help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0071
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dohán, O.
Right arrow Articles by Carrasco, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dohán, O.
Right arrow Articles by Carrasco, N.
Molecular Endocrinology 16 (8): 1893-1902
Copyright © 2002 by The Endocrine Society

Na+/I- Symporter Activity Requires a Small and Uncharged Amino Acid Residue at Position 395

Orsolya Dohán, M. Verónica Gavrielides, Christopher Ginter, L. Mario Amzel and Nancy Carrasco

Department of Molecular Pharmacology (O.D., M.V.G., C.G., N.C.), Albert Einstein College of Medicine, Bronx, New York 10461; and Department of Biophysics and Biophysical Chemistry (L.M.A.), Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Address all correspondence and requests for reprints to: Dr. Nancy Carrasco, Department of Molecular Pharmacology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461. E-mail: carrasco{at}aecom.yu.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Active iodide uptake in the thyroid is mediated by the Na+/I- symporter (NIS), a key plasma membrane glycoprotein. Several NIS mutations have been shown to cause I- transport defect, a condition that, if untreated, can lead to congenital hypothyroidism and, ultimately, cretinism. The study of I- transport defect-causing NIS mutations provides valuable insights into the structure-function and mechanistic properties of NIS. Here we report the thorough analysis of the G395R NIS mutation. We observed no I- uptake activity at saturating or even supersaturating external I- concentrations in COS-7 cells transiently transfected with G395R NIS cDNA, even though we demonstrated normal expression of G395R NIS and proper targeting to the plasma membrane. Several amino acid substitutions at position 395 showed that the presence of an uncharged amino acid residue with a small side chain at position 395 is required for NIS function, suggesting that glycine 395 is located in a tightly packed region of NIS. Substitutions of large amino acid residues at position 395 resulted in lower Vmax without affecting Km values for I- and Na+, suggesting that these residues hamper the Na+/I- coupling reaction.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE THYROID HORMONES T3 and T4, synthesized in the thyroid follicular cells, are the only iodine-containing hormones in vertebrates. An essential constituent of these hormones, iodide (I-), reaches the thyroid follicular cells via a highly specialized system of active transport across the basolateral plasma membrane. This transport process is mediated by an intrinsic plasma membrane glycoprotein, the Na+/I- symporter (NIS) (for recent reviews see Refs. 1 and 2). NIS-mediated active I- transport is driven by the Na+ electrochemical gradient generated by the Na+/K+-ATPase. Two Na+ ions are translocated into the cells per each I- ion (3). The structure and function of NIS have been extensively researched since the isolation of the cDNA that encodes NIS in our laboratory in 1996 (4). The current secondary structure model (Fig. 1Go) depicts NIS as a protein with 13 transmembrane segments, the amino terminus facing the extracellular side, and the carboxy terminus facing the cytosol; the location of both termini has been confirmed experimentally (2).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Schematic Representation of NIS Secondary Structure Model

Transmembrane segments are represented by cylinders and numbered with Roman numerals. The three glycosylation sites are indicated with arrows. The nine identified NIS mutations are shown thus: the letter before the number indicates the original amino acid, and the letter after the number indicates the substitution.

 
Congenital lack of I- transport, resulting in hypothyroidism, is an infrequent condition also known as I- transport defect (ITD). Diagnostic findings typically include hypothyroidism (which can be overcome with L-T4 replacement therapy or in some cases high I- supplementation), goiter, low thyroid I- uptake on scintigraphy, and low saliva/plasma I- ratio (5, 6). ITD, if untreated, can impair the development of the newborn, eventually resulting in cretinism. Mutations in thyroid molecules, such as thyroid peroxidase (7), thyroglobulin (8), and TSH receptor (9) have been identified as causes of congenital hypothyroidism. NIS mutations have been demonstrated to cause ITD and thus congenital hypothyroidism as well. When a mutation renders NIS nonfunctional, I- has no access to the thyroid epithelial cells, and decreased thyroid hormone biosynthesis results. This causes higher circulating levels of TSH, which in turn stimulate the morphological and biochemical changes in the thyroid that lead to the development of goiter. Only recently, as a result of the isolation of the rat (r) NIS cDNA (4) and the subsequent elucidation of the exon-intron organization of the human NIS gene (10, 11), it became possible to examine the molecular basis of congenital hypothyroidism due to NIS mutations. To date about 50 cases of ITD, corresponding to 33 families, have been reported worldwide. Seventeen cases from 13 families studied at the molecular level have been shown to have a mutation in NIS. Nine mutations have been identified, namely V59E, G93R, Q267E, C272X, T354P, G395R, 515X (frame shift), Y531X, and G543E (12, 13, 14, 15, 16) (Fig. 1Go). Although the clinical picture and genetic alterations of these patients are well described, the molecular mechanisms underlying the effects of these mutations have yet to be elucidated, with the exception of T354P, the most extensively analyzed mutation. A detailed structure/function study of T354P revealed that a hydroxyl group at the ß-carbon of the residue at position 354 is essential for thyroid NIS function (17). Another mutation, Q267E, has been proposed to impair NIS trafficking, as suggested by flow cytometry experiments (18). Therefore, the continued study of NIS mutations is likely to lead to the identification of functionally significant residues or segments of NIS.

Kosugi et al. (19) described in 1999 a novel ITD-causing loss-of-function NIS mutation, G395R, in several members of a large family with a history of ITD. The patients belong to the religious Hutterite group of central Canada, whose members live in geographical and cultural isolation and have a high degree of consanguinity. Before the exact nature of the mutation was known, these authors had first studied in 1985 nine children from the same family, whose congenital hypothyroidism was initially diagnosed by routine neonatal TSH screening. The diagnosis of ITD was later established in seven of these patients who remained available for further clinical evaluation, on the basis of thyroidal scintigraphic imaging and serum/saliva I- ratio determinations (20). In their 1999 publication, Kosugi et al. (19) reported nine additional infants with ITD in the same family, after having investigated a total of 10 patients at the molecular level. Genomic DNA was extracted from peripheral blood cells of the patients. PCR products of each NIS gene exon were amplified and subsequently analyzed by direct sequencing, and a mutation due to a nucleotide change of G > A in exon 10 resulting in a change of Gly 395 to Arg (GGA > AGA) was detected (i.e. G395R). All nine patients began to receive T4 treatment as neonates, thus preventing the onset of either hypothyroidism or goiter. Kosugi et al. (19) observed no perchlorate-inhibitable I- uptake at an external I- concentration of 10 µM in COS-7 cells transfected with the mutant G395R NIS cDNA. However, I- uptake in these cells was not explored at higher I- concentrations. The authors mentioned that immunoblot and immunofluorescence analyses suggested that the mutant NIS protein was properly synthesized, although the data were not shown (19).

We have carried out a detailed study of the mechanism by which the G395R mutation renders NIS nonfunctional, by analyzing G395R NIS protein processing, membrane targeting, and I- transport in COS-7 cells transiently transfected with G395R NIS cDNA. In addition, we have probed the significance of the Gly395 residue by performing several additional residue substitutions at position 395 and evaluating the effects of these substitutions on the expression, plasma membrane targeting, and functional characteristics of the resulting NIS mutant constructs. Our findings demonstrate that NIS activity requires a small and uncharged amino acid residue at position 395.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Characterization of Activity and Expression of G395R in COS-7 Cells
Considering that G395 is conserved from rat to human NIS, and that 21 of 22 residues in the predicted transmembrane segment X of both rat and human NIS (the transmembrane segment where G395 is located) are identical, all substitutions were performed in rNIS cDNA background cloned into the pSV SPORT plasmid. We generated G395R NIS by site-directed mutagenesis and used our high-affinity anti-NIS Ab to monitor G395R expression in COS-7 cells transiently transfected with G395R NIS cDNA (17). Cells assayed as described (4) for I- uptake activity under steady-state conditions at I- concentrations of 20 µM (Fig. 2AGo) and 320 µM (not shown) displayed no I- accumulation, just like nontransfected COS-7 cells (Fig. 2AGo), which lack an endogenous I- accumulating system. In contrast, COS-7 cells expressing wild-type NIS accumulated 30–40 pmol I-/µg DNA, as previously reported (4), and I- uptake was inhibitable by perchlorate (ClO4-) (Fig. 2AGo, solid bars). To assess whether the lack of I- uptake activity in cells transfected with G395R cDNA was due to the absence of G395R NIS expression, membrane fractions from transfected COS-7 cells were analyzed by immunoblot analysis using anti-NIS Ab. As we have previously shown (21), anti-NIS Ab recognizes approximately 65-kDa and 90-kDa NIS polypeptides, which correspond, respectively, to partially and fully glycosylated NIS species in COS-7 cells expressing wild-type NIS. Levels of both the partially and fully glycosylated G395R NIS polypeptides observed upon immunoblot analysis were virtually identical with wild-type NIS (Fig. 2BGo). Therefore, G395R NIS generated by site-directed mutagenesis is expressed in transfected COS-7 cells, even though these cells exhibit no I- transport activity. The electrophoretic mobility of G395R NIS was slightly slower than that of wild-type NIS, possibly because of differences in glycosylation. To determine whether G395R was properly targeted to the plasma membrane, we carried out indirect immunofluorescence analysis with anti-NIS Ab. Comparable plasma membrane-associated staining was observed in both wild-type (Fig. 2DGo) and G395R (Fig. 2EGo) NIS-transfected cells. As the anti-NIS Ab is directed against the carboxy terminus, which faces the cytosol, cells have to be permeabilized for immunofluorescence analysis. To assess whether G395R reaches the cell surface, a second approach was taken, i.e. surface biotinylation with the amino-specific and membrane-impermeable reagent sulfosuccinimidyl-2-(biotinamido)ethyl-1,3'-dithioproprionate. The entire biotinylated fraction was isolated with streptavidin-coated beads and immunoblotted with anti-NIS Ab. The results (Fig. 2CGo) confirmed the observations from the immunofluorescence experiments: G395R NIS is properly targeted to the plasma membrane. Thus, the substitution of glycine with arginine at position 395 impairs NIS function, but not its expression or trafficking to the cell surface.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Characterization of Activity and Expression of G395R NIS in Transfected COS-7 Cells

A, I- uptake at steady state (45 min) with an external NaI concentration of 20 µM in nontransfected COS-7 cells (NT) and in cells transiently transfected with pSV SPORT plasmid containing either wild-type (WT) NIS (G395), or G395R mutant cDNAs. Open bars correspond to the absence and solid bars to the presence of 40 µM NaClO4. Results represent the average of at least five independent experiments performed in triplicate and are expressed in percent uptake relative to wild-type NIS. Values for wild-type NIS ranged from 30–40 pmol of I-/µg DNA. B, Immunoblot analysis of membrane fractions (20 µg of protein) prepared from COS-7 cells transiently transfected with wild-type (G395) or G395R mutant NIS cDNA. We used affinity-purified anti-NIS Ab (8 nM) detected by horseradish peroxidase-linked antirabbit Ab followed by enhanced chemiluminescence as described in Materials and Methods. D and E, Membrane localization in COS-7 cells of wild-type (D) or G395R (E) mutant NIS proteins by indirect immunofluorescence as described in Materials and Methods. Immunofluorescence was not detected when the experiment was done with the second Ab alone or in the presence of excess peptide (results are not shown). C, Immunoblot analysis of biotinylated cell surface polypeptides, carried out as described in Materials and Methods in COS-7 cells transfected with wild-type (left lane) or G395R NIS cDNAs (right lane).

 
Effects of Other Charged Amino Acid Substitutions at Position 395 on NIS Expression and Activity in COS-7 Cells
To further investigate the effect of charged residues at position 395, we substituted lysine, aspartate, and glutamate in place of glycine. All constructs were transiently transfected into COS-7 cells. The percentage of transfected cells was similar (20–30%) in all cases, as determined by flow cytometry (data not shown). All mutant proteins were found to be expressed and targeted to the plasma membrane like wild-type NIS when assessed by immunoblot, surface biotinylation, and immunofluorescence (Fig. 3Go, B–F). In contrast, no I- transport activity was observed in mutant NIS proteins bearing any of the tested charged residues at position 395, either at an I- concentration of 20 µM (Fig. 3AGo) or 320 µM (not shown). This suggests that the presence of a charged residue of either polarity at position 395 interferes with NIS function.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Effect of Charged Amino Acid Substitutions at Position 395 on NIS Activity and Expression

A, I- uptake activity at 20 µM external NaI concentration (open bars) and I- uptake inhibition by 40 µM NaClO4 (solid bars). I- uptake activity in picomoles of I-/µg DNA is expressed as percentage relative to wild-type activity. B, Immunoblot analysis of membrane fractions prepared from COS-7 cells transiently transfected with wild-type, G395K, G395D, or G395E mutant NIS cDNA. D–F, Indirect immunofluorescence analysis of COS-7 cells expressing G395K, G395D, or G395E NIS mutants, respectively. C, Cell surface biotinylation of the same NIS mutant proteins expressed in COS-7 cells.

 
Effects of Neutral Amino Acid Residues at Position 395 on NIS Expression and Activity in COS-7 Cells
We also investigated the effect of having neutral side chains at position 395 by studying NIS activity with alanine, asparagine, and proline substitutions. All mutant proteins were expressed in amounts comparable to wild-type NIS (Fig. 4BGo) and correctly targeted to the plasma membrane (Fig. 4Go, C–F). However, these NIS variants displayed markedly different I- transport activity. I- uptake assays carried out at 20 µM I- showed that only G395A and G395N exhibited I- transport, i.e. 76% and 13% of wild-type activity, respectively (Fig. 4AGo). Similar results were obtained at 320 µM (not shown). In contrast, G395P was completely inactive even at supersaturating concentrations of I-. To elucidate if the decrease in I- uptake correlates with an increase in the length of the side chain of the residue, we substituted serine or threonine at position 395. Both mutant proteins were expressed (Fig. 5BGo) and targeted to the plasma membrane (Fig. 5Go, C–E). Whereas G395T NIS was inactive, it is interesting that G395S exhibited modest I- uptake activity at 20 µM I- (Fig. 5AGo). These findings clearly demonstrate that increasingly larger side chains at position 395 increasingly impair NIS function.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 4. Effect of Neutral Side Chains at Position 395 on NIS Activity and Expression

A, I- uptake activity at 20 µM external NaI concentration of the G395P, G395A, and G395N mutant NIS proteins expressed in COS-7 cells, in the absence (open bars) or presence (solid bars) of 40 µM NaClO4. Results are shown as percentage of activity relative to wild-type NIS. B, Immunoblot analysis of membrane fractions prepared from COS-7 cells transiently transfected with wild-type, G395P, G395A, or G395N mutant NIS cDNA. D–F, Indirect immunofluorescence analysis of COS-7 cells expressing the G395P, G395A, or G395N NIS mutant proteins, respectively. C, Cell surface biotinylation of the same mutant NIS proteins expressed in COS-7 cells.

 


View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. Effect of Increasing Size of the Side Chain at Position 395

A, I- uptake activity at 20 µM external NaI concentration of the G395S and G395T NIS mutant proteins in the absence (open bars) or presence (solid bars) of 40 µM NaClO4. B, Immunoblot analysis of membrane fractions prepared from COS-7 cells transiently transfected with wild-type, G395S, or G395T cDNA. D and E, Indirect immunofluorescence analysis of COS-7 cells expressing G395S or G395T NIS mutant proteins, respectively. C, Cell surface biotinylation of the same mutants expressed in COS-7 cells.

 
Kinetic Analysis of I- Transport Mediated by NIS Mutant Proteins
To further explore the effect of the alanine, glutamine, and serine amino acid substitutions at position 395 on the mechanism of I- transport by NIS, we performed kinetic analyses in COS-7 cells transfected with wild-type, G395A, G395N, or G395S NIS cDNAs. We measured the effect of varying external concentrations of I- (ranging from 1 to 80 µM) on initial rates of I- transport (Fig. 6AGo). In all cases, saturation was reached at an I- concentration of 80 µM. The apparent Vmax values of the mutants (G395A: 23.92 ± 1.96; G395N: 2.48 ± 0.25; and G395S: 0.44 ± 0.23 pmol of I-/µg DNA/2 min) differed considerably from the wild-type value of 35.89 ± 1.67 pmol of I-/µg DNA/2 min. In contrast, the calculated Km value for the G395A mutant (23.70 ± 4.20 µM) was virtually identical with that of wild-type NIS (25.46 ± 2.52 µM) (Fig. 6AGo). Because the G395N and G395S mutants displayed very low transport activity (Fig. 6AGo), Km values for both these mutants could not be measured directly. Hence, we assigned to these two mutants a 24 µM Km value, i.e. the average of the values for the G395A mutant and wild-type NIS. Adjustment of Vmax using this assigned Km value for the two mutants showed very good agreement with the data, demonstrating that the assigned Km value is likely to be correct. These results indicate that the reduced I- uptake observed in the G395A, G395N, and G395S NIS mutants is not due to a change in the apparent affinity for I-. Instead, the effect of the substitutions is a decrease in the turnover rates of NIS.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 6. Kinetic Analysis of Iodide Uptake in Transfected COS-7 Cells

