| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Molecular Metabolism and Diabetes (H.K., T.Y., Y.O.), Department of Internal Medicine, Tohoku University Graduate School of Medicine, Sendai 980-8574, Japan; Third Department of Internal Medicine (T.A., Y.F.), Faculty of Medicine, University of Tokyo, Tokyo 113-8655 Japan; Department of Aging Biochemistry (T.A.), Shinshu University School of Medicine, Matsumoto, Nagano 390-8621, Japan; Institute for Adult Disease (M.K.), Asahi Life Foundation, Tokyo 160, Japan; and Department of Molecular Biology and Medicine (T.K.), Research Center for Advanced Science and Technology, University of Tokyo, Tokyo 153, Japan
Address all correspondence and requests for reprints to: Hideki Katagiri, M.D., Division of Molecular Metabolism and Diabetes, Department of Internal Medicine, Tohoku University Graduate School of Medicine, Seiryo-machi, Sendai 980-8574, Japan. E-mail: katagiri-tky{at}umin.ac.jp.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Binding of insulin to its receptor results in receptor autophosphorylation and activation of the receptor tyrosine kinase, followed by tyrosine phosphorylation of several intermediate proteins including insulin receptor substrate 1 (3, 4). Tyrosine-phosphorylated insulin receptor substrates then bind to and thereby regulate SH2 domain-containing proteins. PI3K is one of such signaling molecules (5, 6). The PI3K pharmacological inhibitors (7, 8), or expressions of dominant negative mutants of PI3K (9, 10), reportedly exert marked blocking effects on insulin-stimulated glucose transport and GLUT4 translocation in rat and 3T3-L1 adipocytes. Furthermore, overexpression of the wild-type (11) or constitutively active mutant (12, 13) of PI3K promoted glucose transport activity and GLUT4 translocation. These findings suggest that PI3K plays a central role in insulin-stimulated glucose transport and GLUT4 translocation, although the contribution of a PI3K-independent pathway involving GLUT4 translocation has also been reported recently (14).
Recently, several pathways have been reported to be activated by stimulation with insulin and other growth factors downstream from PI3K. Among them, activations of serine/threonine kinases, protein kinase B (cellular homolog of v-AKT, also termed RAC-PK) (15) or atypical PKC (16) are reportedly involved in insulin-stimulated glucose transport, although these claims are controversial (17, 18). However, the kinase cascade, consisting of receptor tyrosine kinase, lipid kinase, and serine/threonine kinases, is not unique to insulin signaling, being common to other signaling pathways of other growth factors and adhesion molecules as well (19, 20, 21). Why only insulin can recruit GLUT4 to the plasma membrane, resulting in acceleration of glucose transport, is an important research question. We attempted to identify signaling components proximal to GLUT4-containing vesicles.
Studies of immunoadsorbed GLUT4 vesicles have identified a number of other proteins in these vesicles. One of these is insulin-regulated aminopeptidase (IRAP, also called gp160 or vp165), a zinc-dependent aminopeptidase (4, 22, 23), which is oriented in the vesicle membrane with its 109-amino acid amino-terminal end projecting into the cytoplasm and has a single transmembrane domain and a large catalytic domain within the lumen of the vesicle. The distribution of IRAP within adipocytes is very similar to that of GLUT4. In the basal state, the majority of IRAP is sequestered in an intracellular compartment, and after stimulation with insulin both GLUT4 and IRAP are translocated to the cell surface (24, 25). The amino terminus of IRAP contains two dileucine motifs and several acidic regions, which are thought to play important roles in vesicular trafficking. It was reported recently that introduction of the cytoplasmic domain of IRAP into 3T3-L1 adipocytes by microinjection resulted in rapid and sustained translocation of GLUT4 from an intracellular compartment to the cell surface in a PI3K-independent manner, suggesting that it acts downstream from this signaling element (26). By deletion analysis, a 28-amino acid region (amino acid residues 55–82) of IRAP, which contains one of these dileucine motifs (amino acid residues 76–77) and acidic regions, was found to be sufficient to cause GLUT4 translocation (26). Furthermore, a chimeric protein of the cytoplasmic domain of IRAP with the transferrin receptor was reportedly targeted to the insulin-regulated, slow recycling pathway, and its dynamic retention was dependent on this dileucine motif in Chinese hamster ovary (CHO) cells (27) and 3T3-L1 adipocytes (28). These findings suggest that an intracellular molecule(s) recognizes and binds the trafficking motif within IRAP, resulting in sequestration of GLUT4-containing vesicles within a specialized intracellular compartment. To address these issues, we have used glutathione-S-transferase (GST) fusion proteins to identify and characterize IRAP(55–82)-specific binding proteins. Herein, we demonstrate acyl-coenzyme A (CoA) dehydrogenases (ACDs) to associate with IRAP(55–82) in a manner dependent upon its dileucine motif.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). To obtain a large amount of these specific IRAP-associated proteins, 50 confluent 10-cm dishes of 3T3-L1 adipocytes were isolated. Coomasie blue staining of the precipitates revealed the 57-, 46-, and 42-kDa proteins to be precipitated specifically with GST-IRAP(55–82) but not with GST (Fig. 1B). Although other intense bands were detected on the Coomasie blue-stained gel, these were also seen in the absence of lysate and therefore were presumed to be derived from Escherichia coli. Eluants were transferred onto polyvinylidene difluoride membranes and amino-terminal sequences were determined using an automated protein sequencer. Two different amino acid sequences were obtained from the 46-kDa band, SHSGPEAGLE and HSKAAHKQEP, which were identified as long chain acyl-CoA dehydrogenase (LCAD) and medium-chain acyl-CoA dehydrogenase (MCAD), respectively. The 42-kDa band had an amino acid sequence, LHTVYQSVEL, which was identified as a short chain acyl-CoA dehydrogenase (SCAD). In addition, cell extracts were also prepared from primary isolated rat muscle and adipocytes and incubated with the GST fusion proteins (Fig. 1C). Similar to the results obtained for 3T3-L1 adipocytes, several bands, including those at 46 and 42 kDa, were precipitated with GST-IRAP(55–82), suggesting that LCAD, MCAD, and SCAD are also present in rat muscle and fat tissues as proteins bound to GST-IRAP(55–82).
|
, A–C, respectively). In contrast, no proteins immunoreacting with antibodies against these ACDs were detected in the GST precipitates (lane 1 of Fig. 2, A–C), in precipitates with the cytoplasmic C-terminal region of GLUT1 fused with GST (lane 3 of Fig. 2, A–C), or in the cytoplasmic C-terminal region of GLUT4 fused with GST (lane 4 of Fig. 2, A–C). Coomasie blue staining revealed the amount of GST protein for IRAP(55–82) to be equal to or slightly less than those of the other constructs (Fig. 2D). These results indicate specific association of ACDs with the region including the dileucine motif of IRAP.
|
LL]. In this experiment, the amounts of GST-IRAP(55–82) and GST-IRAP(55–82)LL were nearly the same, as demonstrated by Coomasie blue staining (Fig. 2D
). Immunoblotting using anti-LCAD, MCAD, and SCAD antibodies revealed immunoreactive proteins to be virtually undetectable in the precipitates with GST-IRAP(55–82)LL (lane 5 of Fig. 2, A–C). Thus, LCAD, MCAD, and SCAD are associated with IRAP in a dileucine motif (leucines 76 and 77)-dependent manner.
ACDs and GLUT4 Had Overlapping Distribution Profiles on Velocity Gradient Ultracentrifugation of Low-Density Microsomal (LDM) Fractions from 3T3-L1 Adipocytes
To investigate whether LCAD, MCAD, and SCAD are localized on GLUT4-containing vesicles, the LDM fraction from serum-starved 3T3-L1 adipocytes was separated on a continuous 10–30% sucrose velocity gradient as described in Materials and Methods. It is noteworthy that mitochondria were excluded from the LDM fraction using this fractionation method. Fractions were taken from the bottom to the top and subjected to 10% SDS-PAGE. Proteins were transferred to membranes and first immunoblotted with anti-GLUT4 antibody, followed by repeatedly stripping and reblotting the same membrane with anti-LCAD, anti-MCAD, and anti-SCAD antibodies. Immunoblotting with anti-GLUT4 antibody (top panel of Fig. 3) revealed a distinct GLUT4 peak near the bottom. Three ACDs exhibited similar distribution profiles; two distinct peaks, one of which, near the bottom, considerably overlapped that of GLUT4 (the second to fourth panels of Fig. 3). Fractions were also subjected to 7.5% and 12% SDS-PAGE, followed by immunoblotting with the antibody against transferrin receptor and 14-3-3 proteins as markers for endosomal and cytoplasmic proteins (30), respectively. The profiles for transferrin receptor and 14-3-3 proteins exhibited distinct peaks (two panels from the bottom of Fig. 3), which were clearly different from those for ACDs and GLUT4. These results are consistent with colocalization of ACDs with GLUT4 on the same intracellular vesicles.
|
). Control mouse IgG-conjugated beads were employed as controls (lane 1 of Fig. 4A). Immunoblotting of immunopurified vesicles with the rabbit anti-GLUT4 antibody confirmed that GLUT4-containing vesicles had been obtained by the immunopurification procedure. Immunoblotting with specific antibodies against each ACD demonstrated the presence of LCAD, MCAD, and SCAD in vesicles purified with anti-GLUT4 antibody, but not in those immunopurified with control IgG. The same sheet was immunoblotted with antibodies against calnexin and transferrin receptor, which are an endoplasmic reticulum protein (31) and an endosome marker, respectively. A very faint band was detected in vesicles immunopurified with control IgG or anti-GLUT4 antibody, but the amount of the protein in the vesicles immunopurified with control IgG was rather large compared with that of vesicles immunopurified with anti-GLUT4 antibody. These results were in clear contrast to those for ACDs, suggesting specific adsorption of ACDs in the vesicles immunopurified with anti-GLUT4 antibody. Taken together, our findings indicate that these ACD proteins are localized on GLUT4-containing vesicles in the LDM fraction of 3T3-L1 adipocytes via their association with IRAP.
|
, LCAD, MCAD, and SCAD were coimmunoprecipitated with IRAP, suggesting that these ACD proteins are associated with IRAP in vivo.
Inhibitors of LCAD and MCAD Increased Glucose Transport Activity as Well as Plasma Membrane GLUT4 Content in Permeabilized 3T3-L1 Adipocytes
We next examined whether manipulations of ACDs affected the glucose transport activity as well as GLUT4 translocation. First, we examined the effects of ACD inhibitors, 3-mercaptopropionic acid (MPA) as an inhibitor of LCAD (32) and hexanoyl-CoA (HC) as an inhibitor of MCAD (34), on glucose transport activity in 3T3-L1 adipocytes. To allow these reagents to enter cells, the cells were first permeabilized with 
-toxin. Permeabilized 3T3-L1 adipocytes were treated with or without MPA or HC and subsequently with or without insulin, followed by measurement of 2-deoxyglucose uptake. Previous studies showed that glucose transport activity can be measured in 3T3-L1 adipocytes permeabilized with streptolysin-O (34) or -toxin (35), although, in permeabilized cells, basal glucose transport activity is elevated as a consequence of the manipulations involved in the permeabilization procedure. In the present study, both insulin and GTP-
S stimulated glucose transport approximately 2.5-fold (Fig. 5A), which was consistent with the results of previous studies using permeabilized 3T3-L1 adipocytes (34, 35). Treatment with MPA or HC consistently caused a small (
1.7-fold) but statistically significant (P < 0.05) increase in glucose transport activity even in the absence of insulin (Fig. 5A). In contrast, mercaptoacetic acid and ß-hydroxybutyryl-CoA did not affect the glucose transport activity (data not shown).
|
). Treatment with MPA or HC also increased the plasma membrane GLUT4 content even in the absence of insulin, and the addition of insulin further increased the plasma membrane GLUT4 content (Fig. 5B). These findings demonstrate that MPA and HC induce translocation of GLUT4-containing vesicles to the plasma membrane, thereby accelerating glucose transport activity.
MPA and HC Induced Their Dissociation from IRAP
To investigate the mechanism whereby MPA and HC induce translocation of GLUT4, we next examined whether these ACD inhibitors affected the association between ACDs and IRAP. Cell extracts from 3T3-L1 adipocytes were precipitated with GST-IRAP(55–82) in the absence or presence of MPA (lane 2 of Fig. 6) or HC (lane 3 of Fig. 6). Immunoblotting using anti-LCAD antibody revealed the amounts of LCAD (Fig. 6A) to be markedly decreased in the precipitates with the addition of 2 mM MPA and 1 mM HC. MCAD association with GST-IRAP(55–82) was markedly inhibited by the addition of HC (Fig. 6B). In contrast, SCAD association did not appear to be influenced by these reagents (Fig. 6C), suggesting the effect of these reagents to be specific to LCAD and/or MCAD. Mercaptoacetic acid or ß-hydroxybutyryl-CoA did not affect association of these ACDs with GST-IRAP(55–82) (data not shown). In these experiments, the amount of GST-IRAP(55–82) in the precipitates was nearly the same regardless of treatment with MPA or HC as visualized by Coomasie blue staining (Fig. 6D). Thus, these reagents appeared to block the associations of LCAD and MCAD with IRAP. These findings suggest that blockage of the association between ACDs and IRAP by MPA and HC treatment increased glucose transport activity as well as plasma membrane GLUT4 content in permeabilized 3T3-L1 adipocytes.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
What is the mechanism by which MPA and HC induce the dissociation of LCAD and/or MCAD from IRAP? It is unlikely that the enzyme activity itself is involved in the in vitro results of ACDs’ associations with GST-IRAP(55–82), because metabolism of acyl-CoA could not participate in the in vitro association. It is possible that ACDs are associated with IRAP near the catalytic sites of ACDs and that MPA and HC, LCAD and MCAD inhibitors, respectively, affect these catalytic sites, resulting in blockade of the associations of ACDs with IRAP. A similar mechanism was previously reported for the association of L-3-hydroxyacyl-CoA dehydrogenase with the C-terminal region of GLUT4, which also includes a dileucine motif. The association was suggested to occur at the catalytic site of the enzyme (36). Alternatively, these reagents may induce conformational changes in ACDs, leading to dissociation of the ACDs from IRAP. GLUT4 translocation induced by these reagents is likely to be attributable to dissociation of ACDs from IRAP. Taken together with the recent report that microinjection of IRAP(55–82) into 3T3-L1 adipocytes resulted in rapid and sustained translocation of GLUT4 (26), the present findings suggest ACDs to be involved in anchoring GLUT4-containing vesicles to an intracellular compartment via association with IRAP.
The extent to which GLUT4 translocation and glucose transport acceleration were induced by MPA or HC was smaller than that occurring with insulin stimulation (Fig. 5). These reagents blocked association of LCAD and/or MCAD with IRAP, but had almost no effect on the SCAD association (Fig. 6), which may explain the smaller effect on GLUT4 translocation and the increment in glucose transport. Insulin reportedly induces inhibition of GLUT4 internalization as well as acceleration of its exocytosis (37, 38, 39). In addition, insulin has been reported to regulate the binding interaction of Munc 18c (40) and Synip (41) with syntaxin 4 as well as a distribution of Rab4 (42). These findings suggest that insulin also modulates the docking and fusion process for GLUT4-containing vesicles. It is therefore possible that GLUT4-containing vesicles are released in response to treatment with MPA or HC but are translocated to the plasma membrane less efficiently, as compared with insulin treatment.
ACDs have been described as enzymes that unite to form a functional complex and participate in ß-oxidation of fatty acids in mitochondria, where they are predominantly localized. We cannot completely rule out the possibility that the interaction of ACDs with GLUT4-containing vesicles occurred after cell homogenization. ACDs may have leaked from mitochondria and then interacted with GLUT4 vesicles in vitro. However, the amino acid sequences of LCAD and MCAD that we obtained from the GST-IRAP(55–82) precipitates included several residues of their leader sequences, which would be proteolytically cleaved in mitochondria, suggesting that LCAD and MCAD associated with IRAP are newly synthesized molecules that have not passed into mitochondria. Furthermore, immunoblotting of the pull-down precipitates with anti-LCAD and anti-MCAD antibodies showed two apparent bands, which might indicate an immature cytosolic protein and a mature mitochondrial protein (Fig. 2, A and B), although the two bands were observed in some, but not all, experiments. When these observations are taken together, it is possible that a small amount of immature ACD is present in the cytosol and that a portion of these proteins are associated with GLUT4-containing vesicles via IRAP. It is difficult to accurately estimate how much of the total ACDs associates with GLUT4-containing vesicles. Based on the results of the sucrose gradient fractionation experiments, a few percent of total ACD proteins were estimated to be recovered in the fractions where GLUT4 was present. The amount of ACD proteins in the immunopurified GLUT4-containing vesicles was less than that estimated from the sucrose gradient fractionation experiments. However, these results might be due to less efficient immunopurification. It was recently reported that L-3-hydroxyacyl-CoA dehydrogenase, which is also generally believed to be a mitochondria-specific enzyme, interacts with the C-terminal region of GLUT4 (36), suggesting that ACDs function other than as enzymes responsible for ß-oxidation in mitochondria. In the present study, LCAD, MCAD, and SCAD had similar distribution profiles in the LDM fraction (Fig. 3, B–D), indicating their localization outside of mitochondria and possible complex formation involving these three isoforms. Furthermore, long chain acyl-CoA synthetase-1 is reportedly localized on GLUT4-containing vesicles (43). Thus, fatty acid metabolism including ß-oxidation may occur on GLUT4-containing vesicles. Elevated plasma fatty acid levels, which increase intracellular fat oxidation, effectively compete with glucose for substrate oxidation and lead to inhibition of insulin-stimulated glucose uptake and utilization (44, 45). Thus, increased fatty acid metabolism on GLUT4-containing vesicles may affect the mechanism whereby ACDs anchor GLUT4-containing vesicles to specific intracellular compartments. In addition, the PPAR-activated receptor -null mouse, in which expression of ß-oxidative enzymes including LCAD is very low (46), reportedly displays severe hypoglycemia (47, 48). Although hypoglycemia is thought to be due to dramatic inhibition of fatty acid uptake and oxidation, impaired retention of GLUT4-containing vesicles in an intracellular compartment might be involved.
Accumulating evidence suggests a role of acyl-CoA in promoting budding and fusion of transport vesicles. Acyl-CoA was highlighted as a cofactor for the Golgi-associated protein, N-ethylmaleimide-sensitive factor, a factor required for transport between cisternae of the Golgi stack (49, 50). Electron microscopic and biochemical studies have also indicated that acyl-CoA is required for budding of coated transport vesicles from Golgi cisternae and that budding is inhibited by a nonhydrolyzable analog of palmitoyl-CoA (51). In the present study, the enzymes involved in acyl-CoA metabolism were shown to be associated with vesicles in a dileucine motif-dependent manner, suggesting a novel role for the dileucine motif in vesicle transport.
A number of proteins that are sorted from the endosomal pathway to other membrane compartments contain dileucine-sorting motifs. The dileucine motif was implicated in the internalization of the T cell antigen receptor - and 
-chains (52) and the invariant chain (53), as well as lysosomal sorting of the cation-independent mannose-6-phosphate receptors in the Golgi complex (54). GLUT4 also contains the dileucine motif in its C-terminal cytoplasmic domain. The dileucine motif in the C-terminal region of GLUT4 is reportedly involved in GLUT4 targeting in 3T3-L1 adipocytes (55) but is not critical for targeting to the insulin-responsive compartment in adipocytes (56). It is also reported that the dileucine motif of IRAP is responsible for its intracellular sequestration and the insulin responsiveness when expressed in CHO cells (27) as well as in 3T3-L1 adipocytes (28). In contrast, when GLUT4 is expressed in CHO cells, it is concentrated intracellularly in the absence of insulin, but insulin does not cause massive transport to the cell surface (57, 58). These findings suggest that CHO cells possess a specialized, slow recycling machinery that is regulated by insulin and that the cytoplasmic domain of IRAP, but not of exogenous GLUT4, has an important function via its dileucine motif in this mechanism. Thus, the cytoplasmic region of IRAP may bind to cellular machinery, which would explain the insulin responsiveness of IRAP. Consistent with this, we found, in the present study, that ACDs bind to the cytoplasmic region of IRAP but not to the C-terminal, cytoplasmic region of GLUT4 (lane 4 of Fig. 2).
In summary, the present study suggests that ACDs are localized on GLUT4-containing vesicles via association with IRAP in a manner dependent on its dileucine motif and play a role in retention of GLUT4-containing vesicles to a specialized intracellular compartment.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
cDNA Constructs
The rat cDNA region corresponding to amino acid residues 55–82 of IRAP cDNA was amplified using rat IRAP cDNA (a generous gift from Dr. P. F. Pilch) as a substrate and oligonucleotides GAATTCGTGAGAGGTCTTGGTGAGCA and CTCGAGTCACATGAAGGACATGCCCAG as sense and antisense primers, respectively. The amplified fragments were digested with restriction enzymes, EcoRI and XhoI, and subcloned into a pGEX-5T vector. For the LL construct, PCR was performed using the oligonucleotide CTCGAGTCACATGAAGGACATGCCCCGCGCCTTGGCAGATGA as an antisense primer to substitute alanine and serine for leucine residues (amino acid residues 76–77). The cDNA regions corresponding to the cytoplasmic C-terminal regions of rabbit GLUT1 (amino acid residues 451–492) and rat GLUT4 (amino acid residues 467–509) were also amplified using rabbit GLUT1 (59) and rat GLUT4 (60) cDNAs as the respective substrates and subcloned into a pGEX-5T vector. The resultant GST fusion proteins were purified by glutathione affinity chromatography as described by the manufacturer (Amersham Pharmacia Biotech, Arlington Heights, IL).
GST Fusion Protein Pull-Down Experiments
Fully differentiated 3T3-L1 adipocytes were lysed in 50 mM HEPES (pH 7.4), 140 mM KCl, 1 mM MgCl2, 1 mM EGTA, and 1 mM phenylmethylsulfonylfluoride (KHMgE buffer) containing 1% Nonidet P-40. Insoluble material was separated by microcentrifugation, and extracts were precleared by incubation with glutathione-Sepharose beads for 1 h at 4 C, followed by a second 1-h incubation with the GST-IRAP(55–82) protein. In some experiments, 2 mM MPA (Sigma, St. Louis, MO) or 1 mM hexanoyl-CoA (Sigma) in 50 mM HEPES, pH 7.4, was added to the incubation buffer. In labeling experiments, a confluent 10-cm dish of 3T3-L1 adipocytes was incubated with 10 mCi/ml Tran35S label (ICN Biochemicals, Inc., Cleveland, OH) for 3 h before isolation of the cell extracts. The beads were then washed three times with KHMgE buffer, bound proteins were eluted using Laemmli sample buffer, and the samples were then subjected to SDS-PAGE and either autoradiography or immunoblotting. For large-scale preparation of the GST-IRAP(55–82) binding proteins, 50 confluent 10 cm-dishes of 3T3-L1 adipocytes or rat muscle tissue and epididymal fat pads from 10 rats were isolated. Cell extracts were precleared by incubation with GST protein overnight at 4 C, followed by a second 4-h incubation with the GST-IRAP(55–82) protein. Eluants were transferred onto polyvinylidene difluoride membranes, and N-terminal sequences were determined using an automated protein sequencer at Apro Science (Tokushima, Japan).
Subcellular Fractionation of 3T3-L1 Adipocytes
3T3-L1 adipocytes were serum starved overnight in DMEM with 0.1% BSA. Cells were washed with PBS, harvested in HES buffer containing 10 mM HEPES, pH 7.4; 1 mM EDTA; and 5% sucrose supplemented with 1 mM phenylmethylsulfonyl fluoride; and homogenized using eight strokes of a Dounce homogenizer. After removal of the fat layer, the supernatant from a 30-min 48,000 x g centrifugation was again centrifuged at 210,000 x g for 90 min to obtain an LDM pellet. For further fractionation of LDM, sucrose velocity gradient centrifugations were carried out essentially as described previously (61). Briefly, the LDM pellet was resuspended in buffer containing 10 mM HEPES, pH 7.4; 1 mM EDTA; and 5% sucrose. The resuspended LDM was layered on top of a 10–30% continuous sucrose gradient and centrifuged at 4 C for 55 min at 150,000 x g. Fractions were collected from the bottom of each gradient and subjected to 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were incubated with the primary antibody followed by visualization using antirabbit IgG, coupled to horseradish peroxidase, and an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech). Immunoblotting was performed using rabbit polyclonal antibodies against GLUT4 (11), and three isoforms of the ACD family (LCAD, MCAD, and SCAD) (29). The immunoblotted membrane was stripped and reblotted repeatedly as recommended by the manufacturer. For immunoblotting with transferrin receptor and14-3-3 proteins, fractions were subjected to 7.5% and 12% SDS-PAGE, followed by immunoblotting with antihuman transferring receptor antibody (Zymed Laboratories, Inc., South San Francisco, CA) and antibody against 14-3-3 proteins (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
Immunopurification of Vesicles
Protein A-purified 1F8 antibody (Biogenesis, Poole, UK), as well as nonspecific mouse IgG (Sigma), were each coupled to acrylic beads (Reacti-gel GF 2000, Pierce Chemical Co., Rockford, IL) at concentrations of 0.4 and 0.6 mg of antibody/milliliter of resin, respectively, according to the manufacturer’s instructions. Before use, the beads were saturated with 2% BSA in PBS for at least 1 h and washed with PBS. The light microsomes from 3T3-L1 adipocytes were incubated separately with each of the specific and nonspecific antibody-coupled beads overnight at 4 C. The beads were washed extensively with PBS and solubilized in SDS-PAGE sample buffer. After separation by SDS-PAGE, samples were analyzed by immunoblotting with antibodies against GLUT4 (11), three isoforms of ACD family (29), transferrin receptor (Zymed Laboratories, Inc.), or calnexin (Transduction Laboratories, Inc., Lexington, KY).
Immunoprecipitation of LDM Fraction with Anti-IRAP Antibody
The light microsomes from serum-starved 3T3-L1 adipocytes were solubilized with KHMgE buffer containing 1% Nonidet P-40 and incubated, overnight at 4 C, separately with rabbit control IgG (Sigma) or anti-IRAP antibody, which was raised against cytoplasmic region (amino acid residues 1–108) of IRAP, followed by addition of protein A-Sepharose beads 4Fast Flow (Pharmacia Biotech, Piscataway, NJ). The beads were washed extensively with PBS and solubilized in SDS-PAGE sample buffer. After separation by SDS-PAGE, samples were analyzed by immunoblotting with three isoforms of the ACD family (29).
Permeabilization of Adipocytes and Glucose Transport
The 3T3-L1 adipocytes were permeabilized with -toxin (Calbiochem, La Jolla, CA) as described previously (35). Briefly, adipocytes were washed three times with IC buffer (20 mM HEPES (pH 7.2), 140 mM potassium glutamate, 5 mM EGTA, 7.5 mM MgCl2, 5 mM NaCl, 2 mM CaCl2) and then incubated for 5 min at 37 C in ICR buffer (IC buffer plus 10 mM MgATP and 3 mM sodium pyruvate) containing -toxin at 8 µg/ml to permeabilize the plasma membrane. The medium containing -toxin was removed, and then cells were treated at 37 C with 2 mM MPA or 1 mM hexanoyl-CoA in ICR buffer, or put in ICR buffer alone. After this treatment for 5 min, the cells were treated with or without 100 nM insulin for 10 min. Glucose transport into the permeabilized cells was measured by uptake of 2-deoxyglucose as previously described (35). A small volume (50 µl) of radiolabeled 2-deoxy-D-glucose and sucrose was added to the 0.45 ml on the plate, such that the final concentration was 50 µM 2-deoxy-D-glucose (0.3 µCi of 2-deoxy-D-[2.6-3H]glucose) and 50 µM sucrose (0.06 µCi of [U-14C]sucrose), and the mixture was incubated for 4 min at 37 C. The cells were rapidly washed twice with ice-cold IC buffer and solubilized in 0.3 ml of 1% Triton X-100, and the amounts of 3H and 14C in each sample were then measured. The amount of sucrose remaining with the cells provided a measure of nonspecific trapping of and uptake from the medium, and the raw values for 2-deoxyglucose uptake were corrected by subtraction of the corresponding amount of this compound.
Preparation of Plasma Membrane Sheets
3T3-L1 fibroblasts plated on sterile glass coverslips were induced to differentiate into adipocytes. Plasma membrane sheets were prepared by sonication as previously described (62). Adherent plasma membranes were fixed in 2% paraformaldehyde and processed for indirect immunofluorescence using rabbit anti-GLUT4 antiserum (1:100 dilution) followed by rhodamine-conjugated secondary antibody (11).
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Abbreviations: ACD, Acyl-CoA dehydrogenase; CHO, Chinese hamster ovary; CoA, coenzyme A; GST, glutathione-S-transferase; HC, hexanoyl-CoA; IRAP, insulin-regulated aminopeptidase; LCAD, long-chain acyl-CoA dehydrogenase; LDM, low-density microsomal; MCAD, medium-chain acyl-CoA dehydrogenase; MPA, 3-mercaptopropionic acid; SCAD, short-chain acyl-CoA dehydrogenase.
Received for publication August 7, 2001. Accepted for publication January 11, 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
of phosphatidylinositol 3-kinase increases glucose transport activity with translocation of glucose transporters in 3T3-L1 adipocytes. J Biol Chem 271:16987–16990, ß, and 
) by insulin in 3T3/L1 cells. Transfection studies suggest a role for PKC- in glucose transport. J Biol Chem 272:2551–2558
for insulin stimulation of glucose uptake but not for Akt activation in 3T3-L1 adipocytes. Mol Cell Biol 18:6971–6982 (PPAR). J Biol Chem 273:5678–5684 mediates the adaptive response to fasting. J Clin Invest 103:1489–1498[Medline]
(PPAR) in the cellular fasting response: the PPAR-null mouse as a model of fatty acid oxidation disorders. Proc Natl Acad Sci USA 96:7473–7478S and localization of GLUT4 to clathrin lattices. J Cell Biol 117:1181–1196This article has been cited by other articles:
 |
|
 |
|
  G. R. Peck, S. Ye, V. Pham, R. N. Fernando, S. L. Macaulay, S. Y. Chai, and A. L. Albiston Interaction of the Akt Substrate, AS160, with the Glucose Transporter 4 Vesicle Marker Protein, Insulin-Regulated Aminopeptidase Mol. Endocrinol., October 1, 2006; 20(10): 2576 - 2583. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
