Molecular Endocrinology 16 (5): 1049-1059
Copyright © 2002 by The Endocrine Society
Acyl-Coenzyme A Dehydrogenases Are Localized on GLUT4-Containing Vesicles via Association with Insulin-Regulated Aminopeptidase in a Manner Dependent on Its Dileucine Motif
Hideki Katagiri,
Tomoichiro Asano,
Tetsuya Yamada,
Toshifumi Aoyama,
Yasushi Fukushima,
Masatoshi Kikuchi,
Tatsuhiko Kodama and
Yoshitomo Oka
Division of Molecular Metabolism and Diabetes (H.K., T.Y., Y.O.), Department of Internal Medicine, Tohoku University Graduate School of Medicine, Sendai 980-8574, Japan; Third Department of Internal Medicine (T.A., Y.F.), Faculty of Medicine, University of Tokyo, Tokyo 113-8655 Japan; Department of Aging Biochemistry (T.A.), Shinshu University School of Medicine, Matsumoto, Nagano 390-8621, Japan; Institute for Adult Disease (M.K.), Asahi Life Foundation, Tokyo 160, Japan; and Department of Molecular Biology and Medicine (T.K.), Research Center for Advanced Science and Technology, University of Tokyo, Tokyo 153, Japan
Address all correspondence and requests for reprints to: Hideki Katagiri, M.D., Division of Molecular Metabolism and Diabetes, Department of Internal Medicine, Tohoku University Graduate School of Medicine, Seiryo-machi, Sendai 980-8574, Japan. E-mail: katagiri-tky{at}umin.ac.jp.
 |
ABSTRACT
|
|---|
Insulin-regulated aminopeptidase (IRAP, also termed vp165) is known to be localized on the GLUT4-containing vesicles and to be recruited to the plasma membrane after stimulation with insulin. The cytoplasmic region of IRAP contains two dileucine motifs and acidic regions, one of which (amino acid residues 5582) is reportedly involved in retention of GLUT4-containing vesicles. The region of IRAP fused with glutathione-S-transferase [GST-IRAP(5582)] was incubated with lysates from 3T3-L1 adipocytes, leading to identification of long-chain, medium-chain, and short-chain acyl-coenzyme A dehydrogenases (ACDs) as the proteins associated with IRAP. The association was nearly abolished by mutation of the dileucine motif of IRAP. Immunoblotting of fractions prepared from sucrose gradient ultracentrifugation and vesicles immunopurified with anti-GLUT4 antibody revealed these ACDs to be localized on GLUT4-containing vesicles. Furthermore, 3-mercaptopropionic acid and hexanoyl-CoA, inhibitors of long-chain and medium-chain ACDs, respectively, induced dissociation of long-chain acyl-coenzyme A dehydrogenase and/or medium-chain acyl-coenzyme A dehydrogenase from IRAP in vitro as well as recruitment of GLUT4 to the plasma membrane and stimulation of glucose transport activity in permeabilized 3T3-L1 adipocytes. These findings suggest that ACDs are localized on GLUT4-containing vesicles via association with IRAP in a manner dependent on its dileucine motif and play a role in retention of GLUT4-containing vesicles to an intracellular compartment.
 |
INTRODUCTION
|
|---|
REGULATION OF GLUCOSE homeostasis is one of the most important actions of insulin. Insulin stimulates the translocation of GLUT4 glucose transporters from intracellular storage sites to the plasma membrane in muscle and adipose tissue, resulting in increased glucose uptake and thereby contributing to plasma euglycemia. Many intensive studies have focused on the cellular and molecular mechanisms responsible for trafficking events (1, 2).
Binding of insulin to its receptor results in receptor autophosphorylation and activation of the receptor tyrosine kinase, followed by tyrosine phosphorylation of several intermediate proteins including insulin receptor substrate 1 (3, 4). Tyrosine-phosphorylated insulin receptor substrates then bind to and thereby regulate SH2 domain-containing proteins. PI3K is one of such signaling molecules (5, 6). The PI3K pharmacological inhibitors (7, 8), or expressions of dominant negative mutants of PI3K (9, 10), reportedly exert marked blocking effects on insulin-stimulated glucose transport and GLUT4 translocation in rat and 3T3-L1 adipocytes. Furthermore, overexpression of the wild-type (11) or constitutively active mutant (12, 13) of PI3K promoted glucose transport activity and GLUT4 translocation. These findings suggest that PI3K plays a central role in insulin-stimulated glucose transport and GLUT4 translocation, although the contribution of a PI3K-independent pathway involving GLUT4 translocation has also been reported recently (14).
Recently, several pathways have been reported to be activated by stimulation with insulin and other growth factors downstream from PI3K. Among them, activations of serine/threonine kinases, protein kinase B (cellular homolog of v-AKT, also termed RAC-PK) (15) or atypical PKC (16) are reportedly involved in insulin-stimulated glucose transport, although these claims are controversial (17, 18). However, the kinase cascade, consisting of receptor tyrosine kinase, lipid kinase, and serine/threonine kinases, is not unique to insulin signaling, being common to other signaling pathways of other growth factors and adhesion molecules as well (19, 20, 21). Why only insulin can recruit GLUT4 to the plasma membrane, resulting in acceleration of glucose transport, is an important research question. We attempted to identify signaling components proximal to GLUT4-containing vesicles.
Studies of immunoadsorbed GLUT4 vesicles have identified a number of other proteins in these vesicles. One of these is insulin-regulated aminopeptidase (IRAP, also called gp160 or vp165), a zinc-dependent aminopeptidase (4, 22, 23), which is oriented in the vesicle membrane with its 109-amino acid amino-terminal end projecting into the cytoplasm and has a single transmembrane domain and a large catalytic domain within the lumen of the vesicle. The distribution of IRAP within adipocytes is very similar to that of GLUT4. In the basal state, the majority of IRAP is sequestered in an intracellular compartment, and after stimulation with insulin both GLUT4 and IRAP are translocated to the cell surface (24, 25). The amino terminus of IRAP contains two dileucine motifs and several acidic regions, which are thought to play important roles in vesicular trafficking. It was reported recently that introduction of the cytoplasmic domain of IRAP into 3T3-L1 adipocytes by microinjection resulted in rapid and sustained translocation of GLUT4 from an intracellular compartment to the cell surface in a PI3K-independent manner, suggesting that it acts downstream from this signaling element (26). By deletion analysis, a 28-amino acid region (amino acid residues 5582) of IRAP, which contains one of these dileucine motifs (amino acid residues 7677) and acidic regions, was found to be sufficient to cause GLUT4 translocation (26). Furthermore, a chimeric protein of the cytoplasmic domain of IRAP with the transferrin receptor was reportedly targeted to the insulin-regulated, slow recycling pathway, and its dynamic retention was dependent on this dileucine motif in Chinese hamster ovary (CHO) cells (27) and 3T3-L1 adipocytes (28). These findings suggest that an intracellular molecule(s) recognizes and binds the trafficking motif within IRAP, resulting in sequestration of GLUT4-containing vesicles within a specialized intracellular compartment. To address these issues, we have used glutathione-S-transferase (GST) fusion proteins to identify and characterize IRAP(5582)-specific binding proteins. Herein, we demonstrate acyl-coenzyme A (CoA) dehydrogenases (ACDs) to associate with IRAP(5582) in a manner dependent upon its dileucine motif.
 |
RESULTS
|
|---|
ACDs Are Identified as IRAP-Associated Proteins
To identify proteins that interact with the 28-amino acid region of the cytoplasmic domain of IRAP [IRAP(5582)], which is reportedly responsible for inducing GLUT4 translocation (26), we expressed IRAP(5582) as GST fusions [GST-IRAP(5582)]. Incubation of GST or GST-IRAP(5582) with extracts from [35S]methionine-labeled 3T3-L1 adipocytes resulted in the binding of multiple proteins including two protein bands, one of approximately 46 kDa and the other 42 kDa (Fig. 1A
). To obtain a large amount of these specific IRAP-associated proteins, 50 confluent 10-cm dishes of 3T3-L1 adipocytes were isolated. Coomasie blue staining of the precipitates revealed the 57-, 46-, and 42-kDa proteins to be precipitated specifically with GST-IRAP(5582) but not with GST (Fig. 1B
). Although other intense bands were detected on the Coomasie blue-stained gel, these were also seen in the absence of lysate and therefore were presumed to be derived from Escherichia coli. Eluants were transferred onto polyvinylidene difluoride membranes and amino-terminal sequences were determined using an automated protein sequencer. Two different amino acid sequences were obtained from the 46-kDa band, SHSGPEAGLE and HSKAAHKQEP, which were identified as long chain acyl-CoA dehydrogenase (LCAD) and medium-chain acyl-CoA dehydrogenase (MCAD), respectively. The 42-kDa band had an amino acid sequence, LHTVYQSVEL, which was identified as a short chain acyl-CoA dehydrogenase (SCAD). In addition, cell extracts were also prepared from primary isolated rat muscle and adipocytes and incubated with the GST fusion proteins (Fig. 1C
). Similar to the results obtained for 3T3-L1 adipocytes, several bands, including those at 46 and 42 kDa, were precipitated with GST-IRAP(5582), suggesting that LCAD, MCAD, and SCAD are also present in rat muscle and fat tissues as proteins bound to GST-IRAP(5582).

View larger version (31K):
[in this window]
[in a new window]
|
Figure 1. Identification of Proteins That Interact with the 28-Amino Acid Region of the Cytoplasmic Domain of IRAP [IRAP(5582)]
A, lysates from [35S]methionine-labeled 3T3-L1 adipocytes were prepared as described in Materials and Methods and incubated with GST or GST-IRAP(5582). Precipitated samples were resolved by SDS-PAGE and subjected to autoradiography. B, GST or GST-IRAP(5582) was incubated with or without lysates prepared from fully differentiated 3T3-L1 adipocytes. After precipitation, samples were resolved by SDS-PAGE and visualized by Coomasie blue staining. C, GST-IRAP(5582) was incubated with extracts from 3T3-L1 adipocytes (L1), rat muscle tissue (M), or rat adipose tissue (F). After precipitation, samples were resolved by SDS-PAGE and visualized by Coomasie blue staining.
|
|
To confirm that the 42- to 46-kDa proteins bound to GST-IRAP(5582) were indeed LCAD, MCAD, and SCAD, specific antibodies against these ACDs (29) were employed. Incubation of cell extracts with GST-IRAP(5582) resulted in precipitation of proteins showing specific immunoreactivities with anti-LCAD, anti-MCAD, and anti-SCAD antibodies (lane 2 of Fig. 2
, AC, respectively). In contrast, no proteins immunoreacting with antibodies against these ACDs were detected in the GST precipitates (lane 1 of Fig. 2
, AC), in precipitates with the cytoplasmic C-terminal region of GLUT1 fused with GST (lane 3 of Fig. 2
, AC), or in the cytoplasmic C-terminal region of GLUT4 fused with GST (lane 4 of Fig. 2
, AC). Coomasie blue staining revealed the amount of GST protein for IRAP(5582) to be equal to or slightly less than those of the other constructs (Fig. 2D
). These results indicate specific association of ACDs with the region including the dileucine motif of IRAP.

View larger version (41K):
[in this window]
[in a new window]
|
Figure 2. LCAD, MCAD, and SCAD Are Associated with the Region of IRAP(5582) in a Manner Dependent on Its Dileucine Motif
3T3-L1 adipocyte extracts were precipitated with GST (lane 1), GST-IRAP(5582) (lane 2), the C-terminal cytoplasmic region of GLUT1 fused with GST (lane 3), the C-terminal cytoplasmic region of GLUT4 fused with GST (lane 4), or GST-IRAP(5582) LL (lane 5) and subjected to immunoblotting with anti-LCAD (A), anti-MCAD (B), or anti-SCAD (C) antibody. Samples were also resolved by SDS-PAGE and visualized by Coomasie blue staining to show the amounts of GST fusion proteins recovered (D).
|
|
ACDs Are Associated with IRAP(5582) in a Manner Dependent on Its Dileucine Motif
To investigate whether the association of ACDs with IRAP is dependent on the dileucine motif of IRAP, an additional fusion construct of IRAP was generated containing a substitution of the dileucine motif, leucines 76 and 77, with alanine and serine [GST-IRAP(5582)
LL]. In this experiment, the amounts of GST-IRAP(5582) and GST-IRAP(5582)
LL were nearly the same, as demonstrated by Coomasie blue staining (Fig. 2D
). Immunoblotting using anti-LCAD, MCAD, and SCAD antibodies revealed immunoreactive proteins to be virtually undetectable in the precipitates with GST-IRAP(5582)
LL (lane 5 of Fig. 2
, AC). Thus, LCAD, MCAD, and SCAD are associated with IRAP in a dileucine motif (leucines 76 and 77)-dependent manner.
ACDs and GLUT4 Had Overlapping Distribution Profiles on Velocity Gradient Ultracentrifugation of Low-Density Microsomal (LDM) Fractions from 3T3-L1 Adipocytes
To investigate whether LCAD, MCAD, and SCAD are localized on GLUT4-containing vesicles, the LDM fraction from serum-starved 3T3-L1 adipocytes was separated on a continuous 1030% sucrose velocity gradient as described in Materials and Methods. It is noteworthy that mitochondria were excluded from the LDM fraction using this fractionation method. Fractions were taken from the bottom to the top and subjected to 10% SDS-PAGE. Proteins were transferred to membranes and first immunoblotted with anti-GLUT4 antibody, followed by repeatedly stripping and reblotting the same membrane with anti-LCAD, anti-MCAD, and anti-SCAD antibodies. Immunoblotting with anti-GLUT4 antibody (top panel of Fig. 3
) revealed a distinct GLUT4 peak near the bottom. Three ACDs exhibited similar distribution profiles; two distinct peaks, one of which, near the bottom, considerably overlapped that of GLUT4 (the second to fourth panels of Fig. 3
). Fractions were also subjected to 7.5% and 12% SDS-PAGE, followed by immunoblotting with the antibody against transferrin receptor and 14-3-3 proteins as markers for endosomal and cytoplasmic proteins (30), respectively. The profiles for transferrin receptor and 14-3-3 proteins exhibited distinct peaks (two panels from the bottom of Fig. 3
), which were clearly different from those for ACDs and GLUT4. These results are consistent with colocalization of ACDs with GLUT4 on the same intracellular vesicles.

View larger version (68K):
[in this window]
[in a new window]
|
Figure 3. ACDs and GLUT4 Have Overlapping Distribution Profiles on Velocity Gradient Ultracentrifugation of LDM Fractions from 3T3-L1 Adipocytes
LDM fractions from serum-starved 3T3-L1 adipocytes were prepared and resuspended as described in Materials and Methods. The LDM fraction was layered on top of a 1030% continuous sucrose gradient and centrifuged at 4 C for 55 min at 150,000 x g. Fractions were collected from the bottom of the gradients and subjected to 10% SDS-PAGE, and immunoblotting with anti-GLUT4 antibody (top panel), followed by repeated stripping and reblotting of the same membrane with anti-LCAD, anti-MCAD, and anti-SCAD antibodies (second to fourth panels), as indicated. For immunoblotting with transferrin receptor and 14-3-3 proteins, fractions were subjected to 7.5% and 12% SDS-PAGE, followed by immunoblotting with antitransferrin receptor and anti-14-3-3 protein antibodies, respectively (two panels from the bottom). Results are representative of three independent experiments.
|
|
ACDs Are Present in Vesicles Immunopurified with Anti-GLUT4 Antibody
To further determine whether ACDs and GLUT4 reside in the same vesicle populations, immunopurified vesicles were prepared from the LDM fraction using anti-GLUT4 antibody (1F8)-conjugated beads (lane 2 of Fig. 4A
). Control mouse IgG-conjugated beads were employed as controls (lane 1 of Fig. 4A
). Immunoblotting of immunopurified vesicles with the rabbit anti-GLUT4 antibody confirmed that GLUT4-containing vesicles had been obtained by the immunopurification procedure. Immunoblotting with specific antibodies against each ACD demonstrated the presence of LCAD, MCAD, and SCAD in vesicles purified with anti-GLUT4 antibody, but not in those immunopurified with control IgG. The same sheet was immunoblotted with antibodies against calnexin and transferrin receptor, which are an endoplasmic reticulum protein (31) and an endosome marker, respectively. A very faint band was detected in vesicles immunopurified with control IgG or anti-GLUT4 antibody, but the amount of the protein in the vesicles immunopurified with control IgG was rather large compared with that of vesicles immunopurified with anti-GLUT4 antibody. These results were in clear contrast to those for ACDs, suggesting specific adsorption of ACDs in the vesicles immunopurified with anti-GLUT4 antibody. Taken together, our findings indicate that these ACD proteins are localized on GLUT4-containing vesicles in the LDM fraction of 3T3-L1 adipocytes via their association with IRAP.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 4. LCAD, MCAD, and SCAD Are Present in Immunopurified GLUT4-Containing Vesicles via Association with IRAP
A, immunopurified vesicles were prepared from the LDM fractions of serum-starved 3T3-L1 adipocytes using control mouse IgG-conjugated (lane 1) or anti-GLUT4 antibody (1F8)-conjugated (lane 2) beads as described in Materials and Methods. Immunopurified vesicles were solubilized in SDS-PAGE sample buffer, separated on 10% SDS-PAGE, and electrophoretically transferred to nitrocellulose for immunoblotting with rabbit anti-GLUT4, anti-LCAD, anti-MCAD, anti-SCAD, anticalnexin, or antitransferrin receptor antibody, as indicated. B, Immunoprecipitation of LDM fraction with anti-IRAP antibody. The light microsomes from serum-starved 3T3-L1 adipocytes were immunoprecipitated with control IgG (lane 1) and anti-IRAP antibody (lane 2). Samples were analyzed by immunoblotting with anti-LCAD, anti-MCAD, or anti-SCAD antibody. Results are representative of three independent experiments.
|
|
To further confirm the association of ACDs with IRAP in vivo, immunoprecipitates of LDM fraction with antibody against IRAP were immunoblotted with antibodies against ACDs. As shown in Fig. 4B
, LCAD, MCAD, and SCAD were coimmunoprecipitated with IRAP, suggesting that these ACD proteins are associated with IRAP in vivo.
Inhibitors of LCAD and MCAD Increased Glucose Transport Activity as Well as Plasma Membrane GLUT4 Content in Permeabilized 3T3-L1 Adipocytes
We next examined whether manipulations of ACDs affected the glucose transport activity as well as GLUT4 translocation. First, we examined the effects of ACD inhibitors, 3-mercaptopropionic acid (MPA) as an inhibitor of LCAD (32) and hexanoyl-CoA (HC) as an inhibitor of MCAD (34), on glucose transport activity in 3T3-L1 adipocytes. To allow these reagents to enter cells, the cells were first permeabilized with
-toxin. Permeabilized 3T3-L1 adipocytes were treated with or without MPA or HC and subsequently with or without insulin, followed by measurement of 2-deoxyglucose uptake. Previous studies showed that glucose transport activity can be measured in 3T3-L1 adipocytes permeabilized with streptolysin-O (34) or
-toxin (35), although, in permeabilized cells, basal glucose transport activity is elevated as a consequence of the manipulations involved in the permeabilization procedure. In the present study, both insulin and GTP-
S stimulated glucose transport approximately 2.5-fold (Fig. 5A
), which was consistent with the results of previous studies using permeabilized 3T3-L1 adipocytes (34, 35). Treatment with MPA or HC consistently caused a small (
1.7-fold) but statistically significant (P < 0.05) increase in glucose transport activity even in the absence of insulin (Fig. 5A
). In contrast, mercaptoacetic acid and ß-hydroxybutyryl-CoA did not affect the glucose transport activity (data not shown).
To examine the plasma membrane GLUT4 content, permeabilized 3T3-L1 adipocytes were treated with or without MPA or HC and subsequently with or without insulin, followed by sonication to prepare the plasma membrane sheet. Membrane sheets were then immunostained with anti-GLUT4 antibody. In the control permeabilized 3T3-L1 adipocytes, insulin markedly increased the plasma membrane GLUT4 content (Fig. 5B
). Treatment with MPA or HC also increased the plasma membrane GLUT4 content even in the absence of insulin, and the addition of insulin further increased the plasma membrane GLUT4 content (Fig. 5B
). These findings demonstrate that MPA and HC induce translocation of GLUT4-containing vesicles to the plasma membrane, thereby accelerating glucose transport activity.
MPA and HC Induced Their Dissociation from IRAP
To investigate the mechanism whereby MPA and HC induce translocation of GLUT4, we next examined whether these ACD inhibitors affected the association between ACDs and IRAP. Cell extracts from 3T3-L1 adipocytes were precipitated with GST-IRAP(5582) in the absence or presence of MPA (lane 2 of Fig. 6
) or HC (lane 3 of Fig. 6
). Immunoblotting using anti-LCAD antibody revealed the amounts of LCAD (Fig. 6A
) to be markedly decreased in the precipitates with the addition of 2 mM MPA and 1 mM HC. MCAD association with GST-IRAP(5582) was markedly inhibited by the addition of HC (Fig. 6B
). In contrast, SCAD association did not appear to be influenced by these reagents (Fig. 6C
), suggesting the effect of these reagents to be specific to LCAD and/or MCAD. Mercaptoacetic acid or ß-hydroxybutyryl-CoA did not affect association of these ACDs with GST-IRAP(5582) (data not shown). In these experiments, the amount of GST-IRAP(5582) in the precipitates was nearly the same regardless of treatment with MPA or HC as visualized by Coomasie blue staining (Fig. 6D
). Thus, these reagents appeared to block the associations of LCAD and MCAD with IRAP. These findings suggest that blockage of the association between ACDs and IRAP by MPA and HC treatment increased glucose transport activity as well as plasma membrane GLUT4 content in permeabilized 3T3-L1 adipocytes.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 6. Associations of LCAD and MCAD with IRAP(5582) Are Inhibited by the Inhibitors of These Enzymes
Cell extracts from 3T3-L1 adipocytes were incubated with GST-IRAP(5582) in the absence (lane 1) or presence of 2 mM MPA (lane 2) or 1 mM HC (lane 3). After precipitation, the samples were subjected to immunoblotting with anti-LCAD (A), anti-MCAD (B), or anti-SCAD (C) antibody as indicated. Samples were also resolved by SDS-PAGE and visualized by Coomasie blue staining to show the amounts of GST-IRAP(5582) proteins recovered (D). Results are representative of three independent experiments.
|
|
 |
DISCUSSION
|
|---|
Using GST fusion proteins, we identified ACDs from 3T3-L1 adipocyte lysates as the proteins associated with IRAP via the region containing the dileucine motif of IRAP. In accordance with this association with IRAP, ACDs were detected in immunopurified GLUT4-containing vesicles. The association was nearly abolished by mutation of the dileucine motif of IRAP, indicating that the association of ACDs with GLUT4-containing vesicles depends on the dileucine motif of IRAP. Addition of MPA and HC, which reportedly inhibit LCAD and MCAD activities, respectively, induced dissociation of LCAD and/or MCAD from IRAP in vitro. Furthermore, in permeabilized 3T3-L1 adipocytes, treatment with these reagents led to recruitment of GLUT4 to the plasma membrane as well as acceleration of glucose transport activity. These findings strongly suggest that ACDs play a crucial role in the subcellular distribution of GLUT4 in 3T3-L1 adipocytes. Proteins with molecular weights corresponding to those of ACDs were identified as IRAP-associated proteins in rat skeletal muscle as well, suggesting that ACDs also play a similar role in GLUT4 distribution in another insulin-sensitive tissue, muscle.
What is the mechanism by which MPA and HC induce the dissociation of LCAD and/or MCAD from IRAP? It is unlikely that the enzyme activity itself is involved in the in vitro results of ACDs associations with GST-IRAP(5582), because metabolism of acyl-CoA could not participate in the in vitro association. It is possible that ACDs are associated with IRAP near the catalytic sites of ACDs and that MPA and HC, LCAD and MCAD inhibitors, respectively, affect these catalytic sites, resulting in blockade of the associations of ACDs with IRAP. A similar mechanism was previously reported for the association of L-3-hydroxyacyl-CoA dehydrogenase with the C-terminal region of GLUT4, which also includes a dileucine motif. The association was suggested to occur at the catalytic site of the enzyme (36). Alternatively, these reagents may induce conformational changes in ACDs, leading to dissociation of the ACDs from IRAP. GLUT4 translocation induced by these reagents is likely to be attributable to dissociation of ACDs from IRAP. Taken together with the recent report that microinjection of IRAP(5582) into 3T3-L1 adipocytes resulted in rapid and sustained translocation of GLUT4 (26), the present findings suggest ACDs to be involved in anchoring GLUT4-containing vesicles to an intracellular compartment via association with IRAP.
The extent to which GLUT4 translocation and glucose transport acceleration were induced by MPA or HC was smaller than that occurring with insulin stimulation (Fig. 5
). These reagents blocked association of LCAD and/or MCAD with IRAP, but had almost no effect on the SCAD association (Fig. 6
), which may explain the smaller effect on GLUT4 translocation and the increment in glucose transport. Insulin reportedly induces inhibition of GLUT4 internalization as well as acceleration of its exocytosis (37, 38, 39). In addition, insulin has been reported to regulate the binding interaction of Munc 18c (40) and Synip (41) with syntaxin 4 as well as a distribution of Rab4 (42). These findings suggest that insulin also modulates the docking and fusion process for GLUT4-containing vesicles. It is therefore possible that GLUT4-containing vesicles are released in response to treatment with MPA or HC but are translocated to the plasma membrane less efficiently, as compared with insulin treatment.
ACDs have been described as enzymes that unite to form a functional complex and participate in ß-oxidation of fatty acids in mitochondria, where they are predominantly localized. We cannot completely rule out the possibility that the interaction of ACDs with GLUT4-containing vesicles occurred after cell homogenization. ACDs may have leaked from mitochondria and then interacted with GLUT4 vesicles in vitro. However, the amino acid sequences of LCAD and MCAD that we obtained from the GST-IRAP(5582) precipitates included several residues of their leader sequences, which would be proteolytically cleaved in mitochondria, suggesting that LCAD and MCAD associated with IRAP are newly synthesized molecules that have not passed into mitochondria. Furthermore, immunoblotting of the pull-down precipitates with anti-LCAD and anti-MCAD antibodies showed two apparent bands, which might indicate an immature cytosolic protein and a mature mitochondrial protein (Fig. 2
, A and B), although the two bands were observed in some, but not all, experiments. When these observations are taken together, it is possible that a small amount of immature ACD is present in the cytosol and that a portion of these proteins are associated with GLUT4-containing vesicles via IRAP. It is difficult to accurately estimate how much of the total ACDs associates with GLUT4-containing vesicles. Based on the results of the sucrose gradient fractionation experiments, a few percent of total ACD proteins were estimated to be recovered in the fractions where GLUT4 was present. The amount of ACD proteins in the immunopurified GLUT4-containing vesicles was less than that estimated from the sucrose gradient fractionation experiments. However, these results might be due to less efficient immunopurification. It was recently reported that L-3-hydroxyacyl-CoA dehydrogenase, which is also generally believed to be a mitochondria-specific enzyme, interacts with the C-terminal region of GLUT4 (36), suggesting that ACDs function other than as enzymes responsible for ß-oxidation in mitochondria. In the present study, LCAD, MCAD, and SCAD had similar distribution profiles in the LDM fraction (Fig. 3
, BD), indicating their localization outside of mitochondria and possible complex formation involving these three isoforms. Furthermore, long chain acyl-CoA synthetase-1 is reportedly localized on GLUT4-containing vesicles (43). Thus, fatty acid metabolism including ß-oxidation may occur on GLUT4-containing vesicles. Elevated plasma fatty acid levels, which increase intracellular fat oxidation, effectively compete with glucose for substrate oxidation and lead to inhibition of insulin-stimulated glucose uptake and utilization (44, 45). Thus, increased fatty acid metabolism on GLUT4-containing vesicles may affect the mechanism whereby ACDs anchor GLUT4-containing vesicles to specific intracellular compartments. In addition, the PPAR-activated receptor
-null mouse, in which expression of ß-oxidative enzymes including LCAD is very low (46), reportedly displays severe hypoglycemia (47, 48). Although hypoglycemia is thought to be due to dramatic inhibition of fatty acid uptake and oxidation, impaired retention of GLUT4-containing vesicles in an intracellular compartment might be involved.
Accumulating evidence suggests a role of acyl-CoA in promoting budding and fusion of transport vesicles. Acyl-CoA was highlighted as a cofactor for the Golgi-associated protein, N-ethylmaleimide-sensitive factor, a factor required for transport between cisternae of the Golgi stack (49, 50). Electron microscopic and biochemical studies have also indicated that acyl-CoA is required for budding of coated transport vesicles from Golgi cisternae and that budding is inhibited by a nonhydrolyzable analog of palmitoyl-CoA (51). In the present study, the enzymes involved in acyl-CoA metabolism were shown to be associated with vesicles in a dileucine motif-dependent manner, suggesting a novel role for the dileucine motif in vesicle transport.
A number of proteins that are sorted from the endosomal pathway to other membrane compartments contain dileucine-sorting motifs. The dileucine motif was implicated in the internalization of the T cell antigen receptor
- and
-chains (52) and the invariant chain (53), as well as lysosomal sorting of the cation-independent mannose-6-phosphate receptors in the Golgi complex (54). GLUT4 also contains the dileucine motif in its C-terminal cytoplasmic domain. The dileucine motif in the C-terminal region of GLUT4 is reportedly involved in GLUT4 targeting in 3T3-L1 adipocytes (55) but is not critical for targeting to the insulin-responsive compartment in adipocytes (56). It is also reported that the dileucine motif of IRAP is responsible for its intracellular sequestration and the insulin responsiveness when expressed in CHO cells (27) as well as in 3T3-L1 adipocytes (28). In contrast, when GLUT4 is expressed in CHO cells, it is concentrated intracellularly in the absence of insulin, but insulin does not cause massive transport to the cell surface (57, 58). These findings suggest that CHO cells possess a specialized, slow recycling machinery that is regulated by insulin and that the cytoplasmic domain of IRAP, but not of exogenous GLUT4, has an important function via its dileucine motif in this mechanism. Thus, the cytoplasmic region of IRAP may bind to cellular machinery, which would explain the insulin responsiveness of IRAP. Consistent with this, we found, in the present study, that ACDs bind to the cytoplasmic region of IRAP but not to the C-terminal, cytoplasmic region of GLUT4 (lane 4 of Fig. 2
).
In summary, the present study suggests that ACDs are localized on GLUT4-containing vesicles via association with IRAP in a manner dependent on its dileucine motif and play a role in retention of GLUT4-containing vesicles to a specialized intracellular compartment.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
3T3-L1 fibroblasts were maintained in DMEM containing 10% donor calf serum (Life Technologies, Inc., Gaithersburg, MD) in an atmosphere of 10% CO2 at 37 C. Two days after the fibroblasts had reached confluence, differentiation was induced by treating the cells with DMEM containing 0.5 mM 3-isobutyl-1-methyl-xanthine, 4 mg/ml dexamethasone, and 10% FBS for 48 h. Cells were refed with DMEM supplemented with 10% FBS every other day for the following 410 d. More than 90% of the cells expressed the adipocyte phenotype (11).
cDNA Constructs
The rat cDNA region corresponding to amino acid residues 5582 of IRAP cDNA was amplified using rat IRAP cDNA (a generous gift from Dr. P. F. Pilch) as a substrate and oligonucleotides GAATTCGTGAGAGGTCTTGGTGAGCA and CTCGAGTCACATGAAGGACATGCCCAG as sense and antisense primers, respectively. The amplified fragments were digested with restriction enzymes, EcoRI and XhoI, and subcloned into a pGEX-5T vector. For the
LL construct, PCR was performed using the oligonucleotide CTCGAGTCACATGAAGGACATGCCCCGCGCCTTGGCAGATGA as an antisense primer to substitute alanine and serine for leucine residues (amino acid residues 7677). The cDNA regions corresponding to the cytoplasmic C-terminal regions of rabbit GLUT1 (amino acid residues 451492) and rat GLUT4 (amino acid residues 467509) were also amplified using rabbit GLUT1 (59) and rat GLUT4 (60) cDNAs as the respective substrates and subcloned into a pGEX-5T vector. The resultant GST fusion proteins were purified by glutathione affinity chromatography as described by the manufacturer (Amersham Pharmacia Biotech, Arlington Heights, IL).
GST Fusion Protein Pull-Down Experiments
Fully differentiated 3T3-L1 adipocytes were lysed in 50 mM HEPES (pH 7.4), 140 mM KCl, 1 mM MgCl2, 1 mM EGTA, and 1 mM phenylmethylsulfonylfluoride (KHMgE buffer) containing 1% Nonidet P-40. Insoluble material was separated by microcentrifugation, and extracts were precleared by incubation with glutathione-Sepharose beads for 1 h at 4 C, followed by a second 1-h incubation with the GST-IRAP(5582) protein. In some experiments, 2 mM MPA (Sigma, St. Louis, MO) or 1 mM hexanoyl-CoA (Sigma) in 50 mM HEPES, pH 7.4, was added to the incubation buffer. In labeling experiments, a confluent 10-cm dish of 3T3-L1 adipocytes was incubated with 10 mCi/ml Tran35S label (ICN Biochemicals, Inc., Cleveland, OH) for 3 h before isolation of the cell extracts. The beads were then washed three times with KHMgE buffer, bound proteins were eluted using Laemmli sample buffer, and the samples were then subjected to SDS-PAGE and either autoradiography or immunoblotting. For large-scale preparation of the GST-IRAP(5582) binding proteins, 50 confluent 10 cm-dishes of 3T3-L1 adipocytes or rat muscle tissue and epididymal fat pads from 10 rats were isolated. Cell extracts were precleared by incubation with GST protein overnight at 4 C, followed by a second 4-h incubation with the GST-IRAP(5582) protein. Eluants were transferred onto polyvinylidene difluoride membranes, and N-terminal sequences were determined using an automated protein sequencer at Apro Science (Tokushima, Japan).
Subcellular Fractionation of 3T3-L1 Adipocytes
3T3-L1 adipocytes were serum starved overnight in DMEM with 0.1% BSA. Cells were washed with PBS, harvested in HES buffer containing 10 mM HEPES, pH 7.4; 1 mM EDTA; and 5% sucrose supplemented with 1 mM phenylmethylsulfonyl fluoride; and homogenized using eight strokes of a Dounce homogenizer. After removal of the fat layer, the supernatant from a 30-min 48,000 x g centrifugation was again centrifuged at 210,000 x g for 90 min to obtain an LDM pellet. For further fractionation of LDM, sucrose velocity gradient centrifugations were carried out essentially as described previously (61). Briefly, the LDM pellet was resuspended in buffer containing 10 mM HEPES, pH 7.4; 1 mM EDTA; and 5% sucrose. The resuspended LDM was layered on top of a 1030% continuous sucrose gradient and centrifuged at 4 C for 55 min at 150,000 x g. Fractions were collected from the bottom of each gradient and subjected to 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were incubated with the primary antibody followed by visualization using antirabbit IgG, coupled to horseradish peroxidase, and an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech). Immunoblotting was performed using rabbit polyclonal antibodies against GLUT4 (11), and three isoforms of the ACD family (LCAD, MCAD, and SCAD) (29). The immunoblotted membrane was stripped and reblotted repeatedly as recommended by the manufacturer. For immunoblotting with transferrin receptor and14-3-3 proteins, fractions were subjected to 7.5% and 12% SDS-PAGE, followed by immunoblotting with antihuman transferring receptor antibody (Zymed Laboratories, Inc., South San Francisco, CA) and antibody against 14-3-3 proteins (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
Immunopurification of Vesicles
Protein A-purified 1F8 antibody (Biogenesis, Poole, UK), as well as nonspecific mouse IgG (Sigma), were each coupled to acrylic beads (Reacti-gel GF 2000, Pierce Chemical Co., Rockford, IL) at concentrations of 0.4 and 0.6 mg of antibody/milliliter of resin, respectively, according to the manufacturers instructions. Before use, the beads were saturated with 2% BSA in PBS for at least 1 h and washed with PBS. The light microsomes from 3T3-L1 adipocytes were incubated separately with each of the specific and nonspecific antibody-coupled beads overnight at 4 C. The beads were washed extensively with PBS and solubilized in SDS-PAGE sample buffer. After separation by SDS-PAGE, samples were analyzed by immunoblotting with antibodies against GLUT4 (11), three isoforms of ACD family (29), transferrin receptor (Zymed Laboratories, Inc.), or calnexin (Transduction Laboratories, Inc., Lexington, KY).
Immunoprecipitation of LDM Fraction with Anti-IRAP Antibody
The light microsomes from serum-starved 3T3-L1 adipocytes were solubilized with KHMgE buffer containing 1% Nonidet P-40 and incubated, overnight at 4 C, separately with rabbit control IgG (Sigma) or anti-IRAP antibody, which was raised against cytoplasmic region (amino acid residues 1108) of IRAP, followed by addition of protein A-Sepharose beads 4Fast Flow (Pharmacia Biotech, Piscataway, NJ). The beads were washed extensively with PBS and solubilized in SDS-PAGE sample buffer. After separation by SDS-PAGE, samples were analyzed by immunoblotting with three isoforms of the ACD family (29).
Permeabilization of Adipocytes and Glucose Transport
The 3T3-L1 adipocytes were permeabilized with
-toxin (Calbiochem, La Jolla, CA) as described previously (35). Briefly, adipocytes were washed three times with IC buffer (20 mM HEPES (pH 7.2), 140 mM potassium glutamate, 5 mM EGTA, 7.5 mM MgCl2, 5 mM NaCl, 2 mM CaCl2) and then incubated for 5 min at 37 C in ICR buffer (IC buffer plus 10 mM MgATP and 3 mM sodium pyruvate) containing
-toxin at 8 µg/ml to permeabilize the plasma membrane. The medium containing
-toxin was removed, and then cells were treated at 37 C with 2 mM MPA or 1 mM hexanoyl-CoA in ICR buffer, or put in ICR buffer alone. After this treatment for 5 min, the cells were treated with or without 100 nM insulin for 10 min. Glucose transport into the permeabilized cells was measured by uptake of 2-deoxyglucose as previously described (35). A small volume (50 µl) of radiolabeled 2-deoxy-D-glucose and sucrose was added to the 0.45 ml on the plate, such that the final concentration was 50 µM 2-deoxy-D-glucose (0.3 µCi of 2-deoxy-D-[2.6-3H]glucose) and 50 µM sucrose (0.06 µCi of [U-14C]sucrose), and the mixture was incubated for 4 min at 37 C. The cells were rapidly washed twice with ice-cold IC buffer and solubilized in 0.3 ml of 1% Triton X-100, and the amounts of 3H and 14C in each sample were then measured. The amount of sucrose remaining with the cells provided a measure of nonspecific trapping of and uptake from the medium, and the raw values for 2-deoxyglucose uptake were corrected by subtraction of the corresponding amount of this compound.
Preparation of Plasma Membrane Sheets
3T3-L1 fibroblasts plated on sterile glass coverslips were induced to differentiate into adipocytes. Plasma membrane sheets were prepared by sonication as previously described (62). Adherent plasma membranes were fixed in 2% paraformaldehyde and processed for indirect immunofluorescence using rabbit anti-GLUT4 antiserum (1:100 dilution) followed by rhodamine-conjugated secondary antibody (11).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. P. F. Pilch for a generous gift of IRAP cDNA. We also thank Drs. N. Omori and F. Shibasaki for technical consultations.
 |
FOOTNOTES
|
|---|
This work was supported by Grant-in-Aid for Creative Research (10NP0201) and Grant-in-Aid for Scientific Research (B2, 11470234) to Y.O from the Ministry of Education, Science, Sports and Culture of Japan.
Abbreviations: ACD, Acyl-CoA dehydrogenase; CHO, Chinese hamster ovary; CoA, coenzyme A; GST, glutathione-S-transferase; HC, hexanoyl-CoA; IRAP, insulin-regulated aminopeptidase; LCAD, long-chain acyl-CoA dehydrogenase; LDM, low-density microsomal; MCAD, medium-chain acyl-CoA dehydrogenase; MPA, 3-mercaptopropionic acid; SCAD, short-chain acyl-CoA dehydrogenase.
Received for publication August 7, 2001.
Accepted for publication January 11, 2002.
 |
REFERENCES
|
|---|
-
Czech MP, Corvera S 1999 Signaling mechanisms that regulate glucose transport. J Biol Chem 274:18651868[Free Full Text]
-
Pessin JE, Thurmond DC, Elmendorf JS, Coker KJ, Okada S 1999 Molecular basis of insulin-stimulated GLUT4 vesicle trafficking. Location! Location! Location! J Biol Chem 274:25932596[Free Full Text]
-
White MF, Kahn CR 1994 The insulin signaling system. J Biol Chem 269:14[Free Full Text]
-
Keller SR, Scott HM, Mastick CC, Aebersold R, Lienhard GE 1995 Cloning and characterization of a novel insulin-regulated membrane aminopeptidase from Glut4 vesicles. J Biol Chem 270:2361223618[Abstract/Free Full Text]
-
Panayotou G, Waterfield MD 1993 The assembly of signalling complexes by receptor tyrosine kinases. Bioessays 15:171177[CrossRef][Medline]
-
Kapeller R, Cantley LC 1994 Phosphatidylinositol 3-kinase. Bioessays 16:565576[CrossRef][Medline]
-
Okada T, Kawano Y, Sakakibara T, Hazeki O, Ui M 1994 Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes. Studies with a selective inhibitor wortmannin. J Biol Chem 269:35683573[Abstract/Free Full Text]
-
Cheatham B, Vlahos CJ, Cheatham L, Wang L, Blenis J, Kahn CR 1994 Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol 14:49024911[Abstract/Free Full Text]
-
Katagiri H, Asano T, Inukai K, Ogihara T, Ishihara H, Shibasaki Y, Murata T, Terasaki J, Kikuchi M, Yazaki Y, Oka Y 1997 Roles of PI 3-kinase and Ras on insulin-stimulated glucose transport in 3T3-L1 adipocytes. Am J Physiol 272:E326E331
-
Kotani K, Carozzi AJ, Sakaue H, Hara K, Robinson LJ, Clark SF, Yonezawa K, James DE, Kasuga M 1995 Requirement for phosphoinositide 3-kinase in insulin-stimulated GLUT4 translocation in 3T3-L1 adipocytes. Biochem Biophys Res Commun 209:343348[CrossRef][Medline]
-
Katagiri H, Asano T, Ishihara H, Inukai H, Shibasaki Y, Kikuchi M, Yazaki Y, Oka Y 1996 Overexpression of catalytic subunit p110
of phosphatidylinositol 3-kinase increases glucose transport activity with translocation of glucose transporters in 3T3-L1 adipocytes. J Biol Chem 271:1698716990[Abstract/Free Full Text]
-
Tanti JF, Gremeaux T, Grillo S, Calleja V, Klippel A, Williams LT, Van Obberghen E, Le Marchand-Brustel Y 1996 Overexpression of a constitutively active form of phosphatidylinositol 3-kinase is sufficient to promote Glut 4 translocation in adipocytes. J Biol Chem 271:2522725232[Abstract/Free Full Text]
-
Frevert EU, Kahn BB 1997 Differential effects of constitutively active phosphatidylinositol 3-kinase on glucose transport, glycogen synthase activity, and DNA synthesis in 3T3-L1 adipocytes. Mol Cell Biol 17:190198[Abstract/Free Full Text]
-
Baumann CA, Ribon V, Kanzaki M, Thurmond DC, Mora S, Shigematsu S, Bickel PE, Pessin JE, Saltiel AR 2000 CAP defines a second signalling pathway required for insulin-stimulated glucose transport. Nature 407:202207[CrossRef][Medline]
-
Kohn AD, Summers SA, Birnbaum MJ, Roth RA 1996 Expression of a constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. J Biol Chem 271:3137231378[Abstract/Free Full Text]
-
Bandyopadhyay G, Standaert ML, Zhao L, Yu B, Avignon A, Galloway L, Karnam P, Moscat J, Farese RV 1997 Activation of protein kinase C (
, ß, and
) by insulin in 3T3/L1 cells. Transfection studies suggest a role for PKC-
in glucose transport. J Biol Chem 272:25512558[Abstract/Free Full Text]
-
Kotani K, Ogawa W, Matsumoto M, Kitamura T, Sakaue H, Hino Y, Miyake K, Sano W, Akimoto K, Ohno S, Kasuga M 1998 Requirement of atypical protein kinase C
for insulin stimulation of glucose uptake but not for Akt activation in 3T3-L1 adipocytes. Mol Cell Biol 18:69716982[Abstract/Free Full Text]
-
Wang Q, Somwar R, Bilan PJ, Liu Z, Jin J, Woodgett JR, Klip A 1999 Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts. Mol Cell Biol 19:40084018[Abstract/Free Full Text]
-
Isakoff SJ, Taha C, Rose E, Marcusohn J, Klip A, Skolnik EY 1995 The inability of phosphatidylinositol 3-kinase activation to stimulate GLUT4 translocation indicates additional signaling pathways are required for insulin-stimulated glucose uptake. Proc Natl Acad Sci USA 92:1024710251[Abstract/Free Full Text]
-
Wiese RJ, Mastick CC, Lazar DF, Saltiel AR 1995 Activation of mitogen-activated protein kinase and phosphatidylinositol 3'-kinase is not sufficient for the hormonal stimulation of glucose uptake, lipogenesis, or glycogen synthesis in 3T3-L1 adipocytes. J Biol Chem 270:34423446[Abstract/Free Full Text]
-
Guilherme A, Czech MP 1998 Stimulation of IRS-1-associated phosphatidylinositol 3-kinase and Akt/protein kinase B but not glucose transport by ß1-integrin signaling in rat adipocytes. J Biol Chem 273:3311933122[Abstract/Free Full Text]
-
Mastick CC, Aebersold R, Lienhard GE 1994 Characterization of a major protein in GLUT4 vesicles. Concentration in the vesicles and insulin-stimulated translocation to the plasma membrane. J Biol Chem 269:60896092[Abstract/Free Full Text]
-
Kandror KV, Yu L, Pilch PF 1994 The major protein of GLUT4-containing vesicles, gp160, has aminopeptidase activity. J Biol Chem 269:3077730780[Abstract/Free Full Text]
-
Kandror KV, Pilch PF 1994 gp160, a tissue-specific marker for insulin-activated glucose transport. Proc Natl Acad Sci USA 91:80178021[Abstract/Free Full Text]
-
Ross SA, Scott HM, Morris NJ, Leung WY, Mao F, Lienhard GE, Keller SR 1996 Characterization of the insulin-regulated membrane aminopeptidase in 3T3-L1 adipocytes. J Biol Chem 271:33283332[Abstract/Free Full Text]
-
Waters SB, DAuria M, Martin SS, Nguyen C, Kozma LM, Luskey KL 1997 The amino terminus of insulin-responsive aminopeptidase causes Glut4 translocation in 3T3-L1 adipocytes. J Biol Chem 272:2332323327[Abstract/Free Full Text]
-
Johnson AO, Subtil A, Petrush R, Kobylarz K, Keller SR, McGraw TE 1998 Identification of an insulin-responsive, slow endocytic recycling mechanism in Chinese hamster ovary cells. J Biol Chem 273:1796817977[Abstract/Free Full Text]
-
Subtil A, Lampson MA, Keller SR, McGraw TE 2000 Characterization of the insulin-regulated endocytic recycling mechanism in 3T3-L1 adipocytes using a novel reporter molecule. J Biol Chem 275:47874795[Abstract/Free Full Text]
-
Furuta S, Miyazawa S, Hashimoto T 1981 Purification and properties of rat liver acyl-CoA dehydrogenases and electron transfer flavoprotein. J Biochem (Tokyo) 90:17391750[Abstract/Free Full Text]
-
Ogihara T, Isobe T, Ichimura T, Taoka M, Funaki M, Sakoda H, Onishi Y, Inukai K, Anai M, Fukushima Y, Kikuchi M, Yazaki Y, Oka Y, Asano T 1997 14-3-3 protein binds to insulin receptor substrate-1, one of the binding sites of which is in the phosphotyrosine binding domain. J Biol Chem 272:2526725274[Abstract/Free Full Text]
-
Hebert DN, Simons JF, Peterson JR, Helenius A 1995 Calnexin, calreticulin, and Bip/Kar2p in protein folding. Cold Spring Harb Symp Quant Biol 60:405415[Abstract/Free Full Text]
-
Sabbagh E, Cuebas D, Schulz H 1985 3-Mercaptopropionic acid, a potent inhibitor of fatty acid oxidation in rat heart mitochondria. J Biol Chem 260:73377342[Abstract/Free Full Text]
-
Niezen-Koning KE, Wanders RJ, Nagel GT, Sewell AC, Heymans HS 1994 Measurement of short-chain acyl-CoA dehydrogenase (SCAD) in cultured skin fibroblasts with hexanoyl-CoA as a competitive inhibitor to eliminate the contribution of medium-chain acyl-CoA dehydrogenase. Clin Chim Acta 229:99106[CrossRef][Medline]
-
Clarke JF, Young PW, Yonezawa K, Kasuga M, Holman GD 1994 Inhibition of the translocation of GLUT1 and GLUT4 in 3T3-L1 cells by the phosphatidylinositol 3-kinase inhibitor, wortmannin. Biochem J 300:631635
-
Herbst JJ, Andrews GC, Contillo LG, Singleton DH, Genereux PE, Gibbs EM, Lienhard GE 1995 Effect of the activation of phosphatidylinositol 3-kinase by a thiophosphotyrosine peptide on glucose transport in 3T3-L1 adipocytes. J Biol Chem 270:2600026005[Abstract/Free Full Text]
-
Shi Y, Samuel SJ, Lee W, Yu C, Zhang W, Lachaal M, Jung CY 1999 Cloning of an L-3-hydroxyacyl-CoA dehydrogenase that interacts with the GLUT4 C-terminus. Arch Biochem Biophys 363:323332[CrossRef][Medline]
-
Holman GD, Cushman SW 1994 Subcellular localization and trafficking of the GLUT4 glucose transporter isoform in insulin-responsive cells. Bioessays 16:753759[CrossRef][Medline]
-
Czech MP 1995 Molecular actions of insulin on glucose transport. Annu Rev Nutr 15:441471[CrossRef][Medline]
-
Kandror KV, Pilch PF 1996 Compartmentalization of protein traffic in insulin-sensitive cells. Am J Physiol 271:E1E14
-
Thurmond DC, Ceresa BP, Okada S, Elmendorf JS, Coker K, Pessin JE 1998 Regulation of insulin-stimulated GLUT4 translocation by Munc18c in 3T3L1 adipocytes. J Biol Chem 273:3387633883[Abstract/Free Full Text]
-
Min J, Okada S, Kanzaki M, Elmendorf JS, Coker KJ, Ceresa BP, Syu LJ, Noda Y, Saltiel AR, Pessin JE 1999 Synip: a novel insulin-regulated syntaxin 4-binding protein mediating GLUT4 translocation in adipocytes [published erratum appears in Mol Cell 1999 Jul;4(1):following 192]. Mol Cell 3:751760[CrossRef][Medline]
-
Cormont M, Tanti JF, Zahraoui A, Van Obberghen E, Tavitian A, Le Marchand-Brustel Y 1993 Insulin and okadaic acid induce Rab4 redistribution in adipocytes. J Biol Chem 268:1949119497[Abstract/Free Full Text]
-
Sleeman MW, Donegan NP, Heller-Harrison R, Lane WS, Czech MP 1998 Association of acyl-CoA synthetase-1 with GLUT4-containing vesicles. J Biol Chem 273:31323135[Abstract/Free Full Text]
-
Randle PJ, Garland PB, Newsholme EA, Hales CN 1965 The glucose fatty acid cycle in obesity and maturity onset diabetes mellitus. Ann NY Acad Sci 131:324333[Medline]
-
Boden G, Chen X, Ruiz J, White JV, Rossetti L 1994 Mechanisms of fatty acid-induced inhibition of glucose uptake. J Clin Invest 93:24382446
-
Aoyama T, Peters JM, Iritani N, Nakajima T, Furihata K, Hashimoto T, Gonzalez FJ 1998 Altered constitutive expression of fatty acid-metabolizing enzymes in mice lacking the peroxisome proliferator-activated receptor
(PPAR
). J Biol Chem 273:56785684[Abstract/Free Full Text]
-
Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli W 1999 Peroxisome proliferator-activated receptor
mediates the adaptive response to fasting. J Clin Invest 103:14891498[Medline]
-
Leone TC, Weinheimer CJ, Kelly DP 1999 A critical role for the peroxisome proliferator-activated receptor
(PPAR
) in the cellular fasting response: the PPAR
-null mouse as a model of fatty acid oxidation disorders. Proc Natl Acad Sci USA 96:74737478[Abstract/Free Full Text]
-
Glick BS, Rothman JE 1987 Possible role for fatty acyl-coenzyme A in intracellular protein transport. Nature 326:309312[CrossRef][Medline]
-
Ostermann J, Orci L, Tani K, Amherdt M, Ravazzola M, Elazar Z, Rothman JE 1993 Stepwise assembly of functionally active transport vesicles. Cell 75:10151025[CrossRef][Medline]
-
Pfanner N, Orci L, Glick BS, Amherdt M, Arden SR, Malhotra V, Rothman JE 1989 Fatty acyl-coenzyme A is required for budding of transport vesicles from Golgi cisternae. Cell 59:95102[CrossRef][Medline]
-
Letourneur F, Klausner RD 1992 A novel di-leucine motif and a tyrosine-based motif independently mediate lysosomal targeting and endocytosis of CD3 chains. Cell 69:11431157[CrossRef][Medline]
-
Pieters J, Bakke O, Dobberstein B 1993 The MHC class II-associated invariant chain contains two endosomal targeting signals within its cytoplasmic tail. J Cell Sci 106:831846[Abstract]
-
Chen HJ, Remmler J, Delaney JC, Messner DJ, Lobel P 1993 Mutational analysis of the cation-independent mannose 6-phosphate/insulin-like growth factor II receptor. A consensus casein kinase II site followed by 2 leucines near the carboxyl terminus is important for intracellular targeting of lysosomal enzymes. J Biol Chem 268:2233822346[Abstract/Free Full Text]
-
Marsh BJ, Alm RA, McIntosh SR, James DE 1995 Molecular regulation of GLUT-4 targeting in 3T3-L1 adipocytes. J Cell Biol 130:10811091[Abstract/Free Full Text]
-
Verhey KJ, Yeh JI, Birnbaum MJ 1995 Distinct signals in the GLUT4 glucose transporter for internalization and for targeting to an insulin-responsive compartment. J Cell Biol 130:10711079[Abstract/Free Full Text]
-
Asano T, Takata K, Katagiri H, Tsukuda K, Lin JL, Ishihara H, Inukai K, Hirano H, Yazaki Y, Oka Y 1992 Domains responsible for the differential targeting of glucose transporter isoforms. J Biol Chem 267:1963619641[Abstract/Free Full Text]
-
Czech MP, Chawla A, Woon CW, Buxton J, Armoni M, Tang W, Joly M, Corvera S 1993 Exofacial epitope-tagged glucose transporter chimeras reveal COOH-terminal sequences governing cellular localization. J Cell Biol 123:127135[Abstract/Free Full Text]
-
Asano T, Shibasaki Y, Kasuga M, Kanazawa Y, Takaku F, Akanuma Y, Oka Y 1988 Cloning of a rabbit brain glucose transporter cDNA and alteration of glucose transporter mRNA during tissue development. Biochem Biophys Res Commun 154:12041211[CrossRef][Medline]
-
James DE, Strube M, Mueckler M 1989 Molecular cloning and characterization of an insulin-regulatable glucose transporter. Nature 338:8387[CrossRef][Medline]
-
Kandror KV, Coderre L, Pushkin AV, Pilch PF 1995 Comparison of glucose-transporter-containing vesicles from rat fat and muscle tissues: evidence for a unique endosomal compartment. Biochem J 307:383390
-
Robinson LJ, Pang S, Harris DS, Heuser J, James DE 1992 Translocation of the glucose transporter (GLUT4) to the cell surface in permeabilized 3T3-L1 adipocytes: effects of ATP insulin, and GTP
S and localization of GLUT4 to clathrin lattices. J Cell Biol 117:11811196[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
G. R. Peck, S. Ye, V. Pham, R. N. Fernando, S. L. Macaulay, S. Y. Chai, and A. L. Albiston
Interaction of the Akt Substrate, AS160, with the Glucose Transporter 4 Vesicle Marker Protein, Insulin-Regulated Aminopeptidase
Mol. Endocrinol.,
October 1, 2006;
20(10):
2576 - 2583.
[Abstract]
[Full Text]
[PDF]
|
 |
|