help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitney, K. D.
Right arrow Articles by Kliewer, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitney, K. D.
Right arrow Articles by Kliewer, S. A.
Molecular Endocrinology 16 (6): 1378-1385
Copyright © 2002 by The Endocrine Society

Regulation of Cholesterol Homeostasis by the Liver X Receptors in the Central Nervous System

Karl D. Whitney, Michael A. Watson, Jon L. Collins, William G. Benson, Tammy M. Stone, Mary Jo Numerick, Timothy K. Tippin, Joan G. Wilson, Deborah A. Winegar and Steven A. Kliewer

GlaxoSmithKline Research and Development, Research Triangle Park, North Carolina 27709

Address all correspondence and requests for reprints to: Dr. Steve Kliewer, Department of Molecular Biology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75390. E-mail: skliewer{at}hamon.swmed.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The nuclear oxysterol receptors liver X receptor-{alpha} [LXR{alpha} (NR1H3)] and LXRß (NR1H2) coordinately regulate genes involved in cholesterol homeostasis. Although both LXR subtypes are expressed in the brain, their roles in this tissue remain largely unexplored. In this report, we show that LXR agonists have marked effects on gene expression in murine brain tissue both in vitro and in vivo. In primary astrocyte cultures, LXR agonists regulated several established LXR target genes, including ATP binding cassette transporter A1, and enhanced cholesterol efflux. In contrast, little or no effect on gene expression or cholesterol efflux was detected in primary neuronal cultures. Treatment of mice with a selective LXR agonist resulted in the induction of several LXR target genes related to cholesterol homeostasis in the cerebellum and hippocampus. These data provide the first evidence that the LXRs regulate cholesterol homeostasis in the central nervous system. Because dysregulation of cholesterol balance is implicated in central nervous system diseases such as Alzheimer’s and Niemann-Pick disease, pharmacological manipulation of the LXRs may prove beneficial in the treatment of these disorders.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CHOLESTEROL IS AN essential structural constituent of cellular membranes and also serves as a precursor for steroid hormones and bile acids. However, the accumulation of excess cholesterol can result in diseases such as atherosclerosis and gallstone formation. Thus, an appropriate balance must be maintained between de novo biosynthesis and dietary ingestion of cholesterol and its elimination from the body. Recently, the nuclear oxysterol receptors, liver X receptor (LXR){alpha} and LXRß, have been shown to have critical roles in the regulation of cholesterol balance (1, 2). The LXRs are expressed in most tissues (3, 4, 5, 6) and are activated by various naturally occurring cholesterol derivatives including 24(S),25-epoxycholesterol, 22(R)-hydroxycholesterol, and 24(S)-hydroxycholesterol (7, 8, 9, 10). The LXRs regulate the expression of target genes by binding to short stretches of DNA, termed LXR-response elements (LXREs), as heterodimers with the 9-cis-retinoic acid receptors (RXRs) (3, 4, 5, 6). During the past several years, LXREs have been identified in the regulatory regions of a number of genes involved in cholesterol homeostasis including CYP7A1 (9, 11), which catalyzes the first and rate-limiting step in bile acid biosynthesis, cholesterol ester transport protein (12), the transcription factor SREBP-1c (13, 14), apolipoprotein (apo) E (15), and the LXR{alpha} gene itself (16, 17). LXREs have also been identified in the genes encoding the ATP binding cassette transporters (ABC) A1 and G1 (15, 18, 19, 20, 21, 22), which mediate the efflux of phospholipids and cholesterol from macrophages, intestinal enterocytes, and other cell types. Thus, the LXR subtypes are important components of a complex regulatory system that senses cholesterol levels and modifies gene expression accordingly.

Although the central nervous system (CNS) accounts for less than 10% of total body mass, it contains approximately a quarter of all the unesterified cholesterol present in the body (23). Virtually all of the cholesterol present in the brain is derived from in situ biosynthesis. The conversion of cholesterol to the LXR ligand 24(S)-hydroxycholesterol, which can cross the blood brain barrier and enter the general circulation, represents an important mechanism for cholesterol flux out of the CNS (24, 25, 26). Importantly, the dysregulation of cholesterol balance in the brain may be related to the onset of neurological disease (23). Cholesterol turnover across the brain is increased in neurodegenerative disorders such as Alzheimer’s disease (AD) and Niemann-Pick type C disease (27, 28). Moreover, there is clinical evidence that patients with elevated cholesterol levels have increased susceptibility to AD (29, 30), and, conversely, that treatment with the statin class of cholesterol-lowering drugs reduces the incidence of AD (31, 32). Finally, the E2 and E4 isoforms of apoE, which transports cholesterol throughout the body, have been genetically linked to either a decreased or increased risk of AD, respectively (33, 34, 35). Thus, understanding the mechanisms regulating cholesterol balance in the brain may provide important insights into the etiology and treatment of neurodegenerative disorders.

Both LXR subtypes are expressed in the brain. LXRß, in particular, is broadly expressed in the developing and adult rodent brain (36). Interestingly, the LXR agonists 22(R)-hydroxycholesterol and 5-tetradecyloxy-2-furancarboxylic acid induce neuronal differentiation as measured by neurite outgrowth in rat pheochromocytoma cells (37). However, the functions of the LXR subtypes in brain have remained largely unexplored. In this report, we have used potent, synthetic LXR agonists to investigate the role of these nuclear receptors in cholesterol homeostasis in the CNS.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
As a first step in analyzing the role of the LXR subtypes in CNS, we compared their expression levels in hippocampus, cerebellum, and primary cultures of murine glia or neurons to those found in liver. Total RNA was prepared from tissues and cultures obtained from C57 Bl/6 mice and real time quantitative (RTQ)-PCR was used to profile the expression levels of LXR{alpha} and LXRß. LXRß was expressed more abundantly in each of the CNS tissues/cells than in liver (Table 1Go). By contrast, LXR{alpha} was expressed at lower, more variable levels in CNS tissue and cells than in liver (Table 1Go). Notably, cultured neurons expressed very low levels of LXR{alpha}. The LXR target genes ABCA1, ABCG1, and SREBP-1 were detected in each of the tissues/cultures examined (Table 1Go). ABCG1 is implicated in cholesterol transport (38), and its high basal expression in the brain suggests that it may have an important role in cholesterol homeostasis in this tissue. Overall, these results show that LXR{alpha}, LXRß, and several of their target genes are expressed in murine CNS tissue.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of LXR and LXR Target Gene Expression in Various Tissues and Cell Cultures

 
The expression of LXR{alpha} and LXRß in the CNS was also examined by in situ hybridization using probes specific for each receptor subtype. Serial coronal sections were prepared from mouse brain and mounted so that each slide contained forebrain, diencephalon, midbrain, and hindbrain with adjacent cortical and/or cerebellar regions. LXR{alpha} mRNA was detected in both glial cells and neurons in most subcortical regions but was generally absent from the cortex (Fig. 1Go, upper panel; and data not shown). In agreement with a previous study (36), LXRß was widely expressed throughout the brain, where it was detected in both glial cells and neurons (Fig. 1Go, middle panel; and data not shown). Consistent with the RTQ-PCR data (Table 1Go), LXRß appeared to be more highly expressed in the brain than LXR{alpha} (Fig. 1Go, compare upper and middle panels; and data not shown).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 1. Localization of LXR Subtypes in the Medial Thalamic Nucleus by in Situ Hybridization

Expression of LXR{alpha} (black silver grains; top panel) was observed in both glial cells (smaller densely stained nuclei) and neurons (large, less densely stained nuclei with prominent nucleoli). LXRß expression was also detected in glial cells and neurons (middle panel). Other than occasional background silver grains, the sense probe showed no positive signal in either cell type (bottom panel).

 
We next examined whether the LXRs regulate cholesterol efflux in cells derived from the CNS. Efflux of [3H]cholesterol was examined in pure primary cultures of glial or neuronal cells as well as in mixed glial-neuronal cultures. Cultured cells were treated with the potent, selective LXR agonist T0901317 (14), the RXR agonist LG100268 (39), or mixtures of these compounds. As shown in Fig. 2Go, treatment with either T0901317 or LG100268 approximately doubled cholesterol efflux from cultured astrocytes. Efflux after combined treatment with the LXR and RXR agonists was not substantially greater than treatment with either agonist alone. Unlike primary macrophages or differentiated THP-1 cells, the astrocytes did not require addition of an exogenous cholesterol acceptor to detect either basal or drug-induced cholesterol efflux. This may reflect that the cholesterol acceptor proteins apoE and apoA1 are both abundantly expressed in cultured astrocytes (data not shown). In contrast to its effects in astrocytes, T0901317 did not affect cholesterol efflux from pure neuronal cultures either in the absence (Fig. 2Go) or presence (data not shown) of added apoA1. As expected, an increase in cholesterol efflux was detected in mixed glial-neuronal cultures treated with the LXR and RXR agonists (Fig. 2Go). Thus, the LXR agonist had a much more pronounced effect on gene expression in glial cells than in neurons.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. LXR and RXR Agonist Induce Cholesterol Efflux from Cultured Glial Cells

Primary glial or neuronal cells or mixed populations of cells were incubated with [3H]cholesterol for 24 h to allow intracellular equilibration and then challenged with 1 µM of the indicated drugs for 48 h. Radioactivity released into the culture media during the final 24 h was used as a measure of cholesterol efflux from the cells. Efflux data are expressed as the percent of the total [3H]cholesterol present in the culture media. Data points were performed in triplicate. Similar results were obtained in at least two separate experiments. *, P < 0.05; **, P < 0.01 by t test relative to the vehicle group for each culture condition.

 
Total RNA was prepared from the neuronal and glial cultures and used to profile expression patterns of the LXR target genes ABCA1, ABCG1, SREBP-1, and apoE. ABCA1, ABCG1, and SREBP-1 were up-regulated in response to the LXR agonist (Fig. 3Go), with more robust induction observed in astrocytes (black bars) than in neurons (white bars). By contrast, we observed no regulation of apoE in either neurons or glial cells (data not shown). In agreement with the efflux results (Fig. 2Go), gene regulation in astrocytes was no greater in cultures cotreated with T0901317 and LG100268 than with the LXR agonist alone (Fig. 3Go). The relatively weak induction of LXR target gene expression in neurons is consistent with the lack of drug-induced cholesterol efflux and may reflect the relative paucity of LXR{alpha} in these cells relative to cultured glia.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Regulation of LXR Target Gene Expression Changes in Cultured Glial and Neuronal Cells

Total RNA prepared from cultures treated as described in Fig. 1Go was used to profile the expression of ABCA1, ABCG1, and SREBP-1. Expression levels for each gene in neurons (white bars) and astrocytes (black bars) were determined by RTQ-PCR and normalized to the vehicle-treated group. Similar results were obtained in at least two separate experiments.

 
By some estimates, at least 90% of the brain is composed of glia, many of them astrocytes (40). That LXR activation influences cholesterol efflux from this important and prevalent cell type in vitro suggests that a similar and physiologically relevant regulation of cholesterol flux might occur in the CNS. To investigate whether LXR regulates genes involved in cholesterol flux in vivo, C57 Bl/6 mice were orally dosed for 3 or 7 d with T0901317, and their hippocampi and cerebella were removed for gene expression studies. Pharmacokinetic studies revealed that T0901317 was present in brain homogenates at concentrations of approximately 8 µM (data not shown), which is well above the EC50 value for activation of both LXR subtypes (14). Expression of ABCA1 and SREBP-1 was significantly increased by drug treatment in both brain regions at both time points (Fig. 4Go). ABCG1 expression was significantly increased in the cerebellum at the 3-d time point and in both the hippocampus and the cerebellum at the 7-d time point (Fig. 4Go). ApoE was expressed at high levels in both regions of the brain; however, T0901317 had little or no effect on apoE expression (data not shown). Finally, the expression levels of LXR{alpha}, LXRß, and 24-hydroxylase, which produces the LXR ligand 24(S)-hydroxycholesterol, were not altered in any CNS tissue (data not shown). Together, these data demonstrate that the LXR signaling system is operative in the mouse CNS.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. LXR Agonist Modulates Gene Expression in Mouse CNS

Mice (three per group) were treated by oral gavage for 3 or 7 d with vehicle or T0901317 as indicated. Total RNA was prepared from the hippocampus (white bars) and cerebellum (black bars) and analyzed for gene expression levels using RTQ-PCR. Expression levels for each gene were normalized to the average expression level in the vehicle group. *, P < 0.05; **, P < 0.01; ***, P < 0.001 by t test relative to the vehicle group.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In recent years, great strides have been made in understanding the functions of LXR{alpha} and LXRß in the regulation of cholesterol homeostasis. The LXRs regulate a number of genes involved in the biosynthesis, transport, and excretion of cholesterol and thus are likely to have important implications in human diseases such as hypercholesterolemia and atherosclerosis (2). However, the potential role that the LXRs might play in the CNS has remained largely undefined. The brain is the most cholesterol-rich organ in the body, and dysregulation of cholesterol homeostasis may influence neurological disorders such as AD (29, 30, 31, 32, 41, 42). The brain also produces virtually all of the body’s 24(S)-hydroxycholesterol, a cholesterol metabolite that serves as an efficacious agonist of both LXR subtypes (7, 9, 24). The expression patterns of cholesterol-24-hydroxylase, the enzyme that synthesizes 24(S)-hydroxycholesterol, and LXRß within the CNS are remarkably similar (4, 43). These observations suggest that the LXRs might serve as integral components of a regulatory loop that modulates cholesterol levels and/or cholesterol partitioning in the brain.

Our studies demonstrate that an LXR agonist stimulates the expression of several established LXR target genes, including ABCA1, ABCG1, and SREBP-1, in the cerebellum and hippocampus of mice. Ligand treatment induced the expression of these same target genes and stimulated cholesterol efflux in cultured primary murine astrocytes. Notably, little or no effect was seen with the LXR agonist on either cholesterol efflux or LXR target gene expression in primary neuronal cultures. This may be a consequence of the lower expression levels of LXR{alpha} and LXRß in neurons compared with glia. Our findings are the first to demonstrate an effect of LXR activation on cholesterol metabolism in cells derived from the brain.

There is mounting evidence that cholesterol homeostasis is a key factor in CNS function (23). Cholesterol turnover across the brain is increased in neurodegenerative disorders such as AD and Niemann-Pick type C disease (27, 28), and there is clinical evidence that patients with elevated cholesterol levels have an increased susceptibility to AD (29, 30, 31, 32). Recently, it was demonstrated that secretion of cholesterol complexed to apoE-containing lipoproteins from astroglial cells promotes synapse development in cultured CNS neurons (44). These data are intriguing in light of the finding that the apoE4 isoform is associated with an increased risk of late-onset AD and a poor prognosis for recovery of neurological function after head trauma (34, 35, 45, 46). Thus, drugs that affect cholesterol efflux such as LXR ligands may prove beneficial for the treatment of a range of CNS disorders.

In summary, we have demonstrated that LXR regulates a series of genes involved in cholesterol homeostasis in the CNS both in vitro and in vivo as well as cholesterol efflux from cultured astroglial cells. There is mounting evidence that cholesterol balance has an important impact on the onset and/or progression of various CNS disorders, including AD. Thus, LXR ligands may be useful in the treatment of a range of CNS disorders caused by either trauma or disease.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Tissue Culture
Primary murine neuronal cultures were prepared from C57 Bl/6 mice essentially as previously described (47). Embryonic d 18 fetuses were collected by cesarean section, their brains were removed, and the cerebral cortices were dissected from the rest of the brain. The tissue was rinsed during these steps several times in Ca2+- and Mg2+-free HBSS containing 1 mM HEPES (Life Technologies, Inc., Gaithersburg, MD). After the meninges were removed with forceps, the tissue was minced and incubated for 15 min at 37 C in 0.25% trypsin (Sigma, St. Louis, MO) in HBSS. The tissue was then washed twice in HBSS and twice in neuronal plating media [MEM containing 3 mg/ml glucose, 5% FBS (Life Technologies, Inc.), 5% horse serum (Life Technologies, Inc.), 100 U/ml penicillin/100 µg/ml streptomycin (Irvine Scientific, Santa Ana, CA) and 2 mM glutamine (Irvine Scientific)] to which 10 µg/ml deoxyribonuclease I (Sigma) had been added. The tissue was then triturated and spun at 3000 x g for 10 min. The resulting cell pellet was resuspended in plating media, and trypan blue-excluding surviving cells were counted in a hemacytometer. Cells were plated into six-well plates at 1.35 x 106 cells per well and maintained at 37 C in 5% CO2/95% air in a humidified incubator. The next morning, the plating media from some cultures were carefully withdrawn and replaced with serum-free media [Neurobasal media containing B27 supplement (both from Life Technologies, Inc.), 100 U/ml penicillin/100 µg/ml streptomycin, and 0.5 mM glutamine]. These cells were fed by half-volume exchange with fresh serum-free media on d 3 in culture. Serum-free growth conditions restrict glial outgrowth such that the resulting cultures are more than 95% neuronal. The remaining cells were maintained in the same serum-containing plating media without media exchange to establish cultures composed of neurons and glia in an approximate ratio of 60:40 (47). Cells were used in cholesterol efflux assays starting on culture d 6.

Murine astroglia were obtained from mice 1 d after birth. Mice were decapitated, their brains were removed, and the cerebral cortices were prepared as described above, except that astrocyte plating media was used [DMEM containing 4 mg/ml glucose, 5% FBS and 5% horse serum (Life Technologies, Inc. or Irvine Scientific), 100 U/ml penicillin/100 µg/ml streptomycin, 25 mM HEPES, and 2–4 mM glutamine]. Glia were grown in T75 flasks at a density of approximately two brains per flask. Cells were fed once weekly by complete media exchange in maintenance media (DMEM containing 4.5 mg/ml glucose, 10% FBS, 100 U/ml penecillin/100 µg/ml streptomycin, 25 mM HEPES, and 6 mM glutamine). By visual inspection, these cultures were nearly entirely astroglial with less than 1% contamination with microglia. After 7–14 d in vitro, cells were collected by trypsinization, counted in a hemacytometer, and plated into six-well plates at 50,000–100,000 cells per well in maintenance media. Cholesterol efflux assays were begun after 3 d of growth, at which time the cells were approximately 40% confluent.

In Situ Hybridization
Probes for LXR{alpha} and LXRß (500 and 411 bases long, respectively) were generated by RT-PCR and cloned into the transcription vector pGEM-T (Promega Corp., Madison, WI). After cloning, the vectors were linearized, and radiolabeled antisense transcripts were synthesized using SP6 (LXR{alpha}) and T7 (LXRß) RNA polymerase and [33P]rUTP (800 Ci/mol; Amersham Pharmacia Biotech, Arlington Heights, IL). A sense control probe was generated from the LXR{alpha} probe template by transcribing with T7 polymerase. Four C57 mice were transcardially perfused with 10% normal buffered formalin, embedded in paraffin, and sectioned at 8 µm. Serial coronal sections were mounted so that each slide contained four sections: forebrain, diencephalon, midbrain, and hindbrain with adjacent cortical and/or cerebellar regions. The sections were mounted on plus slides, deparaffinized, rehydrated, and pretreated with 0.2 M HCl for 10 min, and then digested with 10 µg/ml Proteinase K for 20 min and acetylated with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min. After dehydrating and drying, the sections were then prehybridized for 2 h in 50% prehybridization mix (600 mM NaCl, 40 mM Tris, pH 8.0, 10 mM EDTA, 2x Denhardt’s, 0.4% SDS, 20 mM dithiothreitol, 0.5 µg/ml tRNA), and 50% formamide at 55 C. The probe (2 x 106 cpm/section) was mixed with hybridization solution [2x hybridization mix: 20% dextran sulfate in formamide, 1:1 (vol/vol)] and hybridized overnight at 55 C. The following day the sections were washed at 55 C in 5x salt-sodium citrate (SSC) (1x SSC = 150 mM NaCl, 15 mM Na citrate) for 1 h and 0.1x SSC for 30 min, and then digested with ribonuclease A (20 µg/ml) at 37 C for 30 min, washed again in 0.1xSSC at 55 C for 30 min, and dehydrated. After drying, the slides were dipped in Kodak NTB-2 emulsion (Eastman-Kodak, Rochester, NY), exposed for 2–4 wk, developed with Kodak D-19 developer, counterstained with hematoxylin, and then examined by both dark-field and bright-field microscopy.

Cholesterol Efflux Assays
Cholesterol efflux assays were performed as described elsewhere (48) with minor modifications. For astrocytes, the culture media were removed and replaced with 1 ml/well DMEM containing 4.5 mg/ml glucose, 5% FBS, 100 U/ml penecillin/100 µg/ml streptomycin, 25 mM HEPES, and 6 mM glutamine supplemented with 0.5% BSA and 5 µl [1,2-3H(N)]-cholesterol (1 mCi/ml ethanolic stock). Twenty-four hours later, cells were washed once in serum-free DMEM containing glucose, penicillin/streptomycin, HEPES, and glutamine and then incubated for 24 h in the same media supplemented with 0.5% BSA and various drugs or dimethylsulfoxide vehicle. The next day, cells were washed twice in serum-free media and then incubated for a further 24 h in serum-free media supplemented with drugs or dimethylsulfoxide. Human apoA1 was added to some culture dishes to serve as an exogenous cholesterol acceptor molecule. At the end of this incubation, culture media were collected and spun in a microfuge. Adherent cells were washed three times in PBS and extracted for 1 h in 1 ml/well hexane-isopropanol (3:2 vol/vol). Two hundred microliters of the culture media supernatant and 200 µl of the cell extract were counted for tritium in 2 ml Packard Ultima Gold Scint (Packard Bioscience, Meriden, CT). Cholesterol efflux from neurons was examined in much the same way except that cells were always washed and incubated with the neuronal serum-free culturing media described above. On the first day of the efflux experiment, neuronal culture dishes received a half-volume media change with media containing 10 µl [1,2-3H(N)]-cholesterol. In all experiments, control culture dishes received an equal volume of ethanol instead of [1,2-3H(N)]-cholesterol on the first day. These culture dishes were subsequently treated in parallel with [1,2-3H(N)]-cholesterol-loaded culture dishes for purposes of collecting RNA for gene expression studies.

Animal Studies
All procedures performed were in compliance with the Animal Welfare Act and US Department of Agriculture regulations and were approved by the GlaxoSmithKline Institutional Animal Care and Use Committee. Adult male C57 Bl/6 mice were dosed by oral gavage with 50 mg/kg/d of T0901317 (2) or vehicle (0.5% methylcellulose). After 2 or 7 d of treatment, animals were euthanized and their brains were removed. The cerebellum and both hippocampi were dissected and snap frozen in liquid nitrogen for RNA isolation.

Determination of Drug Tissue Concentrations
To determine [3H]cholesterol concentrations, tissues and serum samples were analyzed by HPLC with a radioactivity detector. Briefly, tissues (300 mg) were homogenized in 2 ml 0.25 M HEPES, pH 7.4, containing 1.15% KCl. Aliquots of serum and homogenized tissues were removed for total tritium counting by scintillation and the remainder was shaken for 20 min at room temperature in 3 ml choloroform-methanol (2:1) containing 5 mg/ml butylated hydroxytoluene. Samples were spun in a tabletop centrifuge for 20 min at 2,000 rpm and the organic phase was evaporated under nitrogen. The residue was dissolved in HPLC mobile phase solution (99% hexane, 1% methyl t-butyl ether) and analyzed with a normal-phase HPLC system [Bondclone uPoracil silica column (Phenomenex, Inc., Torrance, CA); gradient elution from 10–75% methyl t-butyl ether in hexane] equipped with a Radiomatic FLO-ONE detector (Packard Bioscience). Peaks corresponding to cholesterol, choleseryl ester, and oxysterols were identified by coelution with known standards.

T0901317 (14) concentrations were measured in brain tissue using HPLC with mass spectrometric detection. Tissue homogenates were homogenized in 2 vol of water. Aliquots of the homogenate were extracted with 4 vol of acetonitrile containing an internal standard. After centrifugation, the supernatant was evaporated to dryness and then dissolved in HPLC mobile phase. T0901317 was eluted from an HPLC column [Hypersil phenyl, 2 x 50 mm, 5 µm (Keystone Scientific, Inc., Bellafonte, PA)] using a mobile phase consisting of 5 mM ammonium acetate (pH 4), methanol, and acetonitrile. T0901317 product ions (M+H = 181 m/z and 141 mass-to-charge ratio, respectively) were measured using a Finnigan TSQ 7000 mass spectrometer (Thermo Finnigan, San Jose, CA) after ionization by atmospheric pressure chemical ionization. Tissue standards were prepared by adding T0901317 to blank tissue homogenates. HPLC with mass spectrometric detection responses was used to construct a peak area ratio (T0901317 peak area/internal standard peak area) vs. tissue homogenate concentration calibration curve. Tissue concentrations were expressed as micromoles/g tissue; approximate tissue concentrations were calculated assuming 1 g of tissue occupies a volume of 1 ml.

RNA Isolation
Total RNA was isolated from tissue and cell culture samples using TRIzol reagent (Life Technologies, Inc.) according to the manufacturer’s protocol. To facilitate recovery of nucleic acid, 100 µg glycogen (Ambion, Inc., Austin, TX) was added. Samples were resuspended in ribonuclease-free water and stored at -70 C.

RTQ-PCR
Total RNA samples were diluted to 100 µg/ml and treated with 40 U/ml RNA-free deoxyribonuclease I (Ambion, Inc.) for 30 min at 37 C followed by inactivation at 75 C for 5 min. Samples were quantitated by spectrophotometry or with the RiboGreen assay (Molecular Probes, Inc., Eugene, OR) and diluted to a concentration of 10 ng/µl. Samples were then assayed in duplicate or triplicate 25-µl reactions using 25 ng RNA/reaction with Perkin-Elmer Corp. chemistry on an ABI Prism 7700 (Perkin-Elmer Corp., Norwalk, CT) according to the manufacturer’s instructions. Gene-specific primers were used at 7.5 or 22.5 pmol/reaction and the gene-specific probe was used at 5 pmol/reaction. Primers and probe were synthesized by Keystone Laboratories (Camarillo, CA). Fold induction values were calculated by subtracting the mean threshold cycle number (Ct) for each treatment group from the mean Ct for the vehicle group and raising 2 to the power of this difference. The following primer/probe sets were used:

Mouse LXR{alpha}:

Forward primer: CTGCACGCCTACGTCTCCA

Reverse primer: CATTAGCATCCGTGGGAACA

Oligonucleotide probe: CAACCACCCCCACGACCCACTG

Mouse LXRß:

Forward primer: AGTTGCCGCGCAGCTG

Reverse primer: GGGCCAGGGCGTGACT

Oligonucleotide probe: AGTGCAACAAACGATCTTTCTCCGACCA

Mouse ABCA1:

Forward primer: AAGGGTTTCTTTGCTCAGATTGTC

Reverse primer: TGCCAAAGGGTGGCACA

Oligonucleotide probe: CCAGCTGTCTTTGTTTGCATTGCCC

Mouse ABCG1:

Forward primer: CCATGAATGCCAGCAGCTACT

Reverse primer: CACTGACACGCACACGGACT

Oligonucleotide probe: TGCCGCAATGACGGAGCCC

Mouse SREPB-1:

Forward primer: ACAGACAAACTGCCCATCCAC

Reverse primer: TCACCACGGCTCTGAGCTG

Oligonucleotide probe: AGCTGGCAGCAAGGCCCTAGGC


    ACKNOWLEDGMENTS
 
We thank Elizabeth J. Beaudet and Kevin M. Hedeen for their assistance in determining pharmacokinetic parameters and Tim Willson for discussions and critical reading of the manuscript.


    FOOTNOTES
 
Abbreviations: ABC, ATP binding cassette transporter; AD, Alzheimer’s disease; apoA1 and apoE, apolipoproteins A1 and E; CNS, central nervous system; LXR, liver X receptor; LXRE, LXR response element; RTQ-PCR, real time quantitative PCR; SSC, salt-sodium citrate.

Received for publication September 4, 2001. Accepted for publication January 22, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Peet DJ, Janowski BA, Mangelsdorf DJ 1998 The LXRs: a new class of oxysterol receptors. Curr Opin Genet Dev 8:571–575[CrossRef][Medline]
  2. Repa JJ, Mangelsdorf DJ 2000 The role of orphan nuclear receptors in the regulation of cholesterol homeostasis. Annu Rev Cell Dev Biol 16:459–481[CrossRef][Medline]
  3. Apfel R, Benbrook D, Lernhardt E, Ortiz MA, Salbert G, Pfahl M 1994 A novel orphan receptor specific for a subset of thyroid hormone-responsive elements and its interaction with the retinoid/thyroid hormone receptor subfamily. Mol Cell Biol 14:7025–7035[Abstract/Free Full Text]
  4. Teboul M, Enmark E, Li Q, Wikstrom AC, Pelto-Huikko M, Gustafsson JA 1995 OR-1, a member of the nuclear receptor superfamily that interacts with the 9-cis-retinoic acid receptor. Proc Natl Acad Sci USA 92:2096–2100[Abstract/Free Full Text]
  5. Song C, Kokontis JM, Hiipakka RA, Liao S 1994 Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone receptors. Proc Natl Acad Sci USA 91:10809–10813[Abstract/Free Full Text]
  6. Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ 1995 LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes Dev 9:1033–1045[Abstract/Free Full Text]
  7. Janowski BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ 1996 An oxysterol signalling pathway mediated by the nuclear receptor LXR{alpha}. Nature 383:728–731[CrossRef][Medline]
  8. Janowski BA, Grogan MJ, Jones SA, Wisely GB, Kliewer SA, Corey EJ, Mangelsdorf DJ 1999 Structural requirements of ligands for the oxysterol liver X receptors LXR{alpha} and LXRß. Proc Natl Acad Sci USA 96:266–271[Abstract/Free Full Text]
  9. Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, Willson TM 1997 Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 272:3137–3140[Abstract/Free Full Text]
  10. Spencer TA, Li D, Russel JS, Collins JL, Bledsoe RK, Consler TG, Moore LB, Galardi CM, McKee DD, Moore JT, Watson MA, Parks DJ, Lambert MH, Willson TM 2001 Pharmacophore analysis of the nuclear oxysterol receptor LXR{alpha}. J Med Chem 44:886–897[CrossRef][Medline]
  11. Peet DJ, Turley SD, Ma W, Janowski BA, Lobacarro JM, Hammer RE, Mangelsdorf DJ 1998 Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR {alpha}. Cell 93:693–704[CrossRef][Medline]
  12. Luo Y, Tall AR 2000 Sterol upregulation of human CETP expression in vitro and in transgenic mice by an LXR element. J Clin Invest 105:513–520[Medline]
  13. Repa JJ, Liang G, Ou J, Bashmakov Y, Lobaccaro JM, Shiomomura I, Shan B, Brown MS, Goldstein JL, Mangelsdorf DJ 2000 Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXR{alpha} and LXRß. Genes Dev 14:2819–2830[Abstract/Free Full Text]
  14. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B 2000 Role of LXRs in control of lipogenesis. Genes Dev 14:2831–2838[Abstract/Free Full Text]
  15. Laffitte BA, Repa JJ, Joseph SB, Wilpitz DC, Kast HR, Mangelsdorf DJ, Tontonoz P 2001 LXRs control lipid-inducible expression of the apolipoprotein E gene in macrophages and adipocytes. Proc Natl Acad Sci USA 98:507–512[Abstract/Free Full Text]
  16. Laffitte BA, Joseph SB, Walczak R, Pei L, Wilpitz DC, Collins JL, Tontonoz P 2001 Autoregulation of the human liver X receptor {alpha} promoter. Mol Cell Biol 21:7558–7568[Abstract/Free Full Text]
  17. Whitney KD, Watson MA, Goodwin B, Galardi CM, Maglich JM, Wilson JG, Willson TM, Collins JL, Kliewer SA 2001 LXR regulation of the LXR-{alpha} gene in human macrophages. J Biol Chem 276:43509–43512[Abstract/Free Full Text]
  18. Costet P, Luo Y, Wang N, Tall AR 2000 Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem 275:28240–28245[Abstract/Free Full Text]
  19. Repa JJ, Turley SD, Lobaccaro JA, Medina J, Li L, Lustig K, Shan B, Heyman RA, Dietschy JM, Mangelsdorf DJ 2000 Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289:1524–1529[Abstract/Free Full Text]
  20. Venkateswaran A, Repa JJ, Lobaccaro JM, Bronson A, Mangelsdorf DJ, Edwards PA 2000 Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols. J Biol Chem 275:14700–14707[Abstract/Free Full Text]
  21. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P 2000 Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR{alpha}. Proc Natl Acad Sci USA 97:12097–12102[Abstract/Free Full Text]
  22. Schwartz K, Lawn RM, Wade DP 2000 ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun 274:794–802[CrossRef][Medline]
  23. Dietschy JM, Turley SD 2001 Cholesterol metabolism in the brain. Curr Opin Lipidol 12:105–112[CrossRef][Medline]
  24. Lutjohann D, Breuer O, Ahlborg G, Nennesmo I, Siden A, Diczfalusy U, Bjorkhem I 1996 Cholesterol homeostasis in human brain: evidence for an age-dependent flux of 24S-hydroxycholesterol from the brain into the circulation. Proc Natl Acad Sci USA 93:9799–9804[Abstract/Free Full Text]
  25. Bjorkhem I, Lutjohann D, Breuer O, Sakinis A, Wennmalm A 1997 Importance of a novel oxidative mechanism for elimination of brain cholesterol. Turnover of cholesterol and 24(S)-hydroxycholesterol in rat brain as measured with 18O2 techniques in vivo and in vitro. J Biol Chem 272:30178–30184[Abstract/Free Full Text]
  26. Bjorkhem I, Lutjohann D, Diczfalusy U, Stahle L, Ahlborg G, Wahren J 1998 Cholesterol homeostasis in human brain: turnover of 24S-hydroxycholesterol and evidence for a cerebral origin of most of this oxysterol in the circulation. J Lipid Res 39:1594–1600[Abstract/Free Full Text]
  27. Xie C, Burns DK, Turley SD, Dietschy JM 2000 Cholesterol is sequestered in the brains of mice with Niemann-Pick type C disease but turnover is increased. J Neuropathol Exp Neurol 59:1106–1117[Medline]
  28. Lutjohann D, Papassotiropoulos A, Bjorkhem I, Locatelli S, Bagli M, Oehring RD, Schlegel U, Jessen F, Rao ML, von Bergmann K, Heun R 2000 Plasma 24S-hydroxycholesterol (cerebrosterol) is increased in Alzheimer and vascular demented patients. J Lipid Res 41:195–198[Abstract/Free Full Text]
  29. Notkola IL, Sulkava R, Pekkanen J, Erkinjuntti T, Ehnholm C, Kivinen P, Tuomilehto J, Nissinen A 1998 Serum total cholesterol, apolipoprotein E {epsilon} 4 allele, and Alzheimer’s disease. Neuroepidemiology 17:14–20[CrossRef][Medline]
  30. Kuo YM, Emmerling MR, Bisgaier CL, Essenburg AD, Lampert HC, Drumm D, Roher AE 1998 Elevated low-density lipoprotein in Alzheimer’s disease correlates with brain aß 1–42 levels. Biochem Biophys Res Commun 252:711–715[CrossRef][Medline]
  31. Wolozin B, Kellman W, Ruosseau P, Celesia GG, Siegel G 2000 Decreased prevalence of Alzheimer disease associated with 3-hydroxy-3-methyglutaryl coenzyme A reductase inhibitors. Arch Neurol 57:1439–1443[Abstract/Free Full Text]
  32. Jick H, Zornberg GL, Jick SS, Seshadri S, Drachman DA 2000 Statins and the risk of dementia. Lancet 356:1627–1631[CrossRef][Medline]
  33. Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesan GS, Roses AD 1993 Apolipoprotein E: high-avidity binding to ß-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc Natl Acad Sci USA 90:1977–1981[Abstract/Free Full Text]
  34. Roses AD, Saunders AM, Alberts MA, Strittmater WJ, Schmechel D, Gorder E, Pericak-Vance MA 1995 Apolipoprotein E E4 allele and risk of dementia. JAMA 273:374–375; discussion 375–376[CrossRef][Medline]
  35. Strittmatter WJ, Roses AD 1996 Apolipoprotein E and Alzheimer’s disease. Annu Rev Neurosci 19:53–77[CrossRef][Medline]
  36. Kainu T, Kononen J, Enmark E, Gustafsson JA, Pelto-Huikko M 1996 Localization and ontogeny of the orphan receptor OR-1 in the rat brain. J Mol Neurosci 7:29–39[CrossRef][Medline]
  37. Schmidt A, Vogel R, Holloway MK, Rutledge SJ, Friedman O, Yang Z, Rodan GA, Friedman E 1999 Transcription control and neuronal differentiation by agents that activate the LXR nuclear receptor family. Mol Cell Endocrinol 155:51–60[CrossRef][Medline]
  38. Klucken J, Buchler C, Orso E, Kaminski WE, Porsch-Ozcurumez M, Liebisch G, Kapinski M, Diederich W, Drobnik J, Dean M, Allikmets R, Schmitz G 2000 ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc Natl Acad Sci USA 97:817–822[Abstract/Free Full Text]
  39. Boehm MF, Zhang L, Zhi L, McClurg MR, Berger E, Wagoner M, Mais DE, Suto CM, Davies JA, Heyman RA, Nadzan AM 1995 Design and synthesis of potent retinoid X receptor selective ligands that induce apoptosis in leukemia cells. J Med Chem 38:3146–3155[CrossRef][Medline]
  40. Kandel ER, Schwartz JH, Jessell TM 2000 Principles of neural science. New York: McGraw-Hill Professional Publishing
  41. Jarvik GP, Wijsman EM, Kukull WA, Schellenberg GD, Yu C, Larson EB 1995 Interactions of apolipoprotein E genotype, total cholesterol level, age, and sex in prediction of Alzheimer’s disease: a case-control study. Neurology 45:1092–1096[Abstract]
  42. Liu HC, Hong CJ, Wang SJ, Fuh JL, Wang PN, Shyu HY, Teng EL 1999 ApoE genotype in relation to AD and cholesterol: a study of 2,326 Chinese adults. Neurology 53:962–966[Abstract/Free Full Text]
  43. Lund EG, Guileyardo JM, Russell DW 1999 cDNA cloning of cholesterol 24-hydroxylase, a mediator of cholesterol homeostasis in the brain. Proc Natl Acad Sci USA 96:7238–7243[Abstract/Free Full Text]
  44. Mauch DH, Nagler K, Schumacher S, Goritz C, Muller EC, Otto A, Pfrieger FW 2001 CNS synaptogenesis promoted by glia-derived cholesterol. Science 294:1354–1357[Abstract/Free Full Text]
  45. Kutner KC, Erlanger DM, Tsai J, Jordan B, Relkin NR 2000 Lower cognitive performance of older football players possessing apolipoprotein E {epsilon}4. Neurosurgery 47:651–657; discussion 657–658[CrossRef][Medline]
  46. Jordan BD, Relkin NR, Ravdin LD, Jacobs AR, Bennett A, Gandy S 1997 Apolipoprotein E {epsilon}4 associated with chronic traumatic brain injury in boxing. JAMA 278:136–140[Abstract]
  47. Whitney KD, McNamara JO 2000 GluR3 Autoantibodies destroy neural cells in a complement-dependent manner modulated by complement regulatory proteins. J Neurosci 20:7307–7316[Abstract/Free Full Text]
  48. Oliver Jr WR, Shenk JL, Snaith MR, Russell CS, Plunket KD, Bodkin NL, Lewis MC, Winegar DA, Sznaidman ML, Lambert MH, Xu HE, Sternbach DD, Kliewer SA, Hansen BC, Willson TM 2001 A selective peroxisome proliferator-activated receptor {delta} agonist promotes reverse cholesterol transport. Proc Natl Acad Sci USA 98:5306–5311[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Lipid Res.Home page
I. Zanotti, F. Poti, M. Pedrelli, E. Favari, E. Moleri, G. Franceschini, L. Calabresi, and F. Bernini
The LXR agonist T0901317 promotes the reverse cholesterol transport from macrophages by increasing plasma efflux potential
J. Lipid Res., May 1, 2008; 49(5): 954 - 960.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. Abildayeva, J. F. P. Berbee, A. Blokland, P. J. Jansen, F. J. Hoek, O. Meijer, D. Lutjohann, T. Gautier, T. Pillot, J. De Vente, et al.
Human apolipoprotein C-I expression in mice impairs learning and memory functions
J. Lipid Res., April 1, 2008; 49(4): 856 - 869.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
B. Liu, H. Li, J. J. Repa, S. D. Turley, and J. M. Dietschy
Genetic variations and treatments that affect the lifespan of the NPC1 mouse
J. Lipid Res., March 1, 2008; 49(3): 663 - 669.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. T. Tarr and P. A. Edwards
ABCG1 and ABCG4 are coexpressed in neurons and astrocytes of the CNS and regulate cholesterol homeostasis through SREBP-2
J. Lipid Res., January 1, 2008; 49(1): 169 - 182.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. J. Repa, H. Li, T. C. Frank-Cannon, M. A. Valasek, S. D. Turley, M. G. Tansey, and J. M. Dietschy
Liver X Receptor Activation Enhances Cholesterol Loss from the Brain, Decreases Neuroinflammation, and Increases Survival of the NPC1 Mouse
J. Neurosci., December 26, 2007; 27(52): 14470 - 14480.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Zelcer, N. Khanlou, R. Clare, Q. Jiang, E. G. Reed-Geaghan, G. E. Landreth, H. V. Vinters, and P. Tontonoz
Attenuation of neuroinflammation and Alzheimer's disease pathology by liver x receptors
PNAS, June 19, 2007; 104(25): 10601 - 10606.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Boadu, H. Y. Choi, D. W. K. Lee, E. I. Waddington, T. Chan, B. Asztalos, J. E. Vance, A. Chan, G. Castro, and G. A. Francis
Correction of Apolipoprotein A-I-mediated Lipid Efflux and High Density Lipoprotein Particle Formation in Human Niemann-Pick Type C Disease Fibroblasts
J. Biol. Chem., December 1, 2006; 281(48): 37081 - 37090.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. J. Langmade, S. E. Gale, A. Frolov, I. Mohri, K. Suzuki, S. H. Mellon, S. U. Walkley, D. F. Covey, J. E. Schaffer, and D. S. Ory
Pregnane X receptor (PXR) activation: A mechanism for neuroprotection in a mouse model of Niemann-Pick C disease
PNAS, September 12, 2006; 103(37): 13807 - 13812.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Abildayeva, P. J. Jansen, V. Hirsch-Reinshagen, V. W. Bloks, A. H. F. Bakker, F. C. S. Ramaekers, J. de Vente, A. K. Groen, C. L. Wellington,, F. Kuipers, et al.
24(S)-Hydroxycholesterol Participates in a Liver X Receptor-controlled Pathway in Astrocytes That Regulates Apolipoprotein E-mediated Cholesterol Efflux
J. Biol. Chem., May 5, 2006; 281(18): 12799 - 12808.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Ohyama, S. Meaney, M. Heverin, L. Ekstrom, A. Brafman, M. Shafir, U. Andersson, M. Olin, G. Eggertsen, U. Diczfalusy, et al.
Studies on the Transcriptional Regulation of Cholesterol 24-Hydroxylase (CYP46A1): MARKED INSENSITIVITY TOWARD DIFFERENT REGULATORY AXES
J. Biol. Chem., February 17, 2006; 281(7): 3810 - 3820.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Hirsch-Reinshagen, L. F. Maia, B. L. Burgess, J.-F. Blain, K. E. Naus, S. A. McIsaac, P. F. Parkinson, J. Y. Chan, G. H. Tansley, M. R. Hayden, et al.
The Absence of ABCA1 Decreases Soluble ApoE Levels but Does Not Diminish Amyloid Deposition in Two Murine Models of Alzheimer Disease
J. Biol. Chem., December 30, 2005; 280(52): 43243 - 43256.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. Heverin, S. Meaney, D. Lutjohann, U. Diczfalusy, J. Wahren, and I. Bjorkhem
Crossing the barrier: net flux of 27-hydroxycholesterol into the human brain
J. Lipid Res., May 1, 2005; 46(5): 1047 - 1052.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Andersson, N. Gustafsson, M. Warner, and J.-A. Gustafsson
Inactivation of liver X receptor {beta} leads to adult-onset motor neuron degeneration in male mice
PNAS, March 8, 2005; 102(10): 3857 - 3862.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. P. Koldamova, I. M. Lefterov, M. Staufenbiel, D. Wolfe, S. Huang, J. C. Glorioso, M. Walter, M. G. Roth, and J. S. Lazo
The Liver X Receptor Ligand T0901317 Decreases Amyloid {beta} Production in Vitro and in a Mouse Model of Alzheimer's Disease
J. Biol. Chem., February 11, 2005; 280(6): 4079 - 4088.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
K. Pardee, J. Reinking, and H. Krause
Nuclear Hormone Receptors, Metabolism, and Aging: What Goes Around Comes Around
Sci. Aging Knowl. Environ., November 24, 2004; 2004(47): re8 - re8.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Nakamura, M. A. Kennedy, A. Baldan, D. D. Bojanic, K. Lyons, and P. A. Edwards
Expression and Regulation of Multiple Murine ATP-binding Cassette Transporter G1 mRNAs/Isoforms That Stimulate Cellular Cholesterol Efflux to High Density Lipoprotein
J. Biol. Chem., October 29, 2004; 279(44): 45980 - 45989.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
I. Bjorkhem and S. Meaney
Brain Cholesterol: Long Secret Life Behind a Barrier
Arterioscler. Thromb. Vasc. Biol., May 1, 2004; 24(5): 806 - 815.
[Abstract] [Full Text]


Home page
J. Lipid Res.Home page
M. Heverin, N. Bogdanovic, D. Lutjohann, T. Bayer, I. Pikuleva, L. Bretillon, U. Diczfalusy, B. Winblad, and I. Bjorkhem
Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer's disease
J. Lipid Res., January 1, 2004; 45(1): 186 - 193.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. Borud, G. Mellgren, J. Lund, and M. Bakke
Cloning and Characterization of a Novel Zinc Finger Protein that Modulates the Transcriptional Activity of Nuclear Receptors
Mol. Endocrinol., November 1, 2003; 17(11): 2303 - 2319.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Sun, J. Yao, T.-W. Kim, and A. R. Tall
Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid {beta} Peptide Secretion
J. Biol. Chem., July 18, 2003; 278(30): 27688 - 27694.
[Abstract] [Full Text] [PDF]