treatment with PMSG that stimulates follicular growth and at selected intervals after human CG (hCG) that is used to induce ovulation and luteinization. RT-PCR analyses showed that transcripts for FKHR, FKHRL1, and AFX were expressed in the ovaries of the immature mice (Fig. 1AGo, lane 1). PMSG (48 h) stimulated 2- to 2.5-fold increases in FKHR, FKHRL1, and AFX mRNA (lane 2) above that seen in immature mouse ovary (lane 1) (P < 0.01, 0.01 and 0.05, respectively). However, the response to hCG differed among the three genes. hCG caused FKHR mRNA to decrease within 4 h (lane 4; P < 0.01), after which it remained low in ovaries of PMSG-hCG treated mice collected 8–48 h after hCG (lanes 5–9). FKHR transcripts were also present but low in ovaries of pregnant mice (data not shown). In contrast, FKHRL1 mRNA did not change markedly in response to hCG, whereas AFX mRNA was elevated in luteinized ovaries of mice treated with PMSG-hCG 48 h (lane 9) and on d 15 of pregnancy (data not shown) compared with untreated controls (P < 0.02).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 1. FKHR, FKHRL1, and AFX mRNAs Are Regulated by Hormones in the Mouse Ovary during Follicular Growth and Luteinization

A, RT-PCR: Total RNA was isolated from whole ovaries of untreated immature mice before (lane 1) and after hormone stimulation with PMSG for 48 h to stimulate preovulatory follicle growth (lane 2) and hCG to stimulate ovulation and luteinization (lanes 3–9). FKHR, FKHRL1, and AFX mRNAs were analyzed by semiquantitative RT-PCR analyses using specific primers and conditions as described in Materials and Methods. In this and subsequent slides, the amplified cDNA products were quantified by phosphoimage analysis (Betascope 603 Blot Analyzer; Getagen Corp., Mountain View, CA). Graphs depict the expression of each gene relative to the internal standard, the ribosomal protein L19. Two different complete sets of total RNA for each treatment group (3 animals/group) were analyzed in at least two separate RT-PCRs. A representative autoradiograph is presented for each amplified gene product. Data were analyzed by t test and presented as the mean ± SEM in this and subsequent slides. B, In situ hybridization analyses were done on ovarian tissue sections prepared from mice treated with same hormone regime as in panel A: PMSG (48 h) and hCG (2, 4, 8, and 48 h). FKHR transcripts were detected in granulosa cells (gc) of small and large follicles in the PMSG-treated mouse ovaries. Exposure to an ovulating dose of hCG caused a rapid loss of FKHR mRNA selectively in the ovulatory follicles (OF; indicated by the wide arrows) that rupture, release the oocyte and undergo luteinization. FKHR mRNA was not present in CL of PMSG-hCG, 48 h treated immature mice but was abundantly expressed in granulosa cells of small and large follicles that did not luteinize. FKHRL1 and AFX were localized more diffusely in the mouse ovary but staining of CL was distinct. No staining was observed with the sense probes for FKHR (as shown), FKHRL1 or AFX (not shown).

 
In situ hybridization analyses showed that expression of FKHR mRNA was restricted to granulosa cells of growing follicles present in ovaries of PMSG-treated mice (Fig. 1BGo). In contrast, FKHR mRNA rapidly declined in ovulating follicles, 2–12 h after hCG and was negligible in CL 48 h after hCG (Fig. 1BGo). FKHR mRNA was also not observed by in situ hybridization in CL of pregnant mice or adult cycling mice (data not shown). Note that FKHR remained expressed abundantly in granulosa cells of growing follicles of PMSG-hCG treated mice, thereby explaining the continued amplification of FKHR in the RT-PCRs of whole ovarian RNA prepared after hCG stimulation (Fig. 1AGo, FKHR lanes 4–9). In contrast, FKHRL1 and AFX mRNAs were detected in theca cells as well as granulosa cells of some follicles with distinct expression observed in CL (Fig. 1BGo).

Closer examination of immature mouse ovaries (d 5–21 of age) revealed that FKHR transcripts were readily detectable in follicles that exhibited early signs of atresia, i.e. a distinct beading appearance of the outer layer of granulosa cells and the presence of immune cells in the antral fluid (data not shown). More unexpected and striking was the intense FKHR signal in oocytes of primary follicles (comprised of one or two layers of granulosa cells) in the d 15 and 21 mouse ovaries (Fig. 2Go). In contrast, nests of oocytes at early stages of follicle formation (d 5 of age) or mature oocytes surrounded by cumulus cells within larger follicles at the proestrous stage of follicular growth did not appear to express detectable levels of FKHR mRNA by this method (Fig. 2Go). As expected from the results in Fig. 1Go, granulosa cells and cumulus cells of proestrous follicles were FKHR positive (Fig. 2Go). Thus FKHR appears to be expressed at specific stages of oocyte development.



View larger version (117K):
[in this window]
[in a new window]
 
Figure 2. Expression of FKHR in Oocytes Is Dependent on the Stage of Follicular Growth

Ovaries from mice on d 5, 15, and 21 of age and proestrus were analyzed by in situ hybridization. FKHR mRNA was not detected in the nest of oocytes (narrow arrows) or surrounding cells of the d 5 mouse ovary. However, FKHR was observed in immature oocytes contained in small primary follicles (comprised of 1–2 layers of granulosa cells) of mouse ovaries collected on d 15 of age (narrow arrows). In d 21 ovaries, FKHR remained present in many oocytes (narrow arrows) but was also present in granulosa cells (gc) of large preantral follicles (broad arrows). Although FKHR expression was clearly evident in granulosa cells of preovulatory follicles in proestrous ovaries (broad arrows), FKHR was not detected in mature oocytes of these follicles.

 
The temporal expression pattern of FKHR mRNA in the mouse ovary was similar to that of IGF-I (Fig. 3Go, upper left). IGF-I mRNA was present in immature ovaries, increased approximately 2-fold with PMSG (P < 0.05) and then decreased (P < 0.05) between 4 and 48 h after hCG as ovulating follicles become CL, confirming IGF-I expression in granulosa cells but not CL (30). Sgk, a kinase that can phosphorylate FKHR, FKHRL1, and AFX (18) and is itself a target of IGF-I activation as well as FSH and LH induction and activation in granulosa cells (33, 34, 36), increased slightly (P < .05) in response to PMSG (Fig. 3Go, lower left). The most dramatic increases in Sgk mRNA were observed from 2–48 h after hCG (lanes 3–9), when the levels became approximately 8-fold higher than the those observed in the immature mouse ovary (lane 1; P < 0.001). Sgk mRNA was also elevated in ovaries of pregnant mice (data not shown). In situ hybridization showed that Sgk mRNA is present in granulosa cells of growing follicles but is elevated in CL of PMSG-hCG treated mice (Fig. 3Go), confirming previous observations in the rat (32).



View larger version (91K):
[in this window]
[in a new window]
 
Figure 3. Expression of IGF-I Is Similar to that of FKHR but Distinct from that of Sgk

RT-PCR analyses for IGF-I, Sgk, and L19 were performed using the same sets of RNA as described in Fig. 1Go. After a single RT reaction, each product was then amplified using in separate reactions using specific primer pairs as described in Materials and Methods. In situ hybridization of Sgk was performed on sections from PMSG-hCG-treated mouse ovaries. Note that Sgk mRNA was increased in granulosa cells by PMSG and hCG treatments with highest expression in CL (broad arrows). Sgk mRNA was not detected in follicles adjacent to the CL in the PMSG-hCG ovaries at 48 h (narrow arrows).

 
Expression of FKHR mRNA in Granulosa Cells Is Regulated by E2, FSH, and hCG (LH)
The forgoing data indicate that FKHR mRNA is expressed is in the whole mouse ovary and increased in response to PMSG, a hormone with both FSH and LH-like activity in the rodent that stimulates the growth of preovulatory follicles. Because these follicles synthesize increased amounts of E2, it is difficult in the PMSG model to dissociate the effects of the steroid from those of the gonadotropin. Furthermore, analyses of whole ovarian RNA do not permit analyses of gene expression specifically in granulosa cells. Therefore, the next experiments were done to determine if E2 contributes to the gonadotropin-regulated expression of the FKHR gene in granulosa cells. For these studies, the well-characterized hypophysectomized (H) rat model was used. Although IGF-I expression remains intact in this model (52), E2 is required to stimulate granulosa cell proliferation and the growth of large preantral follicles highly responsive to FSH (6, 48). As a consequence, in the E2-primed (HE) rats, FSH induces the growth of large antral, preovulatory follicles that can respond to LH (or hCG), ovulate, and luteinize. To examine FKHR expression in this model, granulosa cells were isolated from the ovaries of H rats before and after hormone stimulation and used as the source of total RNA (for RT-PCR analyses) and cellular protein (for Western blot analyses). Whole ovaries from each treatment group were also dissected and processed for in situ hybridization analyses.

RT-PCR analyses show that isolated granulosa cells of H rats express FKHR transcripts (Fig. 4AGo). E2 induced a >2-fold increase (P < 0.02) in FKHR mRNA (Fig. 4AGo; HE) in association with the growth of large preantral follicles (32, 53). Subsequent stimulation of HE rats with low doses of FSH for 48 h [Fig. 4AGo; hypophysectomized, E2 and FSH treated (HEF)] initiated the growth of preovulatory follicles and a transitional stage of differentiation. In these cells, FKHR remains expressed. Injections of hCG that terminate follicular growth and stimulate their differentiation to nondividing luteal cells caused the most dramatic (90%) decrease in FKHR mRNA (Fig. 4AGo; HEF, hCG; P < 0.001 compared with HE). Levels of IGF-I mRNA exhibited a similar pattern of expression (data not shown) confirming the continued expression of this growth factor in granulosa cells of the H rat ovary and its down-regulation with luteinization (2, 30).



View larger version (76K):
[in this window]
[in a new window]
 
Figure 4. Expression of FKHR mRNA Is Regulated by Estrogen, FSH, and LH in Granulosa Cells of H Rats

A, RT-PCR: Total RNA was extracted from granulosa cells of H rats before and after sequential treatment with E2 for 3 d (HE) to stimulate growth of large preantral follicles, followed by low levels of FSH (1.5 µg twice daily for 2 d) (HEF) to induce preovulatory follicle growth. Total RNA was also extracted from granulosa cells of ovulating follicles, 12 h after a single ovulatory dose of hCG and from whole ovaries of HEF, hCG-treated rats at 24, 48, and 72 h rats. At these latter time points, the tissue was almost entirely CL (as seen in C). RT-PCR analyses were done as described in Materials and Methods using two separate sets of RNA. E2 specifically increased FKHR mRNA in granulosa cells preantral follicles. FSH decreased FKHR modestly as the granulosa cells began to differentiate in the preovulatory follicles. hCG rapidly and markedly down-regulated FKHR expression as the granulosa cells luteinized and formed CL. B and C, In situ hybrization analyses show FKHR mRNA is expressed at low levels in granulosa cells of growing follicles in the hormonally deprived H rats but is increased in granulosa cells of E2-treated HE rats (B). To analyze the effects of acute as well as basal levels of FSH on expression of FKHR, HE rats divided into two groups. One group received a single ip injection of a high dose of FSH (10 µg) and ovaries were analyzed 2, 8, and 24 h later. The other group was injected twice daily for 2 d with a low dose of FSH (1.5 µg) and the ovaries isolated at 48 h (designated HEF, 48 h) (C). The high dose of FSH rapidly down-regulated FKHR mRNA in granulosa cells (gc; broad arrows) of preantral follicles at 2–8 h. In contrast, the low dose of FSH stimulated the growth of preovulatory follicles that maintain FKHR expression, albeit at a lower level (as observed in the RT-PCR analyses, HEF; panel A). FKHR expression was rapidly turned off by an ovulating dose of hCG (not shown) and was not expressed in CL of HEF-hCG, 48 h rats or rats on d 7 or 22 of pregnancy (C). Note the elevated levels of FKHR mRNA in granulosa and cumulus cells (but not the oocyte) of the preovulatory follicle present in the d 22 pregnant ovary (enlarged in inset) (C).

 
In situ hybridization analyses revealed low levels of FKHR mRNA in granulosa cells of small preantral follicles in the gonadotropin-deprived H rat (Fig. 4BGo). In contrast, intense FKHR labeling of granulosa cells was observed in large E2-stimulated preantral follicles (Fig. 4BGo; HE). In response to an iv injection of a single high (ovulatory-like) dose of FSH (10 µg), FKHR mRNA decreased rapidly by 2 h and remained low at 8 h in the large preantral follicles (Fig. 4CGo). However, at 8 h FKHR mRNA was detected in granulosa cells of small preantral follicles. By 24 h, intense staining of FKHR was again observed in many large follicles. In contrast, when HE rats were injected sc with a low dose of FSH for 2 d (HEF, 48 h) to stimulate growth of preovulatory follicles, FKHR remained expressed in the granulosa cells of these follicles (Fig. 4CGo; HEF, 48 h). FKHR mRNA was not detected in CL of HEF-hCG treated rats or in pregnant rats on d 7 or 22 of gestation. However, FKHR mRNA was detected as a strong signal in follicles present in the pregnant rat ovaries. Note that FKHR message was expressed in granulosa cells and cumulus cells but not the oocyte of the preovulatory follicle present in the d 22 pregnant rat ovary (Fig. 4CGo). As in the mouse ovary, FKHRL1 and AFX were also detected in CL of pregnant rats (data not shown).

FKHR Protein Is Induced and Phosphorylated by Hormones in Vivo
Because genetic analyses in C. elegans (15) and biochemical analyses in mammalian cells indicate that FKHR is a substrate for both PKB and Sgk (18, 20, 21), we sought to determine if the amount or phosphorylation of FKHR protein was altered by hormones in granulosa cells in vivo. For these studies, protein samples from hormonally primed H rats were analyzed by Western blots using specific antibodies against FKHR, phospho-Thr24-FKHR, phospho-Ser 256-FKHR as well as phospho-PKB. Levels of IGF-1Rß that is an upstream component of the IGF-I pathway and to Glut-1 that is a downstream target of IGF-I were also analyzed (54).

Total FKHR Protein
Granulosa cells of H rats expressed low levels of FKHR protein that increased markedly (>7.5-fold) after in vivo exposure to E2 (Fig. 5Go; HE), confirming results of RNA analyses (Fig. 4AGo). The multiple immunopositive bands correspond to intact FKHR (uppermost band) as well as putative proteolytic fragments of the protein (lower MW bands). Stimulation of HE rats with a high dose of FSH caused the amount of immunoreactive FKHR protein in granulosa cells to decrease 50% between 2–8 h. Low doses of FSH given for 48 h (HEF) to stimulate growth of preovulatory follicles also reduced FKHR protein to approximately 50%. A subsequent iv injection of hCG caused the most dramatic decrease in FKHR protein (greater than 90%) between 4 and 24 h when only small amounts of FKHR protein were detected (Fig. 5Go). Collectively, these results confirm the up-regulation of FKHR mRNA in E2-stimulated follicles and the loss of FKHR transcripts as granulosa cells cease dividing and differentiate to luteal cells (Fig. 4Go, A–C).



View larger version (81K):
[in this window]
[in a new window]
 
Figure 5. The Amount and Phosphorylation of FKHR Protein Is Hormonally Regulated in Granulosa Cells of Hypophysectomized (H) Rats

Rats were treated E2 for 3 d (HE), a high dose (10 µg, ip) of FSH for 2 and 8 h or a low dose of FSH (1.5 µg twice daily for 2 d) (HEF) followed by hCG for 2, 4, 8, and 24 h. WCE were prepared from granulosa cells and resolved by SDS-PAGE. Commercial antibodies (as indicated in Materials and Methods) specific for total FKHR protein, phospho-FKHR-Thr-24, phospho-FKHR-Ser-256, phospho-PKB-Ser-473, phospho-PKB-Thr-308, IGF-1Rß and Glut-1 were used in Western blots analyses. Primary antibodies were used at a 1:1000 dilution except for PKB-Thr-308 (1:100); the secondary antibody was at 1:10,000 except for PKB-Thr-308 (1:500).

 
Phosphorylation of FKHR
Changes in the relative amount of immunoreactive phospho-Thr-24 FKHR exhibited a pattern similar to that of the total amount of FKHR itself. PhosphoThr-24 FKHR was increased by E2 and low amounts of FSH (HEF, 48 h) and was retained during the immediate time intervals after administration of hCG. However, the levels of phospho-Thr-24 FKHR were markedly reduced 24 h after hCG-mediated luteinization (Fig. 5Go). The relative increase in FKHR Thr-24 phosphorylation at 48 h after FSH was 4.9-fold greater than the relative increase in FKHR protein. Thus, low doses of FSH given to HE rats stimulate a selective increase in phospho-Thr-24 FKHR in granulosa cells. hCG further increased to 10-fold the amount of phospho-Thr-24 FKHR relative to total FKHR at 2–8 h suggesting that activation of a specific kinase may be occurring in granulosa cells at this stage of differentiation. Because phosphorylation of Thr-24 by an unknown T24 kinase appears to be essential to restrict nuclear localization, at least in some cells (16), FSH and LH at high doses or in association with differentiation appear to enhance conditions favoring cytoplasmic, localization of FKHR. However, the exact ratio of nonphospho-(nuclear) to phospho-(cytoplasmic) FKHR in granulosa cells at any given time needs to be resolved to determine its functional activity as a transcription factor in vivo.

The phosphorylation pattern of FKHR Ser-256 was more complex. It was not related to the amount of FKHR protein, occurred transiently in response to FSH or hCG and decreased before that of phospho-Thr-24. Specifically, immunoreactive phospho-Ser-256 FKHR was detected in granulosa cells of H rat but increased only slightly in response to E2 (Fig. 5Go). Thus, the relative amount of phospho-Ser-256 FKHR to total FKHR decreased 80% in granulosa cells of HE rats. The functional significance of this is not yet clear. A high dose of FSH for 2 h stimulated a transient 2-fold increase in phospho-Ser-256 FKHR (relative to total FKHR protein). By 8 h, the amount phospho-Ser-256 FKHR decreased markedly to less than 90% of that in granulosa cells of HE rats. Although serine phosphorylation of FKHR was increased slightly by low doses of FSH for 48 h and by hCG at 2 h, no phospho-Ser-256 FKHR was detected 8–24 h after hCG as granulosa cells luteinize. In fact, immunoreactive phospho-Ser 256-FKHR declined by 90% before the loss of phospho-Thr-24 FKHR and FKHR protein (Fig. 5Go).

Phosphorylation of PKB
Although FKHR can be a substrate for PKB, the pattern of phosphorylated, activated PKB did not relate directly to that of total or phosphorylated FKHR (Fig. 5Go). Specifically, phospho-Ser-473 PKB and phospho-Thr-308 PKB were detected in granulosa cells of H and HE rats. Whereas the amount of phospho-Thre-308 was relatively constant, FSH stimulated an increase in phospho-Ser-473 PKB at 2 h, but this effect was transient and levels were reduced at 8 h. In contrast, the hCG stimulated phosphorylation of PKB at Ser-473 was sustained as the granulosa cells luteinize, a pattern previously seen in cultured granulosa cells (36). Because phospho-PKB was present in granulosa cells of H rats, it is clear that factors in addition to the gonadotropins stimulate PKB phosphorylation in vivo. One of these is likely to be endogenous IGF-I.

IGF-1Rß and Glut-1
The expression patterns of IGF-1Rß and Glut-1 protein were similar but less dramatic than that of FKHR (Fig. 5Go, upper panels). Both proteins were low in granulosa cells of H rats but increased in response to E2 (HE). IGF-1Rß further increased 2 h after acute administration of FSH and hCG but decreased approximately 50% in luteinized ovaries of HEF, hCG-treated rats. In contrast, Glut-1 was still easily detected in ovaries of HEF, hCG-treated rats. Thus, E2 coordinately up-regulates three components of the IGF-I pathway in growing follicles, namely, FKHR (7.5-fold), Glut-1 (~3-fold), and IGF-1Rß (~1.5-fold), whereas hCG down-regulates these same components in association with luteinization.

FSH and IGF-I Differentially Regulate Expression of FKHR, IGF-I, Sgk, and ERß in Cultured Granulosa Cells
To determine more directly if the expression of either FKHR and/or IGF-I mRNA was regulated by FSH, a granulosa cell culture system was used (55, 56). Granulosa cells were isolated from E2-primed immature rats and cultured overnight on serum-coated plates in defined medium without serum. At that time, FSH (50 ng/ml) and T (10 ng/ml) were added to the cells for 2 h to examine the acute affects or 48 h to analyze changes associated with granulosa cell differentiation (i.e. cells that express aromatase, LH receptor, and other genes indicative of a preovulatory phenotype). The PKA inhibitor H89 or the PI3K inhibitor LY294002 was added 4 h before the addition of hormone (t=0) or 4 h before the preparation of the extracts at 48 h. RNA was extracted and expression of FKHR and IGF-I mRNA was analyzed by RT-RCR using specific primers as described in Materials and Methods.

FKHR mRNA was elevated in granulosa cells cultured in defined medium alone (Fig. 6Go, A and C, control), indicating that FKHR expression is not acutely affected by overnight culture in the absence of hormone. FSH/T caused FKHR mRNA to decrease dramatically within 2 h (Fig. 6Go, solid bars, lane 2; P < 0.01), a response similar to that of HE granulosa cells exposed to high FSH in vivo (Figs. 4Go and 5Go). This rapid FSH-mediated decrease in FKHR was blocked by the addition of the PKA inhibitor H89 or the PI3K inhibitor LY294002 (lanes 3–5) indicating that multiple signaling pathways regulate FKHR expression. After 48 h of culture in the presence of FSH/T, FKHR mRNA was low (25% of control at 0 h; P < 0.02) (Fig. 6Go; hatched bars, lanes 6 vs. 1, respectively) and was not increased by a 4 h exposure to H89 or LY294002 (hatched bars; lanes 7–10). FSH/T also reduced the expression of IGF-I mRNA at 2 h and 48 h (Fig. 6BGo; P < 0.01). H89 and LY294002 blocked the effect at 2 h but were less effective at 48 h. Although not shown, the effects of forskolin (10 µM) were similar to those of FSH. Thus FSH/cAMP can acutely repress expression of FKHR and IGF-I by mechanisms that are PKA and PI3K dependent, whereas the loss of FKHR and IGF-I mRNA associated with granulosa cells differentiation appears to involve additional mechanisms.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. Expression of FKHR and IGF-I mRNA Is Down-Regulated by FSH in Cultured Granulosa Cells

Granulosa cells were isolated from E2-primed immature rats and cultured overnight in serum-free medium. At that time, hormones FSH (50 ng/ml) and T (10 ng/ml) were added for 2 h (closed bars) and 48 h (hatched bars). A-kinase and PI3K inhibitors (H89 and LY294002, respectively) were added at the indicated concentrations 4 h prior to the addition of hormone in the 2 h treatment group or 4 h before extraction of the RNA in the 48 h samples. RT-PCRs were performed as described in Materials and Methods. In these reactions, FKHR (A), IGF-I (B), and L19 cDNAs were amplified in separate reactions after a single RT step.

 
To compare the effects of FSH/T on expression of FKHR mRNA with those of IGF-I, additional experiments were done. Granulosa cells were cultured in the presence of media alone (C, control), IGF-I, FSH/T, or FSH/T/IGF-I with or without LY294002 for 2 h or 48 h. As shown (Fig. 7Go; 2 h, dark bars), FKHR mRNA was elevated in cells cultured in medium alone or with LY294002 alone (lanes 1 and 6, respectively) but was reduced dramatically (P < .01) in cells cultured with FSH/T, IGF-I or the combination of FSH/T/IGF-I for 2 h (lanes 2–5). At 48 h (Fig. 7Go; open bars), FKHR mRNA was elevated in cells cultured in medium alone (lane 7) or with IGF-I alone (lane 9, solid arrow) but was reduced (P < .001) in cells cultured with FSH/T (lane 8, open arrow). The addition of IGF-I or LY294002 in the presence of FSH/T did not prevent the marked down-regulation of FKHR mRNA at 48 h (lanes 10–12) indicating the actions of FSH/T and IGF-I are distinct at this time.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 7. FSH/T and IGF-I Differentially Regulate Expression of FKHR, IGF-I, Sgk, and ERß in Cultured Granulosa Cells

Granulosa cells were cultured as described in the legend of Fig. 6Go in the presence of FSH/T, IGF-I (30 ng/ml), FSH/T/IGF-I with or without LY294002, 25 µM. FKHR, IGF-I, Sgk, and ERß mRNA was analyzed by RT-PCR using specific primers and analyzed relative to L19 used as the internal standard. Assays were repeated at least three times. The open and solid arrows denote selected samples in which FSH/T and IGF-I exert different effects on the expression of the designated amplified gene products.

 
FSH/T also markedly down-regulated IGF-I mRNA in granulosa cells cultured for 48 h with or without the presence of IGF-I (Fig. 7Go, lane 8, open arrow; P < 0.001) supporting observations that IGF-I is not expressed in luteinized cells (2). IGF-I alone did not alter the expression of IGF-I mRNA (lane 9, solid arrow). In marked contrast, FSH/T increased (P < .01) the expression of Sgk at 2 h (Fig. 7Go; closed bars, lanes 2, 4) and 48 h (Fig. 7Go; open bars; lanes 8 and 10; open arrows). The addition of IGF-I alone did not induce expression of Sgk in these granulosa cells (lanes 3 and 9) whereas the addition of LY294002 blocked the actions of FSH/T (lanes 5, 6, 11, 12). Thus, the down-regulation by FSH/T of FKHR and IGF-I mRNAs at 48 h is inversely related to the expression of Sgk and occurs in a temporal manner similar to that observed when granulosa cells luteinize in response to hormones in vivo (Figs. 1–4GoGoGoGo). Furthermore, the up-regulation of Sgk by FSH/T at 48 h cannot be mimicked by IGF-I alone but appears to involve, at least in part, a PI3K-dependent step (Fig. 7Go).

To determine if IGF-I alone could regulate transcription factors that impact either the estrogen or FSH pathways, these same samples were analyzed for expression of ERß and ER{alpha} (57), each of which may mediate specific granulosa functions such as the expression of FKHR, IGF-1Rß, and Glut-1 (Figs. 1Go, 4Go, 5Go). At 2 h, neither IGF-I nor FSH altered ERß mRNA (Fig. 7Go; closed bars) or ER{alpha} mRNA (not shown; Ref. 57). IGF-I increased and/or maintained expression of ERß mRNA but had little effect on ER{alpha} mRNA after 48 h in culture (Fig. 7Go, open bars; lane 9, solid arrow). In addition, the PI3K inhibitor, LY294002 blocked the effects of IGF-I, suggesting that a PI3K pathway may support expression of ERß at this time. In contrast, control cells cultured in medium alone or with FSH/T for 48 h expressed low levels ERß mRNA (lanes 7 and 8, open arrow) and FSH impaired the effects of IGF-I on ERß (lanes 10 and 11). Thus, FSH, E2 and IGF-I regulate transcription FKHR, IGF-I, Sgk and ERß by mechanisms that appear to be distinct, especially in differentiated granulosa cells.

FKHR and PKB Are Rapidly Phosphorylated in Response to FSH/T and IGF-I in Cultured Rat Granulosa Cells: Nuclear vs. Cytoplasmic Localization
To determine if the different responses of granulosa cells to FSH/T and IGF-I were related to changes in the phosphorylation of FKHR, we next determined if FSH and/or IGF-I stimulated the phosphorylation of FKHR and if FKHR phosphorylation altered its intracellular localization in cultured granulosa cells. Accordingly, granulosa cells were isolated from E2-primed immature rats and cultured overnight on serum-coated plates in defined medium without serum. At that time, decreasing doses of either FSH (50–5 ng/ml in the presence of 10 ng/ml T) or IGF-I (30–5 ng/ml) were added to the cells for different intervals of time (0–90 min, 2, or 48 h). Whole cell extracts (WCE) were prepared and the samples were analyzed by Western blots using antibodies to total FKHR, phospho-specific FKHR or phospho-PKB antibodies as indicated in Materials and Methods. To analyze the subcellular localization of FKHR and PKB, some cells were plated on coverslips, fixed in 4% paraformaldehye, and analyzed by immunocytochemical procedures using the same antibodies as in the Western blots.

Western blots show that the total amount of FKHR protein remained relatively constant in granulosa cells exposed for 0–90 min to FSH/T) but was reduced 50% in the presence of 30 ng/ml IGF-I (Fig. 8AGo; lanes 1–7 vs. lanes 8–13, respectively). FSH/T initiated rapid phosphorylation of FKHR on Thr-24 and Ser-256 as well as FKHRL1 on Ser-315 (Fig. 8AGo). Increased levels of phospho-FKHR-Thr-24 and FKHRL1-Ser-315 were sustained for as long as 90 min. In contrast, the amount of FKHR phospho-Ser-256 was elevated 6- to 4-fold between 5–30 min (lanes 2–4) but was nondetectable by 90 min (lane 5) even at lower concentrations (25 and 5 ng/ml) of FSH (lanes 6 and 7). IGF-I (30 ng/ml) also stimulated rapid and sustained increases FKHR phospho-Thr-24 and FKHRL1 phospho-Ser-315. Phosphorylation of Ser-256 FKHR also increased rapidly in response to IGF-I but then declined by 90 min (Fig. 8AGo, lanes 8–11) although lower concentrations of IGF-I supported phosphorylation at 90 min (lanes 12 and 13). In these same samples (Fig. 8AGo), FSH/T and IGF-I also stimulated the phosphorylation of PKB. However, despite the remarkably similar phosphorylation patterns of FKHR (and FKHRL1) induced by FSH/T and IGF-I, 30 ng/ml of IGF-I was two to three times more potent than 50 ng/ml of FSH/T in phosphorylating PKB Ser-473. Moreover, the phosphorylation of PKB persisted, whereas that of FKHR (phospho-Ser-356) was transient.



View larger version (114K):
[in this window]
[in a new window]
 
Figure 8. FSH/T and IGF-I Phosphorylate FKHR and FKHRL1 in a Time- and Dose-Dependent Manner in Granulosa Cells in Culture

Granulosa cells were isolated from E2-primed immature rats and cultured in defined (serum-free) medium overnight. At that time FSH/T or IGF-I were added as indicated. A, Western blot: Cell extracts were prepared by scraping cells in boiling SDS buffer, equal volumes were resolved by SDS-PAGE and electrophorectically transferred to Immobilon filers. Proteins were visualized by using specific antibodies and ECL as described in Materials and Methods. A–C, Immunocytochemistry: Cells that were cultured on coverslips in medium alone or with agonists were fixed in 4% paraformaldehyde and analyzed by immunocytochemstry using the same antibodies used in the Western blots (A). Note that nonphosphorylated FKHR protein is nuclear in cells cultured in medium alone (B; Control, 0 h) but becomes rapidly localized to cytoplasmic structures in cells cultured with FSH/T or IGF-I for 5 min and 30 min but not at 1 min (B). The enlarged inset (B) depicts the typical intracellular localization of immunoreactive FKHR protein observed 5–30 min after treatment with FSH/T or IGF-I. Phosphoforms of FKHR exhibit a similar cytoplasmic localization when cultured with FSH/T (or IGF-I, not shown) for 30 min (A: Phospho-Thr24 and Phospho-Ser 256 FKHR). PKB was localized to a cytoplasmic perinuclear region but not the nucleus of granulosa cells cultured in medium alone (C, Control, 0 h). In cells stimulated by FSH/T (or IGF-I) for 30 min phospho-PKB exhibited a staining pattern similar to that of phospho-FKHR in the hormone-treated cells (compare C with A and B), respectively.

 
Immunocytochemical analyses showed that FKHR was localized to nuclei of granulosa cells cultured overnight in defined media without serum (Fig. 8BGo; Control, 0 h). In response to FSH/T or IGF-I FKHR protein remained nuclear for 1 min but rapidly localized to a distinct region of the cytoplasm within 5–30 min, as shown more clearly in the enlarged insert (Fig. 8BGo). This agonist-induced redistribution of FKHR was blocked by the addition of the PI3K inhibitor LY294002 for 1 h before hormone treatment, indicating that some component of the PI3K pathways regulates retention of FKHR in the cytoplasm. The cytoplasmic localization of immunoreactive FKHR was identical to the immunostaining pattern observed for phosph-Thr24 and phospho-Ser256 FKHR, indicating that restriction of FKHR from the nucleus is associated with its phosphorylation (Fig. 8Go; compare A and B; FSH/T, 30 min). In contrast to FKHR, immunostaining of nonphosphorylated PKB was localized around the nucleus of granulosa cells in the control cultures (Fig. 8Go, A and C; control 0 h). In hormone-treated cells, PhosphoSer-473 PKB localized as an intense dot adjacent to the nucleus. This pattern was highly similar in the cells stimulated by either FSH or IGF-I for 5–30 min (the latter is not shown) and appears similar to the pattern of phospho-FKHR. Immunostaining of PKB or phospho-PKB was not observed distinctly at the plasma membrane or in the nucleus at these time intervals (Fig. 8CGo).

Because FKHR is also a substrate for Sgk, we next determined if the hormone induced pattern of Sgk expression was related temporally to that of changes in FKHR phophorylation. Accordingly, granulosa cells were cultured for 48 h in medium alone with or without FSH/T, IGF-I or the combination. After 48 h of culture in medium alone, immunoreactive FKHR was easily detected in granulosa cell extracts, supporting the observations that FKHR expression (mRNA) is also not acutely dependent of hormonal regulation in these cells (Figs. 7Go and 9Go). However, when the cells were cultured in the presence of FSH/T or FSH/T/IGF-I for 48 h, the amount of FKHR protein decreased markedly to a level 40% of that in the control sample, confirming the down-regulation of FKHR message (Figs. 6Go and 7Go). At the same time, the levels of phospho-Ser-256 FKHR increased markedly in response to FSH/T (4-fold relative to total FKHR) or FSH/T combined with IGF-I (7-fold relative to FKHR). Exposing these cells to LY294002 but not H89 for 4 h reduced the amount of phospho-Ser-256 FKHR 80%. The FSH/T- and FSH/T/IGF-I-stimulated increases in phospho-Ser-256 FKHR at 48 h were associated with increased amounts and phosphorylation (multiple bands) of Sgk (Fig. 9Go, upper panel), supporting previous studies (36). FSH/T and FSH/T/IGF-I also stimulated increased levels of phospho-PKB Thr-308 (Fig. 9Go, lower panel) and phospho-PKB Ser-473 as shown previously (36). Thus, either or both Sgk and PKB could be the components of the PI3K pathway that mediate FSH (not IGF-I)-dependent FKHR phosphorylation in these differentiated granulosa cells.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 9. FSH/T-Stimulated Phosphorylation of FKHR (Ser-256) and PKB (Thr-308) Is Related to FSH/T Induction of Sgk

Granulosa cells were cultured as described in previous. After 48 h of culture with FSH/T, the amount of FKHR protein decreases whereas phosphorylation of Ser-256 and Thr-24 are increased. The increased phosphorylation of FKHR Ser-256 is temporally associated with the FSH/T-mediated induction of Sgk and the phosphorylation of PKB at Ser-308.

 
IGF-I alone, unlike FSH, did not induce Sgk (Fig. 9Go), supporting previous results (Fig. 7Go) (36). Furthermore, culturing granulosa cells with IGF-I alone for 48 h had little effect on the amount or phosphorylation of FKHR protein. Addition of forskolin for 2 h to cells cultured with IGF-I alone, decreased the amount of FKHR protein and thereby increased the relative phosphorylation of FKHR at Ser 256 (5-fold) and Thr-24 (6-fold). Thus, FSH/T (cAMP) more than IGF-I appear to be potent regulators of the FKHR expression and phosphorylation in these differentiating granulosa cells.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Results of these studies document for the first time 1) that FKHR (Foxo1), FKHRL1 (Foxo3), and AFX (Foxo4) are expressed in the rodent ovary at specific stages of follicular development and luteinization and 2) that FSH regulates transcription as well as phosphorylation of FKHR in granulosa cells. Specifically, FKHR is localized to granulosa cells of growing and preovulatory follicles but is not expressed in theca cells, CL, or stromal cells. Conversely, FKHRL1 and AFX showed highest expression in theca cells and CL. FKHR mRNA was also detected in immature oocytes contained within small primary follicles characterized by having 1–2 layers of granulosa cells. FKHR mRNA was not detected in mature, meiotically competent oocytes of preovulatory follicles. The significance of, or the factors mediating, this switch in FKHR expression in oocytes are not known. However, the factors controlling the expression and phosphorylation of FKHR in granulosa cells are more clearly defined.

We show herein for the first time that the expression of FKHR in granulosa cells is mediated at many levels by the intraovarian regulators E2 and IGF-I as well as external factors FSH and LH (see model, Fig. 10Go). Most striking is the pronounced ability of estrogen to increase levels of FKHR mRNA and protein in granulosa cells of H rats, indicating that E2 exerts a potent positive effect on this component of the IGF-I signal transduction cascade (Figs. 4Go, 5Go, 10Go). Moreover, estrogen not only increases expression of FKHR mRNA and protein but also up-regulates other notable components of the IGF-I signaling system, including IGF-1Rß subunit and the glucose transporter, Glut-1 (Fig. 5Go, 10Go). The coordinated up-regulation of FKHR with IGF-1Rß and Glut-1 indicate further that E2 enhances granulosa cell function in the H rat model by regulating three different targets that control cellular energy flow, glucose metabolism and cell survival. Because IGF-I helps maintain high expression of ERß mRNA, at least in cultured granulosa cells, and because Forkhead proteins can activate or repress ER (50, 51), at least in some situations, E2 and IGF-I appear to comprise an autocrine regulatory system in granulosa cells that promotes cell survival and proliferation (see model, Fig. 10Go).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 10. Schematic of Hypothetical Interactions of FSH, E2, and IGF-I Signaling Pathways in Granulosa Cells

First, FSH/PMSG (via aromatase and production of E2 [E]) impacts the IGF-I signaling cascades by increasing the cellular levels of FKHR mRNA and protein, as well as IGF-1Rß and Glut-1 protein. Second, IGF-I supports expression of ERß. Thus, IGF-I and E2 (via FSH) comprise an autocrine regulatory system in granulosa cells favoring energy flow, glucose metabolism and cell survival. Third, FSH and more specifically LH (via cAMP) markedly down-regulate FKHR (but not FKHRL1 or AFX) but increase Sgk expression as the granulosa cells differentiate to nondividing luteal cells indicating FKHRL1 and AFX may be targets of Sgk in luteal cells. Fourth, superimposed on the transcriptional regulation of FKHR by IGF-I, E2, and FSH is the ability of IGF-I and FSH to stimulate PI3K-dependent phosphorylation of FKHR leading to its redistribution from the nucleus to the cytoplasm of granulosa cells. This provides an acute mechanism by which to reduce the amount of transcriptionally active FKHR in the cell but the short-term vs. long-term consequences of this on granulosa cell function are not yet defined but likely enhance proliferation and differentiation. Thus, as a target of IGF-I, E2, and FSH/cAMP signaling in granulosa cells, FKHR as well as FKHRL1 and AFX likely coordinate numerous cell survival mechanisms involving proliferation, apoptosis and differentiation.

 
The regulated expression of FKHR by FSH is more complex and dependent on the dose of hormone and the stage of granulosa cell differentiation. For example, in the mouse model, PMSG stimulates the growth of preovulatory follicles that synthesize increased amounts of E2. Thus, the increased expression of FKHR in these ovaries is the combined result of the actions of the gonadotropin that induces aromatase and the consequent production of E2 (55, 58). Based on the results obtained in the H rat model, E2 more than FSH per se is the major factor that increases FKHR mRNA and protein in granulosa cells of growing follicles. Although low levels of FSH can support some expression of FKHR mRNA and protein as preovulatory follicles develop, exposure of preantral follicles of HE rats to high FSH rapidly down-regulates FKHR expression (mRNA and protein) (Figs. 4Go and 5Go). Exposure of preovulatory follicles to hCG irreversibly down-regulates FKHR expression in mouse and rat granulosa cells as they terminally differentiate to nondividing luteal cells. The inhibitory effects of FSH and LH in vivo are mimicked in cultured granulosa cells where FSH or forskolin (but not IGF-I) caused a dramatic down-regulation of FKHR mRNA as the granulosa cells differentiated (Figs. 1Go, 4–7GoGoGoGo). Thus, at the transcriptional level, E2 and IGF-I appear to support FKHR expression, whereas agonists that stimulate cAMP signaling cascades exert negative regulatory effects both by decreasing transcription of the FKHR gene (Fig. 10Go).

Regulation of Forkhead family members of the Foxo subclass occurs not only at the level of their transcription and expression but also by phosphorylation (16, 20). Specifically, IGF-I-induced phosphorylation of FKHR by PKB (or related kinases) (16) leads to a decrease in apoptotic signals because the movement of phospho-FKHR to the nucleus is restricted (20) and thereby blocks its transcriptional activation of genes such as FasL, p27KIP, and IGFBP-1. Although this model is attractive and supported by an abundance of data in other systems, (primarily cotransfection analysis in cultured cells (21, 22, 23), the role of Forkhead proteins in granulosa cells and the oocyte has not yet been determined. Moreover, each Forkhead gene is expressed in a cell-specific manner at defined stages of follicular growth. Most intriguing are the data that show the levels of FKHR mRNA protein and phosphorylation are not strictly associated with follicles that are undergoing apoptosis. Rather, FKHR is most abundant in granulosa cells that are highly proliferative (26, 48, 59), express high levels of cyclin D2 (59), and ERß (57) and show increased staining for PCNA/BrdU (26). In addition, these cells express Glut-1, a requisite for energy homoestasis. It is important to note that granulosa cells of healthy follicles also express FasL (24, 25) and p27KIP (26, 59). Apoptosis can be triggered in these granulosa cells by specific insults (24) or changes in the hormonal milieu, indicating that neither FasL nor FKHR per se triggers apoptosis but may facilitate the process.

Granulosa cells become resistant to apoptotic insult if they are stimulated with FSH/LH to undergo luteinization (24). At this stage of differentiation, factors that impact proliferation (E2, IGF-I, cyclin D2) and apoptosis (FKHR and FasL) are lost, whereas factors that are expressed in luteal cells and presumed to impact luteinization (FKHRL1, AFX, Sgk, IGFBP-1, p27KIP, and p21CIP) are increased or acquired (Fig. 10Go). Therefore, it is possible that FKHR, FKHL1, and AFX exert different functions that are dependent on the cell type, stage of cell differentiation, or specific associated proteins. In this regard, one study reports that AFX up-regulates p27KIP (22). In another study, Tanaka et al. (60) show that expression of FKHRL1 does not activate p21CIP or p27KIP promoter activity or regulate Fas L expression. Therefore, the precise relation of FKHR proteins to the regulation of these genes remains uncertain. Recently, FKHR has been shown to interact with and selectively modify the functional activity of other transcription factors, specifically members of the nuclear steroid receptor superfamily (50, 51). FKHRL1 and AFX may have similar or different capabilities. Thus, the function of Forkhead proteins may depend not only their specific transcriptional activities but also on the hormonal milieu, the cell context, and the levels of proapoptotic and antiapoptotic factors (61, 62).

Based on the current model of the IGF-I signal transduction, we initially predicted that PKB and Sgk activation (i.e. phosphorylation) would be related to the phosphorylation of FKHR in granulosa cells. This model now appears to be too simplistic, at least for granulosa cells in vivo. In granulosa cells of H rats, PKB was phosphorylated on Ser-473 and Thr-308 at many stages of follicular development, even in the absence of E2, FSH, and LH. Thus, factors other than the gonadotropins can regulate intrafollicular phosphorylation of PKB in these follicles. This is not surprising because many growth factors can impact the PI3K/PDK1/PKB pathway (14) and because IGF-I remains expressed in granulosa cells of H rats (2). Furthermore, the pattern of PKB phosphorylation at Ser-473 or Thr-308 in granulosa cells of H rats does not relate temporally or hormonally to the expression or phosphorylation of FKHR, a presumed direct target of PKB (Fig. 5Go) (14, 16). Thus, PKB may be one but not the only regulator of FKHR in granulosa cells in vivo. A specific isoform of PKB or Sgk may be critical (63). Or, other kinases may be important.

In cultured granulosa cells, phosphorylation of FKHR as well as PKB is induced rapidly by FSH and/or IGF-I with remarkably similar kinetics during the initial phase of stimulation. FKHR that is nuclear localized in unstimulated cells cultured in serum-free medium is rapidly redistributed to cytoplasmic structures in response to either FSH or IGF-I within 5 min and is retained for at least 30 min. At later stages of culture when the granulosa cells have become more differentiated, FSH/T and IGF-I exert different effects on the amount and phosphorylation of FKHR (Fig. 9Go). FSH/T decreases the amount of FKHR protein, whereas IGF-I does not. Nor does IGF-I prevent the FSH-mediated loss of FKHR protein or RNA. At the same time, FSH/T increases the relative amount of phospho-Ser-256 FKHR, indicating this phospho-form is markedly increased relative to the nonphospho-form of FKHR. This effect of FSH/T appears to be related, in part, to the induction and phosphorylation of Sgk at this time (Fig. 9Go) (36, 38) as well as to increased activation of PKB (Fig. 9Go) (36). Whether or not these kinases have overlapping or redundant functions in differentiated granulosa cells remains to be determined in vitro as well as in vivo. However, it is tempting to speculate that Sgk may impact other aspects of granulosa cell function to repress expression of FKHR and increase FKHRL1 and AFX. To what extent this apparent switch in Forkhead proteins (or the marked decrease in FKHR alone) impacts luteinization or permits granulosa cells to become resistant to apoptotic insults is not yet known.

Based on these studies our working model (Fig. 10Go) is that FKHR, FKHRL1, and AFX are expressed in the rodent ovary. FKHR is selectively expressed in granulosa cells of growing follicles and in these cells, is differentially regulated by hormones. First, FSH/PMSG via aromatase and production of E2 enhance the IGF-I signaling cascades by increasing the cellular levels of FKHR mRNA and protein as well as IGF-1Rß and Glut-1 protein. Second, IGF-I supports expression of ERß. Thus, E2 (via FSH and aromatase) and IGF-I appear to comprise an autocrine regulatory system in granulosa cells favoring energy flow, glucose metabolism and cell survival. Conversely, FSH and more specifically LH (via cAMP) markedly down-regulate FKHR (but not FKHRL1 or AFX) expression as granulosa cells differentiate to nondividing luteal cells. Superimposed on the transcriptional regulation of FKHR by FSH, E2, and IGF-I is the ability of FSH and IGF-I to stimulate rapid PI3K-dependent phosphorylation of FKHR. Both FSH and IGF-I can stimulate rapid phosphorylation of FKHR (and FKHRL1) at multiple serine and threonine residues that is PI3K dependent and may be mediated in part by activation of PKB and induction of Sgk in differentiated granulosa cells. Phosphorylation of FKHR is associated with its redistribution from the nucleus to the cytoplasm of granulosa cells. Although this provides an acute mechanism by which to reduce the amount of transcriptionally active FKHR in the cell, the short-term vs. long-term consequences of this on granulosa cell function are not yet clear. The precise ratio of nonphospho (nuclear) FKHR to phospho (cytoplasmic) FKHR in vivo and in vitro in not known and likely depends on the activities of many factors that impact granulosa cell function. Thus, although some of the transcriptional regulators of FKHR in granulosa cells have been identified, the targets of FKHR are not yet known. The elevated expression of FKHR in granulosa cells of growing follicles indicates that it is linked to the proliferative as well as apoptotic pathways in granulosa cells. Expression of FKHRL1 and AFX (but not FKHR) in luteal cells provides an additional layer of regulation. Combined FKHR, FKHRL1, and AFX may help coordinate proliferative, apoptotic, and differentiative events in the ovary.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
Immature female and male C57BL/6 mice were obtained from Harlan Sprague Dawley, Inc. (Indianapolis, IN). On d 23 of age, female mice were injected ip with 4IU of PMSG (Pregnyl; Organon, West Orange, NJ) to stimulate follicular growth followed 48 h later with 5 IU hCG (Gestyl; Diosynth, Oss, The Netherlands) to stimulate ovulation and luteinization (64). Timed-pregnant mice were also obtained from Harlan. Intact immature female Sprague-Dawley rats as well as immature H rats on d 26 of age were obtained from Harlan Sprague Dawley, Inc. (Indianapolis, IN). H rats were injected sc with E2 (HE; 1.5 mg/0.2 ml propylene glycol; Sigma, St. Louis, MO) once daily for 3 d to stimulate the growth of large preantral follicles. HE rats either received by a single injection ip 10 µg FSH (NIH-FSH-16; generously provided by Al Parlow) to mimic the equivalent of an FSH surge or received twice daily injections (1.0 µg/0.1 ml saline, sc) of FSH for 2 d (HEF, 48) to stimulate growth of preovulatory follicles. HEF rats were injected ip with an ovulatory dose (10 IU/0.2 ml saline) of hCG to stimulate ovulation (occurring about 16 h post hCG) and luteinization (complete by 24 h post hCG) (65). Animals were treated in accordance with the principles and procedures outlined in "Guidelines for Care and Use of Experimental Animals".

Cell Culture
Intact immature (23 d of age) rats were primed with E2 (1.5 mg/0.2 ml propylene glycol) for 3 d. Granulosa cells were harvested by needle puncture, pooled, and plated according to routine procedures (55, 66). Cells were cultured on serum-coated plated in defined, DMEM-F12 medium with and without FSH (NIH-FSH-16, the generous gift of Al Parlow), T (from Steraloids, Keene, NH), forskolin, IGF-I and H89 (from Calbiochem, San Diego, CA) or LY294002 (Alexis, San Diego, CA).

In Situ Hybridization
Primers (as described below) were designed to amplify specifically cDNAs encoding mouse and rat FKHR (Foxo1) as well as mouse AFX (Foxo4) and FKHRL1 (Foxo3) mRNAs. The mouse FKHR, FKHL1 and AFX cDNAs were amplified, and subcloned into the pCR4-TOPO vector (Invitrogen,Carlsbad, CA). In situ hybridization was performed as described previously by Wilkenson (67) and as reported by our laboratory (59). Ovaries from mice and rats were fixed immediately in 4% paraformaldehyde in PBS overnight at 4 C before dehydration and paraffin embedding. Sections (6 mm) were baked at 42 C overnight onto 3-amino propyltriethoxysilane coated slides. Slides were prehybridized, hybridized, washed, exposed, and developed as previously described (59). The 35S-labeled riboprobes were also produced as previously described using the Riboprobe In Vitro Transcription Systems Kit from Promega Corp. (Madison, WI). Sgk sense and antisense probes were produced by transcription from the T3 and T7 promoters, respectively, on the NheI digested pBS-sgk vector (32). FKHR, FKHRL1, and AFX sense and antisense probes were produced by transcription from the T3 and T7 promoters using NotI and SpeI digested vector, respectively. Each slide was incubated in 80 µl of hybridization solution containing 5 million counts of the appropriate probe overnight at 55 C in a humid chamber. After washing, slides were exposed overnight to X-OMAT-AR film, dipped in NTB-2 emulsion, and developed (reagents from Eastman Kodak Co., Rochester, NY) according to the intensity of the x-ray film. For most experiments, 3 d of exposure were sufficient to obtain a strong signal. For each in situ hybridization analysis, slides containing ovaries in each treatment group were included to permit direct comparisons of the relative amount of each mRNA signal during follicular development and luteinization. Slides hybridized with the sense probes were also done for each experiment to control for background.

RT-PCRs
RT-PCRs were performed according to established procedure (68). Briefly, total RNA was extracted from tissues or cells with TRIzol (Life Technologies, Inc., Grand Island, NY) and purified by the manufacturer’s specification. Total RNA (300 ng) was reversed transcribed using was reverse transcribed using oligo polydeoxythymidine (Pharmacia Biotech Inc., Piscataway, NJ) and avian myeloblastosis virus reverse transcriptase (Promega Corp., Madison, WI). To determine the linear range of amplification for specific mRNAs, 300 ng RNA was reverse-transcribed and amplified in a range of cycle numbers. Next, increasing amounts of RNA (75–1200 ng) was reverse-transcribed and PCR-amplified at a selected cycle number. Products were amplified using specific primer pairs within the linear range for each gene product. RT-PCR (from 300 ng RNA) for FKHR, IGF-I and Sgk for (r > 0.91) after 25 cycles. Thirty cycles were linear for FKHRL1 (r > 0.95), AFX ER{alpha}, and ERß. Amplified products were resolved by PAGE. Dried gels were quantitated using a Storm 860 PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and exposed to autoradiographic film. The authenticity of each product was verified by cloning, sequence analyses or restriction digests.

Primers (from Genosys, The Woodlands, TX):

Mouse Sgk (accession no. AF205855): 1214–1561: forward 5'-gcacttcgatcccgagttta; reverse 5'-ttgagaggagggtgtgctct

Rat Sgk (accession no. NM019232): 1725–2076: forward 5'-ctgcaatgtgccttttctga; reverse 5'-atgcttccctcaagcatctg

Rat/mouse IGF-I (accession no. M15649; J02743): 397–793: forward 5'-gaacagaaaatgccacgtca; reverse 5'-gcagccaaaattcagagagg

Mouse/rat FKHR/Foxo1 (accession no. AF114258): 1399–1798: forward 5'acgtgccattccctggtgtat; reverse 5'-tcattgtggggaggagagtc

Mouse FKHR2/FKHRL1/Foxo3 (accession no. AF114259): forward 5'-gtcatgggccacgataagtt; reverse 5'-gggctgctaacagtctctgc

Mouse AFX/Foxo4 (accession no. Ab032770): forward 5'-cctcctgctgatgtcctcat; reverse 5'-tgctgtgactcagggatctg

Rat ERß’3a forward 5'-ttcccggcagcaccagtaacc; reverse 5'-tccctctttgcgtttggacta (47)

Rat ER{alpha}: forward 5'-aattctgacaatcgacgccag; reverse 5'-gtgcttcaacattctccctcctc

L19 primers were as described (69).

Western Blot Analyses: Antibodies
Antibodies were obtained from Cell Signaling Technology, Inc. (Beverly, MA) for FKHR (no. 9462), FKHR phospho-Thr-24 (no. 9464), FKHR-phospho-Ser-256 (no. 9461); PKB/Akt (no. 9916), PKB-phospho-Ser-473 (no. 9971), PKB-phospho-Thr-308 (no. 9275), from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) for IGF-1Rß (sc 713), from Chemicon (Temecula, CA) for Glut-1 (no. AB1340), and from Upstate Biochemical (Lake Placid, NY) for IRS-2 (no. 06–506) and FKHRL1 phospho-Ser-253 (no. 06–953). Antibody for FLKHRL1 phospho-Ser-315 was generously provided by Dr. Michael Greenberg (MIT, Boston, MA). Anti-Sgk antibody was generously provided by Dr. Gary L. Firestone (UC Berkeley, Berkeley, CA).

Cell Extracts
Protein was isolated from granulosa cells and luteal cells by homogenization in WCE buffer (10 mM Tris, 1 mM EDTA, 1 mM DTT, 400 mM KCl, 10% glycerol, 1 mM PMSF, 1 mM vanadate, 1 mM diethyl dithiocarbamic acid, 0.1 mg/ml aprotinin) followed by centrifugation (1 min in microfuge) to isolate soluble protein (36, 38). Concentrations of soluble protein in each sample were determined by Bradford assay [Bio-Rad Laboratories, Inc. (Hercules, CA) reagents]. Western blots were run using 30 µg of WCE protein. For in vitro experiments with granulosa cells cultured with or without agonist stimulation, protein extracts were prepared by adding 200 µl of boiling SDS buffer to each well (70), scraping followed by boiling for 5 min. Twenty microliters of each sample in each treatment group were analyzed.

Blotting
One dimensional SDS-PAGE with 4.5% stacking and 10% separating acrylamide gels was used to resolve proteins. Proteins were electrophoretically transferred to 0.45-mm Immobilon membranes and blocked for 1 h in PBS containing 5% milk and 0.1% Tween-20. After one 20-min incubation in wash solution (1% milk in PBS and 0.1% Tween-20), filters were incubated overnight at 4 C with a 1:1000 dilution of all antibodies with the exception of IGF-1Rß (1:500) and PKB phospho-Ser-308 (1:100). After 3 washes (10 min each), blots were incubated with 1:10,000 antirabbit-HRP with the exception of PKB phospho-Ser-308 (1:500). Blots were washed as described above and the immunopositive bands detected using the enhanced chemiluminescence assay system, ECL. Immunoreactive signals were analyzed and quantified using an AlphaImager 2000 (3.3) (Alpha Innotech Corp., San Leandro, CA).

Immunocytochemistry
Immunocytochemistry was performed as previously described (36, 38). Cells were cultured on serum-coated coverslip in defined medium. Agonists were added as described and cells were fixed in 4% paraformaldehyde. Cells were permeabilized with 0.5% NP-40 in saline and processed by routine procedures. Primary antibodies were diluted 1:50 and the fluorescein-labeled IgG (Pierce Chemical Co., Rockford, IL) diluted 1:20.


    ACKNOWLEDGMENTS
 
The authors wish to thank Dr. Michael Greenberg for providing the FKHRL1-Ser-315 specific antibody and Gary L. Firestone for providing the Sgk antibody.


    FOOTNOTES
 
This work was supported in part by NIH Grant HD-16272.

Abbreviations: AFX, A Forkhead transcription factor; CL, corpora lutea; CREB, cAMP response element binding protein; FasL, Fas ligand; FKHR, Forkhead homolog in rhabdomysarcoma; FKHRL1, Forkhead-like protein-1; H, hypophysectomized; hCG, human CG; HE, E2 primed; HEF, hypophysectomized, E2 and FSH treated; IRS 1-2, insulin receptor substrates; PDK1/2, phosphoinositide-induced kinases; PKB, protein kinase B; Sgk, serum and glucocorticoid-induced kinase; WCE, whole cell extracts.

Received for publication September 4, 2001. Accepted for publication December 21, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Bellve AR, Efstratiadis A 1996 Effects of an Igf1 gene null mutation on mouse reproduction. Mol Endocrinol 10:903–918[Abstract/Free Full Text]
  2. Zhou J, Kumar TR, Matzuk MM, Bondy C 1997 Insulin-like growth factor I regulates gonadotropin resonsiveness in the murine ovary. Mol Endocrinol 11:1924–1933[Abstract/Free Full Text]
  3. Burks DJ, de Mora JF, Schubert M, Withers DJ, Myers MG, Towery HH, Altamuro SL, Flint CL, White MF 2000 IRS-2 pathways integrate female reproduction and energy homeostasis. Nature 407:377–382[CrossRef][Medline]
  4. Guidice LC 2000 IGFs in the female reproductive system. In: Rosenfeld, R, Roberts C, eds. Contemporary endocrinology: the IGF system. Totowa, NJ: Humana Press; 379–404
  5. Adashi EY, Resnick CE, D’Ercoel AJ, Svoboda ME, Van Wyk JJ 1985 Insulin-like growth factors as intraovarian regulators of granulosa cell growth and function. Endocr Rev 6:400–420[Abstract/Free Full Text]
  6. Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725–751[Abstract/Free Full Text]
  7. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM 1999 Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 13:1035–1048[Abstract/Free Full Text]
  8. Vainio S, Heikkila M, Kispert A, Chin N, McMahon AP 1999 Female development in mammals is regulated by Wnt-4 signalling. Nature 397:405–409[CrossRef][Medline]
  9. Hsieh M, Johnson M, Greenberg NM, Richards JS 2002 Regulated expression of Wnt and Frizzled signals in the rodent ovary. Endocrinology 143:898–903[Abstract/Free Full Text]
  10. Richards JS, Russell DL, Ochsner S, Espey LL 2002 Ovulation: new dimensions and new regulators of the inflammatory-like response. Annu Rev Physiol 64:02.1–02.24
  11. Orly J 2000 Molecular events defining follicular developments and steroidogenesis in the ovary. Totowa, NJ: Humana Press
  12. Richards JS 2001 New signaling pathways for hormones and cyclic adenosine 3',5'-monophosphate action in endocrine cells. Mol Endocrinol 15:209–218[Abstract/Free Full Text]
  13. LeRoith D, Werner H, Beitner-Johnson D, Roberts Jr CT 1995 Molecular and cellular aspects of insulin-like growth factor I receptor. Endocr Rev 16:143–163[Abstract/Free Full Text]
  14. Vanhaesebroeck B, Alessi DR 2000 The PI3K-PDK1 connection: more than just a road to PKB. Biochem J 346:561–576
  15. Guarente L, Kenyon C 2000 Genetic pathways that regulate ageing in model organisms. Nature 408:255–262[CrossRef][Medline]
  16. Nakae J, Barr V, Accili D 2000 Differential regulation of gene expression by insulin and IGF-1 receptors correlates with phosphorylation of a single amino acid residue in the forkhead transcription factor FKHR. EMBO J 19:989–996[CrossRef][Medline]
  17. Hill MM, Andjelkovic M, Brazil DP, Ferrari S, Fabbro D, Hemmings BA 2001 Insulin-stimulated protein kinase B phosphorylation on Ser-473 is independent of its activity and occurs through a staurosporine-insensitive kinase. J Biol Chem 276:25643–25646[Abstract/Free Full Text]
  18. Brunet A, Park J, Tran H, Hu LS, Hemmings BA, Greenberg ME 2001 Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21:952–965[Abstract/Free Full Text]
  19. Kaestner KH, Knochel W, Martinex DE 2000 Unified nomenclature for the winged helix/forkhead transcription factors. Genes Dev 14:142–146[Free Full Text]
  20. Brownawell AM, Kops GJPL, Macara IG, Burgering BMT 2001 Inhibition of nuclear import by protein kinase B (Akt) regulates the subcellular distribution and activity of the forkhead transcription factor AFX. Mol Cell Biol 21:3534–3546[Abstract/Free Full Text]
  21. Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, Anderson MJ, Arden KC, Blenis J, Greenberg ME 1999 Akt promotes cell survival by phosphorylating and inhibiting a forkhead transcription factor. Cell 96:857–868[CrossRef][Medline]
  22. Medema RH, Kops GJP, Bos JL, Burgering BMT 2000 AFX-like forkhead transcription factors mediate cell cycle regulation by Ras and PKB through p27KIP1. Nature 404:782–787[CrossRef][Medline]
  23. Kops GJPL, de Ruiter ND, De Vries-Smits AMM, Powell DR, Bos JL, Burgering BMTh 1999 Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature 398:630–634[CrossRef][Medline]
  24. Porter DA, Vickers SL, Cowan RG, Huber SC, Quirk SM 2000 Expression and function of Fas antigen in bovine granulosa cells and theca cells during ovarian follicular development and atresia. Biol Reprod 62:62–66[Abstract/Free Full Text]
  25. Kim J-M, Yoon Y-D, Tsang BK 1999 Involvement of the Fas/Fas Ligand system in p53-mediated granulosa cell apoptosis during follicular development and atresia. Endocrinology 140:2307–2317[Abstract/Free Full Text]
  26. Robker RL, Richards JS 1998 Hormonal control of the cell cycle in ovarian cells: proliferation vs. differentiation. Biol Reprod 59:476–482[Free Full Text]
  27. Butler AA, LeRoith D 2001 Minireview: Tissue-specific versus generalized gene targeting of the igf1 and igf1r genes and their roles in insulin-like growth factor physiology. Endocrinology 142:1685–1688[Abstract/Free Full Text]
  28. Arraztoa JA, Kadadia R, Bondy C, Zhou J, Impaired granulosa cell proliferation in the IGF1 null ovary. Program of the 83rd Annual Meeting of The Endocrine Society, Denver, CO, 2001, p 377 (Abstract P2–393)
  29. Zaczek D, Service D, Bartke A, Coschigano K, Suen L, Wandji S, Hammond J 2001 Ovarian follicles are reduced in number but not function in GH receptor (GHR) knockout (KO) mice. Program of the 83rd Annual Meeting of The Endocrine Society, Denver, CO, 2001, p 377 (Abstract P2–394)
  30. Zhou J, Chin E, Bondy C 1991 Cellular pattern of insulin-like growth factor-1 (IGF-1) and IGF-1 receptor gene expression in the developing and mature ovarian follicle. Endocrinology 129:3281–3288[Abstract/Free Full Text]
  31. Alliston TN, Maiyar AC, Buse P, Firestone GL, Richards JS 1997 Follicle stimulating hormone-regulated expression of serum/glucocorticoid-inducible kinase in rat ovarian granulosa cells: a functional role for the Sp1 family in promoter activity. Mol Endocrinol 11:1934–1949[Abstract/Free Full Text]
  32. Alliston TN, Gonzalez-Robayna IJ, Buse P, Fireston GL, Richards JS 2000 Expression and localization of serum/glucocorticoid-induced kinase in the rat ovary: relation to follicular growth and differentiation. Endocrinology 141:385–395[Abstract/Free Full Text]
  33. Park J, Leong MLL, Buse P, Maiyar AC, Firestone GL, Hemmings BA 1999 Serum and glucocorticoid-inducible kinase (SGK) is a target of PI 3-kinase-stimulated signaling pathway. EMBO J 18:3024–3033[CrossRef][Medline]
  34. Perrotti N, He RA, Phillips SA, Haft CR, Taylor SI 2001 Activation of serum- and glucocorticoid-induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem 276:9406–9412[Abstract/Free Full Text]
  35. Lang F, Cohen P 2001 The regulation and physiological roles of serum and glucocorticoid-induced protein kinase. Science (stke-sigtrans) 108:1–11
  36. Gonzalez-Robayna IJ, Falender AE, Ochsner S, Firestone GL, Richards JS 2000 FSH stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-induced kinase (Sgk): evidence for A-kinase independent signaling in granulosa cells. Mol Endocrinol 14:1283–1300[Abstract/Free Full Text]
  37. Buse P, Tran SH, Luther E, Phu PT, Aponte GW, Firestone GL 1999 Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum and glucocorticoid inducible protein kinase, Sgk, in mammary tumor cells: a novel convergence point of anti-proliferative and proliferative cell signaling pathways. J Biol Chem 274:7253–7263[Abstract/Free Full Text]
  38. Gonzalez-Robayna IJ, Alliston TN, Buse P, Firestone GL, Richards JS 1999 Functional and subcellular changes in the A-kinase signaling pathway: relation to aromatase and sgk expression during the transition of granulosa cells to luteal cells. Mol Endocrinol 13:1318–1337[Abstract/Free Full Text]
  39. Mikosz CA, Brickley DR, Sharkey MS, Moran TW, Conzen SD 2001 Glucocorticoid receptor-mediated protection from apoptosis is associated with induction of the serine/threonine survival kinase gene, sgk-1. J Biol Chem 276:16649–16654[Abstract/Free Full Text]
  40. Casamayor A, Torrence PD, Kobayashi T, Thorner J, Alessi DR 1999 Functional counterparts of mammalian protein kinases PDK1 and Sgk in budding yeast. Curr Biol 9:186–197[CrossRef][Medline]
  41. Kawasaki H, Springett GM, Mochizuki N, Toki S, Nakaya M, Matsuda M, Housman DE, Graybiel AM 1998 A family of cAMP-binding proteins that directly activate Rap1. Science 282:2275–2279[Abstract/Free Full Text]
  42. de Rooij J, Zwartkruis FJT, Verheijen MHG, Cool RH, Nijman SMB, Wittinghofer A, Bos JL 1998 Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cAMP. Nature 396:474–477[CrossRef][Medline]
  43. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201–204[CrossRef][Medline]
  44. Abel MH, Wootton AN, Wilkins V, Hutaniemi I, Knight PG, Charlton HM 2000 The effect of a null mutation in the FSH receptor gene on mouse reproduction. Endocrinology 141:1795–1803[Abstract/Free Full Text]
  45. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, Le Meur M, Sassone-Corsi P 1998 Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci USA 95:13612–13617[Abstract/Free Full Text]
  46. Burns KH, Yan C, Kumar TR, Matzuk MM 2001 Analysis of ovarian gene expression in follicle-stimulating hormone ß knockout mice. Endocrinology 142:2742–2751[Abstract/Free Full Text]
  47. Kuiper G, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J-A 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  48. Rao MC, Midgley AR, Richards JS 1978 Hormonal regulation of ovarian cellular proliferation. Cell 14:71–78[CrossRef][Medline]
  49. Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, Korach KS 1999 Postnatal sex reversal of the ovaries in mice lacking estrogen receptor {alpha} and ß. Science 286:2328–2331[Abstract/Free Full Text]
  50. Zhao HH, Herrera RE, Coronado-Heinsohn E, Yang MC, Ludes-Meyers JH, Seybold-Tilson KJ, Nawaz Z, Yee C, Barr FG, Diab SG, Brown PH, Fuqua SAW, Osborne CK 2001 FKHR functions as a bifunctional nuclear receptor interacting protein with both coactivator and corepressor functions. J Biol Chem 276:27907–27912[Abstract/Free Full Text]
  51. Schuur ER, Loktev AV, Sharma M, Sun Z, Roth RA, Weigel RJ 2001 Ligand-dependent interaction of estrogen receptor-{alpha} with FKHR. J Biol Chem
  52. Zhou J, Refuerzo J, Bondy C 1995 Granulosa cell DNA synthesis is strictly correlated with the presence of insulin-like growth factor I and absence of c-fos/c-jun expression. Mol Endocrinol 9:924–931[Abstract/Free Full Text]
  53. Richards J 1975 Estradiol receptor content in rat granulosa cells during follicular development: modification by estradiol and gonadotropins. Endocrinology 97:1174–1184[Abstract/Free Full Text]
  54. Samih N, Hovsepian S, Aouani A, Lombardo D, Fayet G 2000 Glut-1 translocation in FRTL-5 thyroid cells: role of phosphatidylinositol and N-glycosylation. Endocrinology 141:4146–4155[Abstract/Free Full Text]
  55. Fitzpatrick SL, Richards JS 1991 Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa cells. Endocrinology 129:1452–1462[Abstract/Free Full Text]
  56. Ratoosh S, Lifka J, Hedin L, Jahnsen T, Richards J 1987 Hormonal regulation of the synthesis and mRNA content of the regulatory subunit of cyclic AMP-dependent protein kinase type II in cultured granulosa cells. J Biol Chem 262:7306–7313[Abstract/Free Full Text]
  57. Sharma SC, Clemens JW, Pisarska MD, Richards JS 1999 Expression and function of estrogen receptor subtypes in granulosa cells: regulation by estradiol and forskolin. Endocrinology 140:4320–4334[Abstract/Free Full Text]
  58. Hickey G, Chen S, Besman M, Shively J, Hall P, Gaddy-Kurten D, Richards J 1988 Hormonal regulation, tissue distribution and content of aromatase cytochrome P450 messenger ribonucleic acid and enzyme activity in rat ovarian follicles and corpora lutea: relationship to estradiol biosynthesis. Endocrinology 122:1426–1436[Abstract/Free Full Text]
  59. Robker RL, Richards JS 1998 Hormone-induced proliferation and differentiation of granulosa cells: a coordinated balance of the cell cycle regulators cyclin D2 and p27KIP1. Mol Endocrinol 12:924–940[Abstract/Free Full Text]
  60. Tanaka M, Kirito K, Kashii Y, Uchida M, Waatanabe T, Endo H, Endoh T, Sawada K-i, Ozawa K, Komatsu N 2001 Forkhead family transcription factor FKHRL1 is expressed in human megakaryocytes. Regulation of cell cycling as a downstream molecule of thrombopoietin signaling. J Biol Chem 276:15082–15089[Abstract/Free Full Text]
  61. Pru JK, Tilly JL 2001 Programmed cell death in the ovary: insight and future prospects using genetic technologies. Mol Endocrinol 15:845–853[Abstract/Free Full Text]
  62. Hsueh AJW, Billig H, Tsafriri A 1994 Ovarian follicle atresia: a hormonally controlled apoptotic process. Endocr Rev 15:707–724[Abstract/Free Full Text]
  63. Williams MR, Arthur JSC, Balendran A, van der Kaay J, Poli V, Cohen P, Alessi DR 2000 The role of 3-phosphoinositide-dependent protein kinase 1 in activating AGC kinases defined in embryonic stem cells. Curr Biol 10:439–448[CrossRef][Medline]
  64. Robker RL, Russell DL, Espey LL, Lydon JP, O’Malley BW, Richards JS 2000 Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases. Proc Natl Acad Sci USA 97:4689–4694[Abstract/Free Full Text]
  65. Richards J, Ireland J, Rao M, Bernath G, Midgley A, Reichert Jr L 1976 Ovarian follicular development in the rat: hormone receptor regulation by estradiol, follicle stimulating hormone and luteinizing hormone. Endocrinology 99:1562–1570[Abstract/Free Full Text]
  66. Ratoosh SL, Richards JS 1985 Regulation of the content and phosphorylation of RII by cyclic adenosine 3', 5'- monophosphate, FSH and estradiol in cultured granulosa cells. Endocrinology 117:917–927[Abstract/Free Full Text]
  67. Wilkensen, D 1993 In situ hybridization. In: Stem CD, Holland PWH, eds. Essential developmental biology, a practical approach. New York: Oxford University Press; 258–263
  68. Orly J, Rei Z, Greenberg N, Richards JS 1994 Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids. Endocrinology 134:2336–2346[Abstract/Free Full Text]
  69. Park O-K, Mayo K 1991 Transient expression of progesterone receptor messenger RNA in ovarian granulosa cells after the preovulatory luteinizing hormone surge. Mol Endocrinol 5:967–978[Abstract/Free Full Text]
  70. Ginty DD, Kornhauser JM, Thompson MA, Bading H, Mayo KE, Takahashi JS, Greenberg ME 1993 Regulation of CREB phosphorylation in the suprachiasmatic nucleus by light and a circadian clock. Science 260:238–241[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
M. A. Edson, A. K. Nagaraja, and M. M. Matzuk
The Mammalian Ovary from Genesis to Revelation
Endocr. Rev., October 1, 2009; 30(6): 624 - 712.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Shu, A. V. Matveyenko, J. Kerr-Conte, J.-H. Cho, C. H.S. McIntosh, and K. Maedler
Decreased TCF7L2 protein levels in type 2 diabetes mellitus correlate with downregulation of GIP- and GLP-1 receptors and impaired beta-cell function
Hum. Mol. Genet., July 1, 2009; 18(13): 2388 - 2399.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. Liu, M. D. Rudd, I. Hernandez-Gonzalez, I. Gonzalez-Robayna, H.-Y. Fan, A. J. Zeleznik, and J. S. Richards
FSH and FOXO1 Regulate Genes in the Sterol/Steroid and Lipid Biosynthetic Pathways in Granulosa Cells
Mol. Endocrinol., May 1, 2009; 23(5): 649 - 661.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
D. Rosairo, I. Kuyznierewicz, J. Findlay, and A. Drummond
Transforming growth factor-{beta}: its role in ovarian follicle development
Reproduction, December 1, 2008; 136(6): 799 - 809.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M.-N. Lague, M. Paquet, H.-Y. Fan, M. J. Kaartinen, S. Chu, S. P. Jamin, R. R. Behringer, P. J. Fuller, A. Mitchell, M. Dore, et al.
Synergistic effects of Pten loss and WNT/CTNNB1 signaling pathway activation in ovarian granulosa cell tumor development and progression
Carcinogenesis, November 1, 2008; 29(11): 2062 - 2072.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H.-Y. Fan, Z. Liu, N. Cahill, and J. S. Richards
Targeted Disruption of Pten in Ovarian Granulosa Cells Enhances Ovulation and Extends the Life Span of Luteal Cells
Mol. Endocrinol., September 1, 2008; 22(9): 2128 - 2140.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H.-Y. Fan, M. Shimada, Z. Liu, N. Cahill, N. Noma, Y. Wu, J. Gossen, and J. S. Richards
Selective expression of KrasG12D in granulosa cells of the mouse ovary causes defects in follicle development and ovulation
Development, June 15, 2008; 135(12): 2127 - 2137.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. R. Hammes and E. R. Levin
Extranuclear Steroid Receptors: Nature and Actions
Endocr. Rev., December 1, 2007; 28(7): 726 - 741.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. D. Looyenga and G. D. Hammer
Genetic Removal of Smad3 from Inhibin-Null Mice Attenuates Tumor Progression by Uncoupling Extracellular Mitogenic Signals from the Cell Cycle Machinery
Mol. Endocrinol., October 1, 2007; 21(10): 2440 - 2457.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. M. Wayne, H.-Y. Fan, X. Cheng, and J. S. Richards
Follicle-Stimulating Hormone Induces Multiple Signaling Cascades: Evidence that Activation of Rous Sarcoma Oncogene, RAS, and the Epidermal Growth Factor Receptor Are Critical for Granulosa Cell Differentiation
Mol. Endocrinol., August 1, 2007; 21(8): 1940 - 1957.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
D. A Glauser and W. Schlegel
The emerging role of FOXO transcription factors in pancreatic {beta} cells
J. Endocrinol., May 1, 2007; 193(2): 195 - 207.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
Y.-J. Chen, P.-W. Hsiao, M.-T. Lee, J I. Mason, F.-C. Ke, and J.-J. Hwang
Interplay of PI3K and cAMP/PKA signaling, and rapamycin-hypersensitivity in TGF{beta}1 enhancement of FSH-stimulated steroidogenesis in rat ovarian granulosa cells
J. Endocrinol., February 1, 2007; 192(2): 405 - 419.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R. A Forsdike, K. Hardy, L. Bull, J. Stark, L. J Webber, S. Stubbs, J. E Robinson, and S. Franks
Disordered follicle development in ovaries of prenatally androgenized ewes
J. Endocrinol., February 1, 2007; 192(2): 421 - 428.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Stocco, C. Telleria, and G. Gibori
The Molecular Control of Corpus Luteum Formation, Function, and Regression
Endocr. Rev., February 1, 2007; 28(1): 117 - 149.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. S. Ellsworth, N. Egashira, J. L. Haller, D. L. Butts, J. Cocquet, C. M. Clay, R. Y. Osamura, and S. A. Camper
FOXL2 in the Pituitary: Molecular, Genetic, and Developmental Analysis
Mol. Endocrinol., November 1, 2006; 20(11): 2796 - 2805.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. W. Arvisais, A. Romanelli, X. Hou, and J. S. Davis
AKT-independent Phosphorylation of TSC2 and Activation of mTOR and Ribosomal Protein S6 Kinase Signaling by Prostaglandin F2{alpha}
J. Biol. Chem., September 15, 2006; 281(37): 26904 - 26913.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
J. C. Corton and H. M. Brown-Borg
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1 in Caloric Restriction and Other Models of Longevity
J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2005; 60(12): 1494 - 1509.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. R. Levin
Integration of the Extranuclear and Nuclear Actions of Estrogen
Mol. Endocrinol., August 1, 2005; 19(8): 1951 - 1959.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. Mirkin, M. Arslan, D. Churikov, A. Corica, J.I. Diaz, S. Williams, S. Bocca, and S. Oehninger
In search of candidate genes critically expressed in the human endometrium during the window of implantation
Hum. Reprod., August 1, 2005; 20(8): 2104 - 2117.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Gillio-Meina, Y. Y. Hui, and H. A. LaVoie
Expression of CCAAT/Enhancer Binding Proteins Alpha and Beta in the Porcine Ovary and Regulation in Primary Cultures of Granulosa Cells
Biol Reprod, May 1, 2005; 72(5): 1194 - 1204.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Park, E. T. Maizels, Z. J. Feiger, H. Alam, C. A. Peters, T. K. Woodruff, T. G. Unterman, E. J. Lee, J. L. Jameson, and M. Hunzicker-Dunn
Induction of Cyclin D2 in Rat Granulosa Cells Requires FSH-dependent Relief from FOXO1 Repression Coupled with Positive Signals from Smad
J. Biol. Chem., March 11, 2005; 280(10): 9135 - 9148.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
R. L. Lynch, B. W. Konicek, A. M. McNulty, K. R. Hanna, J. E. Lewis, B. L. Neubauer, and J. R. Graff
The Progression of LNCaP Human Prostate Cancer Cells to Androgen Independence Involves Decreased FOXO3a Expression and Reduced p27KIP1 Promoter Transactivation
Mol. Cancer Res., March 1, 2005; 3(3): 163 - 169.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. Boyd and A. Naray-Fejes-Toth
Gene regulation of ENaC subunits by serum- and glucocorticoid-inducible kinase-1
Am J Physiol Renal Physiol, March 1, 2005; 288(3): F505 - F512.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. M. Bastida, A. Cremades, M. T. Castells, A. J. Lopez-Contreras, C. Lopez-Garcia, F. Tejada, and R. Penafiel
Influence of Ovarian Ornithine Decarboxylase in Folliculogenesis and Luteinization
Endocrinology, February 1, 2005; 146(2): 666 - 674.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. A. Nechamen, R. M. Thomas, B. D. Cohen, G. Acevedo, P. I. Poulikakos, J. R. Testa, and J. A. Dias
Human Follicle-Stimulating Hormone (FSH) Receptor Interacts with the Adaptor Protein APPL1 in HEK 293 Cells: Potential Involvement of the PI3K Pathway in FSH Signaling
Biol Reprod, August 1, 2004; 71(2): 629 - 636.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. A. Cunningham, Q. Zhu, and J. M. Hammond
FoxO1a Can Alter Cell Cycle Progression by Regulating the Nuclear Localization of p27kip in Granulosa Cells
Mol. Endocrinol., July 1, 2004; 18(7): 1756 - 1767.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. D. Pisarska, J. Bae, C. Klein, and A. J. W. Hsueh
Forkhead L2 Is Expressed in the Ovary and Represses the Promoter Activity of the Steroidogenic Acute Regulatory Gene
Endocrinology, July 1, 2004; 145(7): 3424 - 3433.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Alam, E. T. Maizels, Y. Park, S. Ghaey, Z. J. Feiger, N. S. Chandel, and M. Hunzicker-Dunn
Follicle-stimulating Hormone Activation of Hypoxia-inducible Factor-1 by the Phosphatidylinositol 3-Kinase/AKT/Ras Homolog Enriched in Brain (Rheb)/Mammalian Target of Rapamycin (mTOR) Pathway Is Necessary for Induction of Select Protein Markers of Follicular Differentiation
J. Biol. Chem., May 7, 2004; 279(19): 19431 - 19440.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. J. Hirvonen-Santti, V. Sriraman, M. Anttonen, S. Savolainen, J. J. Palvimo, M. Heikinheimo, J. S. Richards, and O. A. Janne
Small Nuclear RING Finger Protein Expression during Gonad Development: Regulation by Gonadotropins and Estrogen in the Postnatal Ovary
Endocrinology, May 1, 2004; 145(5): 2433 - 2444.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Hosaka, W. H. Biggs III, D. Tieu, A. D. Boyer, N. M. Varki, W. K. Cavenee, and K. C. Arden
Disruption of forkhead transcription factor (FOXO) family members in mice reveals their functional diversification
PNAS, March 2, 2004; 101(9): 2975 - 2980.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. A. Cunningham, Q. Zhu, T. G. Unterman, and J. M. Hammond
Follicle-Stimulating Hormone Promotes Nuclear Exclusion of the Forkhead Transcription Factor FoxO1a via Phosphatidylinositol 3-Kinase in Porcine Granulosa Cells
Endocrinology, December 1, 2003; 144(12): 5585 - 5594.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. H. Burns, G. E. Owens, S. C. Ogbonna, J. H. Nilson, and M. M. Matzuk
Expression Profiling Analyses of Gonadotropin Responses and Tumor Development in the Absence of Inhibins
Endocrinology, October 1, 2003; 144(10): 4492 - 4507.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
D. H. Castrillon, L. Miao, R. Kollipara, J. W. Horner, and R. A. DePinho
Suppression of Ovarian Follicle Activation in Mice by the Transcription Factor Foxo3a
Science, July 11, 2003; 301(5630): 215 - 218.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. K. Roy, J. Wang, and P. Yang
Dexamethasone Inhibits Transforming Growth Factor-{beta} Receptor (T{beta}R) Messenger RNA Expression in Hamster Preantral Follicles: Possible Association with NF-YA
Biol Reprod, June 1, 2003; 68(6): 2180 - 2188.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. J. Kim, H. S. Taylor, G. E. Akbas, I. Foucher, A. Trembleau, R. C. Jaffe, A. T. Fazleabas, and T. G. Unterman
Regulation of Insulin-Like Growth Factor Binding Protein-1 Promoter Activity by FKHR and HOXA10 in Primate Endometrial Cells
Biol Reprod, January 1, 2003; 68(1): 24 - 30.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Pedram, M. Razandi, M. Aitkenhead, C. C. W. Hughes, and E. R. Levin
Integration of the Non-genomic and Genomic Actions of Estrogen. MEMBRANE-INITIATED SIGNALING BY STEROID TO TRANSCRIPTION AND CELL BIOLOGY
J. Biol. Chem., December 20, 2002; 277(52): 50768 - 50775.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richards, J. S.
Right arrow Articles by Lo, Y. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richards, J. S.
Right arrow Articles by Lo, Y. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals