Molecular Endocrinology 16 (7): 1482-1491
Copyright © 2002 by The Endocrine Society
Direct Interactions between Corepressors and Coactivators Permit the Integration of Nuclear Receptor-Mediated Repression and Activation
Xiaolin Li1,
Erin A. Kimbrel1,
Daniel J. Kenan and
Donald P. MCDonnell
Departments of Pharmacology and Cancer Biology (X.L., E.A.K., D.P.M.) and Pathology (D.J.K.), Duke University Medical Center, Durham, North Carolina 27710
Address all correspondence and requests for reprints to: Dr. Donald P. McDonnell, Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham, North Carolina 27710. E-mail: mcdon016{at}acpub.duke.edu.
 |
ABSTRACT
|
|---|
The unliganded thyroid hormone receptor ß (TRß) represses the basal transcriptional activity of target genes, in part through interactions with the nuclear receptor corepressor (N-CoR). In this study we have identified a rather unexpected interaction between N-CoR and the nuclear receptor coactivator ACTR. We have demonstrated in vitro and in intact cells that N-CoR directly associates with ACTR and that the interaction surfaces on N-CoR and ACTR are distinct from those required for TR binding. The significance of this finding was demonstrated by showing that N-CoR facilitates an interaction between unliganded-TRß and ACTR. One possible consequence of the formation of the trimeric complex of N-CoR/ACTR/unliganded-TR is that N-CoR may raise the local concentration of ACTR at target gene promoters. In support of this hypothesis it was demonstrated that the presence of N-CoR can enhance TRß-mediated transcriptional activation. It is proposed, therefore, that TRß- mediated activation and repression are integrally linked in a manner that is not predicted by the current models of nuclear receptor action.
 |
INTRODUCTION
|
|---|
THE THYROID HORMONE receptor ß (TRß) is a ligand-inducible transcription factor involved in the regulation of morphogenesis and metabolism (1, 2). The current models of thyroid hormone action suggest that in the absence of ligand the unliganded or "apo" receptor binds to specific thyroid hormone response elements (TRE) located within target gene promoters (3, 4, 5). In this DNA-bound state, apo-TRß is capable of nucleating the assembly of a histone deacetylase complex, facilitating local condensation of chromatin and subsequent transcriptional silencing (6, 7, 8, 9). Upon ligand binding, the receptor undergoes a conformational change that relieves this repressing activity by displacing the histone deacetylase complex and recruiting a complex that possesses histone acetyltransferase activity (10, 11, 12). In this manner the repressive effects of chromatin are overcome, and transcription of the target gene ensues.
Although the components of the complexes involved in transcriptional activation and repression have been identified, and their role in TR action has been defined, little is known about the processes that lead to the exchange of complexes. It is unclear, for instance, whether the proteins involved in transcriptional activation or repression are present in different complexes within the cell or are present in a single complex whose bio-character is influenced by the state of activation of TR. The existing cofactor exchange models, which suggest that biochemically distinct activation and repression complexes exist within cells, imply that ligand-activated TR is presented constantly, with the problem of having to find appropriate cofactors before it can activate transcription. Consequently, the kinetics of target gene activation would be very sensitive to the cellular concentrations of individual components of the activation complex. If, on the other hand, the proteins required for activation and repression are present in the same complex and the role of ligand is merely to reorientate the complex, a more rapid transition to transcriptional activation could occur. Resolving this issue has important implications with respect to TR pharmacology and may help elucidate the roles of agonists and antagonists in modulating nuclear receptor action in general.
 |
RESULTS
|
|---|
N-CoR Interacts Directly with ACTR
To define the biochemical processes that enable TR to function as both a transcriptional activator and a repressor, we wished to study the protein-protein interaction surfaces on the corepressor protein N-CoR which are important for its ability to modulate TR function. Using the repressor domain 3 (RD3) and the receptor interaction domain 1 (ID1) of N-CoR as targets, we performed phage display analysis to identify N-CoR-interacting peptides. The initial screen lead to the identification of N-CoR-interacting peptides, a subset of which surprisingly had similarity to the nuclear receptor coactivator, ACTR (p/CIP/AIB1/RAC3/TRAM-1/SRC-3) (11, 13, 14, 15, 16, 17). Although the peptides (not shown) contained relatively weak N-CoR-binding activity, their homology to ACTR intrigued us, as N-CoR and ACTR are both TR cofactors, and they coexist in the same cellular compartment. This prompted us to examine a potential interaction between N-CoR and ACTR using glutathione-S-transferase (GST) pull-down experiments. As shown in Fig. 1B
, RD3, ID1 alone and a larger region that contains ID1, termed C'N-CoR [amino acids (aa) 19442453] all interact with full-length in vitro translated ACTR.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 1. N-CoR and ACTR Directly Interact in Vivo and in Vitro
A, Schematic models of domains of N-CoR and ACTR were partially derived from previous reports (7 11 ). B, N-CoR domains associate with ACTR in GST pull-down experiments. N-CoR domains RD3 (aa 10171461), ID1 (aa 20632142), and C'N-CoR (aa 19442453) were expressed as GST fusion proteins and isolated by glutathione-conjugated beads. GST alone or GST fusion (5 µg each) was incubated with [35S]ACTR. Input, 10%. The result shown is representative of three independent assays. C, 293T cells (70% confluence) were transfected with plasmids pcDNA3-ACTR and pcDNA3-Myc-N-CoR and were grown for additional 2 d. Whole cell lysates were immunoprecipitated by rabbit anti-ACTR and immunoblotted with mouse anti-myc. D, 293T cells were transfected with plasmids pcDNA3-ACTR and pcDNA3-Myc-N-CoR7592453 and were grown for additional 2 d. Whole cell lysates were immunoprecipitated by rabbit anti-Myc and were immunoblotted with mouse anti-ACTR antibodies. Input, 1%.
|
|
Direct interactions between N-CoR and ACTR were also shown to occur in intact cells (Fig. 1C
). In transfected 293T cells, we were able to demonstrate that full-length ACTR and N-CoR could be coimmunoprecipitated, using an antibody against ACTR to immunoprecipitate and a Myc antibody to detect the Myc-tagged N-CoR by immunoblot (Fig. 1C
, lanes 1 and 2). No signal was detected by the anti-Myc antibody in cells expressing ACTR alone (Fig. 1C
, lanes 3 and 4). The interaction between N-CoR and ACTR was also demonstrated in a reciprocal manner in which a Myc-tagged N-CoR fragment (N-CoR7592453) was immunoprecipitated with an anti-Myc antibody, while ACTR was detected in the immunoblots using an anti-ACTR antibody (Fig. 1D
). In addition, a significant interaction between full-length versions of ACTR and N-CoR (Gal4-ACTR and VP16-N-CoR) was observed in the mammalian two-hybrid assay (Fig. 2A
), further supporting the hypothesis that N-CoR and ACTR interact directly in cells.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. ACTR Domains Interact with N-CoR
A, ACTR interacts with N-CoR in a mammalian two-hybrid assay. The interaction between the Gal4 and VP16 fusions was measured using a mammalian two-hybrid assay on a 5XGal4Luc3 reporter gene in CV1 cells. A CMV-ß-gal internal control plasmid was used to normalize the luciferase values for transfection efficiency. Protocols for transfection and the luciferase assay are described in Materials and Methods. The mean ± SD are shown. B, CV1 cells were transfected with 5XGal4Luc3 reporter, CMV-ß-gal internal control vector, and plasmids as indicated. C, CV1 cells were transfected with 5XGal4Luc3 reporter, CMV-ß-gal internal control vector, and plasmids as indicated. T3, 10-7 M. These results are representative of at least three independent experiments.
|
|
Based on the results presented thus far, it appears that a surface encompassing at least the RD3 and ID1 domains mediates the interaction between N-CoR and ACTR. Other individual N-CoR domains were not examined for their ACTR-binding ability; nevertheless, we concluded that full-length N-CoR is capable of interacting with ACTR based on results of the coimmunoprecipitation, two-hybrid, and GST pull-down assays (Figs. 1
, B and C, 2A
, and 3A
). The results also suggest that N-CoR interacts with ACTR through surfaces distinct from those that mediate N-CoRs interaction with TR. We next evaluated the surfaces on ACTR that permit its interaction with N-CoR. Although full-length ACTR clearly associates with N-CoR in a mammalian two-hybrid assay (Fig. 2A
), the high level of basal transcriptional activity exhibited by ACTR when tethered to DNA makes it difficult to evaluate how robust this interaction is. To circumvent this problem in the two-hybrid assays, we used ACTR4001000, a fragment of the coactivator that lacks its cAMP response element binding protein-binding protein (CBP) and methyltransferase-binding sites as well as the region responsible for intrinsic histone acetyltransferase activity (11, 18). When assayed for its interaction with VP16-N-CoR7592453, the total response of Gal4-ACTR4001000 is equivalent to that of full-length ACTR, yet its fold of induction is much greater due to its lower basal transcriptional activity (Fig. 2A
). To rule out the possibility that overexpression of N-CoR has a pan-cellular effect that might indirectly enhance activation, we performed a two-hybrid assay with N-CoR instead of VP16-N-CoR, and no enhancement of ACTR transcriptional activity was observed (Fig. 2B
). Thus, the transcriptional activity observed in the two-hybrid assays requires the presence of the VP16 domain on N-CoR and confirms that the activity observed in this assay is indeed an N-CoR-ACTR interaction.

View larger version (36K):
[in this window]
[in a new window]
|
Figure 3. N-CoR and SMRT Associate with p160 Coactivators
A, ACTR 4001000 was expressed as a GST fusion protein and was isolated by glutathione-conjugated beads. [35S]Methionine-labeled corepressors were generated using plasmids pCMX-N-CoR and pCMX-SMRT and were pulled down by 5 µg GST-ACTR4001000. Input, 10%. B, ACTR, SRC-1, and GRIP1 interact with N-CoR in a mammalian two-hybrid assay. CV1 cells were transfected with a 5XGal4Luc3 reporter, CMV-ß-gal internal control vector and plasmids as indicated. The mean ± SD are shown. The results are representative of at least three independent assays. C, [35S]methionine-labeled p160 coactivator proteins were generated using plasmids PCMX-ACTR, pCR3.1-hSRC-1, and pcDNA3-GRIP1. GST or GST-C'N-CoR (5 µg) was incubated with the 35S-labeled p160 proteins. Input, 10%.
|
|
The results of the mammalian two-hybrid assay indicate that ACTR4001000 contains the major N-CoR interaction surface. Also included in ACTR4001000 is the receptor interaction domain or RID (aa 621821), which is responsible for mediating the coactivators interaction with transcriptionally active nuclear receptors (11). Consequently, we wanted to determine whether the same domain in ACTR was required for TR and N-CoR interaction. The two-hybrid assays indicated that both Gal4-ACTR621821 and Gal4-ACTR4001000 interact strongly with TRß (Fig. 2C
). However, although ACTR621821 represents the major TR-binding surface, it is not sufficient to allow ACTR to associate with N-CoR (Fig. 2
, A and B). We have not created point mutations that split the surfaces that permit N-CoR-ACTR and N-CoR-TR interactions. However, the studies with deletion mutants indicate clearly that the surfaces within ACTR that interact with N-CoR are distinct from those required for TR binding.
Next, we wanted to determine 1) whether the nuclear corepressor SMRT (silencing mediator of retinoic acid and thyroid hormone receptors) is able to interact with ACTR, and 2) whether N-CoR and other p160 coactivators could form similar types of complexes. The GST pull-down assay shown in Fig. 3A
suggests that SMRT, a corepressor protein homologous to N-CoR, also has the ability to bind ACTR directly. In addition, three members of the p160 family of coactivators, ACTR, SRC-1 (steroid receptor coactivator 1), and GRIP1 (glucocorticoid receptor interacting protein 1), were found to bind N-CoR to various degrees when assayed in mammalian two-hybrid or GST pull-down assays (Fig. 3
, B and C). In these assays, ACTR appears to bind N-CoR more avidly than SRC-1. Under the conditions of our assays, GRIP1 displays little or no N-CoR-interacting activity. These results suggest that the corepressor/coactivator interaction is not limited to N-CoR and ACTR; other cofactors can also participate in this type of interaction. However, the different intrinsic abilities of p160 coactivators to interact with different corepressors (and vice versa) could determine, at least in part, the type and number of complexes formed between these two types of proteins.
N-CoR, ACTR, and Apo-TR Form a Trimeric Complex
Previous studies have shown that N-CoR and TRß form a complex in the absence of hormone (7). In this study we have shown that both ACTR and TR interact with N-CoR, albeit using different surfaces. Cumulatively, these findings led us to hypothesize that N-CoR, ACTR, and apo-TR may form a trimeric complex in which N-CoR serves as a bridge to link ACTR and unliganded TR. This possibility was first tested in vitro using GST pull-down assays. As shown in Fig. 4A
, TRß binds to ACTR in a T3-dependent manner. However, in the absence of T3, the addition of N-CoR also resulted in a significant ACTR/TRß interaction, suggesting that N-CoR can participate in a trimeric complex, possibly by functioning as a bridge between TRß and ACTR. In the presence of T3, ACTR and TRß directly interact, and under the conditions of this assay, the addition of N-CoR has no further potentiating effect.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 4. N-CoR, ACTR, and Apo-TR Form a Trimeric Complex
A, N-CoR promotes an ACTR/TR interaction in a GST pull-down assay. GST-ACTR4001000 was isolated using glutathione-conjugated Sepharose beads and was used to pull down 35S-labeled TRß. In vitro translated nonlabeled N-CoR7592453 or an equal amount of reticulocyte lysate was added to each assay. T3, 10-6 M. B, N-CoR promotes ACTR/TR interaction in the mammalian two-hybrid assay. CV1 cells were transfected with 5XGal4Luc3, CMV-ß-gal, and the plasmids as indicated. pcDNA3-N-CoR or an equivalent molar amount of pcDNA3 vector was added to each assay. The results are representative of three independent assays. C, The TR AF2 mutant (L454R) does not interact with ACTR, but remains able to interact with N-CoR. CV1 cells were transfected with 5XGal4Luc3, CMV-ß-gal, and the plasmids as indicated. Twenty-four hours after transfection, cells were treated with T3 (10-7 M). D, N-CoR promotes ACTR/TR interaction in the mammalian two-hybrid assay. CV1 cells were transfected with 5XGal4Luc3, CMV-ß-gal, and the plasmids as indicated. pcDNA3-N-CoR or an equivalent molar amount of pcDNA3 vector was added to each assay. The results are representative of three independent assays.
|
|
Additional evidence in support of a trimeric complex was provided using a three-hybrid assay (Fig. 4B
), with which we were able to demonstrate that Gal4-ACTR and VP16-TRß interact in the absence of T3 only when N-CoR, which contains both the TR and ACTR-binding regions, was coexpressed. We also demonstrated that ACTRs N-CoR-binding ability is required for ACTR to associate with unliganded TR. Specifically, ACTR4001000, but not ACTR621821, was able to interact with unliganded TR in the presence of N-CoR (Fig. 4B
). As we have observed previously (Fig. 2B
), Gal4-ACTR621821 is properly expressed in cells and displays similar TR-binding activity to ACTR4001000. However, ACTR621821 lacks the ability to associate with N-CoR, which is probably the reason that it cannot participate in the trimeric complex. When interpreting the results of the three-hybrid assay, we also considered the minor possibility that overexpression of the corepressor protein N-CoR might indirectly affect the basal transcription level of Gal4-ACTR. This possibility seems unlikely because N-CoR had no effect in the assay where the VP16-TRß expression plasmid was replaced by one expressing TR alone (Fig. 4B
, last lane). We conclude, therefore, that VP16-tagged TR was physically recruited to Gal4-ACTR by N-CoR.
To further demonstrate that the binding between Gal4-ACTR and apo-VP16-TRß depends on the bridging function of N-CoR and is not a consequence of some inherent ability of apo-VP16-TRß to bind Gal4-ACTR, we repeated the experiment using the TRß AF-2 mutant L454R. It has been shown previously that L454R is unable to interact with the p160 coactivators (19). We also observed that L454R retains N-CoR-binding activity, but does not have the ability to bind ACTR, with or without thyroid hormone (Fig. 4C
). In our three-hybrid assay we have found that coexpression of N-CoR allows the TR mutant L454R to interact with ACTR indirectly, and that this interaction is entirely dependent on the presence of N-CoR (Fig. 4D
). Nearly identical results were obtained with another TRß AF2 mutant, E457K (data not shown). These findings strengthen our hypothesis that TRß and ACTR can interact with each other in an indirect manner in the absence of thyroid hormone by simultaneously binding to N-CoR.
N-CoR and ACTR Coordinate to Regulate TR Action
It is well established that in the absence of thyroid hormone, TR/N-CoR complexes reside on TREs within target gene promoters (1, 2, 7). Our data, which identified a trimeric complex of TR/N-CoR/ACTR, implied that ACTR, via association with the TR/N-CoR complex, might also occupy TREs even in the absence of thyroid hormone. To probe this issue further we used chromatin immunoprecipitation (ChIP) assays to study the interaction of TR, N-CoR, and ACTR with the promoter regions of human type 1 iodothyronine deiodinase (D1) and human stromelysin-3 (ST3) genes, both of which contain functional TREs (20, 21). Cross-linked chromatin was immunoprecipitated by specific antibodies and was analyzed using PCR with primers encompassing these endogenous TREs. The results of the ChIP assay suggested that in the absence of thyroid hormone, promoter regions containing TREs in both D1 and ST3 genes can be occupied by ectopically expressed TR, N-CoR, and, more interestingly, ACTR (Fig. 5A
).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 5. ACTR, N-CoR, and Apo-TR Occupy Promoters of Thyroid Hormone-Responsive Genes
A, Promoter occupancy by TR and cofactors. Cultured 293T cells were transfected with pcDNA3-TRß, pcDNA3-ACTR, and pcDNA3-myc-N-CoR and were incubated in medium containing charcoal-stripped serum for 40 h. Soluble chromatin was prepared and immunoprecipitated with control IgG or antibodies against TR, Myc, or ACTR. Extracted DNA from the precipitated complex was subjected to PCR using primers that cover the promoter regions of the D1 and ST3 genes as indicated. B, 293T cells were transfected with pcDNA3-TRß and were incubated for 40 h. T3 (10-7 M) was applied 2 h before fixation of cells. Soluble chromatin was prepared and immunoprecipitated with anti-N-CoR (C-20). Extracted DNA from the precipitated complex was subject to PCR using primers that cover the TRE regions of the D1 genes. C, The distal region of the D1 gene promoter was examined for the presence of ACTR. Cells and soluble chromatin were prepared as described in B. Rabbit IgG or rabbit anti-ACTR was used for the immunoprecipitation. The results are representatives of at least three independent chromatin preparations and at least three PCR reactions.
|
|
We subsequently tested the hormone dependency of these factors on TREs. The results indicate that N-CoR occupies the D1 promoter in the absence of T3, but not when T3 is added (Fig. 5B
). Importantly, ACTR is able to occupy the promoter in the absence of T3, and the occupancy is enhanced by addition of hormone (Fig. 5C
). To confirm the specificity of the ChIP assays, we performed a parallel control assay using primers located approximately 3 kb upstream of the TRE, and we were unable to detect any significant binding to this region of the promoter (Fig. 5C
). Cumulatively, these results suggest that ACTR together with apo-TR and N-CoR can specifically occupy regions of TREs and that ACTR can reside in a protein complex at target gene promoters before ligand activation.
Our results thus far suggest that in the absence of ligand, N-CoR functions not only to suppress TR- mediated gene expression, but also to raise the local concentration of ACTR, possibly to enable activated TRß to more efficiently activate transcription. To test this hypothesis, we performed transient transfection with a TRE-containing reporter plus plasmids expressing TRß, ACTR, and N-CoR (Fig. 6A
). Transfected cells were grown without hormone to allow formation of the N-CoR/ACTR/TR complex. Subsequently, T3 was added to the cells, and the TR-mediated transcriptional activity was measured after an additional period of incubation. In this cell system we observed that TRß was an effective activator of the TRE palindrome luciferase reporter, and that this activity was enhanced modestly when a submaximal level of ACTR was expressed ectopically. Importantly, however, coexpression of N-CoR and ACTR, but not N-CoR alone, significantly enhanced TRß-mediated activation. The basal activity of apo-TR in the presence of ACTR and/or N-CoR was not significantly changed over that with TR alone (Fig. 6A
). Western blot analysis was used to confirm that overexpression of N-CoR does not affect the expression level of either TRß or ACTR (Fig. 6B
). It appears, therefore, that N-CoR increases the dynamic range of TR transcriptional activity by enhancing its ability to suppress the basal activity of TRE-containing genes in the absence of hormone (7, 9). Yet, at the same time, it can recruit ACTR to the promoter before hormone binding to TR and thus facilitate a rapid and robust response to agonist activation.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 6. N-CoR and ACTR Coordinate to Regulate TR Transcriptional Activation
A, TRE-PAL reporter, CMV-ß-gal, pcDNA3-TRß, pcDNA3-ACTR, and pCMX-N-CoR were cotransfected into CV-1 cells. The control vector pcDNA3 was added to insure that each assay contained equal amounts of CMV promoters. After a 30-h incubation, T3 (10-7 M) was added, and cells were incubated for an additional 12 h. Fold activation was calculated using the reference assay points (lane 1) in which apo-TRß without ACTR or N-CoR was transfected. The results are representative of at least three independent experiments. B, N-CoR does not affect the expression levels of ACTR or TRß. Expression plasmids for ACTR or TR with or without N-CoR were used in the transient transfection of 293T cells, and 40 µg whole cell extracts were loaded into each lane and probed with rabbit anti-TRß or rabbit anti-ACTR. Enhanced green fluorescence protein levels serve as internal controls for equal loading. C, CV1 cells were transfected with 5XGal4Luc3, CMV-ß-gal, and the plasmids indicated. VP16 and pcDNA3 vectors were used to ensure that each assay contained equivalent amounts of VP16 and CMV promoters. D, A model to explain how N-CoR and ACTR facilitate thyroid hormone action.
|
|
Previous studies have shown that upon ligand activation the interaction between N-CoR and TRß is lost, and a strong interaction between liganded TRß and a coactivator ensues. Therefore, we sought to determine the effect of ligand-activated TRß on the interaction between ACTR and N-CoR. As shown in Fig. 6C
, addition of ligand-activated TRß destabilized the interaction between Gal4-ACTR and VP16-N-CoR7592453, whereas apo-TRß had no effect on the corepressor/coactivator interaction (lanes 6 and 4, respectively). We propose that formation of the liganded TRß/ACTR complex destabilizes N-CoR/ACTR interaction. Accordingly, TR mutants that cannot associate with ACTR in the presence of ligand should not be able to interfere with the N-CoR/ACTR interaction. Indeed, Fig. 6C
, lane 10, shows that the mutant TR L454R cannot disrupt N-CoR/ACTR interaction upon ligand activation. Overall, our experiments with wild-type and mutant TRßs suggest that N-CoR, ACTR, and apo-TRß can form a trimeric complex, with N-CoR serving as the essential bridging factor between TR and ACTR (Fig. 4
). Furthermore, upon addition of hormone, the strong and direct interaction that occurs between TRß and ACTR contributes to destabilization of the N-CoR/ACTR interaction and possibly to the ejection of N-CoR from the receptor/coactivator complex.
Based on our findings and those of others we have developed a schematic model to describe how the N-CoR/ACTR/TRß complex may be involved in the regulation of thyroid hormone action (Fig. 6D
). We propose that in the absence of thyroid hormone, TRß resides on a TRE within the promoter of target genes. The apo-receptor is then capable of recruiting the N-CoR/ACTR complex. Upon binding T3, TRß undergoes a conformational change that abolishes the N-CoR/TRß interaction and favors the association of ACTR with the TRß coactivator-binding pocket. Thus, formation of the apo-TRß/N-CoR/ACTR complex facilitates the localization of ACTR close to TR at TREs before ligand activation. This model suggests that the processes of activation and repression are more closely linked than originally anticipated and provides a mechanism to explain the differences in cellular responses to thyroid hormone.
 |
DISCUSSION
|
|---|
The established models of TRß action hold that in the absence of ligand, the receptor is associated with the corepressor N-CoR (or SMRT) and its associated proteins (6, 7). This complex is capable of associating with specific thyroid hormone response elements within the regulatory regions of target genes, suppressing their basal transcriptional activity. The conformational change within TR that occurs upon ligand binding disrupts this complex, facilitating the interaction of TR with coactivators such as ACTR (11) and enabling the receptor to activate target genes. Our findings generally support this model, with the exception that we have demonstrated that the processes of TR-mediated repression and activation are both functionally and physically linked. Thus, while facilitating TR-mediated repression, the corepressor N-CoR also helps to recruit the coactivator ACTR to the apo-receptor, positioning it to respond to activating ligands.
Using a variety of different approaches, including GST pull-down, mammalian two-hybrid, and immunoprecipitation assays, we have defined a novel, direct interaction between the corepressor N-CoR and coactivator ACTR. Furthermore, we show that this corepressor-coactivator complex is associated with unliganded TR through concurrent binding of TR and ACTR to N-CoR, with N-CoR acting as a bridge between the receptor and coactivator. The prerecruitment of ACTR to the apo-TR by N-CoR appears to facilitate a more robust activation of TR upon ligand treatment. Cumulatively, these experimental findings suggest that TR-mediated activation and repression are functionally and physically linked. It is likely that the amount of coupling between corepressors and coactivators and its impact on TR activity will depend on the expression levels of various cofactors and these may vary in different cell types. In support of this, we have shown that other p160 coactivators do not interact with N-CoR as well as ACTR does, while the corepressor SMRT can interact with ACTR just as well as N-CoR does. We propose, therefore, that activation and repression are integrally linked but the degree of coupling between the two processes is sensitive to alterations in the cellular expression levels of coactivators or corepressors. Accordingly, our findings may help explain the complex phenotypic differences between siblings with identical TRß-mutations in Resistance to Thyroid Hormone syndrome (22). It is possible that the variable penetrance of the mutant phenotype may be influenced by the relative expression of ACTR, N-CoR, and other proteins involved in formation of the N-CoR/ACTR interface.
We believe that the paradigm we suggest here, direct coupling of activation and repression, will be found to occur in other systems. In support of this hypothesis, close links between activation and repression have already been implicated in other studies. In one recent study, p300 (a coactivator) and Groucho (a corepressor) were demonstrated to bind separate domains of the transcription factor NK-4, suggesting that the coactivator, corepressor, and transcription factor may be in the same complex (23). Likewise, N-CoR and the coactivator CBP have been shown to bind the homeobox heterodimer pbx-hox simultaneously, while protein kinase A stimulation of CBP has been found to facilitate the switch from transcriptional repression to activation in this system (24, 25). Furthermore, a cofactor protein called SHARP was recently found to interact with both the coactivator SRA and the SMRT/histone deacetylase corepressor complex (26). Similar to N-CoR, SHARP is a large protein that has distinct coactivator and corepressor interacting domains. It is therefore plausible that N-CoR and SHARP are similar types of scaffolding proteins, each one interacting with and coordinating multiple coregulators of gene transcription. Such findings are consistent with our hypothesis that corepressors and coactivators coexist in a single regulatory unit.
In this study we have not addressed whether other nuclear receptors, such as retinoic acid receptor (RAR) and estrogen receptor (ER), can participate in similar partnerships with N-CoR and ACTR. RAR uses N-CoR and ACTR as coregulators like TR; therefore, it is possible that RAR integrates transcriptional repression and activation in a way similar to TRß. Interestingly, N-CoR was recently found to be required for retinoic acid-responsive transcriptional activation of some genes (27). Shang et al. (28) have shown that ACTR rapidly associates with ER
upon ligand addition, whereas other coactivators, such as CBP and pCAF, are recruited later. The importance of ACTR and N-CoR in ER action is becoming more evident as several studies have shown that the relative expression levels of these two proteins may play an important role in the pathology of some ER-positive breast tumors. Specifically, a recent study by Anzick et al. (13) has shown that the level of ACTR is significantly increased in ER-positive breast cancer cells, while another study has shown that the level of N-CoR is decreased (29). Thus, the net increase in ACTR with no repressor attached in cells might elevate the basal transcriptional activity of certain genes, which could have pathological consequences. Our study with N-CoR, ACTR, and TRß, along with the findings of others discussed above strongly suggest that corepressors and coactivators can reside together in the same complex and that transcriptional repression and activation are more closely integrated than previously thought.
 |
MATERIALS AND METHODS
|
|---|
Plasmids
The plasmids pCMX-ACTR and pCMX-SMRT were provided by Dr. R. M. Evans (The Salk Institute, La Jolla, CA). Plasmid pCMX-N-CoR was provided by Dr. M. G. Rosenfeld (University of California, San Diego, CA). Plasmids cytomegalovirus (CMV)-TRß (L454R) and pCMV-TRß (E457K) were provided by Dr. B. L. West (University of California, San Francisco, CA). Plasmid pcDNA3-GRIP1 was obtained from Dr. C.-Y. Chang (Duke University, Durham, NC). Gal4-SRC-1 was obtained from Dr. S. A. Onate (University of Pittsburgh, Pittsburgh, PA). Plasmid pcDNA3-5 Myc and pcDNA3-EGFP were obtained from Dr. Maria Huacani-Hamilton (Duke University). VP16-N-CoR7592453 was subcloned using XhoI and XbaI sites from pCMX-N-CoR to a VP16 vector (CLONTECH Laboratories, Inc., Palo Alto, CA). Myc-N-CoR7592453 was subcloned using EcoRI and NotI sites from VP16-N-CoR7592453 to pcDNA35Myc vector. Gal4-ACTR4001000 and Gal4-ACTR621821 were generated by PCR of corresponding regions of ACTR and cloned site into a pM vector (CLONTECH Laboratories, Inc.). GST fusion plasmids for N-CoR RD3 (aa 10171461), ID1 (aa 20632142), and C'N-CoR (aa 19442453) were generated by PCR of the corresponding region of N-CoR and cloned into the pGEX-6P-1 vector (Pharmacia Biotech, Piscataway, NJ).
GST Pull-Down Assay
GST fusion proteins were expressed in bacterial strain BL21 and were isolated by glutathione-conjugated Sepharose 4B beads (Pharmacia Biotech). [35S]Methionine-incorporated proteins were generated by TNT kit (Promega Corp., Madison, WI). The bead-coupled GST fusion proteins were incubated with 35S-labeled protein in NETN buffer [20 mM Tris-HCl (pH 8.0), 1 mM EDTA, 50 mM NaCl, and 0.5% Nonidet P-40] for 16 h at 4 C. Bound proteins were washed twice with NETN buffer and twice with buffer A [2 mM Tris-HCl (pH 7.4), 0.5 mM EDTA, and 0.5% Nonidet P-40] and were analyzed by SDS-PAGE and autoradiography.
Cell Culture and Transfection
All cultured cells were maintained in the minimum essential medium (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum, 0.1 mM nonessential amino acids, and 1 mM sodium pyruvate. Culture dishes were precoated with 0.1% gelatin for 10 min at 25 C. Cells were grown at 37 C in 5% CO2. Transient transfections were performed using lipofectin reagent (Life Technologies, Inc.). Protocols for transient transfection and luciferase assays were previously described (30). Briefly, cells were split into 100-mm culture dishes (for immunoprecipitation) or 24-well plates (for luciferase assay) 1 d before the transfection. The lipid-mediated transient transfection was performed with a mixture of lipofectin (Life Technologies, Inc.) and plasmid DNA containing 3 µg DNA for a triplicate luciferase assay in a 24-well plate (Corning, Inc.) or 18 µg DNA for a 100-mm dish (Falcon). Cells were incubated with the lipofectin-DNA mixture for 37 h and were then incubated in normal medium for an additional 2448 h. In the luciferase assays, luciferase readings were normalized using signals of ß-galactosidase (ß-gal), and the final results are shown as the mean ± SD of triplicate measurements.
Immunoprecipitations and Immunoblots
Cultured cells were washed with PBS and lysed with buffer T containing 20 mM Tris-HCl (pH 7.4), 120 mM NaCl, 1 mM EDTA, 0.5% Triton X-100, 1 mM Na3VO4, and protease inhibitors (Roche Molecular Biochemicals, Indianapolis, IN) for 30 min on ice. The whole cell lysates were clarified by centrifugation and were then precleared for 1 h at 4 C by IgG and protein A agarose (Zymed Laboratories, Inc., San Francisco, CA). Specific antibody was mixed with lysates overnight at 4 C. Protein A beads were added for 2 h and were then washed twice with buffer T and twice with PBS. Immunoprecipitated proteins were separated by SDS-PAGE and transferred to a Hybond-C nitrocellulose membrane (Amersham Pharmacia Biotech, Arlington Heights, IL). The membrane was blocked with a buffer containing 20 mM Tris-HCl (pH 7.4), 500 mM NaCl, and 5% nonfat dried milk for 1 h. Primary antibody (13 µg) was diluted in PBS plus 0.1% Tween 20 and was incubated with the membrane for 2 h at 25 C or overnight at 4 C. Subsequently, the secondary antibodies (1:4000 diluted) were incubated with the membrane for 1 h at 25 C. Anti-Myc mouse monoclonal (9E10), anti-N-CoR goat polyclonal (C-20), and anti-TRß mouse monoclonal (J51) antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-ACTR (anti-AIB1) mouse monoclonal antibody was purchased from BD Transduction Laboratories (Lexington, KY). Anti-ACTR rabbit polyclonal was a gift from Dr. J. Wong (31).
Chromatin Immunoprecipitation
293T cells (90% confluence) were cross-linked, lysed, and immunoprecipitated essentially as previously described (28, 32). Rabbit IgG and rabbit anti-Myc (A14) were obtained from Santa Cruz Biotechnology, Inc. Rabbit anti-TRß was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY) Rabbit anti-ACTR was obtained from Dr. J. Wong (31). Precipitates were eluted/reversed by 1% sodium dodecyl sulfate, 0.1 M NaHCO3, and 2 µg/ml herring sperm DNA at 65 C for 6 h. Eluted DNA was isolated by a PCR purification kit (QIAGEN, Chatsworth, CA). PCR was performed with Vent (exo-) polymerase (New England Biolabs, Inc., Beverly, MA), 5 µl (from a total of 50 µl) eluted DNA, and 3035 cycles of amplifications. PCR products were resolved in 2.5% agarose/Tris-borate EDTA gel and visualized with ethidium bromide. The results shown are representatives of at least three independent chromatin preparations and multiple PCRs. Primers for the D1 promoter were: forward, GCTAGAAGCCATGATTGGG; and reverse, TTATCCTGCCTCAACCTCCTG. Primers for the ST3 promoter were: forward, TCTATCCCAAGCTGAAGAACTGGCCAGTCCCTGC; and reverse, CAAGTAGCTGGGACCACAGACGTGCGCCACCATG.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. R. M. Evans for the expression vector pCMX-ACTR, and Dr. B. L. West for CMV-TR (L454R) and CMV-TR (E457K). We thank Dr. J. Wong for anti-ACTR rabbit polyclonal antibody. We also thank Dr. M. Brown and his colleagues Drs. Y. Shang and W. Shao for help in performing the ChIP assay. We thank the Combinatorial Sciences Center at Duke University for the phage display libraries.
 |
FOOTNOTES
|
|---|
This work was supported by U.S. Army breast cancer research grants to X.L. (DAMD17-00-1-0234) and E.A.K. (DAMD17-99-1-9176) and an NIH grant to D.P.M. (DK-50494).
1 X.L. and E.A.K. should be considered equal first authors. 
Abbreviations: aa, Amino acid; CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; CMV, cytomegalovirus; D1, type 1 iodothyronine deiodinase; ER, estrogen receptor; ß-gal, ß-galactosidase; GRIP-1, glucocorticoid receptor interacting protein-1; GST, glutathione-S-transferase; ID1, interaction domain 1; N-CoR, nuclear receptor corepressor; RAR, retinoic acid receptor; RD3, repressor domain 3; SMRT, silencing mediator of retinoic acid and thyroid hormone receptor; SRC1, steroid hormone receptor coactivator 1; ST3, stromelysin-3; TRß, thyroid hormone receptor ß; TRE, thyroid hormone response element.
Received for publication August 6, 2001.
Accepted for publication February 15, 2002.
 |
REFERENCES
|
|---|
- Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184193[Abstract/Free Full Text]
- Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835839[CrossRef][Medline]
- Shibata H, Spencer TE, Onate SA, Jenster G, Tsai SY, Tsai MJ, OMalley BW 1997 Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141164
- Koenig RJ 1998 Thyroid hormone receptor coactivators and corepressors. Thyroid 8:703713[Medline]
- Xu L, Glass CK, Rosenfeld MG 1999 Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 9:140147[CrossRef][Medline]
- Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454457[CrossRef][Medline]
- Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397404[CrossRef][Medline]
- Alland L, Muhle R, Hou Jr H, Potes J, Chin L, Schreiber-Agus N, DePinho RA 1997 Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. Nature 387:4955[CrossRef][Medline]
- Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:4348[CrossRef][Medline]
- Onate SA, Tsai SY, Tsai MJ, OMalley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:13541357[Abstract/Free Full Text]
- Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569580[CrossRef][Medline]
- Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:27352744[Abstract]
- Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965968[Abstract/Free Full Text]
- Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677684[CrossRef][Medline]
- Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:84798484[Abstract/Free Full Text]
- Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW 1997 TRAM-1, A novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:2762927634[Abstract/Free Full Text]
- Xu J, Liao L, Ning G, Yoshida-Komiya H, Deng C, OMalley BW 2000 The steroid receptor coactivator SRC-3 (p/CIP/RAC3/AIB1/ACTR/TRAM-1) is required for normal growth, puberty, female reproductive function, and mammary gland development. Proc Natl Acad Sci USA 97:63796384[Abstract/Free Full Text]
- Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Aswad DW, Stallcup MR 1999 Regulation of transcription by a protein methyltransferase. Science 284:21742177[Abstract/Free Full Text]
- Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:17471749[Abstract/Free Full Text]
- Toyoda N, Zavacki AM, Maia AL, Harney JW, Larsen PR 1995 A novel retinoid X receptor-independent thyroid hormone response element is present in the human type 1 deiodinase gene. Mol Cell Biol 15:51005112[Abstract]
- Anglard P, Melot T, Guerin E, Thomas G, Basset P 1995 Structure and promoter characterization of the human stromelysin-3 gene. J Biol Chem 270:2033720344[Abstract/Free Full Text]
- Collingwood TN, Rajanayagam O, Adams M, Wagner R, Cavailles V, Kalkhoven E, Matthews C, Nystrom E, Stenlof K, Lindstedt G, Tisell L, Fletterick RJ, Parker MG, Chatterjee VK 1997 A natural transactivation mutation in the thyroid hormone ß receptor: impaired interaction with putative transcriptional mediators. Proc Natl Acad Sci USA 94:248253[Abstract/Free Full Text]
- Choi CY, Lee YM, Kim YH, Park T, Jeon BH, Schulz RA, Kim Y 1999 The homeodomain transcription factor NK-4 acts as either a transcriptional activator or repressor and interacts with the p300 coactivator and the Groucho corepressor. J Biol Chem 274:3154331552[Abstract/Free Full Text]
- Asahara H, Dutta S, Kao HY, Evans RM, Montminy M 1999 Pbx-Hox heterodimers recruit coactivator-corepressor complexes in an isoform-specific manner. Mol Cell Biol 19:82198225[Abstract/Free Full Text]
- Saleh M, Rambaldi I, Xiang-Jiao Y, Fetatherstone MS 2000 Cell signaling switches HOX-PBX complexes from repressors to activators of transcription mediated by histone deacetylases and histone acetyltransferases. Mol Cell Biol 20:86238633[Abstract/Free Full Text]
- Shi Y, Downes M, Xie W, Kao HY, Ordentlich P, Tsai CC, Hon M, Evans RM 2001 Sharp, an inducible cofactor that integrates nuclear receptor repression and activation. Genes Dev 15:11401151[Abstract/Free Full Text]
- Jepsen K, Hermanson O, Onami TM, Gleiberman AS, Lunyak V, McEvilly RJ, Kurokawa R, Kumar V, Liu F, Seto E, Hedrick SM, Mandel G, Glass CK, Rose DW, Rosenfeld MG 2000 Combinatorial roles of the nuclear receptor corepressor in transcription and development. Cell 102:753763[CrossRef][Medline]
- Shang Y, Hu X, DiRenso J, Lazar M, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor regulated transcription. Cell 103:843852[CrossRef][Medline]
- Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TM, Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N- CoR and SMRT complexes. Proc Natl Acad Sci USA 95:29202925[Abstract/Free Full Text]
- Chang C, Norris JD, Gron H, Paige LA, Hamilton PT, Kenan DJ, Fowlkes D, McDonnell DP 1999 Dissection of the LXXLL nuclear receptor-coactivator interaction motif using combinatorial peptide libraries: discovery of peptide antagonists of estrogen receptors
and ß. Mol Cell Biol 19:82268239[Abstract/Free Full Text]
- Li J, OMalley BW, Wong J 2000 p300 requires its histone acetyltransferase activity and SRC-1 interaction domain to facilitate thyroid hormone receptor activation in chromatin. Mol Cell Biol 20:20312042[Abstract/Free Full Text]
- Hecht A, Strahl-Bolsinger S, Grunstein M 1999 Mapping DNA interaction sites of chromosomal proteins. Crosslinking studies in yeast. Methods Mol Biol 119:469479[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
H.-Y. Lin, M. Sun, H.-Y. Tang, C. Lin, M. K. Luidens, S. A. Mousa, S. Incerpi, G. L. Drusano, F. B. Davis, and P. J. Davis
L-Thyroxine vs. 3,5,3'-triiodo-L-thyronine and cell proliferation: activation of mitogen-activated protein kinase and phosphatidylinositol 3-kinase
Am J Physiol Cell Physiol,
May 1, 2009;
296(5):
C980 - C991.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Higgins, S. Liu, M. Abdelrahim, K. Vanderlaag, X. Liu, W. Porter, R. Metz, and S. Safe
Vascular Endothelial Growth Factor Receptor-2 Expression Is Down-Regulated by 17{beta}-Estradiol in MCF-7 Breast Cancer Cells by Estrogen Receptor {alpha}/Sp Proteins
Mol. Endocrinol.,
February 1, 2008;
22(2):
388 - 402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Peterson, S. Karmakar, M. C. Pace, T. Gao, and C. L. Smith
The Silencing Mediator of Retinoic Acid and Thyroid Hormone Receptor (SMRT) Corepressor Is Required for Full Estrogen Receptor {alpha} Transcriptional Activity
Mol. Cell. Biol.,
September 1, 2007;
27(17):
5933 - 5948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Heldring, A. Pike, S. Andersson, J. Matthews, G. Cheng, J. Hartman, M. Tujague, A. Strom, E. Treuter, M. Warner, et al.
Estrogen Receptors: How Do They Signal and What Are Their Targets
Physiol Rev,
July 1, 2007;
87(3):
905 - 931.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jiang, R. Meyer, K. Kang, C. K. Osborne, J. Wong, and S. Oesterreich
Scaffold Attachment Factor SAFB1 Suppresses Estrogen Receptor {alpha}-Mediated Transcription in Part via Interaction with Nuclear Receptor Corepressor
Mol. Endocrinol.,
February 1, 2006;
20(2):
311 - 320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Wan, B. Farboud, and M. L. Privalsky
Pituitary Resistance to Thyroid Hormone Syndrome Is Associated with T3 Receptor Mutants that Selectively Impair {beta}2 Isoform Function
Mol. Endocrinol.,
June 1, 2005;
19(6):
1529 - 1542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Meng, P. Webb, Y.-F. Yang, M. Shuen, A. F. Yousef, J. D. Baxter, J. S. Mymryk, and P. G. Walfish
E1A and a nuclear receptor corepressor splice variant (N-CoRI) are thyroid hormone receptor coactivators that bind in the corepressor mode
PNAS,
May 3, 2005;
102(18):
6267 - 6272.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kumar, A. E. Gururaj, R. K. Vadlamudi, and S. K. Rayala
The Clinical Relevance of Steroid Hormone Receptor Corepressors
Clin. Cancer Res.,
April 15, 2005;
11(8):
2822 - 2831.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-E. Park, J. Xu, A. Frolova, L. Liao, B. W. O'Malley, and B. S. Katzenellenbogen
Genetic Deletion of the Repressor of Estrogen Receptor Activity (REA) Enhances the Response to Estrogen in Target Tissues In Vivo
Mol. Cell. Biol.,
March 1, 2005;
25(5):
1989 - 1999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Song, Y. Li, J. Liu, M. Mukundan, and B. Yan
Simultaneous Substitution of Phenylalanine-305 and Aspartate-318 of Rat Pregnane X Receptor with the Corresponding Human Residues Abolishes the Ability to Transactivate the CYP3A23 Promoter
J. Pharmacol. Exp. Ther.,
February 1, 2005;
312(2):
571 - 582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C M Klinge, S C Jernigan, K A Mattingly, K E Risinger, and J Zhang
Estrogen response element-dependent regulation of transcriptional activation of estrogen receptors {alpha} and {beta} by coactivators and corepressors
J. Mol. Endocrinol.,
October 1, 2004;
33(2):
387 - 410.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Malik, M. Guermah, C.-X. Yuan, W. Wu, S. Yamamura, and R. G. Roeder
Structural and Functional Organization of TRAP220, the TRAP/Mediator Subunit That Is Targeted by Nuclear Receptors
Mol. Cell. Biol.,
September 15, 2004;
24(18):
8244 - 8254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Wang, J. A. Blackford Jr., L.-N. Song, Y. Huang, S. Cho, and S. S. Simons Jr.
Equilibrium Interactions of Corepressors and Coactivators with Agonist and Antagonist Complexes of Glucocorticoid Receptors
Mol. Endocrinol.,
June 1, 2004;
18(6):
1376 - 1395.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Song, M. Xie, H. Zhang, Y. Li, K. Sachdeva, and B. Yan
THE PREGNANE X RECEPTOR BINDS TO RESPONSE ELEMENTS IN A GENOMIC CONTEXT-DEPENDENT MANNER, AND PXR ACTIVATOR RIFAMPICIN SELECTIVELY ALTERS THE BINDING AMONG TARGET GENES
Drug Metab. Dispos.,
January 1, 2004;
32(1):
35 - 42.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. De Bosscher, W. Vanden Berghe, and G. Haegeman
The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression
Endocr. Rev.,
August 1, 2003;
24(4):
488 - 522.
[Abstract]
[Full Text]
[PDF]
|
 |
|