help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0055
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Molecular Endocrinology 16 (8): 1943-1950
Copyright © 2002 by The Endocrine Society

Steroid Deficiency Syndromes in Mice with Targeted Disruption of Cyp11a1

Meng-Chun Hu, Nai-Chi Hsu, Noomen Ben El Hadj, Chin-I Pai, Hsueh-Ping Chu, Chi-Kuang Leo Wang and Bon-chu Chung

Institute of Molecular Biology, Academia Sinica, Nankang, Taipei 115, Taiwan

Address all correspondence and requests for reprints to: Dr. Bon-chu Chung, Institute of Molecular Biology, 48 Academia Sinica, Nankang, Taipei 115, Taiwan. E-mail: mbchung{at}sinica.edu.tw.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Steroid deficiencies are diseases affecting salt levels, sugar levels, and sexual differentiation. To study steroid deficiency in more detail, we used a gene-targeting technique to insert a neo gene into the first exon to disrupt Cyp11a1, the first gene in steroid biosynthetic pathways. Cyp11a1 null mice do not synthesize steroids. They die shortly after birth, but can be rescued by steroid injection. Due to the lack of feedback inhibition by glucocorticoid, their circulating ACTH levels are exceedingly high; this results in ectopic Cyp21 gene expression in the testis. Male Cyp11a1 null mice are feminized with female external genitalia and underdeveloped male accessory sex organs. Their testis, epididymis, and vas deferens are present, but undersized. In addition, their adrenals and gonads accumulate excessive amounts of lipid. The lack of steroid production, abnormal gene expression, and aberrant reproductive organ development resemble various steroid deficiency syndromes, making these mice good models for studies of steroid function and regulation.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
STEROID HORMONES include mineralocorticoids, glucocorticoids, and sex hormones. They are synthesized from a common precursor, cholesterol, which is the substrate for cytochrome P450scc (cholesterol side-chain cleavage enzyme, CYP11A1) in the first and rate-liming step of steroidogenic pathways. Cyp11a1 is expressed in the adrenal cortex, testis Leydig cells, and ovary, all of which are the main sites of steroid production. The expression of Cyp11a1 is under stringent control (1, 2).

The expression of Cyp11a1 in steroidogenic cells is controlled by the pituitary. ACTH stimulates the expression of Cyp11a1 in the adrenal to increase steroid output (3). Steroids in high concentrations then travel through the circulation to the hypothalamus and pituitary to inhibit ACTH release. This hypothalamus-pituitary-adrenal axis maintains steroid balance in the body. Defects in any part of the loop often disrupt endocrine balance, leading to a diseased state. Decreased cortisol secretion from the adrenal is a major cause of congenital adrenal hyperplasia, resulting in virilization (4). On the other hand, chronic glucocorticoid excess leads to Cushing’s disease, characterized by obesity, hypertension, gonadal dysfunction, and other problems (5).

The CYP11A1 mutation has been described in a patient with adrenal insufficiency (6). Similarly, a strain of rabbit deficient for Cyp11a1 shows adrenal insufficiency and male sex reversal (7). The detailed pathological changes in Cyp11a1 deficiency, however, were not analyzed further due to the difficulty of handling humans and rabbits for experimentation. To create a model system amenable to studies of steroid function in detail, we generated a mutant mouse strain that is deficient in steroid synthesis by targeted disruption of Cyp11a1. Our results show that fetal mice deficient of steroid synthesis can survive to term, but die soon after birth. We also showed that steroid deficiency leads to problems of sexual development, imbalance of hormone homeostasis, and disturbed gene regulation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Mice with Targeted Disruption of Cyp11a1
To establish an animal model to study the functions of steroids, we used homologous recombination to generate ES cell clones that contained an insertion of the neo gene in exon 1 of the Cyp11a1 gene (Fig. 1AGo). Through homologous recombination we obtained two ES clones, both of which were used for blastocyst injection to generate mouse lines with targeted disruption of Cyp11a1. The genotypes of mice were identified by Southern blot hybridization using both 5' and 3' probes. The 3' probe detected a BamHI fragment of 4 kb in the wild-type allele and a 6-kb fragment in the mutant allele due to insertion of the neo gene (Fig. 1BGo). Alternatively, the wild-type and mutant alleles were distinguished by PCR, as shown in Fig. 1CGo. Heterozygous animals were fertile and apparently normal. The birth of wild-type, heterozygous, and homozygous knockout mice from heterozygous parents followed a 1:2:1 ratio, indicating no loss of mice during gestation. The same phenotypes were observed in knockout mice derived from the two ES clones.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 1. Targeting Strategy and Genotypic Analysis of Cyp11a1 Knockout Mice

A, Targeting strategy. The neo gene is inserted into the first exon of the Cyp11a1 gene to eliminate its function. {blacksquare}, The exons of Cyp11a1. {square}, Genes of thymidine kinase (TK) and neo. TK is in the opposite orientation, whereas the neo gene is in the same orientation as the Cyp11a1 gene. B, BamHI; X, XbaI; S, ScaI; E1, exon 1; E2, exon 2. B, Southern blot analysis of mouse genotypes. The wild-type allele hybridized to a 3' XbaI-BamHI DNA probe as a 4-kb band, whereas the disrupted allele showed a 6-kb band of hybridization. C, PCR analysis of mouse genotypes. The neo and scc genes were detected in one litter of mice using the same reverse primer, but distinct forward primers are shown in A. The genotypes are written on top of each lane. +/+, Wild type; +/-, heterozygotes; -/-, homozygous knockout.

 
Aberrant Gene Expression in Cyp11a1 Null Mice
To examine whether insertion of the neo gene disrupted Cyp11a1, we analyzed CYP11A1 expression in adrenal and testis by immunoblot analysis. CYP11A1 was detected in adrenal and testis extracts of the wild-type and heterozygous littermates, but was absent in homozygous knockout mice (Fig. 2AGo). This confirmed that our gene targeting strategy generated a null allele at the Cyp11a1 locus. We also determined the gene expression level of a related protein, CYP21, as a control. CYP21, also termed P450c21, is a steroid hydroxylase participating in the synthesis of mineralocorticoid and glucocorticoid, but not sex hormones; it is usually expressed in the adrenals, but not gonads (8). Examining expression by Western blot analysis, we detected CYP21 in the adrenals of wild-type, heterozygous, and homozygous mice, indicating that adrenal CYP21 levels were unchanged by disruption of Cyp11a1 (Fig. 2AGo). In contrast, in the testes of knockout mice, we detected ectopic CYP21, which was absent in normal and heterozygous testes (Fig. 2AGo). To further investigate the site of this ectopic Cyp21 expression, we in situ hybridized sections of knockout testes with the Cyp21 probe to detect its expression in the interstitial cells (Fig. 2BGo). These interstitial cells normally express Cyp11a1, but not Cyp21, for the production of androgens (9).



View larger version (63K):
[in this window]
[in a new window]
 
Figure 2. Lack of Cyp11a1 Expression and Ectopic Cyp21 Expression in Cyp11a1 Null Mice

A, Detection of CYP11A1 and CYP21 in testis and adrenal of wild-type (+/+), heterozygous (+/-), and homozygous (-/-) knockout mice by Western blot analysis. CYP11A1 is not detected in adrenal and testis of homozygous knockout mice. CYP21 is not detected in the testis of wild-type and heterozygous knockout mice, but is detected in the homozygous knockout mice. B, In situ hybridization for Cyp21 mRNA in the testis of Cyp11a1 null mice. The arrows indicate the interstitial cells in which Cyp21 was ectopically expressed.

 
Abnormal Steroid and Electrolyte Levels in Cyp11a1 Null Mice
Most Cyp11a1 null mice died within 1–2 d after birth with symptoms of apparent dehydration. Few survived past 7 d. As CYP11A1 is the first enzyme in the synthesis of steroid hormones (1), its absence should abolish steroid synthesis. We therefore measured serum levels of two major steroids, corticosterone and aldosterone, in neonatal mice. Levels of the predominant glucocorticoid, corticosterone, in the homozygous knockout mice were reduced by 30-fold compared with those in wild-type littermates (Table 1Go). Similarly, levels of the major mineralocorticoid, aldosterone, were decreased by more than 250-fold. As glucocorticoid is the major feedback inhibitor in the hypothalamus-pituitary-adrenal axis, its absence should lead to enhanced levels of ACTH. Indeed, the circulating levels of ACTH were increased about 200-fold in 2-d-old Cyp11a1 null mice compared with wild-type littermates.


View this table:
[in this window]
[in a new window]
 
Table 1. Hormonal and Salt Levels in Cyp11a1 Null Mice

 
Because mineralocorticoid controls electrolyte balance, we checked whether impaired aldosterone secretion would disturb Na+ and K+ levels in the Cyp11a1-disrupted mice. Serum sodium concentrations were decreased, and serum potassium concentrations were increased in the Cyp11a1 null mice (Table 1Go). In urine the result was less apparent, but sodium concentrations in knockout mice were still aberrantly elevated. This electrolyte imbalance explained the apparent water loss and death of the neonatal Cyp11a1 null mice. We were able to sustain their life to adulthood with daily injection of corticosteroids, further corroborating that the main cause of death is the lack of corticosteroids.

As knockout mice survived until birth without apparent steroid deficiency at the fetal stage, the hormonal status of fetuses was examined. The corticosterone levels of Cyp11a1-disrupted mice on embryonic d 18.5 (E18.5) were similar to those of the wild-type siblings (Table 1Go), probably due to the supply of maternal corticosteroids through the placenta. This could explain why fetal mice developed fully to term. Yet, the plasma ACTH levels of the Cyp11a1 knockout embryos on E18.5 were much higher than those of the wild-type embryos, indicating that glucocorticoid levels were probably still subnormal at this fetal stage.

Abnormal Male Reproductive Systems in Cyp11a1 Null Mice
Cyp11a1 knockout mice manifested growth retardation, muscle atrophy, dehydration, lethargy, and anorexia. In addition, XY Cyp11a1 knockout pups exhibited features of sex reversal, such as external female genitalia with short ano-genital distance, appearance of nipples, absence of scrotum, and smaller prepuce than the wild-type males (Fig. 3Go, a–d). We further examined the internal genitalia and noted that testis, epididymis, and vas deferens were smaller than those of the wild-type males; seminal vesicles and prostate were not developed. Male accessory sex organs, such as seminal vesicles, bulbourethral gland, prostate, coagulating gland, ampulla, and penis, were all absent at 30 d of age (Fig. 3eGo).



View larger version (83K):
[in this window]
[in a new window]
 
Figure 3. Male to Female Sex Reversal (a–d) and Underdeveloped Genital Tract in Corticotherapy-Rescued Cyp11a1 Null Mice (e)

a, The distance between anus and prepuce is great in the normal 10-d-old males. b–d, Nipples persist, and the ano-genital distance is small in female genitalia. e, XY internal genitalia at 30 d of age, +/+ (left) and -/- (right). The bladder was removed from the +/+ genital tract to reveal the ampullary region. Testis (T), epididymis (Ep), vas deferens (VD), and preputial gland (PG) are smaller in the homozygous knockout mice. Seminal vesicles (SV), prostate (P), and bulbourethral gland (BUG) are all absent. The lower part of the urogenital sinus differentiated into a vagina-like structure (V). B, Bladder; K, kidney; Ur, ureter.

 
To investigate further the apparent degeneration of male internal genitalia, we compared histological sections of testis, epididymis, and vas deferens of wild-type and Cyp11a1 null mice at 23 d of age (Fig. 4Go). Unlike wild-type testis, which contains primary and secondary spermatocytes, the knockout testis has disorganized seminiferous tubules containing only spermatocytes with condensed chromatin surrounded by a white halo and clear cytoplasm (Fig. 4Go, a and b). Histological sections of the Cyp11a1 null epididymis revealed reduced tubule size, smaller columnar epithelium, and absence of microvilli (Fig. 4Go, c and d). The vas deferens of the Cyp11a1 knockout mice lacked microvilli that extend from the epithelium, and the thickness of the muscle layer and the lumen diameter were considerably reduced (Fig. 4Go, e and f). These histological abnormalities illustrated differentiation blocks of male internal genitalia of Cyp11a1 null mice.



View larger version (149K):
[in this window]
[in a new window]
 
Figure 4. Degeneration of Testis, Epididymis, and Vas Deferens from Cyp11a1 Knockout Mice

Tissue sections of 23-d-old wildtype (a, c, and e) and rescued Cyp11a1 null (b, d, and f) mice are shown. The wild-type male testis (a) has normal seminiferous tubule, presenting spermatogonia (Sg), primary spermatocyte (P), and secondary spermatocyte (SII). The knockout seminiferous tubule (b) is abnormal, with spermatocytes arrested at the meiotic stage (arrow). The wild-type epididymis (c) has long microvilli (arrow) inside the tubule lined by columnar epithelia. The size of epithelial cells and the lumen of the tubule from the knockout epididymis (d) are reduced. Microvilli within the lumen are absent. e, Wild-type vas deferens is composed of a thick muscular tube lined by columnar epithelium (E); microvilli (arrow) are present inside the duct. SM, Smooth muscle. f, -/- vas deferens. Although the general structure is conserved, the thicknesses of the duct, and the lumen are reduced, and the epithelium lacks microvilli.

 
Abnormal Adrenal Glands of Cyp11a1 Null Mice
As one of the major defects of Cyp11a1 null mice is the lack of synthesis of adrenal steroids, we examined adrenal structures in detail. The Cyp11a1-null adrenal glands were smaller, with disorganized adrenal cortex. Closer examination of histological sections revealed adrenocortical cells on postnatal d 2, with enlarged and vacuolated cytoplasm (Fig. 5Go). This abnormality was apparent even on embryonic d 18.5, when vacuoles were already present inside adrenocortical cells (Fig. 5Go).



View larger version (137K):
[in this window]
[in a new window]
 
Figure 5. Histological Examination of Gonads and Adrenal Glands of Wild-Type (a, c, e, and g) and Cyp11a1 Knockout Mice (b, d, f, and h)

Insets show higher magnification of the cells. Adrenocortical region of mice on E18.5 (a and b) and postnatal d 2 (c and d) show that cells of the -/- mice are disorganized and vacuolated. Testes of 2-d-old mice (e and f) and ovaries of 7-d-old mice without rescue (g and h) appear to be normal by hematoxylin-eosin staining. dpp, Days post partum; dpc, days post coitum.

 
In contrast to the degenerating adrenal, both testis and ovary of Cyp11a1 null mice remained relatively intact neonatally. The seminiferous tubules of the testis contained healthy spermatogonia, and the primordial follicles of the ovary also appeared normal (Fig. 5Go). We also analyzed the lungs and kidneys of newborn Cyp11a1 null mice and found no histological abnormalities (data not shown).

Lipid Accumulation in Steroidogenic Tissues of Cyp11a1 Null Mice
As CYP11A1 catalyzes steroid synthesis, its deficiency should lead to the accumulation of its precursor, cholesterol. We examined whether lipid accumulated in the steroidogenic tissues of Cyp11a1 null mice. Oil Red O staining of the adrenal showed excessive accumulation of large oil droplets in the cortex of Cyp11a1 null mice on postnatal d 2 (Fig. 6Go). This oil droplet results in the appearance of foamy cytoplasm, as detected by hematoxylin-eosin staining (Fig. 5Go). The Cyp11a1 null testis also accumulated higher levels of lipid in the interstitial cells on d 2 (Fig. 6Go). There was no obvious lipid deposition in ovaries of Cyp11a1 null neonates. However, 13 d after birth, lipid accumulation increased in the interstitial cells around the follicles (Fig. 6Go).



View larger version (123K):
[in this window]
[in a new window]
 
Figure 6. Accumulation of Lipid in the Steroidogenic Cells of Cyp11a1 Knockout Mice

Lipid accumulation is revealed as heavy red staining with Oil Red O in the adrenal and testis sections of 2-d-old Cyp11a1 null (-/-) and the ovary section of the 13-d-old, glucocorticoid/mineralocorticoid-treated Cyp11a1 null (-/-) mouse, but much less in wild-type (+/+) mouse tissue sections. dpp, Days post partum.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We have analyzed the consequences of Cyp11a1 disruption using the strategy of mouse gene targeting. As CYP11A1 is the first enzyme of all steroidogenic pathways, its elimination results in syndromes of steroid deficiency, including electrolyte imbalance, aberrant gene regulation, and suppression of male sex organ development. These knockout mice can be used to study the function and regulation of steroids.

Mutations of Cyp11a1 have been described in several species. A human patient with a heterozygous mutation in the CYP11A1 gene suffered from adrenal insufficiency and male to female sex reversal, indicating haploid insufficiency (6). The steroid deficiencies we described in this knockout mouse model and that from rabbits, however, are due to homozygous mutations of Cyp11a1. A strain of rabbit inherits deletion of Cyp11a1, resulting in steroid deficiency, female external genitalia, and death (7, 10). As mice are more amenable to experimental manipulations, the Cyp11a1 knockout mouse described in this report should be more useful for detailed analyses.

The male Cyp11a1 null mice exhibit features of male to female sex reversal, as shown by female external genitalia and underdevelopment of male accessory sex organs. This reflects the lack of androgens, which control differentiation of the Wolffian duct derivatives (epididymis, vas deferens, and seminal vesicles), urogenital sinus (prostate and bulbourethral gland), and external genitalia (11). This phenotype is similar to that of testicular feminization syndrome of both humans and mice, which is due to mutations of the androgen receptor gene (12, 13). It is consistent with the idea that androgen and its receptor are acting in the same signaling pathways.

One interesting phenomenon regarding the development of male accessory sex organs in Cyp11a1 null mice is the presence of anterior sex glands such as epididymis and vas deferens, contrasting with the complete absence of the more posterior accessory sex organs, such as seminal vesicles, prostates, and bulbourethral glands. This is probably due to the difference in timing of organ differentiation. The posterior accessory glands develop postnatally (11). At this stage probably very little androgen is available in knockout mice for their development. Therefore, we observe complete absence of these organs. The Wolffian duct derivatives, on the other hand, start to develop embryonically. Our results indicate that some androgen may be present in these fetal knockout mice. The source of androgen in the knockout fetus remains unknown. It could be synthesized from maternal steroids that cross the placenta, but other sources are not ruled out.

Cyp11a1-disrupted mice are deficient in the synthesis of all steroids. They should, therefore, show phenotypes similar to those of steroid receptor null mice. We indeed found very similar deficiencies, but there were also variations. The Cyp11a1 null mice cannot conserve salt, resembling the situation found in mineralocorticoid receptor-deficient mice (14). The glucocorticoid receptor knockout mice die of pulmonary problems neonatally, indicating the importance of glucocorticoid in lung maturation (15). Many of the Cyp11a1 null mice, however, have histologically normal lungs at birth. This is due to the embryonic requirement of glucocorticoid for lung maturation (16). At this time, maternal glucocorticoid can be transferred to the Cyp11a1 null fetus via the placenta for normal development of the lung (16). We indeed detected largely normal levels of corticosterone in the E18.5 embryo (Table 1Go). This maternal supply of steroids is probably the reason why Cyp11a1 null mice survived to birth. This maternal supply of steroids may also explain the partial development of Wolffian duct derivatives such as epididymis and vas deferens in male Cyp11a1 knockout mice.

The fetal development of Cyp11a1 null mice, however, is not entirely normal. We found lipid accumulation in the fetal adrenal at 18.5 d post coitum. This is because the lack of CYP11A1 enzymatic activity leads to the accumulation of its substrate, cholesterol. This accumulation of lipid cannot be compensated for by maternal steroid supply. The increased accumulation of fat in steroidogenic tissues such as adrenal cortex and testis Leydig cells eventually leads to cell damage and tissue atrophy. This phenomenon of lipid accumulation is very similar to that of congenital adrenal lipoid hyperplasia due to the deficiency of steroidogenic acute regulatory protein (StAR) (17), which transports cholesterol into the inner mitochondrial membrane for use as a substrate of CYP11A1 (18). StAR null mice suffer from steroid deficiency (19), with a phenotype very similar to that in Cyp11a1 null mice. Although located in the same pathway of cholesterol utilization, StAR and CYP11A1 deficiencies may have subtle differences in the type of mitochondrial damage caused by lipid droplets. In StAR deficiency, cholesterol cannot be transported to inner mitochondrial membrane, whereas in Cyp11a1 deficiency, cholesterol can be transported, but cannot be used by mitochondria. It will be interesting to compare mitochondrial lipid deposits in the adrenal, testis, and ovary of Cyp11a1and StAR knockout mice by electron microscopy.

Accompanying the decreased synthesis of corticosterone in the Cyp11a1 null mice is the aberrantly high level of ACTH secretion due to the lack of feedback inhibition in the hypothalamus-pituitary-adrenal axis. One consequence of this could be abnormal gene expression. We did observe ectopic expression of Cyp21 in the testis (Fig. 2Go). Ectopic Cyp21 expression has been described in patients with testicular growth of adrenal rest (20), which refers to growths in the adult testis of embryonic adrenal origin. This adrenal rest is often found when circulating ACTH levels are abnormally high. Disturbance in steroid secretion would result in aberrant expression of many other genes. Gene profiling experiments are therefore being carried out to investigate in detail the deregulation of gene expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Generation of Cyp11a1 Knockout Mice
The mouse Cyp11a1 gene was cloned from a strain 129/SvJ BAC library (Incyte Genomics, Palo Alto, CA). A BamHI-XbaI fragment of approximately 7 kb, containing exons 1 and 2, was subcloned. To assemble the targeting construct, a neo gene was inserted into a unique ScaI site within exon 1 to disrupt the Cyp11a1 reading frame. The TK gene was added to increase the efficiency of finding targeted ES cells (Fig. 1Go). The targeting construct was introduced into the 129/SvJ ES cell line (purchased from Incyte Genomics) by electroporation, followed by exposure to gancyclovir and G418. Clones surviving double selection were screened by Southern blotting and hybridization using 3' and 5' probes. Of 423 clones screened, 2 targeted clones were obtained and injected into C57BL/6 blastocysts for the production of chimeras. Heterozygotes were screened by Southern blot for the presence of the targeted Cyp11a1 gene. G2 offspring and subsequent generations were backcrossed on the C57BL/6 genetic background and were genotyped by a PCR-based strategy with the following primer sets: for Cyp11a1, primers scc-186 (sense; TGCCAGTGTTTGCCTAACTC) and scc+163 (antisense; TGCTAGTAGAGGTACCAGCT) were used; and for neo, primers neo+720 (sense; ATCGCCTTCTATCGCCTTCT) and scc+163 (antisense) were used. Animals were maintained in specific pathogen-free environment with light-dark control under standard laboratory conditions following the guidelines of the institutional animal committee. All analyses were performed using mice with a mixed genetic background of 129/SvJ and C57BL/6. The use of mice complied with the guidelines set forth by the Institute.

Corticotherapy of Cyp11a1 Null Mice
Cyp11a1 null mice were rescued with daily injection of 20 µl dexamethasone 21-phosphate (4 µg/ml), prednisolone 21-hemisuccinate (4 µg/ml), and fludrocortisone acetate (10 µg/ml) from birth until termination of the experiments.

Histological Analyses
Individual organs were fixed in either 4% paraformaldehyde or Bouin’s solution for 24 h following standard sectioning methods and staining in hematoxylin/eosin. For Oil Red O staining, frozen tissue sections were stained with Oil Red O (Sigma, St. Louis, MO) and counterstained with hematoxylin.

Hormone Assays and Urine Measurement
Hormonal analyses were performed with RIA kits for corticosterone (ICN Biomedicals, Inc., Palo Alto, CA), aldosterone (Diagnostic Products, Los Angeles, CA), and ACTH (Nichols Institute Diagnostics, San Juan Capistrano, CA) according to the manufacturer’s instructions. Concentrations of Na+ and K+ were determined by standard atomic absorption flame photometry. The values are presented as the mean ± SD. Unpaired t tests were used to determine statistical significance.

Western Blot and In Situ Hybridization
Proteins (5 µg) were isolated from adrenals and testes by homogenization in lysis solution [100 mM potassium phosphate (pH 7.8), 0.2% Triton X-100, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfhydrylfluoride, and 5 µg/ml leupeptin] and then subjected to standard Western blot procedures. Membranes were incubated first with primary antibodies against CYP11A1 or CYP21 (21, 22), then with secondary antibodies (goat antirabbit horseradish peroxidase, 1:10,000), followed by detection with chemiluminescence. In situ hybridization was performed as described previously (23), using a probe synthesized with T7 polymerase from Cyp21 cDNA (plasmid 446) (24).


    ACKNOWLEDGMENTS
 
We thank Dr. Keith Parker for Cyp21 cDNA, Shu-Jan Chou for excellent technical assistance, Wei-Chen Lin for help in statistical analysis, and the Transgenic Core Facility at Academia Sinica for the generation of knockout mouse lines.


    FOOTNOTES
 
This work was supported by Grant NSC 90-2311-B-001-051 from the National Science Council and by Academia Sinica, Republic of China.

Abbreviations: E18.5, Embryonic d 18.5; StAR, steroidogenic acute regulatory protein.

Received for publication February 1, 2002. Accepted for publication April 18, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chung B-c, Guo I-C, Chou S-J 1997 Transcriptional regulation of the CYP11A1 and ferredoxin genes. Steroids 62:37–42[CrossRef][Medline]
  2. Miller WL 1988 Molecular biology of steroid hormone synthesis. Endocr Rev 9:295–318[Abstract/Free Full Text]
  3. Simpson ER, Waterman MR 1988 Regulation of the synthesis of steroidogenic enzymes in adrenal cortical cells by ACTH. Annu Rev Physiol 50:427–440[CrossRef][Medline]
  4. Miller WL, Morel Y 1989 The molecular genetics of 21-hydroxylase deficiency. Annu Rev Genet 23:371–393[CrossRef][Medline]
  5. Aron DC, Tyrrell JB 1994 Glucocorticoids and adrenal androgens. In: Greenspan FS, Baxter JD, eds. Basic and clinical endocrinology. 4th ed. Norwalk: Appleton & Lange; 307–346
  6. Tajima T, Fujieda K, Kouda N, Nakae J, Miller WL 2001 Heterozygous mutation in the cholesterol side chain cleavage enzyme (p450scc) gene in a patient with 46,XY sex reversal and adrenal insufficiency. J Clin Endocrinol Metab 86:3820–3825[Abstract/Free Full Text]
  7. Pang S, Yang X, Wang M, Tissot R, Nino M, Manaligod J, Bullock LP, Mason JI 1992 Inherited congenital adrenal hyperplasia in the rabbit: absent cholesterol side-chain cleavage cytochrome P450 gene expression. Endocrinology 131:181–186[Abstract/Free Full Text]
  8. Chung B-c 1996 Reactions carried out by P450c21 and P450c17. In: Jefcoate CR, ed. Advances in molecular and cell biology. Greenwich: JAI Press; 203–223
  9. Hu M-C, Huang Y-Y, Hsu N-C, Li H, Chung B-c 1999 Tissue-specific, hormonal and developmental regulation of CYP11A1/LacZ expression in transgenic mice leads to adrenocortical zone characterization. Endocrinology 140:5609–5618[Abstract/Free Full Text]
  10. Yang X, Iwamoto K, Wang M, Artwohl J, Mason JI, Pang S 1993 Inherited congenital adrenal hyperplasia in the rabbit is caused by a deletion in the gene encoding cytochrome P450 cholesterol side-chain cleavage enzyme. Endocrinology 132:1977–1982[Abstract/Free Full Text]
  11. Cunha GR, Lung B 1979 Development of male accessory glands. In: Hafez ES, Spring-Mills E, eds. Accessory glands of the male reproductive tract. Ann Arbor: Ann Arbor Science; 1–28
  12. Griffin JE 1992 Androgen resistance–the clinical and molecular spectrum. N Engl J Med 326:611–618[Medline]
  13. Goldstein JL, Wilson JD 1972 Studies on the pathogenesis of the pseudohermaphroditism in the mouse with testicular feminization. J Clin Invest 51:1647–1658
  14. Berger S, Bleich M, Schmid W, Cole TJ, Peters J, Watanabe H, Kriz W, Warth R, Greger R, Schutz G 1998 Mineralocorticoid receptor knockout mice: pathophysiology of Na+ metabolism. Proc Natl Acad Sci USA 95:9424–9429[Abstract/Free Full Text]
  15. Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K, Schutz G 1995 Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 9:1608–1621[Abstract/Free Full Text]
  16. Smith GW, Aubry JM, Dellu F, Contarino A, Bilezikjian LM, Gold LH, Chen R, Marchuk Y, Hauser C, Bentley CA, Sawchenko PE, Koob GF, Vale W, Lee KF 1998 Corticotropin releasing factor receptor 1-deficient mice display decreased anxiety, impaired stress response, and aberrant neuroendocrine development. Neuron 20:1093–1102[CrossRef][Medline]
  17. Bose HS, Sugawara T, Strauss III JF, Miller WL 1996 The pathophysiology and genetics of congenital lipoid adrenal hyperplasia. International Congenital Lipoid Adrenal Hyperplasia Consortium. N Engl J Med 335:1870–1878[Abstract/Free Full Text]
  18. Stocco DM, Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[Abstract/Free Full Text]
  19. Caron KM, Soo S-C, Wetsel WC, Stocco DM, Clark BJ, Parker KL 1997 Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc Natl Acad Sci USA 94:11540–11545[Abstract/Free Full Text]
  20. Solish SB, Goldsmith MA, Voutilainen R, Miller WL 1989 Molecular characterization of a Leydig cell tumor presenting as congenital adrenal hyperplasia. J Clin Endocrinol Metab 69:1148–1152[Abstract/Free Full Text]
  21. Hu M-C, Chung B-c 1990 Expression of human 21-hydroxylase (P450c21) in bacterial and mammalian cells: a system to characterize normal and mutant enzymes. Mol Endocrinol 4:893–898[Abstract/Free Full Text]
  22. Hu M-C, Guo I-C, Lin J-H, Chung B-c 1991 Regulated expression of cytochrome P-450 scc (cholesterol-side-chain cleavage enzyme) in cultured cell lines detected by antibody against bacterially expressed human protein. Biochem J 274:813–817
  23. Chiang EF-L, Pai C-I, Wyatt M, Yan Y-L, Postlethwait J, Chung B-c 2001 Two sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev Biol 231:149–163[CrossRef][Medline]
  24. Chaplin DD, Galbraith LJ, Seidman JD, White PC, Parker KL 1986 Nucleotide sequence analysis of murine 21-hydroxylase genes: mutations affecting gene expression. Proc Natl Acad Sci USA 83:9601–9605[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Ligands:   Aldosterone



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
N. M. Teplyuk, Y. Zhang, Y. Lou, J. R. Hawse, M. Q. Hassan, V. I. Teplyuk, J. Pratap, M. Galindo, J. L. Stein, G. S. Stein, et al.
The Osteogenic Transcription Factor Runx2 Controls Genes Involved in Sterol/Steroid Metabolism, Including Cyp11a1 in Osteoblasts
Mol. Endocrinol., June 1, 2009; 23(6): 849 - 861.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Yivgi-Ohana, N. Sher, N. Melamed-Book, S. Eimerl, M. Koler, P. R. Manna, D. M. Stocco, and J. Orly
Transcription of Steroidogenic Acute Regulatory Protein in the Rodent Ovary and Placenta: Alternative Modes of Cyclic Adenosine 3', 5'-Monophosphate Dependent and Independent Regulation
Endocrinology, February 1, 2009; 150(2): 977 - 989.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M.-C. Shih, N.-C. Hsu, C.-C. Huang, T.-S. Wu, P.-Y. Lai, and B.-c. Chung
Mutation of Mouse Cyp11a1 Promoter Caused Tissue-Specific Reduction of Gene Expression and Blunted Stress Response without Affecting Reproduction
Mol. Endocrinol., April 1, 2008; 22(4): 915 - 923.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. J. Kim, L. Lin, N. Huang, C. A. Quigley, T. W. AvRuskin, J. C. Achermann, and W. L. Miller
Severe Combined Adrenal and Gonadal Deficiency Caused by Novel Mutations in the Cholesterol Side Chain Cleavage Enzyme, P450scc
J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 696 - 702.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. D. Gallardo, G. B. John, L. Shirley, C. M. Contreras, E. A. Akbay, J. M. Haynie, S. E. Ward, M. J. Shidler, and D. H. Castrillon
Genomewide Discovery and Classification of Candidate Ovarian Fertility Genes in the Mouse
Genetics, September 1, 2007; 177(1): 179 - 194.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Sher, N. Yivgi-Ohana, and J. Orly
Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary
Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
W. L. Miller
StAR Search--What We Know about How the Steroidogenic Acute Regulatory Protein Mediates Mitochondrial Cholesterol Import
Mol. Endocrinol., March 1, 2007; 21(3): 589 - 601.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Cole, K. Hensinger, G. A. R. Maciel, R. J. Chang, and G. F. Erickson
Human Fetal Ovary Development Involves the Spatiotemporal Expression of P450c17 Protein
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3654 - 3661.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. al Kandari, N. Katsumata, S. Alexander, and M. A. Rasoul
Homozygous Mutation of P450 Side-Chain Cleavage Enzyme Gene (CYP11A1) in 46, XY Patient with Adrenal Insufficiency, Complete Sex Reversal, and Agenesis of Corpus Callosum
J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 2821 - 2826.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Lee, N. Makhanova, K. Caron, M. L. S. Lopez, R. A. Gomez, O. Smithies, and H.-S. Kim
Homeostatic Responses in the Adrenal Cortex to the Absence of Aldosterone in Mice
Endocrinology, June 1, 2005; 146(6): 2650 - 2656.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. H. Payne and D. B. Hales
Overview of Steroidogenic Enzymes in the Pathway from Cholesterol to Active Steroid Hormones
Endocr. Rev., December 1, 2004; 25(6): 947 - 970.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
K. Hilscherova, P. D. Jones, T. Gracia, J. L. Newsted, X. Zhang, J. T. Sanderson, R. M. K. Yu, R. S. S. Wu, and J. P. Giesy
Assessment of the Effects of Chemicals on the Expression of Ten Steroidogenic Genes in the H295R Cell Line Using Real-Time PCR
Toxicol. Sci., September 1, 2004; 81(1): 78 - 89.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. R. Bair and S. H. Mellon
Deletion of the Mouse P450c17 Gene Causes Early Embryonic Lethality
Mol. Cell. Biol., June 15, 2004; 24(12): 5383 - 5390.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. J. O'Shaughnessy, L. M. Fleming, G. Jackson, U. Hochgeschwender, P. Reed, and P. J. Baker
Adrenocorticotropic Hormone Directly Stimulates Testosterone Production by the Fetal and Neonatal Mouse Testis
Endocrinology, August 1, 2003; 144(8): 3279 - 3284.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Ishii, T. Hasegawa, C.-I Pai, N. Yvgi-Ohana, R. Timberg, L. Zhao, G. Majdic, B.-c. Chung, J. Orly, and K. L. Parker
The Roles of Circulating High-Density Lipoproteins and Trophic Hormones in the Phenotype of Knockout Mice Lacking the Steroidogenic Acute Regulatory Protein
Mol. Endocrinol., October 1, 2002; 16(10): 2297 - 2309.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hu, M.-C.
Right arrow Articles by Chung, B.-c.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals