| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biological Chemistry and Nutrition, Faculty of Medicine, Université Libre de Bruxelles, B-1070 Brussels, Belgium
Address all correspondence and requests for reprints to: Dr. Ingrid Langer, Department of Biological Chemistry and Nutrition, Université Libre de Bruxelles, Faculty of Medicine, Bat GE, CP 611, 808 Route de Lennik, B-1070 Brussels, Belgium. E-mail: ilanger{at}ulb.ac.be.
| ABSTRACT |
|---|
|
|
|---|
Thus, a small sequence in the IC3 of the VPAC1 receptor, probably through interaction with G
i and G
q proteins, is responsible for the efficient agonist-stimulated [Ca2+]i increase.
| INTRODUCTION |
|---|
|
|
|---|
s protein, which stimulates adenylate cyclase activity and induces cAMP increase (2). It was consistently demonstrated in cell lines expressing constitutively the PAC1 receptor and in Chinese hamster ovary (CHO) cells transfected with the human or rat PAC1 receptor that PACAP also initiates an increase in IP3 and of intracellular calcium concentration ([Ca2+]i) that is not blocked by pertussis toxin pretreatment and that was thus attributed to a coupling with G
q (3). The coupling of the VPAC1 and VPAC2 receptors to the IP3/Ca2+ pathway was also demonstrated in both transfected cell lines (4, 5) and cell cultures expressing the receptors constitutively (6, 7, 8). The VPAC1 receptor-mediated inositol phosphate increase is partially blocked by pertussis toxin pretreatment, attesting to a contribution of G
i/o protein (9). The VPAC2 receptor may also couple to PLC through both pertussis toxin-insensitive and -sensitive G protein (10). In addition, both receptors are also able to couple to G
16 (11), a G protein expressed only in hematopoietic cells that enables the coupling of a wide variety of receptors to PLC (12). We recently showed, in CHO cells expressing the same density of human recombinant VPAC1 or VPAC2 receptors, that VIP-mediated calcium increase was more efficient through VPAC1 than through VPAC2 receptor (11). To identify which part of the receptor could be responsible for this differential coupling, we constructed chimeric receptors, transfected them in CHO cells, and evaluated [Ca2+]i increase by a functional assay based on the luminescence produced after coelenterazine oxidation. This study revealed that the third intracellular loop of the receptor was the major determinant for an efficient [Ca2+]i increase. Site-directed mutagenesis suggested that the sequence of the first part of the third intracellular loop of the VPAC1 receptor was sufficient to ensure the efficient [Ca2+]i increase.
| RESULTS |
|---|
|
|
|---|
s (adenylate cyclase activation) with the same efficacy (P = 0.91 when comparing slopes and intercepts of both lines) (Fig. 1e
i and G
q proteins (Table 1
|
|
Receptor density and IC50 values were evaluated by I125-VIP/VIP (chimera V and V1VGGN) or 125I-Ro 251553/Ro 251553 (chimeras I-IV, V2RP and V2IRKS) binding studies (Table 1
).
Dose-effect curves of adenylate cyclase activation by VIP were performed: EC50 values were calculated and were correlated with binding data (Table 1
). Efficacy, expressed in fold stimulation, was also evaluated and, when plotted against the receptor density, was, in any case, different from the response of the wild-type receptors (Fig. 2a
).
|
i and G
q and induce calcium increase through both mobilization of intracellular stores and calcium entry across the plasma membrane (13). For normalization of results, the digitonin response was thus preferred to the ATP response as it was independent of cellular treatment like pertussis toxin.
In a receptor generated by replacement of the C-terminal tail as in chimera I (N
EC3 VPAC2/TM7
C VPAC1), VIP induced a low calcium increase comparable to that of the VPAC2 receptor. When the IC3 of VPAC1 was also included as in chimera II (N
EC2 VPAC2/TM5
C VPAC1) the VIP response reached 69% of the digitonin response, a value comparable to that of VPAC1. These results suggested that the IC3 of the VPAC1 receptor could be responsible for an efficient coupling to the calcium pathway. We tested chimera V (N
EC2 VPAC1/TM5
C VPAC2) and, as expected, the calcium increase was low as in VPAC2 receptors. To exclude the involvement of the C-terminal tail, we constructed chimera III where only the IC3 of the VPAC2 receptor has been replaced by the counterpart VPAC1 sequence. In cells expressing chimera III, VIP-induced calcium increase reached 33% of the digitonin response corresponding to about half of the VPAC1 receptor response. However, binding studies also revealed that the level of expression of chimera III (1.1 pmol/mg protein) was 50% lower than for VPAC1 receptor-expressing cells (2.1 pmol/mg protein). As studies with VPAC1 and VPAC2 receptors have demonstrated that the maximal VIP-induced calcium increase was linearly correlated with receptor density (Fig. 1f
), we compared the results after normalization of the receptor density and concluded that IC3 of the VPAC1 receptor was an essential domain for the efficient coupling to the calcium pathway. To define more precisely the sequence of that loop involved in VPAC1 receptor efficient coupling, we investigated a VPAC2 chimeric receptor containing the amino domain of the IC3 of the VPAC1 receptor (Chim IV). In cells expressing chimera IV, the maximal calcium increase was slightly lower (48%) than that observed for VPAC1 receptor for a similar receptor density. When comparing the amino acid sequence of the amino domain of the IC3 of VPAC1 and VPAC2 receptors (Fig. 3
), we found that only two small clusters of amino acids differ between each receptor. We thus constructed two VPAC2 receptor mutants where two (TS) or four (VGGN) amino acids of the IC3 were replaced by those corresponding to VPAC1 receptor (RP and IRKS), named V2RP and V2IRKS, respectively. VIP-induced calcium increase in V2RP-expressing cells was low, whereas the V2IRKS mutant displayed a response comparable to that observed for chimera IV and thus close to the VPAC1 response. To confirm our results we constructed a last mutant, named V1VGGN, where the IRKS sequence in the VPAC1 receptor was replaced by the corresponding VPAC2 sequence (VGGN). As expected, VIP-induced calcium increase was low as for VPAC2 receptors. Figure 2b
summarizes maximal calcium response observed for all constructions as a function of the receptor density. For all constructions, the peptide concentrations required for half-maximal [Ca2+]i increase were higher than those required for adenylate cyclase activation (Table 1
). This has been often observed in that system as the [Ca2+]i measure is performed within 20 sec after ligand addition and thus reflects essentially the association constant rate of the ligands rather than the equilibrium constant. This could also explain the higher EC50 value for [Ca2+]i increase observed in VPAC2 wild-type and mutated receptors containing the binding domain (the amino terminal), ensuring receptor selectivity. For all constructions VIP-induced calcium increase was partially blocked (between 20 and 37%) by pertussis toxin pretreatment (Table 1
). Calcium-deficient medium reduced calcium response between 12 and 19% or between 16 and 20% in the absence or in the presence of pertussis toxin pretreatment, respectively (data not shown). These results were comparable to those observed with the wild-type receptors (see above).
|
| DISCUSSION |
|---|
|
|
|---|
-subunit of heterotrimeric G proteins has a central role in interaction with both the receptor and the effectors. Several studies have shown that the C-terminal part of G
subunit can directly bind to the receptor and is involved in the coupling specificity: G
q mutants, in which the last five amino acids were replaced by those corresponding to G
i or G
s, are able to couple to receptors acting preferentially through G
i or G
s, respectively (14, 15). In addition, high-resolution crystal structures suggest that the C-terminal part of G
subunit is surface exposed and thus easily accessible for interactions with the receptor (16). Considering that EC loops and transmembrane (TM) helices, which are essential for ligand recognition and receptor structure, are not directly involved in the coupling to the effector, most of the studies searched within the cytoplasmic domains the regions involved in G protein-receptor coupling (17, 18, 19, 20). The study of a wide variety of chimeric or mutated 7-TM receptors demonstrated that IC2 and IC3 and, to a lesser extent, the proximal part of the C-terminal tail (C) can be directly involved in G protein-receptor interaction. The first intracellular loop (IC1), highly conserved among each GPCR family, has been proposed to play a structural role only, as seen with the ß2-adrenergic (21) and the glucagon receptor (22). Studies performed among the rhodopsin-like GPCR family allow us to propose a common pattern of G protein-receptor interaction. Junctions between TM3/IC2, TM5/IC3, and IC3/TM6 share conserved hydrophobic residues, occurring with a periodicity of three or four amino acids, assumed to form a binding pocket allowing the recruitment of G protein to the receptor (20, 23). These regions are also characterized by the presence, with the same periodicity, of charged residues dedicated to interact directly with a specific G protein (17). More precisely, the charged amino acids in the proximal and distal regions of IC3 are dedicated to the specific recognition of the G protein while the TM3/IC2 junction would act as a switch enabling G protein activation (24). These observations are in good agreement with the current model of receptor activation: agonist binding leads to conformational changes that bring TM3 near TM5/6 and allows the receptor to switch from inactive to active state (25, 26). This suggests that when the receptor is in its resting conformation, the hydrophobic G protein binding pocket faces the membrane, thereby preventing G protein-receptor interaction. When the receptor switches to its active conformation, TM proximity is accompanied by IC2 and IC3 movements, leading to exposure of the G protein binding pocket to cytosol and G protein-receptor interaction.
We reported recently that VPAC1 coupling to the calcium pathway was more effective than VPAC2 coupling (11). We attempted in this work to identify which part of the receptor was responsible for that difference. As amino acid sequences of IC1 of both VPAC1 and VPAC2 receptor are identical, we focused on the other intracellular domains and identified that a four-amino acids sequence in the IC3 of VPAC1 receptor (IRKS) was necessary and sufficient to reproduce VPAC1 receptor-mediated calcium increase: when introduced in VPAC2 receptor, the IRKS sequence was sufficient to reproduce the VPAC1 receptor response. Conversely, its replacement in VPAC1 receptor by the corresponding sequence of the VPAC2 receptor (VGGN) abolished the efficient coupling to the calcium effector. Figure 4
summarizes the maximal calcium response observed for all constructions normalized for receptor density and expressed in percent of VPAC1 receptor response.
|
i and G
q receptor coupling specificity and mutational analysis of that loop led to the identification of a series of single amino acids that are key residues for proper G protein recognition. However, the diversity of sequences and loop sizes, even among related receptors, has made difficult the identification of a specific set of sequences defining the coupling profile. In the rhodopsin-like family for instance, the AALS motif located in the IC3 amino domain of muscarinic M3 receptors and its counterpart VTIL in the M2 receptor have been demonstrated to play an important role in specific recognition of G
q and G
i, respectively (20). Similarly, two sequences rich in basic amino acids (WKALKKA and KPRN) located in IC3 proximal and distal regions of the AT1A receptor are responsible for specific recognition of G
q (27).
VIP receptors, as all those of the GPCR-B family, share poor sequence homology with the rhodopsin-like GPCR family. For instance, they do not present the alternate hydrophobic/charged residues motif in their intracellular domains. Even if a recent study suggests that TM3 and TM6 movements could also be involved in PTH receptor activation (28), no general G protein-receptor interaction model has been proposed due to the limited amount of data available. For PTH receptor, site-directed mutagenesis showed that the specificity of coupling to G
q and activation of PLC is mediated through four amino acids (EKKY) in the C-terminal domain of IC2 (29). For glucagon receptor, a study using chimeric glucagon/dopamine 4 receptors demonstrated that both IC2 and IC3 were involved in both adenylate cyclase activation and [Ca2+]i increase (22). For GLP-1 receptor, G protein-receptor interaction specificity could be mediated through the IC3 only: three amino acids (KLK) of the IC3 amino domain are involved in the coupling to G
s (30), while its C-terminal part interacts with G
i/o (31).
Comparison of those data with our results and the rhodopsin-like GPCR family model suggests that both families share some common features. IC2 and IC3 are involved in G protein-receptor interaction specificity, and charged residues within those loops could be directly involved in G protein-receptor interaction.
In summary, we demonstrate that the IC3 of the VPAC1 receptor is necessary for the coupling to the inositol phosphate/calcium pathway and identify, for the first time for a GPCR-B family member, that four amino acids in the amino domain of IC3 (IRKS) are sufficient to allow efficient G
i/G
q coupling and [Ca2+]i increase without affecting G
s recognition and adenylate cyclase activation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
EC3 VPAC2/TM7
C VPAC1), chimera II (N
EC2 VPAC2/TM5
C VPAC1), chimera III (N
TM5 VPAC2/IC3 VPAC1/TM6
C VPAC2), chimera IV (N
310 VPAC2/324331 VPAC1/319
C VPAC2), chimera V (N
EC2 VPAC1/TM5
C VPAC2), V2RP (N
310 VPAC2/324325 VPAC1/313
C VPAC2), V2IRKS (N
315 VPAC2/328331 VPAC1/319
C VPAC2) and V1VGGN (N
327 VPAC1/315318 VPAC2/332
C VPAC1). The cell lines expressing VPAC1 and VPAC2 (11) and chimera I have been detailed in a previous publication (32). Chimeras II and V differ from the previously described chimeras (32) by addition (chimera II) or removal (chimera V) of a proline at the junction between EC2 and TM5 because of its importance for receptor structure (33). Generation of the other receptors was achieved using the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla CA) essentially according to the manufacturers instructions. For V2RP and V2IRKS mutants, the human VPAC2 receptor coding region, inserted into the mammalian expression vector pcDNA3.1 (Invitrogen, San Diego, CA), was submitted to 22 cycles of PCR (95 C for 30 sec, 54 C for 1 min, and 68 C for 14 min) in a 50-µl reaction volume. The chimera III and V1VGGN mutant were generated similarly, but the template used was chimera IV or VPAC1 coding region, respectively. The forward and reverse primers were complementary and contained the desired nucleotide changes, flanked on either side by 15 perfectly matched nucleotides (only the forward primers are shown): Chimera III: TGCTGCAGAAGTTAAGACCCCCAGATATCCGCAAAAGCGACCAGTCTCAGTA
Chimera IV: ATCCGCAAAAGCGACTCGTCTCCGTACTCGAGGCTGGCCAGGTCCACGCTCCTGCT
V2RP: TGCTGCAGAAGTTAAGACCCCCAGATGTCGGCG
V2IRKS: TAACATCCCCAGATATCCGCAAAAGCGACCAGTCTCAGTA
V1VGGN: CTGCGGCCCCCAGATGTCGGGGGGAATGACAGCAGTCCATA
After PCR, 10 µl were analyzed by agarose gel electrophoresis and the remaining 40 µl were digested for at least 2 h by 1 µl DpnI restriction enzyme (Stratagene) to remove the parental methylated DNA. The digested PCR products were transformed into TOP10 One Shot competent Escherichia coli bacterial cells (Invitrogen). Of several colonies verified by agarose gel electrophoresis of miniprep plasmid DNA (Amersham Pharmacia Biotech, Piscataway, NJ), three were retained and the mutations checked for by DNA sequencing on an ABI automated sequencing apparatus, using the BigDye Terminator Sequencing Prism Kit from ABI (Perkin-Elmer Corp., Santa Clara, CA). Plasmid DNA from one clone for each mutation, containing the correct nucleotide substitutions, was prepared using a midiprep endotoxin-free kit (Stratagene), the complete nucleotide sequence of the receptor coding region was verified by DNA sequencing. Twenty micrograms of receptor coding region were transfected by electroporation in the CHO cell line expressing aequorin (kindly provided by Vincent Dupriez, Euroscreen SA, Belgium) as described previously (34). Selection was carried out in culture medium [50% HamF12; 50% DMEM; 10% FCS; 1% penicillin (10 mU/ml); 1% streptomycin (10 µg/ml); 1% L-glutamine (200 mM), Life Technologies, Inc. Ltd., Paisley, UK], supplemented with 600 µg geneticin (G418)/ml culture medium. After 1015 d of selection, isolated colonies were transferred to 24-well microtiter plates and grown until confluence, trypsinized and further expanded in six-well microtiter plates, from which cells were scraped and membranes prepared for identification of receptor-expressing clones by an adenylate cyclase activity assay in the presence of 1 µM VIP.
Membrane Preparation
Membranes were prepared from scraped cells lysed in 1 mM NaHCO3 by immediate freezing in liquid nitrogen. After thawing, the lysate was first centrifuged at 4 C for 10 min at 400 x g, and the supernatant was further centrifuged at 20,000 x g for 10 min. The resulting pellet, resuspended in 1 mM NaHCO3 was used immediately as a crude membrane fraction.
Adenylate Cyclase Activation Assay
Adenylate cyclase activity was determined by the procedure of Solano et al. (34), as described previously. Membrane proteins (315 µg) were incubated in a total volume of 60 µl containing 0.5 mM [
32P]-ATP, 10 µM GTP, 5 mM MgCl2, 0.5 mM EGTA, 1 mM cAMP, 1 mM theophylline, 10 mM phospho(enol)pyruvate, 30 µg/ml pyruvate kinase, and 30 mM Tris-HCl at a final pH of 7.8. The reaction was initiated by addition of membranes and was terminated after 15 min incubation at 37 C by adding 0.5 ml of a 0.5% SDS solution containing 0.5 mM ATP, 0.5 mM cAMP, and 20,000 cpm [3H]-cAMP. cAMP was separated from ATP by two successive chromatographies on Dowex 50W x 8 and neutral alumina.
Binding Studies
Binding studies were performed as described using 125I-VIP or 125I-Ro 251553 (34). The nonspecific binding was defined as residual binding in the presence of 1 µM unlabeled VIP or Ro 251553, respectively. 125I-Ro 251553 was preferred for quantification of receptors with a binding profile similar to that of VPAC2 receptors, as the specific binding and the ratio between total and nonspecific binding was higher than with 125I-VIP. Binding was performed for 30 min at 23 C in a total volume of 120 µl containing 20 mM Tris-maleate, 2 mM MgCl2, 0.1 mg/ml bacitracin, 1% BSA (pH 7.4) buffer; 330 µg of protein were used per assay. Bound and free radioactivity were separated by filtration through glass-fiber GF/C filters presoaked for 24 h in 0.01% polyethyleneimine and rinsed three times with a 20 mM (pH 7.4) sodium phosphate buffer containing 0.5% BSA. The density of the binding sites was estimated by analysis of homologous competition curves assuming that the labeled and unlabeled ligands had the same affinities for the receptors.
Calcium Increase Assay
Calcium increase was measured by a functional assay based on the luminescence of mitochondrial aequorin/coelenterazine after calcium increase as described previously (35, 36, 37). Briefly, cells were collected from plates with PBS containing 5 mM EDTA, pelleted, and resuspended at 5 x 106 cells/ml in DMEM-F12 medium (containing 1 mM [Ca2+]i) supplemented with 0.5% BSA, incubated with 5 µM coelenterazine H (Molecular Probes, Inc., Eugene, OR) for 3 h at room temperature under light agitation. Cells were then diluted at a concentration of 5 x 105 cells/ml and incubated for 1 more hour. Fifty microliters of cell suspension were added to agonists diluted in a volume of 50 µl DMEM-F12. Calcium increase was evaluated by measuring for 20 sec the luminescent signal (integration of area under the curve) resulting from the activation of the aequorin-coelenterazine complex using a microlumat luminometer (Perkin-Elmer Corp.). For pertussis toxin pretreatment experiments, cells were preincubated for 16 h in serum-free medium containing 100 ng/ml pertussis toxin. For testing the influence of intracellular calcium mobilization, cells were prepared as described but added to agonists diluted in DMEM-F12 medium containing 2 mM EGTA, allowing a final 1 mM EGTA concentration.
Data Analysis
All competition curves, dose-response curves, and IC50 and EC50 values were calculated using nonlinear regression Prism software (GraphPad Software, Inc., San Diego, CA). For all data sets, the logarithm of the SE calculated for IC50 and EC50 values was always smaller than 0.2. Linear regressions and statistical analysis were performed using the same software.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: [Ca2+]i, Intracellular calcium concentration; CHO, Chinese hamster ovary; GPCR, G protein-coupled receptor; IC2 or IC3, second or third intracellular loop; PACAP, pituitary adenylate cyclase-activating polypeptide; TM, transmembrane.
Received for publication August 29, 2001. Accepted for publication January 4, 2002.
| REFERENCES |
|---|
|
|
|---|
16. Cell Calcium 30:229234[CrossRef][Medline]
15 and G
16 couple a wide variety of receptors to phospholipase C. J Biol Chem 270:1517515180
(q) subunits. Biochemistry 36:14871495[CrossRef][Medline]
and Gs
that alter the fidelity of receptor activation. Mol Pharmacol 50:885890[Abstract]
q coupling selectivity. J Biol Chem 272:2367523681
-factor pheromone receptor. Mol Cell Biol 16:48184823[Abstract]
(s) and G
(i)/G
(o) activation. Biochim Biophys Acta 1546:7986[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. Langlet, I. Langer, P. Vertongen, N. Gaspard, J.-M. Vanderwinden, and P. Robberecht Contribution of the Carboxyl Terminus of the VPAC1 Receptor to Agonist-induced Receptor Phosphorylation, Internalization, and Recycling J. Biol. Chem., July 29, 2005; 280(30): 28034 - 28043. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Langer, C. Langlet, and P. Robberecht Effect of inactivating mutations on phosphorylation and internalization of the human VPAC2 receptor J. Mol. Endocrinol., April 1, 2005; 34(2): 405 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yin, S. Gavi, H.-y. Wang, and C. C. Malbon Probing Receptor Structure/Function with Chimeric G-Protein-Coupled Receptors Mol. Pharmacol., June 1, 2004; 65(6): 1323 - 1332. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |