| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
GlaxoSmithKline Research and Development, Research Triangle Park, North Carolina 27709
Address all correspondence and requests for reprints to: Dr. Steve Kliewer, Department of Molecular Biology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75390. E-mail: skliewer{at}hamon.swmed.edu.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
[LXR (NR1H3)] and LXRß (NR1H2) coordinately regulate genes involved in cholesterol homeostasis. Although both LXR subtypes are expressed in the brain, their roles in this tissue remain largely unexplored. In this report, we show that LXR agonists have marked effects on gene expression in murine brain tissue both in vitro and in vivo. In primary astrocyte cultures, LXR agonists regulated several established LXR target genes, including ATP binding cassette transporter A1, and enhanced cholesterol efflux. In contrast, little or no effect on gene expression or cholesterol efflux was detected in primary neuronal cultures. Treatment of mice with a selective LXR agonist resulted in the induction of several LXR target genes related to cholesterol homeostasis in the cerebellum and hippocampus. These data provide the first evidence that the LXRs regulate cholesterol homeostasis in the central nervous system. Because dysregulation of cholesterol balance is implicated in central nervous system diseases such as Alzheimer’s and Niemann-Pick disease, pharmacological manipulation of the LXRs may prove beneficial in the treatment of these disorders. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and LXRß, have been shown to have critical roles in the regulation of cholesterol balance (1, 2). The LXRs are expressed in most tissues (3, 4, 5, 6) and are activated by various naturally occurring cholesterol derivatives including 24(S),25-epoxycholesterol, 22(R)-hydroxycholesterol, and 24(S)-hydroxycholesterol (7, 8, 9, 10). The LXRs regulate the expression of target genes by binding to short stretches of DNA, termed LXR-response elements (LXREs), as heterodimers with the 9-cis-retinoic acid receptors (RXRs) (3, 4, 5, 6). During the past several years, LXREs have been identified in the regulatory regions of a number of genes involved in cholesterol homeostasis including CYP7A1 (9, 11), which catalyzes the first and rate-limiting step in bile acid biosynthesis, cholesterol ester transport protein (12), the transcription factor SREBP-1c (13, 14), apolipoprotein (apo) E (15), and the LXR gene itself (16, 17). LXREs have also been identified in the genes encoding the ATP binding cassette transporters (ABC) A1 and G1 (15, 18, 19, 20, 21, 22), which mediate the efflux of phospholipids and cholesterol from macrophages, intestinal enterocytes, and other cell types. Thus, the LXR subtypes are important components of a complex regulatory system that senses cholesterol levels and modifies gene expression accordingly. Although the central nervous system (CNS) accounts for less than 10% of total body mass, it contains approximately a quarter of all the unesterified cholesterol present in the body (23). Virtually all of the cholesterol present in the brain is derived from in situ biosynthesis. The conversion of cholesterol to the LXR ligand 24(S)-hydroxycholesterol, which can cross the blood brain barrier and enter the general circulation, represents an important mechanism for cholesterol flux out of the CNS (24, 25, 26). Importantly, the dysregulation of cholesterol balance in the brain may be related to the onset of neurological disease (23). Cholesterol turnover across the brain is increased in neurodegenerative disorders such as Alzheimer’s disease (AD) and Niemann-Pick type C disease (27, 28). Moreover, there is clinical evidence that patients with elevated cholesterol levels have increased susceptibility to AD (29, 30), and, conversely, that treatment with the statin class of cholesterol-lowering drugs reduces the incidence of AD (31, 32). Finally, the E2 and E4 isoforms of apoE, which transports cholesterol throughout the body, have been genetically linked to either a decreased or increased risk of AD, respectively (33, 34, 35). Thus, understanding the mechanisms regulating cholesterol balance in the brain may provide important insights into the etiology and treatment of neurodegenerative disorders.
Both LXR subtypes are expressed in the brain. LXRß, in particular, is broadly expressed in the developing and adult rodent brain (36). Interestingly, the LXR agonists 22(R)-hydroxycholesterol and 5-tetradecyloxy-2-furancarboxylic acid induce neuronal differentiation as measured by neurite outgrowth in rat pheochromocytoma cells (37). However, the functions of the LXR subtypes in brain have remained largely unexplored. In this report, we have used potent, synthetic LXR agonists to investigate the role of these nuclear receptors in cholesterol homeostasis in the CNS.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and LXRß. LXRß was expressed more abundantly in each of the CNS tissues/cells than in liver (Table 1
). By contrast, LXR was expressed at lower, more variable levels in CNS tissue and cells than in liver (Table 1). Notably, cultured neurons expressed very low levels of LXR. The LXR target genes ABCA1, ABCG1, and SREBP-1 were detected in each of the tissues/cultures examined (Table 1). ABCG1 is implicated in cholesterol transport (38), and its high basal expression in the brain suggests that it may have an important role in cholesterol homeostasis in this tissue. Overall, these results show that LXR, LXRß, and several of their target genes are expressed in murine CNS tissue.
|
and LXRß in the CNS was also examined by in situ hybridization using probes specific for each receptor subtype. Serial coronal sections were prepared from mouse brain and mounted so that each slide contained forebrain, diencephalon, midbrain, and hindbrain with adjacent cortical and/or cerebellar regions. LXR mRNA was detected in both glial cells and neurons in most subcortical regions but was generally absent from the cortex (Fig. 1, upper panel; and data not shown). In agreement with a previous study (36), LXRß was widely expressed throughout the brain, where it was detected in both glial cells and neurons (Fig. 1, middle panel; and data not shown). Consistent with the RTQ-PCR data (Table 1
), LXRß appeared to be more highly expressed in the brain than LXR (Fig. 1, compare upper and middle panels; and data not shown).
|
, treatment with either T0901317 or LG100268 approximately doubled cholesterol efflux from cultured astrocytes. Efflux after combined treatment with the LXR and RXR agonists was not substantially greater than treatment with either agonist alone. Unlike primary macrophages or differentiated THP-1 cells, the astrocytes did not require addition of an exogenous cholesterol acceptor to detect either basal or drug-induced cholesterol efflux. This may reflect that the cholesterol acceptor proteins apoE and apoA1 are both abundantly expressed in cultured astrocytes (data not shown). In contrast to its effects in astrocytes, T0901317 did not affect cholesterol efflux from pure neuronal cultures either in the absence (Fig. 2) or presence (data not shown) of added apoA1. As expected, an increase in cholesterol efflux was detected in mixed glial-neuronal cultures treated with the LXR and RXR agonists (Fig. 2). Thus, the LXR agonist had a much more pronounced effect on gene expression in glial cells than in neurons.
|
), with more robust induction observed in astrocytes (black bars) than in neurons (white bars). By contrast, we observed no regulation of apoE in either neurons or glial cells (data not shown). In agreement with the efflux results (Fig. 2), gene regulation in astrocytes was no greater in cultures cotreated with T0901317 and LG100268 than with the LXR agonist alone (Fig. 3). The relatively weak induction of LXR target gene expression in neurons is consistent with the lack of drug-induced cholesterol efflux and may reflect the relative paucity of LXR in these cells relative to cultured glia.
|
). ABCG1 expression was significantly increased in the cerebellum at the 3-d time point and in both the hippocampus and the cerebellum at the 7-d time point (Fig. 4). ApoE was expressed at high levels in both regions of the brain; however, T0901317 had little or no effect on apoE expression (data not shown). Finally, the expression levels of LXR, LXRß, and 24-hydroxylase, which produces the LXR ligand 24(S)-hydroxycholesterol, were not altered in any CNS tissue (data not shown). Together, these data demonstrate that the LXR signaling system is operative in the mouse CNS.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
and LXRß in the regulation of cholesterol homeostasis. The LXRs regulate a number of genes involved in the biosynthesis, transport, and excretion of cholesterol and thus are likely to have important implications in human diseases such as hypercholesterolemia and atherosclerosis (2). However, the potential role that the LXRs might play in the CNS has remained largely undefined. The brain is the most cholesterol-rich organ in the body, and dysregulation of cholesterol homeostasis may influence neurological disorders such as AD (29, 30, 31, 32, 41, 42). The brain also produces virtually all of the body’s 24(S)-hydroxycholesterol, a cholesterol metabolite that serves as an efficacious agonist of both LXR subtypes (7, 9, 24). The expression patterns of cholesterol-24-hydroxylase, the enzyme that synthesizes 24(S)-hydroxycholesterol, and LXRß within the CNS are remarkably similar (4, 43). These observations suggest that the LXRs might serve as integral components of a regulatory loop that modulates cholesterol levels and/or cholesterol partitioning in the brain.
Our studies demonstrate that an LXR agonist stimulates the expression of several established LXR target genes, including ABCA1, ABCG1, and SREBP-1, in the cerebellum and hippocampus of mice. Ligand treatment induced the expression of these same target genes and stimulated cholesterol efflux in cultured primary murine astrocytes. Notably, little or no effect was seen with the LXR agonist on either cholesterol efflux or LXR target gene expression in primary neuronal cultures. This may be a consequence of the lower expression levels of LXR and LXRß in neurons compared with glia. Our findings are the first to demonstrate an effect of LXR activation on cholesterol metabolism in cells derived from the brain.
There is mounting evidence that cholesterol homeostasis is a key factor in CNS function (23). Cholesterol turnover across the brain is increased in neurodegenerative disorders such as AD and Niemann-Pick type C disease (27, 28), and there is clinical evidence that patients with elevated cholesterol levels have an increased susceptibility to AD (29, 30, 31, 32). Recently, it was demonstrated that secretion of cholesterol complexed to apoE-containing lipoproteins from astroglial cells promotes synapse development in cultured CNS neurons (44). These data are intriguing in light of the finding that the apoE4 isoform is associated with an increased risk of late-onset AD and a poor prognosis for recovery of neurological function after head trauma (34, 35, 45, 46). Thus, drugs that affect cholesterol efflux such as LXR ligands may prove beneficial for the treatment of a range of CNS disorders.
In summary, we have demonstrated that LXR regulates a series of genes involved in cholesterol homeostasis in the CNS both in vitro and in vivo as well as cholesterol efflux from cultured astroglial cells. There is mounting evidence that cholesterol balance has an important impact on the onset and/or progression of various CNS disorders, including AD. Thus, LXR ligands may be useful in the treatment of a range of CNS disorders caused by either trauma or disease.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Murine astroglia were obtained from mice 1 d after birth. Mice were decapitated, their brains were removed, and the cerebral cortices were prepared as described above, except that astrocyte plating media was used [DMEM containing 4 mg/ml glucose, 5% FBS and 5% horse serum (Life Technologies, Inc. or Irvine Scientific), 100 U/ml penicillin/100 µg/ml streptomycin, 25 mM HEPES, and 2–4 mM glutamine]. Glia were grown in T75 flasks at a density of approximately two brains per flask. Cells were fed once weekly by complete media exchange in maintenance media (DMEM containing 4.5 mg/ml glucose, 10% FBS, 100 U/ml penecillin/100 µg/ml streptomycin, 25 mM HEPES, and 6 mM glutamine). By visual inspection, these cultures were nearly entirely astroglial with less than 1% contamination with microglia. After 7–14 d in vitro, cells were collected by trypsinization, counted in a hemacytometer, and plated into six-well plates at 50,000–100,000 cells per well in maintenance media. Cholesterol efflux assays were begun after 3 d of growth, at which time the cells were approximately 40% confluent.
In Situ Hybridization
Probes for LXR and LXRß (500 and 411 bases long, respectively) were generated by RT-PCR and cloned into the transcription vector pGEM-T (Promega Corp., Madison, WI). After cloning, the vectors were linearized, and radiolabeled antisense transcripts were synthesized using SP6 (LXR) and T7 (LXRß) RNA polymerase and [33P]rUTP (800 Ci/mol; Amersham Pharmacia Biotech, Arlington Heights, IL). A sense control probe was generated from the LXR probe template by transcribing with T7 polymerase. Four C57 mice were transcardially perfused with 10% normal buffered formalin, embedded in paraffin, and sectioned at 8 µm. Serial coronal sections were mounted so that each slide contained four sections: forebrain, diencephalon, midbrain, and hindbrain with adjacent cortical and/or cerebellar regions. The sections were mounted on plus slides, deparaffinized, rehydrated, and pretreated with 0.2 M HCl for 10 min, and then digested with 10 µg/ml Proteinase K for 20 min and acetylated with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min. After dehydrating and drying, the sections were then prehybridized for 2 h in 50% prehybridization mix (600 mM NaCl, 40 mM Tris, pH 8.0, 10 mM EDTA, 2x Denhardt’s, 0.4% SDS, 20 mM dithiothreitol, 0.5 µg/ml tRNA), and 50% formamide at 55 C. The probe (2 x 106 cpm/section) was mixed with hybridization solution [2x hybridization mix: 20% dextran sulfate in formamide, 1:1 (vol/vol)] and hybridized overnight at 55 C. The following day the sections were washed at 55 C in 5x salt-sodium citrate (SSC) (1x SSC = 150 mM NaCl, 15 mM Na citrate) for 1 h and 0.1x SSC for 30 min, and then digested with ribonuclease A (20 µg/ml) at 37 C for 30 min, washed again in 0.1xSSC at 55 C for 30 min, and dehydrated. After drying, the slides were dipped in Kodak NTB-2 emulsion (Eastman-Kodak, Rochester, NY), exposed for 2–4 wk, developed with Kodak D-19 developer, counterstained with hematoxylin, and then examined by both dark-field and bright-field microscopy.
Cholesterol Efflux Assays
Cholesterol efflux assays were performed as described elsewhere (48) with minor modifications. For astrocytes, the culture media were removed and replaced with 1 ml/well DMEM containing 4.5 mg/ml glucose, 5% FBS, 100 U/ml penecillin/100 µg/ml streptomycin, 25 mM HEPES, and 6 mM glutamine supplemented with 0.5% BSA and 5 µl [1,2-3H(N)]-cholesterol (1 mCi/ml ethanolic stock). Twenty-four hours later, cells were washed once in serum-free DMEM containing glucose, penicillin/streptomycin, HEPES, and glutamine and then incubated for 24 h in the same media supplemented with 0.5% BSA and various drugs or dimethylsulfoxide vehicle. The next day, cells were washed twice in serum-free media and then incubated for a further 24 h in serum-free media supplemented with drugs or dimethylsulfoxide. Human apoA1 was added to some culture dishes to serve as an exogenous cholesterol acceptor molecule. At the end of this incubation, culture media were collected and spun in a microfuge. Adherent cells were washed three times in PBS and extracted for 1 h in 1 ml/well hexane-isopropanol (3:2 vol/vol). Two hundred microliters of the culture media supernatant and 200 µl of the cell extract were counted for tritium in 2 ml Packard Ultima Gold Scint (Packard Bioscience, Meriden, CT). Cholesterol efflux from neurons was examined in much the same way except that cells were always washed and incubated with the neuronal serum-free culturing media described above. On the first day of the efflux experiment, neuronal culture dishes received a half-volume media change with media containing 10 µl [1,2-3H(N)]-cholesterol. In all experiments, control culture dishes received an equal volume of ethanol instead of [1,2-3H(N)]-cholesterol on the first day. These culture dishes were subsequently treated in parallel with [1,2-3H(N)]-cholesterol-loaded culture dishes for purposes of collecting RNA for gene expression studies.
Animal Studies
All procedures performed were in compliance with the Animal Welfare Act and US Department of Agriculture regulations and were approved by the GlaxoSmithKline Institutional Animal Care and Use Committee. Adult male C57 Bl/6 mice were dosed by oral gavage with 50 mg/kg/d of T0901317 (2) or vehicle (0.5% methylcellulose). After 2 or 7 d of treatment, animals were euthanized and their brains were removed. The cerebellum and both hippocampi were dissected and snap frozen in liquid nitrogen for RNA isolation.
Determination of Drug Tissue Concentrations
To determine [3H]cholesterol concentrations, tissues and serum samples were analyzed by HPLC with a radioactivity detector. Briefly, tissues (300 mg) were homogenized in 2 ml 0.25 M HEPES, pH 7.4, containing 1.15% KCl. Aliquots of serum and homogenized tissues were removed for total tritium counting by scintillation and the remainder was shaken for 20 min at room temperature in 3 ml choloroform-methanol (2:1) containing 5 mg/ml butylated hydroxytoluene. Samples were spun in a tabletop centrifuge for 20 min at 2,000 rpm and the organic phase was evaporated under nitrogen. The residue was dissolved in HPLC mobile phase solution (99% hexane, 1% methyl t-butyl ether) and analyzed with a normal-phase HPLC system [Bondclone uPoracil silica column (Phenomenex, Inc., Torrance, CA); gradient elution from 10–75% methyl t-butyl ether in hexane] equipped with a Radiomatic FLO-ONE detector (Packard Bioscience). Peaks corresponding to cholesterol, choleseryl ester, and oxysterols were identified by coelution with known standards.
T0901317 (14) concentrations were measured in brain tissue using HPLC with mass spectrometric detection. Tissue homogenates were homogenized in 2 vol of water. Aliquots of the homogenate were extracted with 4 vol of acetonitrile containing an internal standard. After centrifugation, the supernatant was evaporated to dryness and then dissolved in HPLC mobile phase. T0901317 was eluted from an HPLC column [Hypersil phenyl, 2 x 50 mm, 5 µm (Keystone Scientific, Inc., Bellafonte, PA)] using a mobile phase consisting of 5 mM ammonium acetate (pH 4), methanol, and acetonitrile. T0901317 product ions (M+H = 181 m/z and 141 mass-to-charge ratio, respectively) were measured using a Finnigan TSQ 7000 mass spectrometer (Thermo Finnigan, San Jose, CA) after ionization by atmospheric pressure chemical ionization. Tissue standards were prepared by adding T0901317 to blank tissue homogenates. HPLC with mass spectrometric detection responses was used to construct a peak area ratio (T0901317 peak area/internal standard peak area) vs. tissue homogenate concentration calibration curve. Tissue concentrations were expressed as micromoles/g tissue; approximate tissue concentrations were calculated assuming 1 g of tissue occupies a volume of 1 ml.
RNA Isolation
Total RNA was isolated from tissue and cell culture samples using TRIzol reagent (Life Technologies, Inc.) according to the manufacturer’s protocol. To facilitate recovery of nucleic acid, 100 µg glycogen (Ambion, Inc., Austin, TX) was added. Samples were resuspended in ribonuclease-free water and stored at -70 C.
RTQ-PCR
Total RNA samples were diluted to 100 µg/ml and treated with 40 U/ml RNA-free deoxyribonuclease I (Ambion, Inc.) for 30 min at 37 C followed by inactivation at 75 C for 5 min. Samples were quantitated by spectrophotometry or with the RiboGreen assay (Molecular Probes, Inc., Eugene, OR) and diluted to a concentration of 10 ng/µl. Samples were then assayed in duplicate or triplicate 25-µl reactions using 25 ng RNA/reaction with Perkin-Elmer Corp. chemistry on an ABI Prism 7700 (Perkin-Elmer Corp., Norwalk, CT) according to the manufacturer’s instructions. Gene-specific primers were used at 7.5 or 22.5 pmol/reaction and the gene-specific probe was used at 5 pmol/reaction. Primers and probe were synthesized by Keystone Laboratories (Camarillo, CA). Fold induction values were calculated by subtracting the mean threshold cycle number (Ct) for each treatment group from the mean Ct for the vehicle group and raising 2 to the power of this difference. The following primer/probe sets were used:
Mouse LXR:
Forward primer: CTGCACGCCTACGTCTCCA
Reverse primer: CATTAGCATCCGTGGGAACA
Oligonucleotide probe: CAACCACCCCCACGACCCACTG
Mouse LXRß:
Forward primer: AGTTGCCGCGCAGCTG
Reverse primer: GGGCCAGGGCGTGACT
Oligonucleotide probe: AGTGCAACAAACGATCTTTCTCCGACCA
Mouse ABCA1:
Forward primer: AAGGGTTTCTTTGCTCAGATTGTC
Reverse primer: TGCCAAAGGGTGGCACA
Oligonucleotide probe: CCAGCTGTCTTTGTTTGCATTGCCC
Mouse ABCG1:
Forward primer: CCATGAATGCCAGCAGCTACT
Reverse primer: CACTGACACGCACACGGACT
Oligonucleotide probe: TGCCGCAATGACGGAGCCC
Mouse SREPB-1:
Forward primer: ACAGACAAACTGCCCATCCAC
Reverse primer: TCACCACGGCTCTGAGCTG
Oligonucleotide probe: AGCTGGCAGCAAGGCCCTAGGC
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Received for publication September 4, 2001. Accepted for publication January 22, 2002.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
. Nature 383:728–731[CrossRef][Medline]
and LXRß. Proc Natl Acad Sci USA 96:266–271. J Med Chem 44:886–897[CrossRef][Medline]
. Cell 93:693–704[CrossRef][Medline]
and LXRß. Genes Dev 14:2819–2830 promoter. Mol Cell Biol 21:7558–7568 gene in human macrophages. J Biol Chem 276:43509–43512. Proc Natl Acad Sci USA 97:12097–12102
4 allele, and Alzheimer’s disease. Neuroepidemiology 17:14–20[CrossRef][Medline]
4. Neurosurgery 47:651–657; discussion 657–658[CrossRef][Medline]
4 associated with chronic traumatic brain injury in boxing. JAMA 278:136–140
agonist promotes reverse cholesterol transport. Proc Natl Acad Sci USA 98:5306–5311This article has been cited by other articles:
 |
|
 |
|
  J. Chen, X. Cui, A. Zacharek, C. Roberts, and M. Chopp eNOS Mediates TO90317 Treatment-Induced Angiogenesis and Functional Outcome After Stroke in Mice Stroke, July 1, 2009; 40(7): 2532 - 2538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Lu, J. Ito, N. Iwamoto, T. Nishimaki-Mogami, and S. Yokoyama FGF-1 induces expression of LXR{alpha} and production of 25-hydroxycholesterol to upregulate the apoE gene in rat astrocytes J. Lipid Res., June 1, 2009; 50(6): 1156 - 1164. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Katz, C. Udata, E. Ott, L. Hickey, M. E. Burczynski, P. Burghart, O. Vesterqvist, and X. Meng Safety, Pharmacokinetics, and Pharmacodynamics of Single Doses of LXR-623, a Novel Liver X-Receptor Agonist, in Healthy Participants J. Clin. Pharmacol., June 1, 2009; 49(6): 643 - 649. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, P. M. Rogers, K. R. Stayrook, C. Su, G. Varga, Q. Shen, S. Nagpal, and T. P. Burris The Selective Alzheimer's Disease Indicator-1 Gene (Seladin-1/DHCR24) Is a Liver X Receptor Target Gene Mol. Pharmacol., December 1, 2008; 74(6): 1716 - 1721. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Morales, I. Ballesteros, J. M. Deniz, O. Hurtado, J. Vivancos, F. Nombela, I. Lizasoain, A. Castrillo, and M. A. Moro Activation of Liver X Receptors Promotes Neuroprotection and Reduces Brain Inflammation in Experimental Stroke Circulation, September 30, 2008; 118(14): 1450 - 1459. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Zanotti, F. Poti, M. Pedrelli, E. Favari, E. Moleri, G. Franceschini, L. Calabresi, and F. Bernini The LXR agonist T0901317 promotes the reverse cholesterol transport from macrophages by increasing plasma efflux potential J. Lipid Res., May 1, 2008; 49(5): 954 - 960. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Abildayeva, J. F. P. Berbee, A. Blokland, P. J. Jansen, F. J. Hoek, O. Meijer, D. Lutjohann, T. Gautier, T. Pillot, J. De Vente, et al. Human apolipoprotein C-I expression in mice impairs learning and memory functions J. Lipid Res., April 1, 2008; 49(4): 856 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Liu, H. Li, J. J. Repa, S. D. Turley, and J. M. Dietschy Genetic variations and treatments that affect the lifespan of the NPC1 mouse J. Lipid Res., March 1, 2008; 49(3): 663 - 669. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. T. Tarr and P. A. Edwards ABCG1 and ABCG4 are coexpressed in neurons and astrocytes of the CNS and regulate cholesterol homeostasis through SREBP-2 J. Lipid Res., January 1, 2008; 49(1): 169 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Repa, H. Li, T. C. Frank-Cannon, M. A. Valasek, S. D. Turley, M. G. Tansey, and J. M. Dietschy Liver X Receptor Activation Enhances Cholesterol Loss from the Brain, Decreases Neuroinflammation, and Increases Survival of the NPC1 Mouse J. Neurosci., December 26, 2007; 27(52): 14470 - 14480. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Zelcer, N. Khanlou, R. Clare, Q. Jiang, E. G. Reed-Geaghan, G. E. Landreth, H. V. Vinters, and P. Tontonoz Attenuation of neuroinflammation and Alzheimer's disease pathology by liver x receptors PNAS, June 19, 2007; 104(25): 10601 - 10606. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Boadu, H. Y. Choi, D. W. K. Lee, E. I. Waddington, T. Chan, B. Asztalos, J. E. Vance, A. Chan, G. Castro, and G. A. Francis Correction of Apolipoprotein A-I-mediated Lipid Efflux and High Density Lipoprotein Particle Formation in Human Niemann-Pick Type C Disease Fibroblasts J. Biol. Chem., December 1, 2006; 281(48): 37081 - 37090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Langmade, S. E. Gale, A. Frolov, I. Mohri, K. Suzuki, S. H. Mellon, S. U. Walkley, D. F. Covey, J. E. Schaffer, and D. S. Ory Pregnane X receptor (PXR) activation: A mechanism for neuroprotection in a mouse model of Niemann-Pick C disease PNAS, September 12, 2006; 103(37): 13807 - 13812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Abildayeva, P. J. Jansen, V. Hirsch-Reinshagen, V. W. Bloks, A. H. F. Bakker, F. C. S. Ramaekers, J. de Vente, A. K. Groen, C. L. Wellington,, F. Kuipers, et al. 24(S)-Hydroxycholesterol Participates in a Liver X Receptor-controlled Pathway in Astrocytes That Regulates Apolipoprotein E-mediated Cholesterol Efflux J. Biol. Chem., May 5, 2006; 281(18): 12799 - 12808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ohyama, S. Meaney, M. Heverin, L. Ekstrom, A. Brafman, M. Shafir, U. Andersson, M. Olin, G. Eggertsen, U. Diczfalusy, et al. Studies on the Transcriptional Regulation of Cholesterol 24-Hydroxylase (CYP46A1): MARKED INSENSITIVITY TOWARD DIFFERENT REGULATORY AXES J. Biol. Chem., February 17, 2006; 281(7): 3810 - 3820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Hirsch-Reinshagen, L. F. Maia, B. L. Burgess, J.-F. Blain, K. E. Naus, S. A. McIsaac, P. F. Parkinson, J. Y. Chan, G. H. Tansley, M. R. Hayden, et al. The Absence of ABCA1 Decreases Soluble ApoE Levels but Does Not Diminish Amyloid Deposition in Two Murine Models of Alzheimer Disease J. Biol. Chem., December 30, 2005; 280(52): 43243 - 43256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Heverin, S. Meaney, D. Lutjohann, U. Diczfalusy, J. Wahren, and I. Bjorkhem Crossing the barrier: net flux of 27-hydroxycholesterol into the human brain J. Lipid Res., May 1, 2005; 46(5): 1047 - 1052. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Andersson, N. Gustafsson, M. Warner, and J.-A. Gustafsson Inactivation of liver X receptor {beta} leads to adult-onset motor neuron degeneration in male mice PNAS, March 8, 2005; 102(10): 3857 - 3862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Koldamova, I. M. Lefterov, M. Staufenbiel, D. Wolfe, S. Huang, J. C. Glorioso, M. Walter, M. G. Roth, and J. S. Lazo The Liver X Receptor Ligand T0901317 Decreases Amyloid {beta} Production in Vitro and in a Mouse Model of Alzheimer's Disease J. Biol. Chem., February 11, 2005; 280(6): 4079 - 4088. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Pardee, J. Reinking, and H. Krause Nuclear Hormone Receptors, Metabolism, and Aging: What Goes Around Comes Around Sci. Aging Knowl. Environ., November 24, 2004; 2004(47): re8 - re8. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Nakamura, M. A. Kennedy, A. Baldan, D. D. Bojanic, K. Lyons, and P. A. Edwards Expression and Regulation of Multiple Murine ATP-binding Cassette Transporter G1 mRNAs/Isoforms That Stimulate Cellular Cholesterol Efflux to High Density Lipoprotein J. Biol. Chem., October 29, 2004; 279(44): 45980 - 45989. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Bjorkhem and S. Meaney Brain Cholesterol: Long Secret Life Behind a Barrier Arterioscler. Thromb. Vasc. Biol., May 1, 2004; 24(5): 806 - 815. [Abstract] [Full Text]
|
|
|
|
|
|
M. Heverin, N. Bogdanovic, D. Lutjohann, T. Bayer, I. Pikuleva, L. Bretillon, U. Diczfalusy, B. Winblad, and I. Bjorkhem Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer's disease J. Lipid Res., January 1, 2004; 45(1): 186 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Borud, G. Mellgren, J. Lund, and M. Bakke Cloning and Characterization of a Novel Zinc Finger Protein that Modulates the Transcriptional Activity of Nuclear Receptors Mol. Endocrinol., November 1, 2003; 17(11): 2303 - 2319. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sun, J. Yao, T.-W. Kim, and A. R. Tall Expression of Liver X Receptor Target Genes Decreases Cellular Amyloid {beta} Peptide Secretion J. Biol. Chem., July 18, 2003; 278(30): 27688 - 27694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Lund, J. G. Menke, and C. P. Sparrow Liver X Receptor Agonists as Potential Therapeutic Agents for Dyslipidemia and Atherosclerosis Arterioscler. Thromb. Vasc. Biol., July 1, 2003; 23(7): 1169 - 1177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Koldamova, I. M. Lefterov, M. D. Ikonomovic, J. Skoko, P. I. Lefterov, B. A. Isanski, S. T. DeKosky, and J. S. Lazo 22R-Hydroxycholesterol and 9-cis-Retinoic Acid Induce ATP-binding Cassette Transporter A1 Expression and Cholesterol Efflux in Brain Cells and Decrease Amyloid beta Secretion J. Biol. Chem., April 4, 2003; 278(15): 13244 - 13256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Fukumoto, A. Deng, M. C. Irizarry, M. L. Fitzgerald, and G. W. Rebeck Induction of the Cholesterol Transporter ABCA1 in Central Nervous System Cells by Liver X Receptor Agonists Increases Secreted Abeta Levels J. Biol. Chem., December 6, 2002; 277(50): 48508 - 48513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Wang, G. U. Schuster, K. Hultenby, Q. Zhang, S. Andersson, and J.-A. Gustafsson Liver X receptors in the central nervous system: From lipid homeostasis to neuronal degeneration PNAS, October 15, 2002; 99(21): 13878 - 13883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Dietschy and S. D. Turley Thematic review series: Brain Lipids. Cholesterol metabolism in the central nervous system during early development and in the mature animal J. Lipid Res., August 1, 2004; 45(8): 1375 - 1397. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