A, Initial rates (2-min time points) of I- uptake were determined at the indicated concentrations of I- as described in Materials and Methods. Calculated curves (smooth lines) were generated using the equation: v = Vmax · [I]/(Km + [I]) + 0.0205 · [I] + 0.1879. The terms 0.0205 · [I]+ 0.1879 correspond to background adjusted by least squares to the data obtained with nontransfected cells. Vmax values for the WT, G395A, G395N, and G395S NIS are: 35.89 ± 1.67; 23.92 ± 1.96; 2.48 ± 0.25; and 0.44 ± 0.23 pmol of I-/µg DNA/2 min. Km values for I- for the WT and G395A are: 25.46 ± 2.52 and 23.70 ± 4.20 µM. Data for the G395N and G395S mutants were adjusted using a Km value of 24 µM, i.e. the average of the WT and G395A mutant Kmvalues. B, To assess Na+ dependence of I- uptake, cells were incubated for 2 min with the indicated concentrations of Na+; isotonicity was maintained constant with choline Cl. Na+ dependence data were analyzed using the equation: v = Vmax · [Na+]2/Km + [Na+]2 + 0.604. The term 0.604 corresponds to the constant average background obtained with nontransfected cells. Data were fitted by nonlinear least squares using the Marquard-Levenberg algorithm (28 ). The Km values for Na+ for the WT and G395A NIS molecules are: 45.47 ± 2.7 and 67.42 ± 5.5 mM.

 
We also measured the effect of varying concentrations of Na+ (ranging from 0 to 140 mM) on the initial rates of I- uptake in COS-7 cells transfected with wild-type or G395A NIS cDNAs (the only mutant with which this study was feasible). Osmolarity was kept constant with choline chloride. We observed that the sigmoidal Na+ dependence of I- uptake in G395A was very similar to that of wild-type NIS (Fig. 6BGo). As the wild-type and G395A NIS Km values for Na+ are close (Fig. 6BGo) and, significantly, at physiological concentrations of Na+ (140 mM), both proteins are working at Vmax, these data are also consistent with the interpretation that the G395A substitution leads to a decrease in NIS turnover rates.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The study of NIS mutations that cause ITD provides valuable insights into the structure-function and mechanistic properties of NIS. Analysis of the T354P NIS mutation led to the study of several additional substitutions, revealing that the hydroxyl group at the ß-carbon of the residue at position 354 is essential for thyroid NIS function. The characterization of the Q267E mutation showed that residue 267 may play a role in targeting NIS to the plasma membrane (18). The ITD-causing G395R NIS mutation was first identified by Kosugi et al. (19). The reported absence of thyroidal I- uptake in these patients suggests that, at some level, the G395R NIS mutation impairs NIS function. As a corollary, it also suggests that some attributes of residue 395, which is located in the putative transmembrane segment X (Fig. 1Go), may play a significant role in some aspects of NIS activity. Indeed, Kosugi et al. reported a lack of NIS activity at subsaturating external I- concentrations (10 µM) in COS-7 cells transfected with the mutant G395R NIS cDNA. In addition, these authors indicated that expression of the G395R NIS protein was indistinguishable from wild-type NIS, as suggested by immunoblot and immunofluorescence analyses (not shown in the report). These findings support the notion that the G395R NIS mutation does not interfere with either the biosynthesis of NIS or its targeting to the plasma membrane. We have extended the observations of Kosugi et al. to a full characterization of the effects of substitutions at position 395 in NIS.

We observed that COS-7 cells transiently transfected with G395R NIS cDNA exhibited no I- uptake activity, not only at low external I- concentrations (10 µM) as Kosugi et al. had reported, but also at higher (20 µM) and even supersaturating (320 µM) I- concentrations (Fig. 2AGo). In agreement with the suggestion of Kosugi et al. that the G395R NIS mutation is normally expressed, we demonstrated by immunoblot analysis that the levels of expression of both the partially and fully glycosylated species of G395R NIS were identical with wild-type NIS (Fig. 2BGo). In addition, we showed by both immunofluorescence analysis and surface biotinylation that G395R NIS is properly targeted to the plasma membrane (Fig. 2Go). This is in stark contrast to the effects of point mutations on other transporters, such as CFTR (24) or SGLT1 (25), in which mutations interfere with trafficking of the transporters to the cell surface.

Having shown that the G395R NIS mutation directly affects protein activity rather than its expression or targeting, we investigated the significance of glycine at position 395 by carrying out several amino acid substitutions at this position by site-directed mutagenesis and assessing the impact of the substitutions on NIS activity, as well as on its expression and targeting. Considering that the "original" G395R mutant identified in the patients, which exhibits no I- transport activity at any I- concentration, contains arginine, a positively charged residue with a considerably larger side chain than glycine, we investigated the effect of size and charge at position 395 (Fig. 7Go). First, we demonstrated that the presence of any charged residue at this position, regardless of the polarity of the charge, yields a nonfunctioning NIS protein (Fig. 3Go). Next, we showed that the size and geometry of the side chain of the residue at this position are of paramount functional significance, provided no charge is present (Figs. 4Go and 5Go). We observed that when the native glycine 395 was replaced with alanine (G395A mutant), a residue with a side chain that is only slightly larger than that of glycine and equally neutral (Fig. 7Go), the resulting NIS molecule still exhibited 73% of the I- transport activity of wild-type NIS, and a virtually identical affinity for I- to wild-type NIS, as indicated by the Km values (Fig. 6AGo). Thus, substitutions at position 395 seem to interfere with the rate of some aspect of the coupling between Na+ and I- transport. Lower I- transport activity was observed with the G395S and G395N mutants, in which serine (89 Å3) and asparagine (117 Å3) were placed at position 395 instead of glycine (60 Å3) (Fig. 7Go). Serine and asparagine have consecutively larger side chains than alanine (88 Å3) and, like both glycine and alanine, they are devoid of charge. Remarkably, threonine at position 395 yielded a functionally inactive NIS protein even though its volume (116 Å3) is not significantly different from that of asparagine (117 Å3). One conceivable explanation derives from the fact that threonine has a side chain branched at the ß-carbon, severely restricting the possible positions of the hydroxyl group. The energetically favorable conformation for threonine in a helix (gauche -) may be incompatible with placing the oxygen in a favorable environment.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 7. Amino Acid Substitutions at Position 395 in the Secondary Structure Model Of Putative Transmembrane Segment X

Initial coordinates were obtained with the program QUANTA (Molecular Simulations, Inc., Burlington, MA). Regularization of the model was carried out with the program "O" (26 ). Graphics were carried out with the program SETOR (27 ). {alpha}-Helix backbone is depicted as a green ribbon. The NH2 terminus of the helix, depicted in aqua, faces the cytosol, whereas the COOH terminus, depicted in orange, faces the extracellular milieu. Amino acid residues are represented in ball-and-stick form except for the residue at position 395, which is represented as space-filling model. Color code: carbon, gray; oxygen, red; nitrogen, blue; sulfur, yellow.

 
In conclusion, given that no I- transport activity was detected in any mutant containing a charged residue at position 395, and that NIS activity decreased in an inverse relation to the side chain size of the noncharged residue placed at position 395, it appears that the presence of an uncharged amino acid residue with a small side chain at position 395 is a requirement for NIS function, suggesting that glycine 395 is located in a tightly packed membrane-embedded region of NIS. That turnover (Vmax), rather than substrate affinities (Km), is affected by the substitutions seems to indicate that either the rate of ion binding/release (without affecting the affinity) or the rate of the conformational change required to couple the transport of Na+ and I- must be affected. However, ion binding and/or release are unlikely to be rate limiting. In addition, it is also difficult to envision how the tested substitutions could have an impact on the rate of binding and/or release of simple ions such as Na+ and I-. Therefore, the most likely explanation for these observations is that the substitutions hamper a conformational change involving transmembrane segment X. One may speculate that this conformational change may involve a helix rotation that pivots around glycine 395.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Site-Directed Mutagenesis
Individual mutagenic oligonucleotides were generated to make the following substitutions at the glycine-395 position: G395P: CATTCATCTACCCCTCTGCCTGC; G395N: CATTCATCTACAACTCTGCCTGC, G395KR: CATTCATCTACARGTCTGCCTGC; G395AE: CATTCATCTACGMATCTGCCTGC; G395D: CATTCATCTACGACTCTGCCTGC; G395S: CATTCATCTACTGCTCTGCCTGC; G395T CATTCATCTACACCTCTGCCTGC. The initial PCR extensions were performed using reverse primers complementary to the 3'-end. These fragments were gel purified and used for a second-round PCR extension with primers complementary to the 5'-end. Fragments with the mutant sequences were obtained by digesting the final PCR products with the appropriate unique restriction enzymes that would yield the smallest mutant fragments. These fragments were ligated into wild-type NIS cDNA, and the mutant inserts were sequenced past their respective cloning sites.

COS-7 Cells Transfection
COS-7 cells were cultured and transfected as previously reported (21). Briefly, COS-7 cells grown in 10-cm plates were transfected by the diethylaminoethyl dextran method with 3 µg of NIS cDNA in pSV SPORT plasmid per plate. All assays were performed 2 d after transfection.

Iodide Uptake
After aspirating the culture medium, cells were washed twice with 1 ml of a modified Hanks’ balanced salt solution (buffered HBSS) with the following composition: 137 mM NaCl, 5.4 mM KCl, 1.3 mM, CaCl2, 0.4 mM MgSO4·7H2O, 0.5 mM MgCl2, 0.4 mM Na2HPO4·7 H2O, 0.44 mM KH2PO4, and 5.55 mM glucose with 10 mM HEPES buffer (pH 7.3). Cells grown in 12-well plates were incubated with buffered HBSS containing 20 µM NaI supplemented with 10 µCi/µl carrier-free Na125I to give a specific activity of 100 mCi/mmol. For steady-state experiments, incubations proceeded at 37 C for 45 min in a humidified atmosphere and were terminated by aspirating the radioactive medium and washing twice with 1 ml ice-cold HBSS. For kinetic analysis, cells were incubated for 2 min with 1, 2, 3, 4, 8, 12, 16, 20, 40, and 80 µM NaI, and uptake reactions were terminated as indicated above. Data were processed using the equation: v = Vmax · [I]/(Km+[I])+0.0205 · [I]+0.1879. The terms 0.0205 · [I]+0.1879 correspond to background adjusted by least squares to the data obtained with nontransfected cells. To assess Na+ dependence of I- uptake, cells were incubated for 2 min with 0, 5, 10, 20, 30, 40, 80, and 140 mM NaCl; isotonicity was maintained constant with choline Cl. Na+ dependence data were analyzed using the equation: v = Vmax · [Na+]2/Km+[Na+]2+0.604. The term 0.604 corresponds to the constant average background obtained with nontransfected cells. Data were fitted by nonlinear least squares using the Marquard-Levenberg algorithm (28).

To determine the amount of 125I accumulated in the cells, 500 µl 95% ethanol were added to each well for 20 min at 4 C and then quantitated in an LKB (Rockville, MD) {gamma}-counter. The DNA content of each well was determined on the material not extracted by ethanol after trichloroacetic acid precipitation, by the diphenylamine method, as previously described (21). I- uptake was expressed as picomoles per microgram of DNA. All parameters were determined at least in triplicate.

Membrane Preparation
Cells were scraped in a buffer containing 250 mM sucrose, 1 mM EDTA, 10 mM HEPES (pH 7.5), and protease inhibitors. Then cells were homogenized and centrifuged at 500 x g for 15 min. The supernatant was centrifuged at 100,000 x g for 1 h to pellet the membrane fraction. Protein determination was performed using the protein assay based on the Bradford method (Bio-Rad Laboratories, Inc., Hercules, CA).

Immunoblot Analysis
PAGE and electroblotting to nitrocellulose were performed as previously described (21). All samples were diluted 1:2 with sample buffer and heated at 37 C for 30 min before electrophoresis. Immunoblot analysis was also carried out as described (21), with affinity-purified anti-rNIS Ab (1 µg/µl) at a 1:2000 dilution, and a 1:2000 dilution of a horseradish peroxidase-linked donkey antirabbit IgG (Amersham Pharmacia Biotech, Arlington Heights, IL). Both incubations were performed for 1 h. Proteins were visualized by the enhanced chemiluminescence Western blot detection system (Amersham Pharmacia Biotech).

Immunofluorescence Analysis
COS-7 cells were seeded onto polylysine-coated cover slips 1 d after transfection. On the second day after transfection, cells were fixed with 2% paraformaldehyde for 30 min at room temperature and then rinsed with PBS containing 0.1 mM CaCl2 and 1 mM MgCl2, subsequently referred to as PBS-C-M. Cells were permeabilized with PBS-C-M-0.2% BSA-0.1% Triton for 10 min and then quenched with 50 mM NH4Cl in PBS-C-M for 10 min. Cells were rinsed with PBS-C-M-BSA-Triton and incubated for 1 h at room temperature with affinity-purified anti-rNIS antibody (Ab) (1 µg/µl) at 1:1000 dilution in PBS-C-M-BSA-Triton. Subsequently, cells were washed three times for 10 min with PBS-C-M-BSA-Triton, incubated for 1 h in the dark with antirabbit fluorescein-conjugated secondary Ab (Vector Laboratories, Inc., Burlingame, CA) (1:1000 dilution), and washed as above. Cover slips were mounted onto slides with Slow Fade antifade reagent (Molecular Probes, Inc., Eugene, OR), sealed with quick-dry nail polish, and allowed to dry in the dark for 2 h at room temperature and then stored at 4 C in the dark. Cells were visualized in a Radiance 2000 laser scanning confocal microscope (Bio-Rad Laboratories, Inc.).

Flow Cytometry
COS-7 cells expressing the 395 NIS substitutions were detached with trypsin, counted, and fixed in PBS containing 2% paraformaldehyde, after which they were permeabilized with 0.2% saponin in PBS supplemented with 0.1% BSA and transferred into Eppendorf tubes (Eppendorf North America, Inc., Madison, WI; 200,000 cells per tube). Next, they were incubated for 1 h at room temperature with 100 µl PBS-0.1% BSA-0.2% Sap containing anti-rNIS Ab (1 µg/µl) at a 1:1000 dilution. Cells were washed with 1 ml PBS-BSA-Sap and centrifuged as above. Next, they were incubated for 30 min at room temperature in the dark with fluorescein-conjugated antirabbit IgG (Vector Laboratories, Inc.) at a 1:1000 dilution in the same buffer. Cells were washed once again, centrifuged, and resuspended in 300 µl PBS. The fluorescence of 10,000 cells per tube was assayed by a fluorescence-activated cell sorting scan flow cytometer (Becton Dickinson and Co., Franklin Lakes, NJ).

Surface Biotinylation
Biotinylation experiments were performed essentially as described (23). Cells were grown in 12-well plates to 80% confluence. Cells were rinsed at 4 C twice with PBS/Ca2+/Mg2+ (138 mM NaCl; 2.7 mM KCl; 1.5 mM KH2PO4; 9.6 mM Na2HPO4; 1 mM MgCl2; 0.1 mM CaCl2; pH 7.4). Cells were next incubated with 500 µl/well of a solution containing 1.5 mg/ml sulfosuccinimidyl-2-(biotinamido)ethyl-1,3'-dithioproprionate (Pierce Chemical Co., Rockford, IL) in biotinylation buffer [HEPES 20 mM (pH 8.5), CaCl2 2 mM, NaCl 150 mM] for 20 min at 4 C with gentle shaking. The biotinylation solution was removed by two washes in PBS Ca2+/Mg2+ containing 100 mM glycine. Cells were lysed with 1 ml of lysis buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 5 mM EDTA; 1% Triton X-100; 1% sodium dodecyl sulfate; protease inhibitors) at 4 C for 15 min. Cell lysates were incubated overnight at 4 C with 50 µl of streptoavidin agarose beads (Pierce Chemical Co.). Beads were centrifuged at 5000 x g for 2 min and rinsed three times with lysis buffer, twice with high salt, and once with low salt solution. Adsorbed proteins were eluted from the beads with sample buffer containing 10 mM dithiothreitol, at 75 C for 5 min, and analyzed by immunoblot using anti-rNIS Ab.


    ACKNOWLEDGMENTS
 
We are grateful to Drs. J. S. Blanchard and A. Argyrides for their help and advice on the kinetic studies. We thank the members of the Carrasco laboratory for critical reading of the manuscript.


    FOOTNOTES
 
This work was supported by NIH Grant DK-41544 (to N.C.).

Abbreviations: Ab, Antibody; HBSS, Hanks’ balanced salt solution; ITD, iodide transport defect; NIS, Na+/I- symporter; PBS-C-M, PBS containing 0.1mM CaCl2 and 1 mM MgCl2; rNIS, rat NIS.

Received for publication February 15, 2002. Accepted for publication March 27, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Levy O, De La Vieja A, Carrasco N 1998 The Na+/I- symporter (NIS): recent advances. J Bioenerg Biomembr 30:195–206[CrossRef][Medline]
  2. De La Vieja, A, Dohan O, Carrasco N 2000 Molecular analysis of the sodium/iodide symporter: impact on thyroid and extrathyroid pathophysiology. Physiol Rev 80:1083–1105[Abstract/Free Full Text]
  3. Eskandari, S, Loo DDF, Dai G, Levy O, Wright EW, Carrasco N 1997 Thyroid Na+/I- symporter: mechanism, stoichiometry, and specificity. J Biol Chem 272:27230–27238[Abstract/Free Full Text]
  4. Dai G, Levy O, Carrasco N 1996 Cloning and characterization of the thyroid iodide transporter. Nature 379:458–460[CrossRef][Medline]
  5. Stanbury JB, Dumont JE 1983 Familiar goiter and related disorders. In: The metabolic basis of inherited disease. In: Stanbury JB, Wyngaarden JB, Fredrickson DS, Goldstein JL, Brown MS, eds. New York: McGraw-Hill; 231–269
  6. Wolff J 1983 Congenital goiter with defective iodide transport. Endocr Rev 4:240–254[Abstract/Free Full Text]
  7. Bikker H, Vulsma T, Baas F, de Vijlder JJM 1995 Identification of five novel inactivating mutations in the human thyroid peroxidase gene by denaturing gradient gel electrophoresis. Hum Mutat 6:9–16[CrossRef][Medline]
  8. Medeiros-Neto G, Targovnik HM, Vassart G 1993 Defective thyroglobulin synthesis and secretion causing goiter and hypothyroididsm. Endocr Rev 14:165–183[Abstract/Free Full Text]
  9. Sunthornthepvarukui T, Gottschalk ME, Hayashi Y, Refetoff S 1995 Brief report: resistance to thyrotropin caused by mutations in the thyrotropin receptor gene. N Engl J Med 332:155–160[Free Full Text]
  10. Smanik PA, Liu Q, Furminger TL, Ryu K, Xing S, Mazzaferri EL, Jhiang SM 1996 Cloning of the human sodium iodide symporter. Biochem Biophys Res Commun 226:339–345[CrossRef][Medline]
  11. Smanik PA, Ryu K, Theil KS, Mazzaferri EL, Jhiang SM 1997 Expression, exon-intron organization and chromosome mapping of the human sodium iodide symporter. Endocrinology 138:3555–3558[Abstract/Free Full Text]
  12. Kosugi S, Inoue S, Matsuda A, Jhiang S 1998 Novel missense and loss-of-function mutations in the sodium/iodide symporter gene causing iodide transport defect in three Japanese patients. J Clin Endocrinol Metab 83:3373–3376[Abstract/Free Full Text]
  13. Pohlenz J, Medeiros-Neto G, Gross JL, Silveiro SP, Knobel M, Refetoff S 1997 Hypothyroidism in a Brazilian kindred due to iodide trapping defect caused by a homozygous mutation in the sodium/iodide symporter gene. Biochem Biophys Res Commun 240:488–491[CrossRef][Medline]
  14. Fujiwara H, Tatsumi K, Miki K, Harada T, Okada S, Nose O, Kodama S, Amino N 1998 Recurrent T354P mutation of the Na+/I- symporter in patients with iodide transport defect. J Clin Endocrinol Metab 83:2940–2943[Abstract/Free Full Text]
  15. Pohlenz J, Rosenthal M, Weiss RE, Jhiang SM, Burant C, Refetoff S 1998 Congenital hypothyroidism due to mutations in the sodium/iodide symporter. Identification of a nonsense mutation producing a downstream cryptic 3' splice site. J Clin Invest 101:1028–1035[Medline]
  16. Fujiwara H, Tatsumi K, Tanaka S, Kimura M, Nose O, Amino N 2000 A novel V59E missense mutation in the sodium iodide symporter gene in a family with iodide transport defect. Thyroid 10:471–474[Medline]
  17. Levy O, Ginter CS, De la Vieja A, Levy O, Carrasco N 1998 Identification of a structural requirement for thyroid Na+/I- symporter (NIS) function from analysis of a mutation that causes human congenital hypothyroidism. FEBS Lett 429:36–40[CrossRef][Medline]
  18. Pohlenz J, Duprez L, Weiss RE, Vassart G, Refetoff S, Costagliola S 2000 Failure of membrane targeting causes the functional defect of two mutant sodium iodide symporters. J Clin Endocrinol Metab 85:2366–2369[Abstract/Free Full Text]
  19. Kosugi S, Bhayana S, Dean HJ 1999 A novel mutation in the sodium/iodide symporter gene in the largest family with iodide transport defect. J Clin Endocrinol Metab 84:3248–3253[Abstract/Free Full Text]
  20. Couch RM, Dean HJ, Winter JSD 1985 Congenital hypothyroidism caused by defective iodide transport. J Pediatr 106:950–953[CrossRef][Medline]
  21. Levy O, Dai G, Riedel C, Ginter CS, Paul EM, Lebowitz AN, Carrasco N 1997 Characterization of the thyroid Na+/I- symporter with an anti-COOH terminus antibody. Proc Natl Acad Sci USA 94:5568–5573[Abstract/Free Full Text]
  22. Kissane JM, Robbins E 1958 The fluorometric measurement of deoxyribonucleic acid in animal tissues with special reference to the central nervous system. J Biol Chem 233:184[Free Full Text]
  23. Chen JG, Liu-Chen S, Rudnick G 1997 External cysteine residues in the serotonin transporter. Biochemistry 36:1479–1486[CrossRef][Medline]
  24. Skach WR 2000 Defects in processing and trafficking of the cystic fibrosis transmembrane conductance regulator. Kidney Int 57:825–831[CrossRef][Medline]
  25. Martin MG, Turk E, Lostao MP, Kerner C, Wright EM 1996 Defects in Na+/glucose cotransporter (SGLT1) trafficking and function cause glucose-galactose malabsorption. Nat Genet 12:216–220[CrossRef][Medline]
  26. Jones TA, Zou JY, Cowan SW, Kjeldgaard M 1991 Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr A47:110–119
  27. Evans SV 1993 SETOR: hardware-lighted three-dimensional solid model representation of macromolecules. J Mol Graph 11:134–138[CrossRef][Medline]
  28. Press WH, Flannery BP, Teukolsky SA, Wetterling WT 1986 Numerical recipes: the art of scientific computing. Cambridge, UK: Cambridge University Press; 523–528



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. Bizhanova and P. Kopp
The Sodium-Iodide Symporter NIS and Pendrin in Iodide Homeostasis of the Thyroid
Endocrinology, March 1, 2009; 150(3): 1084 - 1090.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S.-L. Wu, T.-Y. Ho, J.-A. Liang, and C.-Y. Hsiang
Histidine residue at position 226 is critical for iodide uptake activity of human sodium/iodide symporter
J. Endocrinol., November 1, 2008; 199(2): 213 - 219.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. D. Reed-Tsur, A. De la Vieja, C. S. Ginter, and N. Carrasco
Molecular Characterization of V59E NIS, a Na+/I- Symporter Mutant that Causes Congenital I- Transport Defect
Endocrinology, June 1, 2008; 149(6): 3077 - 3084.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Dayem, C. Basquin, V. Navarro, P. Carrier, R. Marsault, P. Chang, S. Huc, E. Darrouzet, S. Lindenthal, and T. Pourcher
Comparison of expressed human and mouse sodium/iodide symporters reveals differences in transport properties and subcellular localization
J. Endocrinol., April 1, 2008; 197(1): 95 - 109.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. D. Vadysirisack, E. S.-W. Chen, Z. Zhang, M.-D. Tsai, G.-D. Chang, and S. M. Jhiang
Identification of in Vivo Phosphorylation Sites and Their Functional Significance in the Sodium Iodide Symporter
J. Biol. Chem., December 21, 2007; 282(51): 36820 - 36828.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Dohan, C. Portulano, C. Basquin, A. Reyna-Neyra, L. M. Amzel, and N. Carrasco
The Na+/I symporter (NIS) mediates electroneutral active transport of the environmental pollutant perchlorate
PNAS, December 18, 2007; 104(51): 20250 - 20255.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D. D Vadysirisack, A. Venkateswaran, Z. Zhang, and S. M Jhiang
MEK signaling modulates sodium iodide symporter at multiple levels and in a paradoxical manner
Endocr. Relat. Cancer, June 1, 2007; 14(2): 421 - 432.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. J. Rhoden, S. Cianchetta, V. Stivani, C. Portulano, L. J. V. Galietta, and G. Romeo
Cell-based imaging of sodium iodide symporter activity with the yellow fluorescent protein variant YFP-H148Q/I152L
Am J Physiol Cell Physiol, February 1, 2007; 292(2): C814 - C823.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
G. Riesco-Eizaguirre and P. Santisteban
A perspective view of sodium iodide symporter research and its clinical implications.
Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. C. Arufe, M. Lu, A. Kubo, G. Keller, T. F. Davies, and R.-Y. Lin
Directed Differentiation of Mouse Embryonic Stem Cells into Thyroid Follicular Cells
Endocrinology, June 1, 2006; 147(6): 3007 - 3015.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Paroder, S. R. Spencer, M. Paroder, D. Arango, S. Schwartz Jr., J. M. Mariadason, L. H. Augenlicht, S. Eskandari, and N. Carrasco
Na+/monocarboxylate transport (SMCT) protein expression correlates with survival in colon cancer: Molecular characterization of SMCT
PNAS, May 9, 2006; 103(19): 7270 - 7275.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
O. Dohan, A. De la Vieja, and N. Carrasco
Hydrocortisone and Purinergic Signaling Stimulate Sodium/Iodide Symporter (NIS)-Mediated Iodide Transport in Breast Cancer Cells
Mol. Endocrinol., May 1, 2006; 20(5): 1121 - 1137.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Szinnai, S. Kosugi, C. Derrien, N. Lucidarme, V. David, P. Czernichow, and M. Polak
Extending the Clinical Heterogeneity of Iodide Transport Defect (ITD): A Novel Mutation R124H of the Sodium/Iodide Symporter Gene and Review of Genotype-Phenotype Correlations in ITD
J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1199 - 1204.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. De la Vieja, C. S. Ginter, and N. Carrasco
Molecular Analysis of a Congenital Iodide Transport Defect: G543E Impairs Maturation and Trafficking of the Na+/I- Symporter
Mol. Endocrinol., November 1, 2005; 19(11): 2847 - 2858.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Z. Zhang, Y.-Y. Liu, and S. M. Jhiang
Cell Surface Targeting Accounts for the Difference in Iodide Uptake Activity between Human Na+/I- Symporter and Rat Na+/I- Symporter
J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6131 - 6140.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
L. S. Zuckier, O. Dohan, Y. Li, C. J. Chang, N. Carrasco, and E. Dadachova
Kinetics of Perrhenate Uptake and Comparative Biodistribution of Perrhenate, Pertechnetate, and Iodide by NaI Symporter-Expressing Tissues In Vivo
J. Nucl. Med., March 1, 2004; 45(3): 500 - 507.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
A. De la Vieja, C. S. Ginter, and N. Carrasco
The Q267E mutation in the sodium/iodide symporter (NIS) causes congenital iodide transport defect (ITD) by decreasing the NIS turnover number
J. Cell Sci., February 15, 2004; 117(5): 677 - 687.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
O. Dohan, A. De la Vieja, V. Paroder, C. Riedel, M. Artani, M. Reed, C. S. Ginter, and N. Carrasco
The Sodium/Iodide Symporter (NIS): Characterization, Regulation, and Medical Significance
Endocr. Rev., February 1, 2003; 24(1): 48 - 77.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dohán, O.
Right arrow Articles by Carrasco, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dohán, O.
Right arrow Articles by Carrasco, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals