| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Physiology, Semmelweis University of Medicine, Budapest H-1444, Hungary
Address all correspondence and requests for reprints to: Peter Enyedi, M.D., Ph.D., Department of Physiology, Semmelweis University of Medicine, P.O Box 259, H-1444 Budapest, Hungary. E-mail: enyedi{at}puskin.sote.hu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In our preceding study we demonstrated high level expression of TWIK-related acid-sensitive K+ channel (TASK-1) mRNA in the adrenal capsular tissue with Northern blot. It was verified that the mRNA of TASK-1 derives from glomerulosa cells by applying single-cell RT-PCR. Injection of glomerulosa mRNA into Xenopus oocytes evoked high K+ conductance. Several pharmacological properties of ImRNA and ITASK-1 (the K+ currents expressed in Xenopus oocytes by injecting glomerulosa mRNA or TASK-1 cRNA, respectively) were identical. Furthermore, coinjection of an antisense oligonucleotide designed to anneal to the 5'-end of the TASK-1 coding region prevented the expression of ImRNA specifically and almost completely. However, ITASK-1 was more sensitive to extracellular (EC) acidification than ImRNA, which suggested that the contribution of ITASK-1 to ImRNA could be 25% at maximum (somewhat contradictory to the antisense results) (7).
Recent molecular cloning uncovered additional mammalian 2P potassium channels (for review see Ref. 8). Members of the 2P K+ channel family have four transmembrane segments and two potassium channel pore-forming domains. Apart from the distinctive topology, they are distantly related at the amino acid level. They have different expression patterns and regulatory mechanisms. With the only exception of TWIK-2 (9), all the functionally expressed 2P channels induce noninactivating background K+ currents.
In this study we examined whether the recently described 2P channels, TASK-2 (10) or TASK-3 (11, 12), the closest structural relative of TASK-1, were present in glomerulosa tissue, and whether their expression could be responsible for the previously observed difference between the pharmacology of glomerulosa and TASK-1 currents. Our data indicate that TASK-3 is expressed in high abundance in glomerulosa tissue, and its pharmacology gives an explanation not only for the previously observed discrepancy between ImRNA and ITASK-1, but suggests that TASK-3 is responsible predominantly for the negative resting membrane potential of glomerulosa cells. We show, moreover, that TASK-3 is prone to be inhibited by angiotensin II; thus it may also be involved in the angiotensin II-induced depolarization of glomerulosa cells.
| RESULTS |
|---|
|
|
|---|
|
The expression level of the TASK-3 mRNA in the adrenal glomerulosa was compared with that of other tissues by Northern blot. The radioactive probe corresponded to the unique C-terminal intracellular tail of the channel. A representative Northern blot, shown in Fig. 2
indicates that the specific (
3.9 kb) message was detected exclusively in the adrenal glomerulosa tissue.
|
Expression of TASK-3 and Pharmacological Comparison of ImRNA, ITASK-1 and ITASK-3
Injection of TASK-3 cRNA into Xenopus oocytes shifted their resting membrane potential toward more negative values (-91 ± 2 mV, n = 5). The potassium current responsible for this shift was measured at -100 mV by a two-electrode voltage clamp. The increase of the inward current on elevation of the EC [K+] from 2 mM to 80 mM can be regarded as an indication of the K+ conductance of the plasma membrane. In oocytes expressing TASK-3, this increase of current (ITASK-3) was several microamperes (14.9 ± 2.7 µAmp, n = 19), much larger than the 50100 nAmp current increase in control (non-, or water-injected) oocytes. Therefore, ITASK-3 and its alteration by treatments could be measured similarly to ITASK-1 and ImRNA (the currents expressed by injection of TASK-1 cRNA and glomerulosa mRNA, respectively) (7). In our preceding study we showed that Ba2+ (300 µM) and Cs+ (3 mM) exerted voltage-dependent block of ImRNA and ITASK-1. TASK-3 was inhibited by the same concentration of these ions (Fig. 3
.). Similarly to ITASK-1, Ba2+ and Cs+ caused voltage-dependent block of ITASK-3 in the hyperpolarized voltage range. The Ba2+ block developed slowly in time, but the steady state inhibition by Cs+ was almost instantaneous. Under our experimental conditions the Ba2+ and Cs+ inhibitory profiles of ITASK-1 and ITASK-3 were indistinguishable (not shown).
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
To estimate the relative quantity of mRNAs of different TASK channels in glomerulosa tissue, RT-PCR was performed with degenerate oligonucleotides, which annealed to conserved sequences of TASK-1 (15), TASK-2 (10), and TASK-3 (11). The proportion of TASK-1 and TASK-3 mRNA proved to be higher than that of TASK-2. Because the degenerate oligonucleotides may have amplified one or the other TASK channel preferentially, more reliable quantitative results were obtained; the mRNA expression levels of the three TASK channels were determined one by one by competitive PCR. These experiments demonstrated about 4-fold higher expression of TASK-3 than TASK-1, whereas TASK-2 mRNA was present at a far lower concentration. During the preparation of this paper the sequence of the fourth member of the TASK subfamily was published (18). However, TASK-4 conducts measurable current only above pH 9, which renders its physiological significance rather enigmatic.
With the aim of detailed analysis and comparison of the expressed ITASK-3 and ImRNA, we took advantage of the published TASK-3 sequence (11) and amplified the coding region of the channel by RT-PCR from glomerulosa RNA. The PCR product was cloned and its sequence was determined. Apart from a minor difference, which probably results from some sequencing errors (a short frame-shifted fragment and three bases missing) in the previously published TASK-3 sequence deposited to the GenBank, our sequence turned out to be identical with the published one. The TASK-3 coding region was subcloned into a Xenopus expression plasmid and ITASK-3 was expressed and examined in the oocytes.
Inhibition of TASK-3 by acidification appears at lower pH than that of TASK-1. Accordingly, the approach (a pH step from 7.5 to 6.7) we used in our previous study to reveal the presence of TASK-1 in glomerulosa cells, also inhibited TASK-3, but only by 1020%. This highly resembles the degree of inhibition of ImRNA and of glomerulosa cell K+ current by this pH step (7). We also found that the weakly pH-sensitive ImRNA was inhibited specifically and almost completely by an antisense oligonucleotide designed to hybridize to the 5'-end of TASK-1 (7). However, the nucleotide sequences of rat TASK-1 and TASK-3 are identical in this region; accordingly the antisense inhibition could have manifested on both channels.
The polycationic dye RR is known to affect different Ca2+ transport-, and calcium-regulated processes (c.f. Ref. 19). It was shown to inhibit also Ca2+-activated potassium currents (IK and BK) from the intracellular side, an effect interpreted as a probable interaction with the Ca2+-binding sites of the channel protein (20). However, in addition to the Ca2+-related processes, RR affects other ion transport mechanisms as well (21, 22). In a previous study we found that RR, when applied extracellularly, depolarized the adrenal glomerulosa cells by inhibiting the resting K+ conductance (16). Accordingly, RR inhibited ImRNA in the oocytes in the micromolar concentration range. Therefore we examined whether the candidates for the glomerulosa resting potassium current, ITASK-1 and ITASK-3, were affected by RR. Our present results show that TASK-3 is highly sensitive to RR (3 µM exerts 70% inhibition) whereas the same concentration of the dye does not affect TASK-1 current at all. The strong inhibition of ImRNA by RR confirms the major background potassium channel role of TASK-3 in glomerulosa cells. Although RR turned out to be an excellent tool for dissecting the relative contribution of the two TASK channels to ImRNA, it was not specific enough to inhibit TASK-3 selectively in the glomerulosa cell. Formerly, RR was shown to reduce also the voltage-dependent Ca2+ currents of glomerulosa cells (16). Therefore, the effects of RR on the complex regulation of aldosterone production should be regarded carefully, because this drug also influences other important regulatory mechanisms in addition to the efficient inhibition of the background K+ conductance (16).
Sensitivity of the glomerulosa cell to EC [K+] changes in the physiological range is regarded as a consequence of the depolarizing shift of the potassium equilibrium potential (EK) (23, 24, 25, 26, 27). TASK-3 maintains highly negative resting membrane potential, thus allowing pronounced depolarization in a range, where the H subtype of the T type voltage-dependent Ca2+ channels [recently identified as the dominant low-voltage-activated Ca2+ channel in the glomerulosa cell (28)] may open. The significance of the low-voltage-activated mechanisms in the regulation of aldosterone production is well documented (23, 29), and they may influence other components having feedback also to the membrane potential [e.g. stimulation of the sodium pump (30)].
We also demonstrated that TASK-3, expressed in Xenopus oocytes, is inhibited by AT1a receptor stimulation. Although the TASK-3 inhibition by angiotensin II (28%) was smaller than the inhibition of TASK-1 [77% (Ref. 7)] in the oocyte, it should be pointed out that the glomerulosa K+ current expressed in the oocytes (ImRNA) showed also smaller inhibition by angiotensin II than the background K+ current in the glomerulosa cell (7). This indicates that the degree of inhibition of the same channel may depend on the experimental system. In addition to the angiotensin II receptor, activation of the endogenous lysophosphatidic acid receptor and also the heterologously expressed M1 muscarinic receptor inhibited the TASK-3 current. Thus, similarly to TASK-1, the inhibitory mechanism of TASK-3 is not restricted to angiotensin II, but could be evoked by a wider range of receptors activating the Gq protein-PLC signaling pathway.
Although detailed analysis of the mechanism of regulation of TASK-3 was beyond the scope of this study, the deviation of the time courses of the calcium signal and the channel inhibition allows further speculation. Although the angiotensin II-induced Ca2+ signal (measured as calcium-activated chloride current in the oocyte) was rapidly reduced to a sustained phase after the initial peak, the TASK-3 inhibition remained nearly maximal during maintained stimulation. This apparent dissociation between the two effects suggests that the intracellular [Ca2+] may not be the determining factor responsible for the TASK-3 inhibition. Recently we have shown that activation of PLC by angiotensin II or by other Ca2+-mobilizing agonists reduced the TASK-1 current, an effect probably related to the phosphatidyl-inositol-4,5-bisphosphate (PIP2) breakdown (17); a similar mechanism for the TASK-3 inhibition would be plausible.
Summarizing our results, the high level expression of TASK-3, the high RR sensitivity of ITASK-3, and its limited inhibition by acidification in the physiological range indicate that TASK-3 is the major determinant of the resting K+ conductance in glomerulosa cells. This channel, similarly to TASK-1, is inhibited by angiotensin II and, being a target of receptor-mediated regulation, it certainly participates in the complex effect of the hormone.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]dCTP was obtained from Izinta (Budapest, Hungary).
RNA Preparation and RT-PCR
Total RNA was prepared from adrenal capsular tissue [mainly glomerulosa cells (13)] by the guanidium-isothiocyanate, phenol-chloroform method as previously described (14). The quantitation of the RNA was based on its absorbance at 260 nm, and its integrity was confirmed by agarose-formaldehyde gel electrophoresis. For PCR total RNA (1 µg) was reverse transcribed by mouse Moloney leukemia virus reverse transcriptase.
For detection of the TASK-3 message in glomerulosa tissue, the forward primer (T3s) was 5'-ggcatATGAAGCGGCAGAAtGTGCG-3', and the reverse primer (T3a) was 5'-TCCCTCtAGAAGATCTTCATCGGTATT-3'. The sense primer annealed to the start codon region of TASK-3 with one mismatch indicated by lowercase letter. (The sequence of TASK-3 is identical with that of TASK-1 in this region apart from this single base difference.) The mismatch in T3s caused a silent mutation, leaving the TASK-3 amino acid sequence unaltered. The antisense primer was specific exclusively for TASK-3. To promote cloning of the PCR product the T3s primer had an additional short sequence at the 5'-end, generating an NdeI restriction enzyme recognition site, whereas an XbaI restriction enzyme site was introduced into the T3a primer close to its 5'-end. The cDNA was amplified with a PCR protocol of 25 cycles (denaturation for 30 sec at 94 C, annealing for 1 min at 50 C, extension for 90 sec at 72 C) and final extension for 5 min at 72 C.
Cloning of the cDNA Encoding TASK-3
The coding region of TASK-3 was amplified from total glomerulosa RNA using Pfu turbo DNA polymerase after reverse transcription. PCR primers were based on the published rat TASK-3 sequence. The forward primer was T3s (see above); the reverse primer (T3end-a) was 5'-cctctctagACTTAGATGGACTTGCGACG 3'. The additional bases at the 5'-end (indicated by lowercase letters) introduced an XbaI restriction enzyme site. The PCR product was digested with XbaI enzyme and cloned into the XbaI-SmaI-digested Bluescript pKS-phagemid (Stratagene). Subsequently it was subcloned into pEXO vector containing the 5'- and 3'-untranslated regions of the Xenopus globin gene. The sequence of the construct (pEXO-TASK-3) was determined from both directions by automatic sequencing.
Quantification of the mRNA Expression of the Three TASK Channels
To estimate the relative abundance of TASK-1, TASK-2, and TASK-3 mRNA in the glomerulosa tissue, degenerate primers were used to amplify all three messages simultaneously. The forward primer (T123s) 5'-GTCAT(C/T)AC(A/C)AC(T/C)AT(T/C)GG(A/C)TATGG-3' and the reverse primer (T123a) 5'-A(G/T) (G/T)GT(G/A)ATGAAG(G/C)AGTAGTA-3' annealed to highly conserved regions (corresponding to the K+ channel pore forming P1 and P2 segment of each channel), which flanked subtype-specific sequences. This allowed identification of the amplified product by restriction enzyme mapping. The radioactive PCR product [each PCR mixture contained [
-32P]dCTP (50 kBq)] was purified as previously described (14) and divided into aliquots, and the aliquots were digested with NcoI, PvuII, and Eco91I restriction enzymes, which were specific for the products deriving from TASK-1, TASK-2, and TASK-3, respectively. The digested samples were electrophoretically separated, and the degree of digestion was determined by phosphor imager (model GS-525, Bio-Rad Laboratories, Inc., Hercules, CA).
For obtaining more quantitative data we measured the mRNA levels of the three TASK channels by competitive PCR. The competitive templates for TASK-1 and TASK-3 were the mutant pEXO-TASK-1 (15) and pEXO-TASK-3 plasmids, respectively, in which the NcoI (or Kpn2I in TASK-3) restriction enzyme site was destroyed by digesting with the respective enzyme, creating blunt ends (Klenow polymerase), and religating. Because the rat TASK-2 cDNA has not yet been cloned, we amplified a fragment of the rat TASK-2 coding region from glomerulosa RNA applying the degenerate AC(C/T)GTCATCAC(A/C)ACCAT(A/C)GG sense, and G(C/G)CAC(A/G)(A/T)AGTCICC(A/G)AAICC(A/T) antisense oligonucleotides. The TASK-2 RT-PCR product was cloned into the EcoRV site of Bluescript pKS- (Stratagene), and sequenced. The TASK-2 competitive template was produced by destroying the Eco81I restriction enzyme site of this clone. The template regions of the competitive templates were cleaved out from the plasmids (TASK-1, HinfI; TASK-2, EcoRI and XhoI; TASK-3, Eco81I and SmaI) to facilitate denaturation. Known amounts of these digested competitive templates were mixed with reverse transcription reactions from 200 ng glomerulosa RNA, and the PCR was performed with the highly thermostable Vent DNA polymerase (initial denaturation for 2 min at 98 C, 30 cycles of denaturation for 30 sec at 98 C, annealing for 1 min at 51 C, extension for 40 sec at 72 C, and final extension for 5 min at 72 C). The primer pairs were specific for the different TASK channels. (TASK-1, GCGTCGTGCTGCGCCTCAAG sense, TCCTTCTGCAGCGCCACGTAG antisense; TASK-2, GGGCGCCTCTTCTGTGTCTTC sense, AGGCCCTCAATGTAGTTCCAC antisense; TASK-3, CTCTGCTTCCCTGGTGCCAAC sense, ATGGACTTGCGACGGATGTGC antisense.) The radioactive TASK-1, TASK-2, and TASK-3 competitive PCR products were digested completely with NcoI, Eco81I, and Kpn2I, respectively. The digested fragments (deriving from the glomerulosa RNA) were separated from the digestion-resistant product (deriving from the competitive template) on agarose gel, and the radioactivity of the bands was measured by phosphor imager. The ion channel mRNA expression level was calculated in moles of competitive template strand per µg of glomerulosa total RNA from the reactions in which the radioactive counts of the digested and digestion-resistant products were nearly equal.
Northern Blot
Ten micrograms of total RNA from different tissues were loaded and run on a 1% agarose formaldehyde gel after denaturation. The electrophoretic separation of RNA was followed by its transfer to Nytran nylon membrane (Schleicher \|[amp ]\| Schuell, Inc., Keene, NH). For the TASK-3 probe, the BglII-XbaI fragment (440 bp, corresponding to the unique C- terminal intracellular tail of the channel) was labeled with [32P]dCTP (2 MBq) by random primed reaction using the Oligolabeling Kit from Pharmacia Biotech. Hybridization was carried out at 42 C for 24 h. After hybridization the blot was washed successively in buffers of 1x SSPE + 0.1% SDS twice for 30 min at room temperature and 0.1x SSPE + 0.1% SDS twice for 30 min at 70 C. After detection of the radioactivity by phosphor imager, the membrane was stripped and reprobed for glyceraldehyde-3-phosphate dehydrogenase reference signal as previously described (14).
mRNA Purification and cRNA Synthesis
mRNA was purified from total RNA by Dynabeads Oligo (dT)25 (DynAl, Oslo, Norway), divided into aliquots, and stored at -70 C. The cRNAs of TASK-1 and TASK-3 potassium channels and AT1a and muscarinic M1 receptors were synthesized in vitro according to the manufacturers instructions (Ambion, Inc. mMESSAGE mMACHINE T7 In vitro Transcription Kit). The templates were the XbaI-linearized pEXO-TASK-1 (15) and pEXO-TASK-3 constructs, the NotI-linearized plasmid comprising the coding sequence and 5'-untranslated region of rat AT1a angiotensin II receptor (a gift from Dr. K. E. Bernstein), and the BamHI-linearized pcDNA3.1 (Invitrogen) containing the coding sequence of the human M1 muscarinic acetylcholine receptor in its EcoRI site (a gift from Dr. Xin-Yun Huang).
Animals and Tissue Preparation and Xenopus laevis Oocyte Injection
Mature female X. laevis frogs were obtained from Amrep Reptielen (Breda, Netherlands). Frogs were anesthetized by immersing them into benzocaine solution (0.03%). Ovarian lobes were removed, the tissue was dissected and treated with collagenase (1.45 mg/ml, 148 U/mg, type I, Worthington Biochemical Corp., Freehold, NJ) and continuous mechanical agitation in Ca2+-free OR2 solution containing (in mM): NaCl, 82.5; KCl, 2; MgCl2, 1; HEPES, 5, pH 7.5) for 1.52 h. Stage V and VI oocytes were defolliculated manually and kept at 18 C in modified Barths saline containing (in mM): NaCl, 88; KCl, 1; NaHCO3, 2.4; MgSO4, 0.82; Ca(NO3)2, 0.33; CaCl2, 0.41; HEPES, 20; buffered to pH 7.5 with NaOH and supplemented with penicillin (100 U/ml), streptomycin (100 µg/ml), sodium pyruvate (4.5 mM), and theophylline (0.5 mM). Oocytes were injected 1 d after defolliculation. Fifty nanoliters of the appropriate RNA solution were delivered with Nanoliter Injector (World Precision Instruments, Saratosa, FL). Electrophysiological experiments were performed 3 or 4 d after the injection.
The tissues for RNA preparation were derived from Wistar rats (250350 g), which were stunned before decapitation. All treatment of the animals was conducted in accordance with state laws and institutional regulations. The experiments were approved by the Animal Care and Ethics Committee of Semmelweis University.
Electrophysiology
Membrane currents were recorded by two-electrode voltage clamp (OC-725-C, Warner Instrument Corp., Hamden, CT) using microelectrodes made of borosilicate glass (Clark Electromedical Instruments, Pangbourne, UK) with resistance of 0.31 megaohm when filled with 3 M KCl. Currents were filtered at 1 kilohertz, digitally sampled at 12.5 kilohertz with a Digidata Interface (Axon Instruments, Foster City, CA), and stored on a PC/AT computer. Recording and data analysis were performed using pCLAMP software 6.0.4 (Axon Instruments). Experiments were carried out at room temperature, and solutions were applied by a gravity-driven perfusion system. Low [K+] solution contained (in mM): NaCl, 95.4; KCl, 2; CaCl2, 1.8; HEPES, 5. High [K+] solution contained 80 mM K+ (78 mM Na+ of the low [K+] solution was replaced with K+). Unless otherwise stated, the pH of every solution was adjusted to 7.5 with NaOH. Perifusing solutions with pH < 6.5 were buffered by including 5 mM 2-[N-morpholino]ethane sulphonic acid in addition. Background K+ currents were measured in high EC [K+] at the end of 300 msec long voltage steps to -100 mV applied in every 3 sec. The holding potential was 0 mV. Where it was possible, the inward current in high [K+] was corrected for the small nonspecific leak measured in 2 mM EC [K+].
Statistics and Calculations
Data are expressed as means ± SEM. Normalized dose- response curves were fitted (least squares method, Sigmaplot, Jandel Corp., San Rafael, CA) to a Hill equation of the form: y = 1/[1 + (c/K1/2)n], where c is the concentration, K1/2 is the concentration at which half-maximal inhibition occurs, and n is the Hill coefficient. Where the treatment failed to cause complete inhibition, a modified form of the equation was used: y =
/[1 + (c/K1/2)n] + (1 -
), where
is the fraction inhibited by the treatment.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: EC, Extracellular; 2P, two-pore; RR, ruthenium red; TASK, TWIK-related acid-sensitive K+ channel.
Received for publication June 25, 2001. Accepted for publication November 20, 2001.
| REFERENCES |
|---|
|
|
|---|
1H T-type Ca2+ channel is the predominant subtype expressed in bovine and rat zona glomerulosa. Am J Physiol 280:C265C272
This article has been cited by other articles:
![]() |
L. A. Davies, C. Hu, N. A. Guagliardo, N. Sen, X. Chen, E. M. Talley, R. M. Carey, D. A. Bayliss, and P. Q. Barrett TASK channel deletion in mice causes primary hyperaldosteronism PNAS, February 12, 2008; 105(6): 2203 - 2208. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zanzouri, I. Lauritzen, F. Duprat, M. Mazzuca, F. Lesage, M. Lazdunski, and A. Patel Membrane Potential-regulated Transcription of the Resting K+ Conductance TASK-3 via the Calcineurin Pathway J. Biol. Chem., September 29, 2006; 281(39): 28910 - 28918. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Musset, S. G. Meuth, G. X. Liu, C. Derst, S. Wegner, H.-C. Pape, T. Budde, R. Preisig-Muller, and J. Daut Effects of divalent cations and spermine on the K+ channel TASK-3 and on the outward current in thalamic neurons J. Physiol., May 1, 2006; 572(3): 639 - 657. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. B Lopes, T. Rohacs, G. Czirjak, T. Balla, P. Enyedi, and D. E Logothetis PIP2 hydrolysis underlies agonist-induced inhibition and regulates voltage gating of two-pore domain K+ channels J. Physiol., April 1, 2005; 564(1): 117 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Enyeart, S. J. Danthi, and J. J. Enyeart TREK-1 K+ channels couple angiotensin II receptors to membrane depolarization and aldosterone secretion in bovine adrenal glomerulosa cells Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1154 - E1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Berg, E. M. Talley, J. P. Manger, and D. A. Bayliss Motoneurons Express Heteromeric TWIK-Related Acid-Sensitive K+ (TASK) Channels Containing TASK-1 (KCNK3) and TASK-3 (KCNK9) Subunits J. Neurosci., July 28, 2004; 24(30): 6693 - 6702. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Czirjak, Z. E. Toth, and P. Enyedi The Two-pore Domain K+ Channel, TRESK, Is Activated by the Cytoplasmic Calcium Signal through Calcineurin J. Biol. Chem., April 30, 2004; 279(18): 18550 - 18558. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. SPAT and L. HUNYADY Control of Aldosterone Secretion: A Model for Convergence in Cellular Signaling Pathways Physiol Rev, April 1, 2004; 84(2): 489 - 539. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kang, J. Han, E. M. Talley, D. A. Bayliss, and D. Kim Functional expression of TASK-1/TASK-3 heteromers in cerebellar granule cells J. Physiol., January 1, 2004; 554(1): 64 - 77. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Han, D. Kang, and D. Kim Functional properties of four splice variants of a human pancreatic tandem-pore K+ channel, TALK-1 Am J Physiol Cell Physiol, September 1, 2003; 285(3): C529 - C538. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Bayliss, J. E. Sirois, and E. M. Talley The TASK Family: Two-Pore Domain Background K+ Channels Mol. Interv., June 1, 2003; 3(4): 205 - 219. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Czirjak and P. Enyedi Ruthenium Red Inhibits TASK-3 Potassium Channel by Interconnecting Glutamate 70 of the Two Subunits Mol. Pharmacol., March 1, 2003; 63(3): 646 - 652. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP |