| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Subunit of PKA Leads to Growth Retardation and Sperm Dysfunction
Department of Pharmacology, University of Washington School of Medicine, Seattle, Washington 98195-7750
Address all correspondence and requests for reprints to: Dr. G. S. McKnight, Department of Pharmacology, Box 357750, University of Washington, Seattle, Washington 98195-7750. E-mail: mcknight{at}u.washington.edu.
| ABSTRACT |
|---|
|
|
|---|
and Cß, are expressed in the mouse and mediate the effects of PKA. We generated a null mutation in the major catalytic subunit of PKA, C
, and observed early postnatal lethality in the majority of C
knockout mice. Surprisingly, a small percentage of C
knockout mice, although runted, survived to adulthood. This growth retardation was not due to decreased GH production but did correlate with a reduction in IGF-I mRNA in the liver and diminished production of the major urinary proteins in kidney. The survival of C
knockout mice after birth is dependent on the genetic background as well as environmental factors, but sufficient adult animals were obtained to characterize the mutants. In these animals, compensatory increases in Cß levels occurred in brain whereas many tissues, including skeletal muscle, heart, and sperm, contained less than 10% of the normal PKA activity. Analysis of sperm in C
knockout males revealed that spermatogenesis progressed normally but that mature sperm had defective forward motility. | INTRODUCTION |
|---|
|
|
|---|
(Prkaca) or Cß (Prkacb) might not be required for viability.
It has been demonstrated that the C
gene encodes two splice variants, C
1 and C
2 (Cs), in mouse (3), human (4), and sheep (5). C
1 is expressed ubiquitously, but C
2/Cs is restricted in its expression to midpachytene and postmeiotic germ cells. The Cß gene encodes three splice variants, Cß1, Cß2, and Cß3 (6). Cß1 is expressed in all tissues, whereas Cß2 and Cß3 are neural specific. Although Cß1 is expressed in nonneuronal tissues, C
is thought to be the principal source of PKA activity in these tissues (7).
In gonadal tissue, PKA is implicated in spermatogenesis. FSH and LH regulate sperm development and maturation through G protein-coupled receptors. Signaling through the LH receptor is Gs mediated and results in direct activation of adenylate cyclase and activation of the cAMP/PKA pathway. FSH receptors are also coupled to adenylate cyclase via Gs but have recently been shown to activate additional signaling pathways (8). In addition, PKA activity may be required for sperm motility because elevation of cAMP and, therefore, activation of PKA, after treatment with cAMP or phosphodiesterase inhibitors stimulates sperm motility (9, 10, 11, 12). PKA activity is required for sperm capacitation and protein tyrosine phosphorylation (13). Together, these reports demonstrate the important role that PKA mediates in male fertility.
In this report, we describe the phenotype of mice that are homozygous for a targeted deletion of the C
gene. Consistent with the proposed vital role of PKA in cellular function, the majority of C
knockouts are not viable and die in the immediate postnatal period. However, a small percentage survive into adulthood, and, when examined at 12 wk, C
knockouts are growth retarded but, surprisingly, organogenesis and tissue histology appear normal. Some tissues in which Cß is either not expressed or expressed at very low levels exhibit a near-complete loss of PKA activity. The most dramatically affected tissue is the testis, and sperm from C
knockout mice have essentially no detectable PKA activity. Although sperm production and morphology are normal, these PKA-deficient sperm lack forward motility and would be expected to be incapable of fertilization in vivo.
| RESULTS |
|---|
|
|
|---|
Gene
gene by replacing three of the coding exons for the catalytic domain (exons 6, 7, and 8) with a neomycin resistance cassette (Fig. 1A
gene. Southern blot (Fig. 1B
knockout mice confirmed that the C
protein was absent in homozygous knockout mice (Fig. 1D
knockouts survived when the genetic contribution of C57BL/6 was increased to 93%. Likewise, more C
knockouts survived when the animals were on a 50:50 C57BL/6:129SV/J background. Analysis of embryos at embryonic days 1518 (E1518) gave the expected Mendelian proportion of homozygotes (25%), suggesting that C
knockout mice survive as embryos but the majority die at birth or during the early postnatal period. Observation of pups during the early postnatal period revealed that most C
knockout pups die in the immediate postnatal period.
|
knockout mice survived past weaning. Examination of these mice at 3 months of age revealed that C
knockout mice weighed only 65% as much as their wild-type littermates (C
+/+: 27.1 ± 0.8 g vs. C
-/-: 17.6 ± 0.3 g, n = 3 mice/group). There was no significant difference in the weight of most visceral organs as a percentage of body weight with the exception of liver (C
+/+: 5.6 ± 0.4% vs. C
-/-: 4.1 ± 0.3%) and brain (C
+/+: 1.75 ± 0.03% vs. C
-/-: 2.42 ± 0.06%), indicating that the decrease in overall body weight in C
knockouts results from a reduction throughout the body, including most visceral organs. All organs appeared histologically normal, including the brain, pancreas, spleen, and intestines. There was no significant difference between wild-type and C
heterozygous littermates in total body weight or in visceral organ weights. These findings demonstrate that C
is critical for overall growth but not for organogenesis.
Examination of Growth Defects in C
Knockouts
C
knockout mice are growth retarded beginning as early as 2 wk of age (Fig. 2A
), a phenotype that is consistent with a disruption of the GH/IGF-I endocrine system. Because GH stimulates the expression of IGF-I mRNA in the liver and causes an elevation of the major urinary proteins (MUPs) (14, 15), we examined the levels of serum GH, IGF-I mRNA, and MUPS in wild-type and C
knockout males. Surprisingly, serum GH levels were unchanged but IGF-I mRNA levels were reduced by 60% in C
knockout mice compared with wild-type littermates (Fig. 2, B andC
). Likewise, we observed a large decrease in the levels of MUPs in C
knockout mice (Fig. 2D
). These findings indicate that C
knockout mice are partially GH resistant, which is likely to account for some of the growth retardation observed in these animals.
|
Knockouts
gene would be expected to result in a reduction in kinase activity in many tissues. PKA activity was measured in brain, heart, kidney, liver, lung, skeletal muscle, spleen, and white adipose tissue (WAT). As is evident from Fig. 3
knockouts.
|
Protein Alters R and Cß Subunit Protein Levels
, and Cß1 (16, 17, 18, 19). The deletion of an R subunit gene resulted in a tissue-dependent decrease in C subunit levels, suggesting that the PKA holoezyme is more resistant to protein degradation than free PKA subunits. Therefore, we hypothesized that the deletion of C
protein would result in a reduction of R subunits. Indeed, we observed a significant reduction in RI
levels in heart, kidney, lung, and skeletal muscle (Fig. 4
levels was seen in skeletal muscle. Interestingly, in brain, heart, lung, and skeletal muscle of C
knockouts, the phosphorylated form (P-RII
) is absent. This finding may be as a consequence of the loss of C
subunit, which is known to phosphorylate RII
in the holoenzyme complex. In the case of the RIIß subunit levels in C
knockouts, a decrease was observed in WAT, whereas no change was observed in brain or lung. In the latter tissues, RIIß may be stabilized by protein-protein interactions other than holoenzyme formation. The A kinase-anchoring proteins (AKAPs) are possible candidates for this alternative form of stabilization.
|
subunit resulted in a compensatory increase in Cß1 protein in brain, kidney, spleen, and liver. The increase in Cß1 protein in kidney was not accompanied by an increase in Cß1 mRNA (data not shown), suggesting a posttranscriptional stabilization of Cß1 protein. This compensation by Cß1 accounts for the remaining kinase activity observed in these tissues. The fold change in PKA subunit protein levels of C
knockouts compared with wild type is summarized in Table 1
|
Knockouts
(C
1 and C
2) have been shown to be expressed in the testis (3, 20, 21). C
1 is expressed in Sertoli cells, Leydig cells, and spermatogonia (20). C
2 is expressed exclusively in developing germ cells as early as stage V pachytene spermatocytes with continued expression in mature spermatids (3, 21). In mature spermatozoa, PKA has been shown to be involved in motility (22). Based on these findings, we hypothesized that the loss of C
in the testis would result in deficits in germ cell production and sperm motility.
In 12-wk-old male C
knockout mice, we observed a nearly complete loss of PKA activity in the testis and in mature sperm removed from the cauda epididymis (Fig. 5A
). Concomitant with the loss of C
, RI
protein levels were reduced in the testis, and both RI
and RII
subunits were absent in mature sperm (Fig. 5B
). Although PKA activity is largely undetectable in C
knockout testis and spermatozoa, testis weight (as a percentage of total body weight) and FSH levels were not significantly different from wild type (Table 2
). Furthermore, the sperm count in testis was essentially normal in the C
knockout testis, but the percentage of sperm with morphological abnormalities (abnormal head shape) increased from 7% in wild type to 28% in the knockout (Table 2
). No difference was observed in the percentage of sperm isolated from the cauda epididymis that exhibited some flagellar movement when placed in media capable of capacitating spermatozoa. However, the percent of C
knockout sperm (1%, 22/1,503 sperm, n = 2 mice) with forward velocity was dramatically reduced when compared with wild-type sperm (28%, 207/856 sperm, n = 2 mice) (Table 2
).
|
|
knockout mice provided additional evidence of normal spermatogenesis. All stages of the developmental cycles of spermatogenesis were evident in C
knockout mice. For example, elongated spermatids in the lumen and round spermatids and pachytene spermatocytes in seminiferous tubules were present at stage VII (Fig. 6, A and D
is required for the effective forward velocity of sperm but is not essential for production or maturation.
|
| DISCUSSION |
|---|
|
|
|---|
gene resulted in mice that survived through embryonic development and then were lost in the neonatal period with less than 30% surviving to adulthood. The level of remaining kinase activity derived from the Cß gene is essential for embryonic development, as demonstrated by the complete absence of embryos deficient in both the C
and Cß alleles when the two knockout lines are crossed (Huang, Y., and G. S. McKnight, manuscript submitted). The small percentage of C
knockout mice that survived to adulthood were growth retarded but survived to 3 months, the age when they were studied. The growth retardation may be a consequence of partial GH resistance, as evidenced by normal circulating GH levels and a reduction in the GH-dependent molecules, IGF-I mRNA and MUPs. Surprisingly, spermatogenesis in adult C
knockout males is largely unaffected, although mature sperm lack forward velocity.
The majority of C
knockouts die shortly after birth, and changing the genetic background from 50:50 to approximately 93:7 C57BL/6:129SV/J further decreased the survival rate by approximately 30%. The cause of early postnatal death has not been determined. In contrast, loss of the other C isoform, Cß1, does not lead to premature death, although the mice have impaired hippocampal synaptic plasticity (17). Surprisingly, a few C
knockout mice do survive but have decreased postnatal growth rate such that their body weights are reduced to about 65% of wild-type littermates at 12 wk of age. Normal serum GH levels but reduced liver IGF-I mRNA and urinary MUPs levels suggests that C
knockout mice are partially GH resistant. The cause of partial GH insensitivity is unknown, but it is possible that C
knockouts may be immunocompromised, which can lead to GH insensitivity (23). Alternatively, signaling through GH receptor may be altered via cross-talk between the PKA and the ERK2/MAPK signaling pathway (24) and its convergence on the Janus kinase/signal transducer and activator of transcription (JAK/STAT) signaling pathway (25).
The loss of the C
subunit results in a dramatic reduction in PKA activity in all tissues except brain and large changes in the remaining PKA subunit levels. Tissues (skeletal muscle, heart, and testis) that had previously been shown to express the lowest levels of Cß mRNA relative to C
mRNA (7) also displayed the lowest levels of remaining PKA activity in the C
knockouts. These experiments reveal the relatively small contribution of Cß1 to total PKA activity in most tissues. However, in several cases, significant compensation by Cß1 has occurred, and in those tissues the loss of kinase activity is partially prevented. For instance, an elevation of Cß1 levels was observed in brain and kidney of C
knockouts. No change in Cß1 mRNA was observed in either tissue (data not shown), indicating a posttranscriptional stabilization of Cß1 protein is responsible for the compensation. This stabilization is accomplished by the release of R subunits normally bound by C
but which are now available to bind to Cß1 protein and stabilize it against proteolysis.
The loss of C
protein results in a reduction of both RI and RII subunits in several tissues. The most dramatic change occurs in skeletal muscle, heart, and sperm where both RI
and RII
are nearly absent in C
knockouts. In lung, RI
is absent in the C
knockout but the levels of RII
and RIIß remain with only a modest reduction. This observation that the level of RI is the most sensitive to changes in C protein is in agreement with our previous observations that the RI subunits compete less effectively than the RII subunits in the formation of holoenzyme (18, 26). Previous work has shown that the RII subunits have a higher affinity for most anchoring proteins (AKAPs) than the RI subunits (19), and it is also possible that the presence of RII interacting AKAPs in these tissues may help stabilize the RII protein in the absence of C subunit.
Spermatogenesis in C
knockout testis remains relatively unaffected despite a loss of more than 95% of total PKA activity in the testis. The near-normal development of sperm is surprising because both LH and, to a partial extent, FSH, rely on cAMP and PKA to transduce ligand binding to Leydig and Sertoli cells into physiological responses. Loss of signaling through FSH, such as is observed in the FSH receptor knockout (27), results in small testes and partial spermatogenic failure. In these mice, a decrease in sperm production, an increase in aberrant spermatozoa, and a decrease in percent motility were observed. Similar to FSH receptor knockouts, C
knockouts have a reduction in sperm count and an increase in aberrant spermatozoa. However, C
knockouts have normal testes size relative to their body weight. The dramatic loss of total testis PKA activity may not be a good reflection of the changes in activity within Leydig and Sertoli cells because sexually mature testis is dominated by the germ cell contribution. In experiments using immature testis from wild-type and C
knockout mice where the contribution of germ cells is reduced, we found a more moderate decrease in PKA activity (Su, T., and G. S. McKnight, unpublished data). Based on this result we conclude that the remaining Cß1 PKA activity may be sufficient to maintain adequate signaling through the LH and FSH receptors to regulate steroidogenesis and germ cell differentiation in C
knockout testis.
Although C
knockouts have only a slightly reduced sperm count, the mature sperm exhibit flagella oscillation but a near-total loss of forward velocity. Several reports have demonstrated the requirement for PKA activity in stimulating sperm motility (4, 10, 14). However, the mechanism through which PKA promotes sperm motility remains unclear. C
2/Cs is expressed in germ cells and has been shown to be the only isoform of C
present in mature spermatozoa (3, 21). Furthermore, C
2/Cs is located along the flagellum (4, 21) where PKA may be involved in stimulating fibrous sheath sliding through phosphorylation of axoneme components (28). Thus, the germ cell-specific expression of C
2/Cs along the flagellum suggests that deletion of this C subunit coupled with no observable compensation by Cß1 may be the direct cause for sperm motility arrest in C
knockout mice. However, it is also possible that the absence of PKA in germ cells may result in abnormal sperm development and subsequent motility defects secondary to developmental changes. Indeed, 28% of C
knockout sperm appear morphologically abnormal compared with only 7% in wild type.
Although the fertility of C
knockout males was not possible to assess due to the small size and delicate health of those knockouts that survived past weaning, the loss of sperm motility suggests that C
knockouts would be incapable of successful fertilization. Additional studies on mice with germ cell-specific lesions in C
will help resolve the contribution of PKA to normal sperm motility and fertility.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Targeting Vector and Generation of Knockout Mice
knockout mice were generated from the targeted disruption of the C
gene by homologous recombination. To construct the targeting vector, a 5.3-kb genomic fragment containing exons 58 of the C
gene was used. An approximately 1.3-kb StuI fragment encompassing exons 6, 7, and 8 was replaced with a neomycin phosphotransferase cassette to facilitate positive selection. This strategy deleted the catalytic domain of both the C
1 and C
2 splice variants of the C
gene (3).
Gene targeting in ES cells was carried out essentially as previously described (16). The targeting vector, C
-Rec1, was linearized and electroporated into REK3 ES cells derived from 129SV/J mice (29). Two different clones of ES cells yielded germline chimeras, which were then bred for four generations onto the C57BL/6 background to generate heterozygous mice that were 93% C57BL/6 and 7% 129SV/J. Heterozygous mice were crossed to generate wild-type littermate controls and homozygous C
knockout mice.
Southern and PCR Analysis
Genotyping was performed by Southern or PCR analysis as follows. Southern analysis of BamHI digested tail DNA was done by using a 1-kb EcoRV/BamHI probe outside the region of homology between the targeting vector and the C
wild-type allele. The wild-type allele generated a 6.0-kb fragment, and the knockout allele generated a 2.7-kb fragment. PCR analysis was performed on tail DNA with two pairs of primers. The first pair was used to detect the wild-type allele (CTGACCTTTGAGTATCTGCAC and GTCCCACACAAGGTCCAAGTA) by amplification of the intron between exons 6 and 7, and the second pair was used to detect the knockout allele (GTGGTTTGTCCAAACTCATCAATGT and AGACTACTGCTCTATCAC TGA) by amplification of the region between the 3'-end of the neomycin resistance gene and a portion of the intron just 3' to exon 8.
Western Blots
Tissues were removed from 12-wk-old wild-type and knockout mice, frozen in liquid nitrogen, and stored at 80 C. Sperm were isolated from the cauda epididymis and prepared as previously described (30). Each tissue was then disrupted with a Polytron in homogenization buffer [250 mM sucrose/100 mM sodium phosphate, pH 7.0/150 mM NaCl/1 mM EDTA/4 mM EGTA/4 mM dithiothreitol/1.0% Triton X-100/2 µg/ml leupeptin/3 µg/ml aprotinin/0.2 mg/ml soybean trypsin inhibitor/1 mM 4-(2-aminoethyl) benzenesulfonyl fluoride] as previously described (18), sonicated, and centrifuged for 10 min at 12,000 x g at 4 C. Protein concentration was measured by the Bradford method (Bio-Rad Laboratories, Inc., Hercules, CA) on supernatants. Forty-eighty micrograms of protein were loaded onto individual lanes of a 10% polyacrylamide gel and transferred to a nitrocellulose membrane. That equivalent amounts of protein were present in each lane was verified by staining the membrane with Ponceau S. The blots were then blocked overnight in blocking buffer (10 mM Tris HCl, pH 8, 150 mM NaCl, 5% nonfat powdered milk, 0.05% Tween 20) and probed with anti-C
(a gift kindly provided by S. S. Taylor, University of California, San Diego), anti-RI
monoclonal antibody (Transduction Laboratories, Lexington, KY), anti-RII
, or anti-Cß polyclonal antipeptide antibodies. The blots were then incubated with horseradish peroxidase-conjugated secondary antibody and visualized using the ECL system (Amersham Pharmacia Biotech, Arlington Heights, IL).
Solution Hybridization
The method used for measuring the total amount of IGF-I mRNA and Cß mRNA has been described (7). Briefly, total nucleic acid samples isolated by proteinase K digestion and phenol/chloroform extraction were hybridized with a single-stranded [32P]CTP-labeled RNA probe. Samples were then digested with ribonuclease A and T1, precipitated in 10% trichloroacetic acid, and filtered onto GF/C filters (Whatman, Clifton, NJ). The amount of ribonuclease-resistant probe was determined by liquid scintillation counting. IGF-I- and Cß-specific mRNA in each sample was determined by comparison to a standard curve constructed with known amounts of RNA containing the sense strand of the IGF-I and Cß cDNAs. The results, calculated as picograms of RNA hybridized per µg of total nucleic acid, were converted to molecules per cell by assuming 6 pg of DNA per cell.
MUPs Analysis
MUPs were analyzed after the collection of urine at the time of euthanasia from 12-wk-old wild-type and C
knockout mice with free access to food and water. The urine was diluted (1:10) in sample buffer to a final concentration of 63 mM Tris, pH 6.8, 2% SDS, 5% glycerol, and 0.05% bromophenol blue and boiled for 3 min. Ten microliters were loaded onto individual lanes of a 12% polyacrylamide gel. The proteins were separated and stained with Coomassie blue.
Protein Kinase Activity Assay
Protein homogenates from tissues and cauda epididymal sperm removed from 12-wk-old wild-type and C
knockout mice were prepared in homogenization buffer (described under Western Blots) and sonicated. Homogenates except sperm were then centrifuged for 10 min at 12,000 x g at 4 C and the supernatant was assayed. Protein kinase activity, expressed as picomoles of Pi (inorganic phosphate) transferred per min (U) per mg of protein, was determined in the presence and absence of 5 µM cAMP by using Kemptide (Sigma, St. Louis, MO) as a substrate as described previously (31). Nonspecific kinase activity that remained in the presence of 1 µM heat stable PKA inhibitor was subtracted from both basal and total PKA activity. For spermatozoa, kinase activity (picomoles of Pi transferred per min) was measured as described above with the exception that equivalent amounts of sample, as determined by DNA readings as previously described (30), were assayed.
Histology
The testis was removed from 12-wk-old wild-type and C
knockout mice and was placed in Bouins fixative overnight and washed several times in 70% ethanol. The tissue was embedded in paraffin and sectioned at 2 µm and stained with hematoxylin and Periodic Acid Schiff to stain the spermatid acrosome.
Sperm Motility Analysis
Sperm isolation from the cauda epididymis was performed as previously described (30). Briefly, the cauda epididymis was cut and placed into a medium containing NaHCO3 (25 mM), Ca2+ (1 mM), and BSA (BSA, Fraction V, Sigma; 20 mg/ml) which stimulates sperm motility and capacitation (32). Sperm from 12-wk-old wild-type and C
knockout mice were readily recovered in this manner after a 30-min incubation. Sperm were then placed in a slide chamber of 50 µm depth, and 20 fields were recorded for 5 sec each. Measurements were made on a minimum of 200 sperm from the recorded sperm samples. All sperm with moving flagella were counted for the percent motility measurement, and those sperm that moved at least 100 µm were counted as having forward velocity.
Testicular Sperm Count
Testes from 12-wk-old wild-type and C
knockout mice were homogenized with a Dounce homogenizer in 2 ml of normal saline containing 0.05% Triton X-100. Homogenization-resistant elongated spermatids were counted by using a hemocytometer. The numbers were expressed as per testis.
Hormone Assays
Serum was collected from blood removed from 12-wk-old wild-type and C
knockout mice and frozen at 20 C until assayed for GH and FSH. For the GH assay, the rat GH ELISA kit (Amersham Pharmacia Biotech, Arlington Heights, IL) was used (sensitivity, 1.6 ng/ml). For the FSH assay, the standard was rFHS-RP-2, and the antiserum was anti-rFSH-S-11. Final values are expressed as nanograms of FSH per ml of serum. The intraassay and interassay coefficients of variation were 8.5% and 13.5%, respectively.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Present address: Institute for Nutrition, University of Oslo, P.O. Box 1046 Blindern, N-0317 Oslo, Norway. ![]()
2 Present address: Department of Medicine, Division of Metabolism, Endocrinology, and Nutrition, University of Washington, Seattle, Washington 98195; and Veterans Affairs Puget Sound Health Care System, Seattle, Washington 98108. ![]()
Abbreviations: AKAP, A-kinase anchoring protein; C, catalytic subunit; ES, embryonic stem; MUPs, major urinary proteins; Pi, inorganic phosphate; R, regulatory subunit; WAT, white adipose tissue.
Received for publication September 25, 2001. Accepted for publication November 8, 2001.
| REFERENCES |
|---|
|
|
|---|
-s, localizes to sperm midpiece. Biol Reprod 63:607611
protein levels in protein kinase A mutant mice. J Biol Chem 272:39933998
1 isoforms of the catalytic subunit of cyclic 3',5'-adenosine monophosphate-dependent protein kinase in testicular cells. Biol Reprod 65:151164
inhibit growth hormone stimulation of insulin-like growth factor I synthesis and growth hormone receptor mRNA levels in cultured rat liver cells. Eur J Endocrinol 135:729737
regulatory subunit delocalizes protein kinase A in mouse sperm without affecting motility or fertilization. J Biol Chem 274:2413124136This article has been cited by other articles:
![]() |
L. S Kirschner, Z. Yin, G. N Jones, and E. Mahoney Mouse models of altered protein kinase A signaling Endocr. Relat. Cancer, September 1, 2009; 16(3): 773 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Wall, J. R. Zavzavadjian, M. S. Chang, B. Randhawa, X. Zhu, R. C. Hsueh, J. Liu, A. Driver, X. R. Bao, P. C. Sternweis, et al. Suppression of LPS-Induced TNF-{alpha} Production in Macrophages by cAMP Is Mediated by PKA-AKAP95-p105 Sci. Signal., June 16, 2009; 2(75): ra28 - ra28. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Mitchell, B. Nixon, M. A. Baker, and R. J. Aitken Investigation of the role of SRC in capacitation-associated tyrosine phosphorylation of human spermatozoa Mol. Hum. Reprod., April 1, 2008; 14(4): 235 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Qu, X. Ying, W. Guo, Q. Guo, G. Chen, Y. Liu, and Z. Ding The role of Zn-{alpha}2 glycoprotein in sperm motility is mediated by changes in cyclic AMP Reproduction, October 1, 2007; 134(4): 569 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Burton and G. S. McKnight PKA, Germ Cells, and Fertility Physiology, February 1, 2007; 22(1): 40 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Watson, R. M. Abdel-Majid, M. W. Barnett, B. S. Willis, A. Katsnelson, T. H. Gillingwater, G. S. McKnight, P. C. Kind, and P. E. Neumann Involvement of protein kinase A in patterning of the mouse somatosensory cortex. J. Neurosci., May 17, 2006; 26(20): 5393 - 5401. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Collins, Y.-F. Lee, C. A. Heinlein, N.-C. Liu, Y.-T. Chen, C.-R. Shyr, C. K. Meshul, H. Uno, K. A. Platt, and C. Chang Growth retardation and abnormal maternal behavior in mice lacking testicular orphan nuclear receptor 4 PNAS, October 19, 2004; 101(42): 15058 - 15063. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Nolan, D. F. Babcock, G. Wennemuth, W. Brown, K. A. Burton, and G. S. McKnight Sperm-specific protein kinase A catalytic subunit C{alpha}2 orchestrates cAMP signaling for male fertility PNAS, September 14, 2004; 101(37): 13483 - 13488. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bao, D. J. Miller, Z. Ma, M. Wohltmann, G. Eng, S. Ramanadham, K. Moley, and J. Turk Male Mice That Do Not Express Group VIA Phospholipase A2 Produce Spermatozoa with Impaired Motility and Have Greatly Reduced Fertility J. Biol. Chem., September 10, 2004; 279(37): 38194 - 38200. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Esposito, B. S. Jaiswal, F. Xie, M. A. M. Krajnc-Franken, T. J. A. A. Robben, A. M. Strik, C. Kuil, R. L. A. Philipsen, M. van Duin, M. Conti, et al. Mice deficient for soluble adenylyl cyclase are infertile because of a severe sperm-motility defect PNAS, March 2, 2004; 101(9): 2993 - 2998. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Luconi, V. Carloni, F. Marra, P. Ferruzzi, G. Forti, and E. Baldi Increased phosphorylation of AKAP by inhibition of phosphatidylinositol 3-kinase enhances human sperm motility through tail recruitment of protein kinase A J. Cell Sci., March 1, 2004; 117(7): 1235 - 1246. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. TASKEN and E. M. AANDAHL Localized Effects of cAMP Mediated by Distinct Routes of Protein Kinase A Physiol Rev, January 1, 2004; 84(1): 137 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Carlson, R. E. Westenbroek, T. Quill, D. Ren, D. E. Clapham, B. Hille, D. L. Garbers, and D. F. Babcock CatSper1 required for evoked Ca2+ entry and control of flagellar function in sperm PNAS, December 9, 2003; 100(25): 14864 - 14868. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Turner Tales From the Tail: What Do We Really Know About Sperm Motility? J Androl, November 1, 2003; 24(6): 790 - 803. [Full Text] [PDF] |
||||
![]() |
Genetically Modified Animals in Endocrinology Endocr. Rev., August 1, 2003; 24(4): 554 - 555. [Full Text] [PDF] |
||||
![]() |
G. Wennemuth, A. E. Carlson, A. J. Harper, and D. F. Babcock Bicarbonate actions on flagellar and Ca2+-channel responses: initial events in sperm activation Development, April 1, 2003; 130(7): 1317 - 1326. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Niswender, R. W. Ishihara, L. M. Judge, C. Zhang, K. M. Shokat, and G. S. McKnight Protein Engineering of Protein Kinase A Catalytic Subunits Results in the Acquisition of Novel Inhibitor Sensitivity J. Biol. Chem., August 2, 2002; 277(32): 28916 - 28922. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Amieux, D. G. Howe, H. Knickerbocker, D. C. Lee, T. Su, G. S. Laszlo, R. L. Idzerda, and G. S. McKnight Increased Basal cAMP-dependent Protein Kinase Activity Inhibits the Formation of Mesoderm-derived Structures in the Developing Mouse Embryo J. Biol. Chem., July 19, 2002; 277(30): 27294 - 27304. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang, H. Roelink, and G. S. McKnight Protein Kinase A Deficiency Causes Axially Localized Neural Tube Defects in Mice J. Biol. Chem., May 24, 2002; 277(22): 19889 - 19896. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |