help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Langer, I.
Right arrow Articles by Robberecht, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Langer, I.
Right arrow Articles by Robberecht, P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
Molecular Endocrinology 16 (5): 1089-1096
Copyright © 2002 by The Endocrine Society

A Small Sequence in the Third Intracellular Loop of the VPAC1 Receptor Is Responsible for Its Efficient Coupling to the Calcium Effector

Ingrid Langer, Pascale Vertongen, Jason Perret, Magali Waelbroeck and Patrick Robberecht

Department of Biological Chemistry and Nutrition, Faculty of Medicine, Université Libre de Bruxelles, B-1070 Brussels, Belgium

Address all correspondence and requests for reprints to: Dr. Ingrid Langer, Department of Biological Chemistry and Nutrition, Université Libre de Bruxelles, Faculty of Medicine, Bat GE, CP 611, 808 Route de Lennik, B-1070 Brussels, Belgium. E-mail: ilanger{at}ulb.ac.be.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The stimulatory effect of VIP on intracellular calcium concentration ([Ca2+]i) has been investigated in Chinese hamster ovary cells stably transfected with the reporter gene aequorin, and expressing human VPAC1, VPAC2, chimeric VPAC1/VPAC2, or mutated receptors. The VIP-induced [Ca2+]i increase was linearly correlated with receptor density and was higher in cells expressing VPAC1 receptors than in cells expressing a similar VPAC2 receptor density. The study was performed to establish the receptor sequence responsible for that difference. VPAC1/VPAC2 chimeric receptors were first used for a broad positioning: those having the third intracellular loop (IC3) of the VPAC1 or of the VPAC2 receptor behaved, in that respect, phenotypically like VPAC1 and VPAC2 receptor, respectively. Replacement in the VPAC2 receptor of the sequence 315–318 (VGGN) within the IC3 by its VPAC1 receptor counterpart 328–331 (IRKS) and the introduction of VGGN in state of IRKS in VPAC1 was sufficient to mimic the VPAC1 and VPAC2 receptor characteristics, respectively.

Thus, a small sequence in the IC3 of the VPAC1 receptor, probably through interaction with G{alpha}i and G{alpha}q proteins, is responsible for the efficient agonist-stimulated [Ca2+]i increase.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
VIP AND PITUITARY adenylate cyclase activating polypeptide (PACAP) are neuropeptides that contribute to the regulation of intestinal secretion and motility of the exocrine and endocrine secretions and to the homeostasis of the immune system (1). The effects of VIP are mediated through interaction with two receptor subclasses named the VPAC1 and VPAC2 receptors (2). The effects of PACAP are also mediated through interactions with the same receptors as well as through a selective receptor named PAC1 (3). The three receptors are members of a large family of G protein-coupled receptors, often referred as the G protein-coupled receptor (GPCR)-B family (2), that includes also the receptors for secretin, glucagon, GLP-1, calcitonin, PTH, and GRF. These receptors are preferentially coupled to G{alpha}s protein, which stimulates adenylate cyclase activity and induces cAMP increase (2). It was consistently demonstrated in cell lines expressing constitutively the PAC1 receptor and in Chinese hamster ovary (CHO) cells transfected with the human or rat PAC1 receptor that PACAP also initiates an increase in IP3 and of intracellular calcium concentration ([Ca2+]i) that is not blocked by pertussis toxin pretreatment and that was thus attributed to a coupling with G{alpha}q (3). The coupling of the VPAC1 and VPAC2 receptors to the IP3/Ca2+ pathway was also demonstrated in both transfected cell lines (4, 5) and cell cultures expressing the receptors constitutively (6, 7, 8). The VPAC1 receptor-mediated inositol phosphate increase is partially blocked by pertussis toxin pretreatment, attesting to a contribution of G{alpha}i/o protein (9). The VPAC2 receptor may also couple to PLC through both pertussis toxin-insensitive and -sensitive G protein (10). In addition, both receptors are also able to couple to G{alpha}16 (11), a G protein expressed only in hematopoietic cells that enables the coupling of a wide variety of receptors to PLC (12).

We recently showed, in CHO cells expressing the same density of human recombinant VPAC1 or VPAC2 receptors, that VIP-mediated calcium increase was more efficient through VPAC1 than through VPAC2 receptor (11). To identify which part of the receptor could be responsible for this differential coupling, we constructed chimeric receptors, transfected them in CHO cells, and evaluated [Ca2+]i increase by a functional assay based on the luminescence produced after coelenterazine oxidation. This study revealed that the third intracellular loop of the receptor was the major determinant for an efficient [Ca2+]i increase. Site-directed mutagenesis suggested that the sequence of the first part of the third intracellular loop of the VPAC1 receptor was sufficient to ensure the efficient [Ca2+]i increase.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Correlation Between Receptor Density and Efficacy
In a first set of experiments we tested whether the magnitude of VIP-stimulated cAMP and [Ca2+]i increases was correlated with receptor density. For VPAC1 transfected cells three clones with receptor density (determined by 125I-VIP/VIP binding studies) of 0.4, 1, and 2.1 pmol/mg protein were tested. VIP increased cAMP and [Ca2+]i in a dose-dependent manner with a maximal cAMP response of 50 ± 1, 125 ± 4, and 225 ± 7 pmol cAMP/min/mg protein (Fig. 1aGo) while the maximal calcium increase reached 15 ± 1, 34 ± 2, and 63 ± 3% of the digitonin response, respectively (Fig. 1bGo). For VPAC2 transfected cells four clones with receptor density (determined by 125I-Ro 25–1553/Ro 25–1553 binding studies) of 0.6, 0.8, 1.3, and 1.8 pmol/mg protein were tested with respective maximal cAMP production of 80 ± 3, 88 ± 3, 114 ± 2, and 134 ± 6 pmol cAMP/min/mg protein (Fig. 1cGo) and a maximal [Ca2+]i increase of 9 ± 1, 10 ± 1, 11 ± 1, and 12 ± 1% of the digitonin response (Fig. 1dGo). As shown in Fig. 1Go, both maximal cAMP and calcium increase were linearly correlated with receptor density. For adenylate cyclase activation studies, linear regression analysis yielded a correlation coefficient of 0.97 for both VPAC1 and VPAC2 receptor-expressing cells. Using the same analysis for calcium increase studies, the correlation coefficient was of 0.99 and 0.81 for VPAC1- or VPAC2-expressing cells, respectively. The data also showed that both receptors interacted with G{alpha}s (adenylate cyclase activation) with the same efficacy (P = 0.91 when comparing slopes and intercepts of both lines) (Fig. 1eGo) while the coupling to the calcium pathway (whatever the G protein involved) was more efficient in VPAC1-expressing cells (slope = 29 ± 2 for VPAC1 and slope = 7 ± 2 for VPAC2; P < 0.001 when comparing slopes and intercepts of both lines) (Fig. 1fGo). Pertussis toxin pretreatment of the cells also showed that VIP-stimulated calcium increase was partially inhibited for both VPAC1 (31 ± 6%) and VPAC2 (17 ± 5%) receptors, indicating the involvement of both G{alpha}i and G{alpha}q proteins (Table 1Go). Experiments performed in calcium-deficient medium indicated that VIP-induced calcium increase was only slightly reduced for both VPAC1 (14 ± 3%) and VPAC2 (14 ± 2%) receptors in control experiments as well as after pertussis toxin pretreatment (17 ± 4% and 16 ± 3%, respectively), indicating that whatever the G protein involved, the response was mainly due to calcium intracellular stores mobilization.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Analysis of VPAC Wild-Type Receptors for Functional Studies and Receptor Expression

VIP dose-effect curves of adenylate cyclase activation (left panels) and calcium increase studies (right panels) performed on several clones of VPAC1 (a–b) or VPAC2 (c–d) receptor-expressing cells. Correlation between maximal cAMP (e, expressed in fold stimulation) or calcium increase (f) and VPAC1 (closed circles) or VPAC2 (open circles) receptor density (regression line and 95% confidence limits). The results represent the mean of three independent experiments performed in duplicate on each clone.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Binding and Functional Studies Performed on Wild-Type, Chimeric, and Mutated VPAC Receptors

 
Study of Chimeric and Mutated Receptors
We expressed different VPAC chimeric and mutated receptors and evaluated them for binding studies, adenylate cyclase activation, and calcium increase. We first started from the VPAC2 receptor sequence and replaced cytoplasmic domains or mutated amino acids by those corresponding to the VPAC1 receptor to measure a gain of function.

Receptor density and IC50 values were evaluated by I125-VIP/VIP (chimera V and V1VGGN) or 125I-Ro 25–1553/Ro 25–1553 (chimeras I-IV, V2RP and V2IRKS) binding studies (Table 1Go).

Dose-effect curves of adenylate cyclase activation by VIP were performed: EC50 values were calculated and were correlated with binding data (Table 1Go). Efficacy, expressed in fold stimulation, was also evaluated and, when plotted against the receptor density, was, in any case, different from the response of the wild-type receptors (Fig. 2aGo).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Analysis of VPAC Chimeric and Mutated Receptors for Functional Studies and Receptor Expression Compared with Wild-Type Receptors

Correlation between maximal cAMP response (a, expressed in fold stimulation) or maximal calcium increase (b), observed for wild-type (regression line and 95% confidence limits), chimeric, and mutated receptors and receptor density. The results represent the mean of three independent experiments in duplicate.

 
Calcium increase was evaluated by measuring for 20 sec the luminescent signal (integration of area under the curve) resulting from the activation of the aequorin-coelenterazine complex in a luminometer. The data were normalized for basal (0%, background removal) and maximal luminescence (100%) corresponding to the signal measured after exposure to 50 µM digitonin. Calcium increase after 10 µM ATP stimulation was also measured to evaluate the response through a constitutively expressed receptor; the maximal stimulation was 66 ± 7% whatever the construction tested (data not shown). Pertussis toxin pretreatment of the cells reduced 75 ± 4% of the ATP-induced calcium increase. Experiments performed in calcium-deficient medium indicated that ATP response was reduced by 20 ± 3% and 16 ± 3% in the absence or in the presence of pertussis toxin pretreatment, respectively. These results are in agreement with the expression in CHO cells of P2Y2 receptors that couple to both G{alpha}i and G{alpha}q and induce calcium increase through both mobilization of intracellular stores and calcium entry across the plasma membrane (13). For normalization of results, the digitonin response was thus preferred to the ATP response as it was independent of cellular treatment like pertussis toxin.

In a receptor generated by replacement of the C-terminal tail as in chimera I (N->EC3 VPAC2/TM7->C VPAC1), VIP induced a low calcium increase comparable to that of the VPAC2 receptor. When the IC3 of VPAC1 was also included as in chimera II (N->EC2 VPAC2/TM5->C VPAC1) the VIP response reached 69% of the digitonin response, a value comparable to that of VPAC1. These results suggested that the IC3 of the VPAC1 receptor could be responsible for an efficient coupling to the calcium pathway. We tested chimera V (N->EC2 VPAC1/TM5->C VPAC2) and, as expected, the calcium increase was low as in VPAC2 receptors. To exclude the involvement of the C-terminal tail, we constructed chimera III where only the IC3 of the VPAC2 receptor has been replaced by the counterpart VPAC1 sequence. In cells expressing chimera III, VIP-induced calcium increase reached 33% of the digitonin response corresponding to about half of the VPAC1 receptor response. However, binding studies also revealed that the level of expression of chimera III (1.1 pmol/mg protein) was 50% lower than for VPAC1 receptor-expressing cells (2.1 pmol/mg protein). As studies with VPAC1 and VPAC2 receptors have demonstrated that the maximal VIP-induced calcium increase was linearly correlated with receptor density (Fig. 1fGo), we compared the results after normalization of the receptor density and concluded that IC3 of the VPAC1 receptor was an essential domain for the efficient coupling to the calcium pathway. To define more precisely the sequence of that loop involved in VPAC1 receptor efficient coupling, we investigated a VPAC2 chimeric receptor containing the amino domain of the IC3 of the VPAC1 receptor (Chim IV). In cells expressing chimera IV, the maximal calcium increase was slightly lower (48%) than that observed for VPAC1 receptor for a similar receptor density. When comparing the amino acid sequence of the amino domain of the IC3 of VPAC1 and VPAC2 receptors (Fig. 3Go), we found that only two small clusters of amino acids differ between each receptor. We thus constructed two VPAC2 receptor mutants where two (TS) or four (VGGN) amino acids of the IC3 were replaced by those corresponding to VPAC1 receptor (RP and IRKS), named V2RP and V2IRKS, respectively. VIP-induced calcium increase in V2RP-expressing cells was low, whereas the V2IRKS mutant displayed a response comparable to that observed for chimera IV and thus close to the VPAC1 response. To confirm our results we constructed a last mutant, named V1VGGN, where the IRKS sequence in the VPAC1 receptor was replaced by the corresponding VPAC2 sequence (VGGN). As expected, VIP-induced calcium increase was low as for VPAC2 receptors. Figure 2bGo summarizes maximal calcium response observed for all constructions as a function of the receptor density. For all constructions, the peptide concentrations required for half-maximal [Ca2+]i increase were higher than those required for adenylate cyclase activation (Table 1Go). This has been often observed in that system as the [Ca2+]i measure is performed within 20 sec after ligand addition and thus reflects essentially the association constant rate of the ligands rather than the equilibrium constant. This could also explain the higher EC50 value for [Ca2+]i increase observed in VPAC2 wild-type and mutated receptors containing the binding domain (the amino terminal), ensuring receptor selectivity. For all constructions VIP-induced calcium increase was partially blocked (between 20 and 37%) by pertussis toxin pretreatment (Table 1Go). Calcium-deficient medium reduced calcium response between 12 and 19% or between 16 and 20% in the absence or in the presence of pertussis toxin pretreatment, respectively (data not shown). These results were comparable to those observed with the wild-type receptors (see above).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Amino Acid Sequence of the IC3 of Wild-Type, Chimeric, and Mutated VPAC Receptors

The amino acids specific for VPAC1 receptor are shown in bold, those specific for VPAC2 receptor are underlined. Chimera I consisted of N->EC3 VPAC2/TM7->C VPAC1, chimera II in N->EC2 VPAC2/TM5->C VPAC1, chimera III in N->TM5 VPAC2/IC3 VPAC1/TM6->C VPAC2, chimera IV in N->310 VPAC2/324–331 VPAC1/319->C VPAC2, chimera V in N->EC2 VPAC1/TM5->C VPAC2, V2RP in N->310 VPAC2/324–325 VPAC1/313->C VPAC2, V2IRKS in N->315 VPAC2/328–331 VPAC1/319->C VPAC2 and V1VGGN N->327 VPAC1/315–318 VPAC2/332->C VPAC1.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The {alpha}-subunit of heterotrimeric G proteins has a central role in interaction with both the receptor and the effectors. Several studies have shown that the C-terminal part of G{alpha} subunit can directly bind to the receptor and is involved in the coupling specificity: G{alpha}q mutants, in which the last five amino acids were replaced by those corresponding to G{alpha}i or G{alpha}s, are able to couple to receptors acting preferentially through G{alpha}i or G{alpha}s, respectively (14, 15). In addition, high-resolution crystal structures suggest that the C-terminal part of G{alpha} subunit is surface exposed and thus easily accessible for interactions with the receptor (16). Considering that EC loops and transmembrane (TM) helices, which are essential for ligand recognition and receptor structure, are not directly involved in the coupling to the effector, most of the studies searched within the cytoplasmic domains the regions involved in G protein-receptor coupling (17, 18, 19, 20). The study of a wide variety of chimeric or mutated 7-TM receptors demonstrated that IC2 and IC3 and, to a lesser extent, the proximal part of the C-terminal tail (C) can be directly involved in G protein-receptor interaction. The first intracellular loop (IC1), highly conserved among each GPCR family, has been proposed to play a structural role only, as seen with the ß2-adrenergic (21) and the glucagon receptor (22).

Studies performed among the rhodopsin-like GPCR family allow us to propose a common pattern of G protein-receptor interaction. Junctions between TM3/IC2, TM5/IC3, and IC3/TM6 share conserved hydrophobic residues, occurring with a periodicity of three or four amino acids, assumed to form a binding pocket allowing the recruitment of G protein to the receptor (20, 23). These regions are also characterized by the presence, with the same periodicity, of charged residues dedicated to interact directly with a specific G protein (17). More precisely, the charged amino acids in the proximal and distal regions of IC3 are dedicated to the specific recognition of the G protein while the TM3/IC2 junction would act as a switch enabling G protein activation (24). These observations are in good agreement with the current model of receptor activation: agonist binding leads to conformational changes that bring TM3 near TM5/6 and allows the receptor to switch from inactive to active state (25, 26). This suggests that when the receptor is in its resting conformation, the hydrophobic G protein binding pocket faces the membrane, thereby preventing G protein-receptor interaction. When the receptor switches to its active conformation, TM proximity is accompanied by IC2 and IC3 movements, leading to exposure of the G protein binding pocket to cytosol and G protein-receptor interaction.

We reported recently that VPAC1 coupling to the calcium pathway was more effective than VPAC2 coupling (11). We attempted in this work to identify which part of the receptor was responsible for that difference. As amino acid sequences of IC1 of both VPAC1 and VPAC2 receptor are identical, we focused on the other intracellular domains and identified that a four-amino acids sequence in the IC3 of VPAC1 receptor (IRKS) was necessary and sufficient to reproduce VPAC1 receptor-mediated calcium increase: when introduced in VPAC2 receptor, the IRKS sequence was sufficient to reproduce the VPAC1 receptor response. Conversely, its replacement in VPAC1 receptor by the corresponding sequence of the VPAC2 receptor (VGGN) abolished the efficient coupling to the calcium effector. Figure 4Go summarizes the maximal calcium response observed for all constructions normalized for receptor density and expressed in percent of VPAC1 receptor response.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. VIP-Induced Calcium Increase for Wild-Type, Chimeric, and Mutated VPAC Receptors

The maximal calcium response observed for all constructions investigated in this work is shown as a percentage of VPAC1 receptor response (100%) and normalized for receptor density (VPAC1 receptor density = 100%). The results represent the mean ± SEM of three independent experiments in duplicate.

 
Numerous studies demonstrated the involvement of IC3 in both G{alpha}i and G{alpha}q receptor coupling specificity and mutational analysis of that loop led to the identification of a series of single amino acids that are key residues for proper G protein recognition. However, the diversity of sequences and loop sizes, even among related receptors, has made difficult the identification of a specific set of sequences defining the coupling profile. In the rhodopsin-like family for instance, the AALS motif located in the IC3 amino domain of muscarinic M3 receptors and its counterpart VTIL in the M2 receptor have been demonstrated to play an important role in specific recognition of G{alpha}q and G{alpha}i, respectively (20). Similarly, two sequences rich in basic amino acids (WKALKKA and KPRN) located in IC3 proximal and distal regions of the AT1A receptor are responsible for specific recognition of G{alpha}q (27).

VIP receptors, as all those of the GPCR-B family, share poor sequence homology with the rhodopsin-like GPCR family. For instance, they do not present the alternate hydrophobic/charged residues motif in their intracellular domains. Even if a recent study suggests that TM3 and TM6 movements could also be involved in PTH receptor activation (28), no general G protein-receptor interaction model has been proposed due to the limited amount of data available. For PTH receptor, site-directed mutagenesis showed that the specificity of coupling to G{alpha}q and activation of PLC is mediated through four amino acids (EKKY) in the C-terminal domain of IC2 (29). For glucagon receptor, a study using chimeric glucagon/dopamine 4 receptors demonstrated that both IC2 and IC3 were involved in both adenylate cyclase activation and [Ca2+]i increase (22). For GLP-1 receptor, G protein-receptor interaction specificity could be mediated through the IC3 only: three amino acids (KLK) of the IC3 amino domain are involved in the coupling to G{alpha}s (30), while its C-terminal part interacts with G{alpha}i/o (31).

Comparison of those data with our results and the rhodopsin-like GPCR family model suggests that both families share some common features. IC2 and IC3 are involved in G protein-receptor interaction specificity, and charged residues within those loops could be directly involved in G protein-receptor interaction.

In summary, we demonstrate that the IC3 of the VPAC1 receptor is necessary for the coupling to the inositol phosphate/calcium pathway and identify, for the first time for a GPCR-B family member, that four amino acids in the amino domain of IC3 (IRKS) are sufficient to allow efficient G{alpha}i/G{alpha}q coupling and [Ca2+]i increase without affecting G{alpha}s recognition and adenylate cyclase activation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Construction and Expression of VIP Chimeric and Mutant Receptors
The following chimeric and mutant receptors were constructed: chimera I (N->EC3 VPAC2/TM7->C VPAC1), chimera II (N->EC2 VPAC2/TM5->C VPAC1), chimera III (N->TM5 VPAC2/IC3 VPAC1/TM6->C VPAC2), chimera IV (N->310 VPAC2/324–331 VPAC1/319->C VPAC2), chimera V (N->EC2 VPAC1/TM5->C VPAC2), V2RP (N->310 VPAC2/324–325 VPAC1/313->C VPAC2), V2IRKS (N->315 VPAC2/328–331 VPAC1/319->C VPAC2) and V1VGGN (N->327 VPAC1/315–318 VPAC2/332->C VPAC1). The cell lines expressing VPAC1 and VPAC2 (11) and chimera I have been detailed in a previous publication (32). Chimeras II and V differ from the previously described chimeras (32) by addition (chimera II) or removal (chimera V) of a proline at the junction between EC2 and TM5 because of its importance for receptor structure (33). Generation of the other receptors was achieved using the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla CA) essentially according to the manufacturer’s instructions. For V2RP and V2IRKS mutants, the human VPAC2 receptor coding region, inserted into the mammalian expression vector pcDNA3.1 (Invitrogen, San Diego, CA), was submitted to 22 cycles of PCR (95 C for 30 sec, 54 C for 1 min, and 68 C for 14 min) in a 50-µl reaction volume. The chimera III and V1VGGN mutant were generated similarly, but the template used was chimera IV or VPAC1 coding region, respectively. The forward and reverse primers were complementary and contained the desired nucleotide changes, flanked on either side by 15 perfectly matched nucleotides (only the forward primers are shown):

Chimera III: TGCTGCAGAAGTTAAGACCCCCAGATATCCGCAAAAGCGACCAGTCTCAGTA

Chimera IV: ATCCGCAAAAGCGACTCGTCTCCGTACTCGAGGCTGGCCAGGTCCACGCTCCTGCT

V2RP: TGCTGCAGAAGTTAAGACCCCCAGATGTCGGCG

V2IRKS: TAACATCCCCAGATATCCGCAAAAGCGACCAGTCTCAGTA

V1VGGN: CTGCGGCCCCCAGATGTCGGGGGGAATGACAGCAGTCCATA

After PCR, 10 µl were analyzed by agarose gel electrophoresis and the remaining 40 µl were digested for at least 2 h by 1 µl DpnI restriction enzyme (Stratagene) to remove the parental methylated DNA. The digested PCR products were transformed into TOP10 One Shot competent Escherichia coli bacterial cells (Invitrogen). Of several colonies verified by agarose gel electrophoresis of miniprep plasmid DNA (Amersham Pharmacia Biotech, Piscataway, NJ), three were retained and the mutations checked for by DNA sequencing on an ABI automated sequencing apparatus, using the BigDye Terminator Sequencing Prism Kit from ABI (Perkin-Elmer Corp., Santa Clara, CA). Plasmid DNA from one clone for each mutation, containing the correct nucleotide substitutions, was prepared using a midiprep endotoxin-free kit (Stratagene), the complete nucleotide sequence of the receptor coding region was verified by DNA sequencing. Twenty micrograms of receptor coding region were transfected by electroporation in the CHO cell line expressing aequorin (kindly provided by Vincent Dupriez, Euroscreen SA, Belgium) as described previously (34). Selection was carried out in culture medium [50% HamF12; 50% DMEM; 10% FCS; 1% penicillin (10 mU/ml); 1% streptomycin (10 µg/ml); 1% L-glutamine (200 mM), Life Technologies, Inc. Ltd., Paisley, UK], supplemented with 600 µg geneticin (G418)/ml culture medium. After 10–15 d of selection, isolated colonies were transferred to 24-well microtiter plates and grown until confluence, trypsinized and further expanded in six-well microtiter plates, from which cells were scraped and membranes prepared for identification of receptor-expressing clones by an adenylate cyclase activity assay in the presence of 1 µM VIP.

Membrane Preparation
Membranes were prepared from scraped cells lysed in 1 mM NaHCO3 by immediate freezing in liquid nitrogen. After thawing, the lysate was first centrifuged at 4 C for 10 min at 400 x g, and the supernatant was further centrifuged at 20,000 x g for 10 min. The resulting pellet, resuspended in 1 mM NaHCO3 was used immediately as a crude membrane fraction.

Adenylate Cyclase Activation Assay
Adenylate cyclase activity was determined by the procedure of Solano et al. (34), as described previously. Membrane proteins (3–15 µg) were incubated in a total volume of 60 µl containing 0.5 mM [{alpha}32P]-ATP, 10 µM GTP, 5 mM MgCl2, 0.5 mM EGTA, 1 mM cAMP, 1 mM theophylline, 10 mM phospho(enol)pyruvate, 30 µg/ml pyruvate kinase, and 30 mM Tris-HCl at a final pH of 7.8. The reaction was initiated by addition of membranes and was terminated after 15 min incubation at 37 C by adding 0.5 ml of a 0.5% SDS solution containing 0.5 mM ATP, 0.5 mM cAMP, and 20,000 cpm [3H]-cAMP. cAMP was separated from ATP by two successive chromatographies on Dowex 50W x 8 and neutral alumina.

Binding Studies
Binding studies were performed as described using 125I-VIP or 125I-Ro 25–1553 (34). The nonspecific binding was defined as residual binding in the presence of 1 µM unlabeled VIP or Ro 25–1553, respectively. 125I-Ro 25–1553 was preferred for quantification of receptors with a binding profile similar to that of VPAC2 receptors, as the specific binding and the ratio between total and nonspecific binding was higher than with 125I-VIP. Binding was performed for 30 min at 23 C in a total volume of 120 µl containing 20 mM Tris-maleate, 2 mM MgCl2, 0.1 mg/ml bacitracin, 1% BSA (pH 7.4) buffer; 3–30 µg of protein were used per assay. Bound and free radioactivity were separated by filtration through glass-fiber GF/C filters presoaked for 24 h in 0.01% polyethyleneimine and rinsed three times with a 20 mM (pH 7.4) sodium phosphate buffer containing 0.5% BSA. The density of the binding sites was estimated by analysis of homologous competition curves assuming that the labeled and unlabeled ligands had the same affinities for the receptors.

Calcium Increase Assay
Calcium increase was measured by a functional assay based on the luminescence of mitochondrial aequorin/coelenterazine after calcium increase as described previously (35, 36, 37). Briefly, cells were collected from plates with PBS containing 5 mM EDTA, pelleted, and resuspended at 5 x 106 cells/ml in DMEM-F12 medium (containing 1 mM [Ca2+]i) supplemented with 0.5% BSA, incubated with 5 µM coelenterazine H (Molecular Probes, Inc., Eugene, OR) for 3 h at room temperature under light agitation. Cells were then diluted at a concentration of 5 x 105 cells/ml and incubated for 1 more hour. Fifty microliters of cell suspension were added to agonists diluted in a volume of 50 µl DMEM-F12. Calcium increase was evaluated by measuring for 20 sec the luminescent signal (integration of area under the curve) resulting from the activation of the aequorin-coelenterazine complex using a microlumat luminometer (Perkin-Elmer Corp.). For pertussis toxin pretreatment experiments, cells were preincubated for 16 h in serum-free medium containing 100 ng/ml pertussis toxin. For testing the influence of intracellular calcium mobilization, cells were prepared as described but added to agonists diluted in DMEM-F12 medium containing 2 mM EGTA, allowing a final 1 mM EGTA concentration.

Data Analysis
All competition curves, dose-response curves, and IC50 and EC50 values were calculated using nonlinear regression Prism software (GraphPad Software, Inc., San Diego, CA). For all data sets, the logarithm of the SE calculated for IC50 and EC50 values was always smaller than 0.2. Linear regressions and statistical analysis were performed using the same software.


    ACKNOWLEDGMENTS
 


    FOOTNOTES
 
This work was supported by an "Action Concertée de Recherche" from the "Communauté Française de Belgique," by Fonds de la Recherche Scientifique Médicale Contracts 3.4507.98 and 3.4504.99, and by an Interuniversity Pole of Attraction, Prime Minister Office, Belgium.

Abbreviations: [Ca2+]i, Intracellular calcium concentration; CHO, Chinese hamster ovary; GPCR, G protein-coupled receptor; IC2 or IC3, second or third intracellular loop; PACAP, pituitary adenylate cyclase-activating polypeptide; TM, transmembrane.

Received for publication August 29, 2001. Accepted for publication January 4, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Gomariz RP, Martinez C, Abad C, Leceta J, Delgado M 2001 Immunology of VIP: a review and therapeutical perspectives. Curr Pharm Des 7:89–111[CrossRef][Medline]
  2. Harmar AJ, Arimura A, Gozes I, Journot L, Laburthe M, Pisegna JR, Rawlings SR, Robberecht P, Said SI, Sreedharan SP, Wank SA, Waschek JA 1998 International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol Rev 50:265–270[Abstract/Free Full Text]
  3. Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A, Vaudry H 2000 Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Rev 52:269–324[Abstract/Free Full Text]
  4. Sreedharan SP, Patel DR, Xia M, Ichikawa S, Goetzl EJ 1994 Human vasoactive intestinal peptide 1 receptors expressed by stable transfectants couple to two distinct signaling pathways. Biochem Biophys Res Commun 203:141–148[CrossRef][Medline]
  5. Xia M, Sreedharan SP, Bolin DR, Gaufo GO, Goetzl EJ 1997 Novel cyclic peptide agonist of high potency and selectivity for the type II vasoactive intestinal peptide receptor. J Pharmacol Exp Ther 281:629–633[Abstract/Free Full Text]
  6. Zhang GH, Helmke RJ, Martinez JR 1997 Characterization of Ca2+ mobilization in the human submandibular duct cell line A253. Proc Soc Exp Biol Med 216:117–124[Abstract]
  7. Rawlings SR, Piuz I, Schlegel W, Bockaert J, Journot L 1995 Differential expression of pituitary adenylate cyclase-activating polypeptide/vasoactive intestinal polypeptide receptor subtypes in clonal pituitary somatotrophs and gonadotrophs. Endocrinology 136:2088–2098[Abstract]
  8. Ransjo M, Lie A, Mukohyama H, Lundberg P, Lerner UH 2000 Microisolated mouse osteoclasts express VIP-1 and PACAP receptors. Biochem Biophys Res Commun 274:400–404[CrossRef][Medline]
  9. Van Rampelbergh J, Poloczek P, Francoys I, Delporte C, Winand J, Robberecht P, Waelbroeck M 1997 The pituitary adenylate cyclase activating polypeptide (PACAP I) and VIP (PACAP II VIP1) receptors stimulate inositol phosphate synthesis in transfected CHO cells through interaction with different G proteins. Biochim Biophys Acta 1357:249–255[Medline]
  10. MacKenzie CJ, Lutz EM, Johnson MS, Robertson DN, Holland PJ, Mitchell R 2001 Mechanisms of phospholipase C activation by the vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating polypeptide type 2 receptor. Endocrinology 142:1209–1217[Abstract/Free Full Text]
  11. Langer I, Perret J, Vertongen P, Waelbroeck M, Robberecht P 2001 Vasoactive intestinal peptide (VIP) stimulates [Ca(2+)](i) and cyclic AMP in CHO cells expressing G{alpha}16. Cell Calcium 30:229–234[CrossRef][Medline]
  12. Offermanns S, Simon MI 1995 G{alpha} 15 and G{alpha} 16 couple a wide variety of receptors to phospholipase C. J Biol Chem 270:15175–15180[Abstract/Free Full Text]
  13. Iredale PA, Hill SJ 1993 Increases in intracellular calcium via activation of an endogenous P2-purinoceptor in cultured CHO-K1 cells. Br J Pharmacol 110:1305–1310[Medline]
  14. Kostenis E, Conklin BR, Wess J 1997 Molecular basis of receptor/G protein coupling selectivity studied by coexpression of wild type and mutant m2 muscarinic receptors with mutant G{alpha}(q) subunits. Biochemistry 36:1487–1495[CrossRef][Medline]
  15. Conklin BR, Herzmark P, Ishida S, Voyno-Yasenetskaya TA, Sun Y, Farfel Z, Bourne HR 1996 Carboxyl-terminal mutations of Gq{alpha} and Gs{alpha} that alter the fidelity of receptor activation. Mol Pharmacol 50:885–890[Abstract]
  16. Lambright DG, Sondek J, Bohm A, Skiba NP, Hamm HE, Sigler PB 1996 The 2.0 A crystal structure of a heterotrimeric G protein. Nature 379:311–319[CrossRef][Medline]
  17. Burstein ES, Spalding TA, Brann MR 1996 Amino acid side chains that define muscarinic receptor/G-protein coupling. Studies of the third intracellular loop. J Biol Chem 271:2882–2885[Abstract/Free Full Text]
  18. Kostenis E, Gomeza J, Lerche C, Wess J 1997 Genetic analysis of receptor-G{alpha}q coupling selectivity. J Biol Chem 272:23675–23681[Abstract/Free Full Text]
  19. Olah ME 1997 Identification of A2a adenosine receptor domains involved in selective coupling to Gs. Analysis of chimeric A1/A2a adenosine receptors. J Biol Chem 272:337–344[Abstract/Free Full Text]
  20. Wess J 1997 G-protein-coupled receptors: molecular mechanisms involved in receptor activation and selectivity of G-protein recognition. FASEB J 11:346–354[Abstract]
  21. Kobilka BK, MacGregor C, Daniel K, Kobilka TS, Caron MG, Lefkowitz RJ 1987 Functional activity and regulation of human ß2-adrenergic receptors expressed in Xenopus oocytes. J Biol Chem 262:15796–15802[Abstract/Free Full Text]
  22. Cypess AM, Unson CG, Wu CR, Sakmar TP 1999 Two cytoplasmic loops of the glucagon receptor are required to elevate cAMP or intracellular calcium. J Biol Chem 274:19455–19464[Abstract/Free Full Text]
  23. Burstein ES, Spalding TA, Brann MR 1998 Structure/function relationships of a G-protein coupling pocket formed by the third intracellular loop of the m5 muscarinic receptor. Biochemistry 37:4052–4058[CrossRef][Medline]
  24. Burstein ES, Spalding TA, Brann MR 1998 The second intracellular loop of the m5 muscarinic receptor is the switch which enables G-protein coupling. J Biol Chem 273:24322–24327[Abstract/Free Full Text]
  25. Farrens DL, Altenbach C, Yang K, Hubbell WL, Khorana HG 1996 Requirement of rigid-body motion of transmembrane helices for light activation of rhodopsin. Science 274:768–770[Abstract/Free Full Text]
  26. Bukusoglu G, Jenness DD 1996 Agonist-specific conformational changes in the yeast {alpha}-factor pheromone receptor. Mol Cell Biol 16:4818–4823[Abstract]
  27. Conchon S, Barrault MB, Miserey S, Corvol P, Clauser E 1997 The C-terminal third intracellular loop of the rat AT1A angiotensin receptor plays a key role in G protein coupling specificity and transduction of the mitogenic signal. J Biol Chem 272:25566–25572[Abstract/Free Full Text]
  28. Sheikh SP, Vilardarga JP, Baranski TJ, Lichtarge O, Iiri T, Meng EC, Nissenson RA, Bourne HR 1999 Similar structures and shared switch mechanisms of the ß2-adrenoceptor and the parathyroid hormone receptor. Zn(II) bridges between helices III and VI block activation. J Biol Chem 274:17033–17041[Abstract/Free Full Text]
  29. Iida-Klein A, Guo J, Takemura M, Drake MT, Potts Jr JT, Abou-Samra A, Bringhurst FR, Segre GV 1997 Mutations in the second cytoplasmic loop of the rat parathyroid hormone (PTH)/PTH-related protein receptor result in selective loss of PTH-stimulated phospholipase C activity. J Biol Chem 272:6882–6889[Abstract/Free Full Text]
  30. Takhar S, Gyomorey S, Su RC, Mathi SK, Li X, Wheeler MB 1996 The third cytoplasmic domain of the GLP-1[7–36 amide] receptor is required for coupling to the adenylyl cyclase system. Endocrinology 137:2175–2178[Abstract]
  31. Hallbrink M, Holmqvist T, Olsson M, Ostenson CG, Efendic S, Langel U 2001 Different domains in the third intracellular loop of the GLP-1 receptor are responsible for G{alpha}(s) and G{alpha}(i)/G{alpha}(o) activation. Biochim Biophys Acta 1546:79–86[CrossRef][Medline]
  32. Juarranz MG, Van Rampelbergh J, Gourlet P, De Neef P, Cnudde J, Robberecht P, Waelbroeck M 1999 Different vasoactive intestinal polypeptide receptor domains are involved in the selective recognition of two VPAC(2)-selective ligands. Mol Pharmacol 56:1280–1287[Abstract/Free Full Text]
  33. Vertongen P, Solano RM, Juarranz MG, Perret J, Waelbroeck M, Robberecht P 2001 Proline residue 280 in the second extracellular loop (EC2) of the VPAC(2) receptor is essential for the receptor structure(2). Peptides 22:1363–1370[CrossRef][Medline]
  34. Solano RM, Langer I, Perret J, Vertongen P, Juarranz MG, Robberecht P, Waelbroeck M 2001 Two basic residues of the h-VPAC1 receptor second transmembrane helix are essential for ligand binding and signal transduction. J Biol Chem 276:1084–1088[Abstract/Free Full Text]
  35. Detheux M, Standker L, Vakili J, Munch J, Forssmann U, Adermann K, Pohlmann S, Vassart G, Kirchhoff F, Parmentier M, Forssmann WG 192 2000 Natural proteolytic processing of hemofiltrate CC chemokine 1 generates a potent CC chemokine receptor (CCR)1 and CCR5 agonist with anti-HIV properties. J Exp Med 192:1501–1508[Abstract/Free Full Text]
  36. Brini M, Marsault R, Bastianutto C, Alvarez J, Pozzan T, Rizzuto R 1995 Transfected aequorin in the measurement of cytosolic Ca2+ concentration ([Ca2+]c). A critical evaluation. J Biol Chem 270:9896–9903[Abstract/Free Full Text]
  37. Stables J, Green A, Marshall F, Fraser N, Knight E, Sautel M, Milligan G, Lee M, Rees S 1997 A bioluminescent assay for agonist activity at potentially any G-protein-coupled receptor. Anal Biochem 252:115–126[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. Langlet, I. Langer, P. Vertongen, N. Gaspard, J.-M. Vanderwinden, and P. Robberecht
Contribution of the Carboxyl Terminus of the VPAC1 Receptor to Agonist-induced Receptor Phosphorylation, Internalization, and Recycling
J. Biol. Chem., July 29, 2005; 280(30): 28034 - 28043.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
I. Langer, C. Langlet, and P. Robberecht
Effect of inactivating mutations on phosphorylation and internalization of the human VPAC2 receptor
J. Mol. Endocrinol., April 1, 2005; 34(2): 405 - 414.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. Yin, S. Gavi, H.-y. Wang, and C. C. Malbon
Probing Receptor Structure/Function with Chimeric G-Protein-Coupled Receptors
Mol. Pharmacol., June 1, 2004; 65(6): 1323 - 1332.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Langer, I.
Right arrow Articles by Robberecht, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Langer, I.
Right arrow Articles by Robberecht, P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals