help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Molecular Endocrinology, doi:10.1210/me.2001-0260
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huening, M.
Right arrow Articles by Christakos, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huening, M.
Right arrow Articles by Christakos, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PARATHYROID HORMONE
Molecular Endocrinology 16 (9): 2052-2064
Copyright © 2002 by The Endocrine Society

Evidence for a Regulatory Role of Inducible cAMP Early Repressor in Protein Kinase A-Mediated Enhancement of Vitamin D Receptor Expression and Modulation of Hormone Action

Michael Huening, Ghassan Yehia, Carlos A. Molina and Sylvia Christakos

Department of Biochemistry and Molecular Biology (M.H., S.C.) and Department of Obstetrics and Gynecology (G.Y., C.A.M.), University of Medicine and Dentistry of New Jersey–New Jersey Medical School and Graduate School of Biomedical Sciences, Newark, New Jersey 07103

Address all correspondence and requests for reprints to: Dr. Sylvia Christakos, Department of Biochemistry and Molecular Biology, University of Medicine and Dentistry of New Jersey-New Jersey Medical School, 185 South Orange Avenue, Newark, New Jersey 07103. E-mail: christak{at}umdnj.edu.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Parathyroid hormone (PTH) or activators of protein kinase A (PKA) up-regulate the vitamin D receptor (VDR) and augment the induction by 1,25-dihydroxyvitamin D3 of the expression of target genes (24-hydroxylase and osteopontin) in osteoblastic cells. To understand regulatory mechanisms involved, we asked whether the inducible cAMP early repressor (ICER), which serves as a dominant negative regulator of cAMP-induced transcription in other endocrine systems, may similarly play a role in modulation of vitamin D hormone action. In this study we demonstrate that PTH or 8-bromo-cAMP rapidly induces ICER mRNA and protein in osteoblastic cells. In UMR 106 osteoblastic cells transfected with an expression vector containing the ICER II-{gamma} coding sequence, cAMP or PTH enhancement of 1,25-dihydroxyvitamin D3-induced osteopontin and 24-hydroxylase mRNA and transcription is inhibited. The vitamin D response element is sufficient for the PKA enhancement of VDR-mediated transcription and is also sufficient to observe the inhibitory effect of ICER. Our data indicate that the mechanism of the inhibitory effect of ICER involves an inhibition of PKA-induced VDR transcription, and this inhibition may be mediated in part by binding of ICER to a cAMP response element-like sequence in the VDR promoter. This study provides evidence for the first time that ICER has a key regulatory role in the PKA enhancement of VDR transcription and therefore in the cross-talk between the PKA signaling pathway and the vitamin D endocrine system.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
PARATHYROID HORMONE (PTH) is a peptide hormone that has been reported to affect the transcriptional regulation of many genes. One of the major targets for PTH action is bone, where it binds to receptors present on the plasma membrane of osteoblasts (1). PTH induces expression of many osteoblastic genes, including c-fos and c-jun (2), IL-6 (3), collagenase (4), prostaglandin G/H synthase 2 (5), osteocalcin (6), and osteopontin (OPN) (7). PTH also causes an up-regulation of vitamin D receptor (VDR) in osteoblastic cells via a protein kinase A (PKA)-dependent mechanism (8, 9, 10), and PTH and/or activation of PKA has been reported to enhance the 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3]-dependent induction in osteoblastic cells of 24-hydroxylase (24OHase) (8, 10, 11) and OPN (11) transcription. 24OHase is an enzyme involved in the catabolic breakdown of 1,25-(OH)2D3 (12, 13), and OPN is a secreted phosphoprotein abundant in bone matrix that has been reported to affect both bone resorption and mineralization (14). The enhancement by PKA activation of vitamin D hormone action in osteoblastic cells has been suggested to occur, at least in part, as a result of up-regulation of VDR (10, 11).

Stimulation of the PKA pathway in cells of neuroendocrine origin (15, 16, 17, 18, 19) as well as in nonneuroendocrine cells (20, 21, 22, 23, 24) has been shown to induce expression of an inhibitory protein called inducible cAMP early repressor (ICER) that can down-regulate transcription of cAMP-responsive genes (15). ICER is a member of the CREM (cAMP-responsive element modulator) protein family that is comprised of several proteins that function either as activators or antagonists of cAMP-inducible transcription by differential splicing of the same gene (15, 25). ICER consists of essentially the CREM DNA binding domain and lacks the CREM transactivation domain. ICER mRNA is rapidly and transiently induced by cAMP from the intronic promoter of the CREM gene (P2) that contains four cAMP response elements (CREs) in tandem (15). ICER binds to CREs and down-regulates both its own expression as part of a negative autoregulatory mechanism and the expression of other CRE-containing genes (15). Recent studies have shown that PTH can induce ICER in osteoblastic cells (26) and have suggested that ICER may play an important modulatory role in PTH-mediated regulation of target genes in bone.

In this study we tested the possibility that ICER may play a modulatory role in PTH and cAMP-enhanced cellular response to 1,25-(OH)2D3 in osteoblastic cells. We found that cAMP and PTH enhancement of 1,25-(OH)2D3-induced 24OHase and OPN transcription in UMR 106 osteoblastic cells is inhibited by ICER. The vitamin D response element (VDRE) is sufficient for the PKA enhancement of VDR-mediated transcription and is also sufficient to observe the inhibitory effect of ICER. Our data indicate that the mechanism of the inhibitory effect of ICER involves an inhibition of PKA induction of VDR transcription, and this inhibition may be mediated in part by binding of ICER to a CRE-like sequence in the VDR promoter. Our findings provide evidence for the first time for a regulatory role for ICER in the PKA enhancement of VDR-mediated transcription and therefore in the cross-talk between the PKA signaling pathway and the vitamin D endocrine system.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Activation of PKA Enhances 1,25-(OH)2D3 Induction of VDR, 24OHase, and OPN mRNAs and Augments VDR-Mediated 24OHase and OPN Transcription
8-Bromo-cAMP (an activator of PKA) enhances 1,25-(OH)2D3-induced levels of VDR, 24OHase, and OPN mRNAs in UMR 106 osteoblastic cells (Fig. 1AGo). As previously reported (11), 8-bromo-cAMP alone induces VDR mRNA expression but not the expression of 24OHase or OPN mRNAs (Fig. 1AGo, left panel). Additionally when UMR 106 cells were transfected with chloramphenicol acetyltransferase (CAT) reporter gene constructs containing promoter regions from the 24OHase (-1367/+74) and OPN (-777/+79) genes, 8-bromo-cAMP or PTH significantly enhanced transcription of both reporter gene constructs over the levels seen with 1,25-(OH)2D3 alone (Fig. 1BGo).



View larger version (43K):
[in this window]
[in a new window]
  		Figure 1. Activators of PKA Enhance the Induction by 1,25-(OH)2D3 of VDR, 24OHase, and OPN mRNAs and Augment VDR- Mediated 24(OH)ase and OPN Transcription in UMR 106 Osteoblastic Cells

A (left panel), Graphic representation of Northern blot analyses. Northern analysis was performed using poly(A+) RNA from UMR 106 cells that had been treated for 9 h with 1,25-(OH)2D3 (10-8 M) in the absence or presence of 8-bromo-cAMP (1 mM), or 8-bromo-cAMP alone (1 mM) compared with treatment with 0.1% ethanol vehicle control (-D). The filters were hybridized with 32P-labeled rat VDR cDNA; the membranes were then stripped and sequentially rehybridized with 32P rat 24OHase, mouse OPN, and human ß-actin cDNAs. Data were normalized on the basis of results obtained after rehybridization with ß-actin cDNA. Data are from three independent experiments (mean ± SE). In the presence of 8-bromo-cAMP, VDR, 24OHase, and OPN mRNAs are significantly induced above the levels observed with 1,25-(OH)2D3 alone (P < 0.05). In the presence of 8-bromo-cAMP alone (cAMP), only VDR mRNA is significantly induced (P < 0.05) above -D levels. A (right panel), Representative autoradiograms. B, UMR 106 cells were transfected with 6 µg of the CAT construct of the rat 24OHase promoter -1367/+74 (which contains both VDREs at -258/-244 and at -150/-136) or 6 µg of the CAT construct of the mouse OPN promoter -777/+79. Transfected cells were then treated with vehicle (-D), 10-8 M 1,25-(OH)2D3 (+D), 1,25-(OH)2D3 plus 1 mM 8-bromo-cAMP (cAMP + D), or 1,25-(OH)2D3 plus 25 nM PTH (PTH + D) for 24 h. After treatments, cells were harvested and lysed, and CAT activity was measured as described in Materials and Methods. Representative autoradiograms are shown.

 
cAMP or PTH Induces ICER mRNA and Protein in UMR 106 Osteoblastic Cells
To study the possible role of ICER in modulation of PKA enhancement of VDR-mediated transcription, we first examined the effect of 8-bromo-cAMP or PTH to induce ICER expression in UMR osteoblastic cells. ICER mRNA was maximally induced by 8-bromo-cAMP (1 mM) at 3 h after treatment and declined rapidly to basal levels by 12 h (Fig. 2AGo). ICER protein levels were maximally induced at 6 h posttreatment with 8-bromo-cAMP (Fig. 2BGo). Treatment of UMR 106 cells with PTH (25 nM) yielded similar results for both ICER mRNA and protein time courses. PTH maximally induced ICER mRNA between 3 and 4 h after treatment, with a return to basal levels by 12 h (not shown); ICER protein reached highest levels in response to PTH between 6 and 9 h (not shown). To investigate a possible function for PTH and cAMP-induced ICER expression, UMR 106 cells were transfected with a plasmid containing the coding sequence for the II-{gamma} form of ICER (Fig. 2CGo).



View larger version (51K):
[in this window]
[in a new window]
  		Figure 2. Time-Dependent Effects of 8-Bromo-cAMP on ICER mRNA and Protein in UMR 106 Cells

A, Northern analysis was performed using 8 µg poly (A+) RNA per lane from UMR 106 cells that had been treated with 8-bromo-cAMP (1 mM) and harvested at indicated times after treatment. The filter was hybridized with 32P-labeled ICER cDNA; the filter was then stripped and rehybridized with 32P-labeled human ß-actin cDNA. Shown are a representative autoradiogram and a graphic representation of the results normalized on the basis of rehybridization with ß-actin cDNA. The results of three separate experiments are expressed as percent of maximal response ± SE. B, Western blot analysis was performed using 50 µg of extract per lane from UMR 106 cells that had been treated with 8-bromo-cAMP (1 mM) and harvested at indicated times after treatment. ICER protein was detected by immunoblotting with an antibody against the DNA binding domain II of CREM. The migration of CREMt (CREM {tau}) and ICER is indicated on the right. Right lane, ICER, 25 ng bacterially expressed, purified ICER II-{gamma}. C, Western blot performed using 50 µg extract per lane from ICER II-{gamma}-transfected UMR cells (lane 1, cells were transfected with 2 µg pSV2ICER II-{gamma} expression vector; lane 2, UMR cells were stably transfected with ICER II-{gamma} under the control of the human metallothionein IIA cadmium-inducible promoter and treated with 5 µM CdCl2 for 6 h) and from UMR cells that had been treated with 1 mM 8-bromo-cAMP for 6 h (lane 3) compared with control cells (lane 4).

 
ICER Inhibits PKA Enhancement of VDR-Mediated Transcription
As seen in Fig. 3AGo, transfection of 1 µg of ICER II-{gamma} significantly inhibited the cAMP and PTH enhancement of 1,25-(OH)2D3-induced 24OHase transcription (by 31.2% and 31.6%, respectively; P < 0.05 compared with vector transfected cells treated with cAMP +D or PTH +D). Increasing the dose of ICER plasmid from 1 µg to 2 µg increased the inhibition of the cAMP +D and PTH +D response to 65.4% and 62.0%, respectively (P < 0.05 compared with vector transfected cells similarly treated). The 1,25-(OH)2D3 induction of 24OHase transcriptional activity was also inhibited by 1 or 2 µg ICER, but not significantly (P > 0.06). Transfection of ICER II-{gamma} also results in a significant dose-dependent inhibition of the cAMP and PTH enhancement of 1,25-(OH)2D3-induced OPN transcriptional activity (Fig. 3BGo; P < 0.05 compared with vector-transfected cells). Using the OPN promoter construct, a significant inhibition of the 1,25-(OH)2D3 response was also observed in the presence of ICER (P < 0.05, Fig. 3BGo). Significant inhibition of the cAMP or PTH enhancement of the 1,25-(OH)2D3 induction of 24OHase or OPN transcription was observed in additional experiments using UMR 106 cells stably expressing ICER II-{gamma} (data not shown), confirming the results observed using transient transfection.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 3. ICER Inhibits Transcriptional Activation of 24OHase and OPN Promoter CAT Constructs

UMR 106 cells were transfected with 6 µg of the CAT construct of the rat 24OHase promoter -1367/+74 (A) or 6 µg of the CAT construct of the mouse OPN promoter -777/+79 (B) in the absence or presence of 1 µg or 2 µg of pSV2ICER II-{gamma} expression vector. Transfected cells in both experiments were treated with vehicle (-D), 10-8 M 1,25-(OH)2D3 (+D), or 1,25-(OH)2D3 plus 1 mM 8-bromo-cAMP (cAMP + D) or 1,25(OH)2D3 plus 25 nM PTH (PTH + D) for 24 h. After treatments, cells were harvested and lysed, and CAT activity was measured as described in Materials and Methods. The results (obtained from three or more separate experiments) are expressed as percent of maximal response ± SE (A) or relative CAT activity ± SE (B).

 
Because the VDRE is sufficient to mediate the cAMP enhancement of 1,25-(OH)2D3-induced transcription (11), we tested whether the inhibitory effect of ICER also occurs through the VDRE and not via other sequences in the promoter. We examined the effect of ICER using the rat proximal 24OHase VDRE-thymidine kinase (tk) CAT construct or the mouse OPN VDRE-tk CAT construct. In the presence of ICER (1 µg) the cAMP + D response using the 24OHase VDRE-tk CAT or the OPN VDRE tk CAT construct was inhibited by 38.6 ± 4.8% and 44.9 ± 5.3%, respectively (P < 0.05 compared with similarly treated vector transfected cells; Fig. 4Go, A and B). These results are similar to the findings obtained using the longer promoter constructs (Fig. 3Go) and suggest that the VDRE is sufficient to confer the inhibition by ICER of the cAMP-mediated enhancement of VDR-mediated transcription.



View larger version (64K):
[in this window]
[in a new window]
  		Figure 4. ICER Inhibits Transcriptional Activation of 24OHase VDRE (-150/-136)-tk CAT and OPN VDRE (-757/-743)-tk CAT Constructs (A and B); 8-Bromo-cAMP or PTH Does Not Affect 24OHase or OPN VDRE-tk CAT Transcription or the Transcription of the Control Reporter Plasmid pBL (tk) CAT2 (C and D); and ICER Does Not Inhibit the Transcription of the Control Reporter Plasmid pBL (tk) CAT2 or Transcription Mediated by ER (D and E)

UMR 106 cells were cotransfected with 6 µg of the 24OHase VDRE (-150/-136)-tk CAT construct (A) or 6 µg of the OPN VDRE (-757/-743)-tk CAT (B) together with either 1 µg of pSV empty vector or pSV2ICER II-{gamma} expression vector. Transfected cells in both experiments were treated with vehicle (-D), 10-8 M 1,25-(OH)2D3 (+D), or 1,25-(OH)2D3 plus 1 mM 8-bromo-cAMP (cAMP + D) for 24 h. After treatments, cells were harvested and lysed, and CAT activity was measured as described in Materials and Methods. Experiments were done in triplicate and representative autoradiograms are shown (for A or B aliquots of lysate from vector-transfected and ICER-transfected cells were spotted on the same thin-layer chromatography plate, and the representative results observed are from the same autoradiogram). The cAMP +D response using the 24OHase VDRE-tk CAT construct or the OPN VDRE-tk construct was inhibited by 38.6 ± 4.8% and 44.9 ± 5.3%, respectively, after transfection of pSV2ICER II-{gamma} (P < 0.05 compared with similarly treated vector-transfected cells). C, UMR 106 cells were transfected with 6 µg of the 24OHase VDRE (-150/-136)-tk CAT construct or the OPN VDRE (-757/-743)-tk CAT construct. Transfected cells were treated with vehicle (-D), 10-8 M 1,25-(OH)2D3 (+D), 1 mM 8-bromo-cAMP (cAMP), or 25 nM PTH for 24 h. Similar results were observed in three separate experiments. D (left autoradiogram), UMR 106 cells were transfected with 4 µg of a minimal promoter tk-CAT construct. Transfected cells were treated with vehicle (-D), 10-8 M 1,25-(OH)2D3 (+D), 1 mM 8-bromo-cAMP (cAMP), or 25 nM PTH for 24 h. None of the treatments resulted in a detectable enhancement over basal activity. Similar results were obtained in three separate experiments. D (right panel), UMR 106 cells were transfected with 4 µg of a minimal promoter tk-CAT construct in the absence or presence of 2 µg of pSV2ICER II-{gamma} expression vector. Transfection with ICER did not result in a significant inhibition of the minimal promoter construct. E, ICER does not inhibit ER-mediated transcription. UMR 106 cells were cotransfected with 500 ng ER and 4 µg of an ERE-tk CAT construct in the absence or presence of 2 µg pSV2ICER II-{gamma} expression vector. Transfected cells were treated with vehicle (Basal), 10 nM estradiol (+E2), or 1 mM 8-bromo-cAMP (cAMP) for 24 h. After treatments in all experiments (A–E), cells were harvested and lysed, and CAT activity was measured as described in Materials and Methods. Representative autoradiograms are shown (A–E) of three or more separate experiments. The results are expressed as relative CAT activity ± SE (D and E).

 
The activity of the VDRE tk CAT constructs as well as the activity of a tk CAT construct containing the minimal promoter region of the herpes virus thymidine kinase gene were not significantly affected by 8- bromo-cAMP or PTH treatment (Fig. 4Go, C and D, left panel). Importantly, ICER did not affect the activity of the tk CAT construct (Fig. 4DGo, right panel). In addition, experiments conducted cotransfecting an estrogen response element (ERE) tk CAT construct with the human estrogen receptor indicated that ICER had no inhibitory effect on estrogen receptor (ER)-mediated transcriptional activation (Fig. 4EGo). The data in Fig. 4Go, D (right panel) and E, indicate specificity of the inhibition by ICER.

As assessed by Northern blot analysis, overexpression of ICER was also observed to inhibit the endogenous expression of PKA-enhanced 1,25-(OH)2D3- induced levels of VDR, 24OHase, and OPN mRNAs in UMR 106 cells (Fig. 5Go).



View larger version (55K):
[in this window]
[in a new window]
  		Figure 5. ICER Inhibits cAMP-Dependent Enhancement of 1,25-(OH)2D3-Induced VDR, 24OHase, and OPN mRNA Levels

Northern analysis was performed using 8 µg poly(A+) RNA per lane from UMR 106 cells that had been treated for 9 h with vehicle (-D), 10 nM 1,25-(OH)2D3 (+D), or 10 nM 1,25-(OH)2D3 plus 1 mM 8-bromo-cAMP (cAMP + D) in the absence or presence of 2 µg pSV2ICER II-{gamma} expression vector. The filters were hybridized with 32P-labeled rat VDR cDNA; the membranes were then stripped and sequentially rehybridized with 32P rat 24OHase, mouse OPN, and human ß-actin cDNAs. Representative autoradiograms are shown, along with graphic representations of three separate experiments. Results are expressed as either fold induction (VDR and OPN) or percent of maximal response (24OHase) ± SE.

 
Mechanism of the Effect of ICER on PKA Enhancement of VDR-Mediated Transcription
Gel shift analysis was performed to determine whether ICER might modify the binding of VDR/retinoid X receptor (RXR) to the VDRE. No effect of ICER on VDR/RXR binding to the proximal rat 24OHase VDRE or the mouse OPN VDRE was observed (data not shown), suggesting that the mechanism of action of ICER does not include inhibition of the DNA binding ability of the VDR/RXR complex. The levels of VDR protein in UMR 106 cells were also examined after transfection of ICER. VDR protein levels, induced after 1,25-(OH)2D3 (+D) or cAMP treatment, were inhibited by ICER transfection (Fig. 6Go), suggesting that ICER mediates its inhibition of VDR-mediated transcription, at least in part, through down-regulation of the VDR levels.



View larger version (46K):
[in this window]
[in a new window]
  		Figure 6. ICER Down-Regulates VDR Protein Levels in UMR 106 Cells

Western blot analysis was performed using 50 µg of nuclear protein prepared from UMR 106 cells treated with vehicle (-D), 10 nM 1,25-(OH)2D3 (+D), or 1 mM 8-bromo-cAMP (cAMP) for 12 h in the absence or presence of 2 µg pSV2ICER II-{gamma} expression vector. Detection was by immunoblotting with a monoclonal anti-VDR antibody.

 
Because ICER may effect its inhibition at least partly by inhibiting VDR levels, we asked whether repression by ICER may be mediated by effects on the VDR promoter. Gel mobility shift assays were performed using oligonucleotide sequences corresponding to CRE-like elements present within two regions of the human VDR (hVDR) promoter (-369/-347 and -579/-558). ICER exhibited binding to the more proximal site and no detectable binding to the distal site under conditions that allowed binding to a consensus CRE from the somatostatin gene promoter (Fig. 7Go). This suggests that ICER can be mediating its inhibitory effect, at least in part, by binding to a CRE-like sequence in the VDR promoter.



View larger version (55K):
[in this window]
[in a new window]
  		Figure 7. Bacterially Expressed ICER Binds to a CRE-Like Sequence in the hVDR Promoter

Right panel, EMSA using bacterially expressed ICER II-{gamma} (500 ng) was performed using 32P-labeled oligonucleotide probes corresponding to CRE-like sequences in the hVDR promoter hVDR1 (-369/-347) and hVDR2 (-579/-558) (right panel). Under conditions that allowed binding of ICER to an oligonucleotide probe containing a canonical CRE (left panel), binding was observed to the -369/-347 (lanes 2 and 4) site but not the -579/-558 site (lanes 6 and 7). This binding was specific because it could be depleted by ICER antibody (lane 3) or a 100-fold excess of cold CRE competitor (lane 5), but not by a 100-fold excess of cold C/EBP competitor (lane 4). Left panel, The binding of ICER to the consensus CRE from the somatostatin gene promoter was examined in a gel shift experiment run in parallel [left panel; lane 1, probe alone; lane 2, ICER (500 ng) binding to the canonical CRE under the same conditions]. Similar results were observed in two additional experiments.

 
Finally, experiments were done to evaluate the functional significance of the observed binding of ICER to the hVDR promoter. The hVDR promoter fragment (-1500/+60) was isolated by PCR and ligated into the PGL-2 luciferase vector. Cotransfection of the hVDR promoter construct with an expression vector for the catalytic subunit of PKA (27) resulted in a 6-fold induction of hVDR promoter activity. Basal hVDR promoter activity as well as promoter activation by PKA were unaffected by 1,25-(OH)2D3 (not shown). In ICER-transfected cells, the PKA induction was completely inhibited (Fig. 8AGo). These data suggest that ICER can bind to one of the two CRE-like sequences present in the VDR promoter (28), and that this binding allows ICER to modulate PKA enhancement of VDR-mediated transcription. These experiments were performed in JEG-3 human choriocarcinoma cells [which endogenously express VDR (29) and are strongly responsive to stimulation of the cAMP signal-transduction pathway (15)] because the hVDR promoter construct showed no activity in rat UMR 106 cells, perhaps due to species specificity. We therefore tested whether ICER overexpression could affect regulation of CRE-tk luciferase activity by PKA activation in UMR 106 cells. CRE-tk luciferase activity was activated approximately 4-fold by cotransfection of PKA expression vector and 3-fold by 1 mM 8-bromo-cAMP. Both of these responses were inhibited by cotransfection of ICER (Fig. 8BGo), confirming the results seen with the hVDR promoter. These data indicate functional significance for the observed binding of ICER to the proximal CRE-like sequence in the hVDR promoter and suggest that the inhibition of VDR levels seen in the presence of ICER may result, at least in part, from inhibition of VDR transcription by ICER. To test the possibility that the effects of ICER are due to inhibition of VDR expression, studies were done in UMR 106 cells transfected with hVDR expression vector (500 ng; Fig. 8CGo). When VDR was overexpressed in UMR cells, ICER was unable to repress the transcriptional response of the 24OHase promoter to cAMP + D.



View larger version (30K):
[in this window]
[in a new window]
  		Figure 8. Transcriptional Activation by PKA of an hVDR (-1500/+60) Promoter Luciferase Construct or a CRE-tk Luciferase Construct Is Inhibited in ICER-Transfected Cells (A and B) and Repression of the cAMP + D Response of the 24OHase Promoter by ICER Is Not Observed when VDR Is Overexpressed in UMR Cells (C)

A, JEG-3 cells were transfected with 2 µg of hVDR (-1500/+60) luc in the absence or presence of 1 µg PKA catalytic subunit expression vector and 1 µg pSV2ICER II-{gamma} expression vector as indicated. PKA overexpression resulted in a significant enhancement of hVDR reporter activity, which was completely abolished by ICER transfection (PKA-mediated induction of hVDR promoter activity -ICER vs. +ICER, P < 0.05). B, UMR 106 cells were transfected with 4 µg of a CRE tk luc reporter gene construct in the absence or presence of 1 µg PKA catalytic subunit expression vector and 1 µg pSV2ICER II-{gamma} expression vector as indicated. Transfected cells were treated with vehicle or 1 mM 8-bromo-cAMP for 24 h as indicated. ICER was able to completely inhibit activation of the CRE-tk luciferase reporter construct by PKA transfection or cAMP treatment (induction by PKA or cAMP of CRE tk luc reporter activity -ICER vs. +ICER, P < 0.05). Results presented in panels A and B are expressed as fold induction ± SE. C, UMR 106 cells were transiently transfected with 500 ng hVDR expression vector and 6 µg of the rat 24OHase promoter construct (-1367/+74) in the absence or presence of 2 µg pSV2ICER II-{gamma} expression vector. Results are expressed as percent of maximal response ± SE. When VDR was overexpressed in UMR 106 cells, CAT activity in the presence or absence of ICER was not significantly different (P > 0.5). In a single parallel experiment, transfection of ICER (2 µg) resulted in a 74% inhibition of the transcriptional response observed in the presence of cAMP + D (similar to the findings observed in multiple experiments as shown in Fig. 3AGo (2 µg ICER).

 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
MATERIALS AND METHODS
 REFERENCES
 
In this study we provide evidence for the first time that the cAMP-responsive inhibitor protein ICER can play a role in the PKA enhancement of VDR-mediated transcription. In our study, we demonstrate that ICER is capable of decreasing the induction in VDR protein levels resulting from the activation of the cAMP signaling pathway; this decrease in VDR protein levels results, at least partly, from inhibition by ICER of PKA-induced VDR transcription. The mechanism by which ICER inhibits cAMP-inducible genes typically includes binding to a variety of cAMP response elements (CREs) or CRE-like sequences in the promoters of target genes that are binding sites for activator forms of CRE-binding protein (CREB) and/or related factors of CREM (30, 31). Because ICER lacks the CREM transactivation domain, which is similar in sequence to that of CREB (15), binding of ICER to a CRE does not allow recruitment of CREB or the CREB-binding protein (CBP/p300) to activate transcription. Our findings suggest that at least part of the inhibition by ICER of PKA enhancement of VDR-mediated transcription occurs via binding of ICER to a CRE-like sequence in the VDR promoter. It is possible that secondary effects of ICER on other cellular factors [for example, destabilization of a CREM/transcription factor IID complex, (24)] may also contribute to ICER inhibition of VDR transcription.

We found that cAMP- or PTH-mediated ICER mRNA induction in UMR 106 osteoblastic cells is rapid and transient and that multiple transcripts are observed. A similar time course and induction of multiple transcripts were also observed for ICER mRNA induction by activation of the cAMP pathway in other cells and tissues including pituitary corticotrophs (17), PC12 cells (15), MC3T3-E1 osteoblastic cells (26), mouse calvaria (26), and rat thyroid gland (18). It has been suggested that rapid activation of ICER could serve as a protective mechanism by which the cell limits mRNA accumulation of CRE-containing genes, and that this regulation subverts pathological consequences of chronic stimulation of activation of PKA (17, 32). Thus, enhanced expression of vitamin D-regulated genes by activation of PKA would be determined by a complex balance of activation by CREB and repression by ICER, providing a system for fine modulation of gene expression.

In our study we found that ICER is induced in osteoblastic cells and can repress the cAMP- and PTH-dependent enhancement of VDR-mediated transcription in these cells. ICER has also been reported to act in osteoblastic cells to inhibit PTH-stimulated prostaglandin G/H synthase 2 transcription (5, 26). Originally, ICER was thought to be a repressor of cAMP-induced transcription specifically in tissues of neuroendocrine origin. For example, in the pineal gland ICER has been reported to be involved in the repression of melatonin synthesis during the course of normal circadian rhythm (16). In PC12 cells ICER inhibits PKA-stimulated transcriptional activity of tyrosine hydroxylase (33). ICER has also been shown to have a regulatory role in ACTH secretion from a pituitary-derived corticotroph cell line (17). Rather than being restricted to neuroendocrine tissues, our findings and those of Tetradis et al. (26), as well as several recent reports (20, 21, 22, 23, 24), suggest that ICER can play a regulatory role in a wide range of cell types. In addition to osteoblastic cells, ICER is strongly induced by agonists that stimulate PKA in other nonneuroendocrine cells including T lymphocytes (20), somatic Sertoli cells of the seminiferous tubules (21), rat ovarian granulosa cells (22), fibroblasts and epithelial cells (23), pancreatic islets (24), and pancreatic acinar cells (23). Although different roles for ICER have been suggested in these nonneuroendocrine tissues, including modulation of proliferation of T lymphocytes (20), modulation of the expression of specific PTH-regulated genes in bone (26), effects on the cycle of spermatogenesis (21), and inhibition of insulin synthesis (24), it is likely that future studies will reveal additional roles for ICER in the physiology of bone as well as the other nonneuroendocrine tissues. In bone, for example, it is possible that ICER may participate in the down-regulation of the PTH receptor or other PTH-induced genes such as c-fos, IL-6, collagenase, or osteocalcin. It will also be of interest to determine whether ICER can affect VDR expression and PKA modulation of vitamin D action in vitamin D target tissues in addition to bone, such as skin and kidney.

A novel finding of our study is that ICER can modulate VDR expression. The concentration of VDR has been reported to be a major factor in determining the level of response to 1,25-(OH)2D3 (34, 35). Although up-regulation of VDR by 1,25-(OH)2D3 as well as tissue-specific regulation of VDR by a number of other factors including PTH, activation of PKA, and protein kinase C have been reported, the exact mechanisms involved have not been clearly defined (10, 34, 36, 37). 1,25-(OH)2D3 has been reported to induce VDR mRNA as well as VDR protein in some tissues but not others, and cell cycle and differentiation state of the cells in culture have been found to influence VDR expression (9, 34). Up-regulation of VDR by activation of PKA has previously been reported and found to play an important role in modulating target cell responsiveness to 1,25-(OH)2D3 (10, 11, 37). It was suggested that up-regulation of VDR by cAMP may involve transcriptional regulation through a CRE in the VDR promoter (37). Only recently has the chromosomal gene for VDR been cloned, enabling studies for the first time on the transcriptional regulation of VDR (28). Our study represents the first demonstration of PKA activation of the VDR promoter and inhibition of this activation by ICER. Our hypothesis was confirmed in experiments using overexpression of VDR to prevent repression by ICER (Fig. 8CGo). ICER mRNA is maximally induced in UMR 106 cells at 3 h after treatment with 8-bromo-cAMP (Fig. 2Go). This induction precedes the maximal induction of VDR mRNA by cAMP at 9 h (11). ICER may function to prevent an early rise in VDR levels. The autoregulatory properties of ICER (15, 16, 20, 38) led to a return to basal ICER mRNA levels by 12 h after cAMP treatment (Fig. 2Go) when maximal levels of PKA-enhanced 24OHase and OPN mRNAs are observed in UMR cells (11). In an earlier study by Krishnan and Feldman (37), an early refractory phase in VDR protein levels after forskolin treatment was observed before a rise in VDR levels. Although unexplained at that time, the refractory phase may have been due to an induction in ICER protein. ICER may be mediating its effect, in part, by binding to a CRE-like sequence in the VDR promoter (-369/-347; Fig. 7Go). Although hVDR -369/-347 is not a canonical CRE, studies have indicated that ICER is able to bind to a wide range of divergent CREs (20). It should be noted that it is probable that more than one mechanism may be involved in the modulation of VDR and the enhancement of 1,25-(OH)2D3-induced 24OHase and OPN expression by cAMP. The effect of PKA may involve not only an effect on VDR transcription but also an effect on VDR stability, VDR phosphorylation, or on the phosphorylation of another protein involved in VDR transcription. It is of interest that we found that ICER could inhibit 1,25-(OH)2D3 as well as cAMP-induced VDR levels. Unlike what has been observed with PKA activation, we and others (28) have been unable to detect 1,25-(OH)2D3 inducibility of the VDR gene at the level of the promoter. It is possible that 1,25-(OH)2D3-responsive regions of the promoter have yet to be defined; another possibility is that homologous up-regulation of VDR by 1,25-(OH)2D3 is indirect. Previous studies have indicated that 1,25-(OH)2D3 can activate the transcription of c-fos in osteoblastic cells (39). It has been suggested that 1,25-(OH)2D3-induced c-fos may, in turn, stimulate VDR gene expression (28). ICER could then inhibit 1,25-(OH)2D3-induced VDR expression by binding to CREs in the c-fos promoter, preventing activation. It is also possible that ICER may inhibit the transcription of CRE-containing genes other than c-fos that may be involved the 1,25-(OH)2D3-induction of VDR.

A regulatory system controlling VDR enhancement by the PKA pathway would have physiological importance. The need for controlled 1,25-(OH)2D3 homeostasis for proper bone formation has been suggested by studies using 24OHase-deficient mice that were found to have impaired bone formation at specific sites (13). Because crossing the 24OHase-deficient mice to VDR-ablated mice rescued the bone phenotype, the authors suggested that the observed abnormalities in bone development were caused by elevated 1,25-(OH)2D3 levels inducing VDR at specific sites. Overexpression of VDR in bones of transgenic animals has been reported to affect bone structure, providing additional evidence for a direct effect of 1,25-(OH)2D3 on bone (40). These findings provide evidence for the need to properly modulate levels of 1,25-(OH)2D3 and VDR to prevent pathological consequences. ICER may act to modulate VDR-mediated enhancement of 24OHase production that would lead to abnormally low levels of 1,25-(OH)2D3; thus, ICER would assist in maintaining 1,25-(OH)2D3 homeostasis and the appropriate physiological effects of 1,25-(OH)2D3 on bone. In addition, because it has previously been suggested that PKA may be involved in enhancing the effect of 1,25-(OH)2D3 by enhancing OPN expression and its reported effects on bone resorption (11), ICER may be important to subvert an effect of chronic PKA stimulation on enhanced bone resorption.

CREM-mutant mice have been generated by homologous recombination; the resulting mice exhibit a phenotype of male sterility due to a postmeiotic arrest at the first step of spermatogenesis (41, 42). Judging by the apparent pleiotropic function of the CREM gene products, such a specific phenotype was surprising. Nevertheless, it must be noted that the CREM homozygous mutant mice lacked activators and repressors such as CREM-{tau} and ICER. Therefore, this phenotype cannot be attributed to the lack of expression of a specific CREM activator or repressor. We hypothesize that the balance mechanism controlling CREM-mediated gene expression in these mice might be affected in two opposite directions, resulting in a mutual cancellation without other apparent phenotypic differences. This might explain why the CREM-mutant mice have not been reported to be prone to bone malformations or impaired regulation of serum calcium homeostasis. In the future, the generation of ICER-specific knock-out mice could help to clarify these discrepancies and provide a further understanding on the role of ICER in VDR regulation.

In summary, our findings show that ICER can significantly reduce the cAMP- mediated enhancement of 1,25-(OH)2D3-induced cellular responses in osteoblastic cells and that the mechanism of the inhibitory effect of ICER involves an inhibition of PKA enhancement of VDR transcription. The inhibition may be mediated, in part, by binding of ICER to a CRE-like sequence in the VDR promoter. Our study therefore suggests that ICER can play a regulatory role in PKA enhancement of VDR-mediated transcription and thus in the cross-talk between the PKA signaling pathway and the vitamin D endocrine system.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
REFERENCES
 
Materials
[14C]chloramphenicol (50 mCi/mmol), {alpha}[32P]deoxy-CTP (3000 Ci/mmol), and {gamma}[32P]deoxy-ATP (3000 Ci/mmol) were obtained from NEN Life Science Products (Boston, MA). Random Primers DNA labeling kit, T4 polynucleotide kinase, oligo(dT) cellulose, and all restriction enzymes were purchased from Life Technologies, Inc. (Gaithersburg, MD). Charged nylon membranes, prestained protein molecular weight markers, and electrochemiluminescent detection system were obtained from NEN Life Science Products. 8-Bromo-cAMP, human PTH fragment (1–34), formamide, acetyl coenzyme A, and {alpha}-tubulin antibody were obtained from Sigma (St. Louis, MO). RNAzol was purchased from Tel-Test (Friendswood, TX). Rat anti-VDR antibody was from Affinity BioReagents, Inc. (Neshanic Station, NJ). Chemically synthesized 1,25-(OH)2D3 was provided by Dr. M. Uskokovic of Hoffman-LaRoche Inc. (Nutley, NJ).

Cell Culture
UMR 106–01 rat osteoblastic cells were maintained in DMEM plus Ham’s F12 nutrient mixture (Life Technologies, Inc.) supplemented with 5% heat-inactivated fetal bovine serum (FBS) (Gemini Biological Products, Calabasas, CA) in 5% CO2 atmosphere at 37 C. Cells were grown to 60% confluence and changed to medium supplemented with 2% charcoal-dextran-treated FBS before treatment. Cells were treated with the vehicle or the compounds noted at the indicated times and concentrations. Studies were also done using JEG-3 human choriocarcinoma cells that were maintained in MEM (Life Technologies, Inc.) supplemented with 10% FBS in a 5% CO2 atmosphere at 37 C.

RNA Isolation and Northern Blot Analysis
Total RNA was prepared from UMR cells using RNAzol RNA extraction solution according to the manufacturer’s recommended protocol. Polyadenylated [poly(A+)] mRNA was prepared by two cycles of oligo (deoxythymidine)-cellulose chromatography. mRNA (8 µg) samples were denatured and electrophoresed on 1% agarose gels containing 3.7% formaldehyde. After electrophoresis, mRNA was transferred to charged nylon membranes by capillary action in 20x standard saline citrate (SSC; 1x SSC = 150 mM sodium chloride and 15 mM sodium citrate, pH 7.0) at room temperature for 48 h. Membranes were prehybridized at 42 C in Ultrahyb hybridization buffer from Ambion, Inc. (Austin, TX) for 1 h. Hybridization was carried out for 16–18 h at 42 C in the same solution containing 3–5 x 106 cpm/ml of labeled DNA probes specific for VDR, 24OHase, OPN, or ICER. Labeled cDNA probes were prepared using the Random Primers DNA Labeling System according to manufacturer’s instructions. A 1.7-kb rat VDR cDNA was created by digestion of pIBI76 with EcoRI (43). The 3.2-kb rat 24OHase cDNA was obtained by EcoRI digestion and was a gift from K. Okuda [Hiroshima University School of Dentistry, Hiroshima, Japan (44)]. The 1-kb mouse OPN cDNA was generated by HindIII digestion and was a gift from D. Denhardt [Rutgers University, Piscataway, NJ (45)]. The ß-actin cDNA was purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA). The blots were washed twice for 5 min at room temperature in 2x SSC/0.1% sodium dodecyl sulfate, three times for 15 min at 42 C in 0.1x SSC/0.1% sodium dodecyl sulfate, and then exposed to Biomax MR-1 film (NEN Life Science Products) at -80 C for 1–3 d. To detect any problems with transfer or differences in sample loading, blots were probed with 32P-labeled ß-actin cDNA and/or 32P-labeled 18S rRNA cDNA. All autoradiograms were analyzed by densitometric scanning using the Shimadzu CS9000U Dual-Wavelength Flying Spot scanner (Shimadzu Scientific Instruments, Princeton, NJ), and the relative optical densities obtained using the test probes were divided by the relative optical density of the control probe to correct for sample variation.

Protein Isolation and Western Blot Analysis
For Western blot analysis of VDR, crude nuclear extracts from UMR 106 cells were prepared as previously described (46). Aliquots of the KCl-extracted chromatin preparation were assayed for protein concentration by the Bradford method (47), and 50 µg of protein from each sample were used for Western blot analysis. Protein samples were used for electrophoresis on a 10% sodium dodecyl sulfate polyacrylamide gel and were then transferred electrophoretically to polyvinylidine difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA). The membrane was blocked overnight at 4 C in PBST (0.5% Tween 20 in 1x PBS) containing 5% nonfat milk and then incubated with anti-VDR antibody (1:2500) in PBST containing 5% nonfat milk for 2 h at room temperature. After washing with PBST, the membrane was incubated with goat antirat IgG conjugated to horseradish peroxidase (Sigma) for 1 h at room temperature. After subsequent washing with PBST, the antigen-antibody complex was detected using the electrochemiluminescent Western blotting detection system (NEN Life Science Products) according to the manufacturer’s protocol. As a control, VDR Western blots were also analyzed for {alpha}-tubulin (antibody from Sigma). {alpha}-Tubulin in UMR cells was not found to be regulated by 1,25-(OH)2D3 or ICER. Thus, {alpha}-tubulin antibody was used to detect any problems with transfer or differences in sample loading. Western blots were quantitated by densitometric scanning. The relative optical density obtained using VDR antibody was divided by the relative optical density obtained after incubation with the control antibody to normalize for sample variation. Slight differences in the mobility of VDR were occasionally observed within the same Western blot under different conditions. Differences in mobility were found to be due to electrophoretic conditions because analysis of the same Western blot with antitubulin resulted in similar slight differences in tubulin mobility. Also differences in mobility of VDR under various conditions were not generally observed in different Western blots.

For Western blot analysis of ICER, UMR-106 cells were harvested in PBS and extracts were prepared. Aliquots (50 µg) were then used for Western blot analysis using a 15% sodium dodecyl sulfate polyacrylamide gel with subsequent transfer of protein to polyvinylidine difluoride membrane incubated with a polyclonal antibody raised against the ICER protein (15) in 5% nonfat milk (1:1000 dilution) for 16 h at 4 C. Membranes were then processed as described for the VDR Western blot.

Cell Transfection and Assay of CAT or Luciferase Activity
For transfection studies, promoter constructs containing the rat 24OHase promoter (-1367/+74) (48) or the mouse OPN promoter (-777/+79) (49) linked to the CAT reporter gene were used. A tk CAT reporter plasmid containing multiple copies of the rat 24OHase VDRE (-150/-136) (11) was also used. The mouse OPN VDRE tk CAT construct, containing multiple copies of the mouse OPN VDRE (-757/-743), was obtained from Dr. L. P. Freedman (Memorial Sloan-Kettering Cancer Center, New York, NY). The expression vector containing the ICER II-{gamma} coding sequence (pSV2ICER II-{gamma}) is under the control of the SV40 promoter and has been previously described (15). The ERE tk CAT construct as well as the human ER expression vector were obtained from Benita Katzenellenbogen (University of Illinois, Urbana, IL). The tk CAT construct (pBL2CAT vector upstream from the minimal promoter region of the herpes virus tk gene) was from J. W. Pike (University of Cincinnati, Cincinnati, OH).

For transient transfections, UMR or JEG cells were plated at a density of 1 x 106 cells/100-mm plate in DMEM + Ham’s-F12 nutrient mixture or MEM, respectively. UMR or JEG cells were cotransfected with indicated amounts of reporter plasmid, ICER II-{gamma} expression vector or vector alone, and/or ß-galactosidase expression vector (pCH110, Pharmacia Biotech, Piscataway, NJ) using the Lipofectamine 2000 reagent (Life Technologies, Inc.) according to the manufacturer’s protocol. In some studies results obtained using vector alone or no DNA transfected were compared and found to be identical. Efficiency of transfection, as assessed by green fluorescent protein cotransfection and subsequent visualization, was estimated at 60–70%. Cells were transfected for 16 h, shocked for 1 min with 10% dimethyl sulfoxide-PBS, washed with PBS, and treated in medium supplemented with charcoal-dextran-treated FBS for 24 h with vehicle (0.1% ethanol) or test compound at the concentrations indicated. After a 24-h incubation, cells were harvested and cell extracts were prepared by freeze (-80 C)-thaw (37 C) five times, 5 min each. In some experiments VDR was overexpressed in UMR cells (Fig. 8CGo). hVDR expression vector was a gift from J. W. Pike (University of Wisconsin, Madison, WI).

For stable transfection with ICER II-{gamma}, UMR cells were plated at a density of 1 x 106 cells/100-mm plate and transfected using the calcium phosphate DNA precipitation method (50) with either empty vector (10 µg) or vector containing the ICER II-{gamma} cDNA under the control of the human metallothionein IIA cadmium-inducible promoter (10 µg). Cells stably expressing the vector or ICER cDNA were selected by incubation for 14–21 d with increasing amounts of the antibiotic G418. Multiple colonies with similar morphologies were cloned and analyzed for ICER expression by Northern and Western analysis as previously described.

The CAT assay was performed at constant ß-galactosidase activity and/or equivalent amounts of protein following standard protocols (50, 51). For each experiment, extracts from vector-transfected and ICER-transfected cells were processed identically and spotted on the same thin-layer chromatography plate for the assay of CAT activity. Luciferase activity, performed at constant ß-galactosidase activity and/or equivalent amounts of protein, was determined using a luciferase assay system (Promega Corp.). Autoradiograms were analyzed by densitometric scanning using the Shimadzu CS9000U Dual-Wavelength Flying Spot scanner (Shimadzu Scientific Instruments). For a number of studies several autoradiographic exposure times were needed to estimate changes in CAT activity. Luciferase results were quantitated as relative light units using a luminometer.

hVDR-Luciferase Construct
Human genomic DNA was isolated by proteinase K digestion of human vascular endothelial tissue followed by phenol/chloroform extraction and ethanol precipitation. Oligonucleotide primers were designed that were complementary to known sequences in the hVDR promoter (28). These primers were used for PCR amplification of a fragment of the promoter region upstream of exon 1A (-1500/+60) of the hVDR. PCR products were resolved on a 1% agarose gel and visualized with ethidium bromide. A single prominent band was visualized at approximately 1.5 kb. This fragment was gel purified and then ligated into the luciferase expression vector pGL-2 basic (Promega Corp.) using BglII and HindIII restriction sites that had been added onto the ends of the PCR product. Identity and orientation of the insert were confirmed by sequencing.

EMSAs
Complementary oligonucleotide probes were synthesized corresponding to the proximal VDRE of the rat 24OHase gene promoter region (5'-CTAGGAGGCC CCGGCGCCCTCACTCACCTCGCGA CTCATGTCCT-3'. Overlapping forward and reverse strands were heat denatured and annealed overnight at room temperature. Oligonucleotide probe (50 ng) was 5'-end labeled with [{alpha}-32P] using T4 polynucleotide kinase and purified using P30 gel exclusion columns (Bio-Rad Laboratories, Inc.). Purified VDR (20 ng) and 6.5 ng of purified RXR (gifts from Dr. L. P. Freedman) were incubated with 0.3–0.5 ng (100,000 cpm) of labeled probe for 20 min at room temperature in the absence or presence of 20–250 ng bacterially expressed ICER in binding buffer (40 mM Tris-HCl, pH 7.9; 2 mM EDTA, pH 8.0; 100 mM NaCl; 20% glycerol; 0.2% Nonidet P-40; and 2 mM dithiothreitol). Samples were then resolved with electrophoresis using 6% native polyacrylamide gels. Gels were dried and exposed to film.

To examine a potential for ICER binding to the hVDR promoter, complementary oligonucleotide probes were synthesized corresponding to CRE-like sequences present in the hVDR promoter. hVDR1 was a 23 mer (5'-GGTGGGGG TGACGCACCTGGCTC corresponding to the region (-369/-347), and hVDR2 was a 22 mer (5'-GGGAGCAATGACGCAACTCCGG corresponding to the region (-579/-558). An oligonucleotide probe containing a canonical CRE from the somatostatin gene promoter region -54/-37 (5'-CTTGGCTGACGTCAGAGA was also used as a positive control for ICER binding. Bacterially expressed ICER II-{gamma} (250–500 ng) (15) was incubated with 0.5 ng (80,000 cpm) of labeled oligonucleotide probe for 20 min at room temperature in binding buffer (50 mM Tris-HCl, pH 7.9; 12.5 mM MgCl2; 1 mM EDTA; 1 mM dithiothreitol; and 20% glycerol).

Statistical Analysis
Results are expressed as the mean ± SE, and significance was determined by analysis with Student’s t test for two-group comparison or ANOVA for multiple group comparison. In conjunction with ANOVA, a posttest analysis by Dunnett’s multiple t statistic was used with a significance level of 0.05.


   ACKNOWLEDGMENTS
 
We acknowledge Dr. Bheem Bhat (Wyeth-Ayerst Laboratories, Inc., Radnor, PA) for providing the CRE-tk luciferase construct, and Dr. Leonard P. Freedman (Memorial Sloan-Kettering Cancer Center, New York, NY) for purified VDR and RXR. The expert assistance of Xiaorong Peng and Dr. Angela Porta in certain aspects of this investigation is also gratefully acknowledged.


   FOOTNOTES
 
This work was supported by NIH Grant DK-38961 (to S.C.) and NIH Grant CA-69316 (to C.A.M.).

Abbreviations: CAT, Chloramphenicol acetyltransferase; CRE, cAMP response element; CREB, CRE-binding protein; CREM, CRE modulator; ER, estrogen receptor; ERE, estrogen response element; FBS, fetal bovine serum; hVDR, human VDR; ICER, inducible cAMP early repressor; 24OHase, 24-hydroxylase; 1,25-(OH)2D3, 1,25-dihydroxyvitamin D3; OPN, osteopontin; PKA, protein kinase A; RXR, retinoid X receptor; SSC, standard saline citrate; tk, thymidine kinase; VDR, vitamin D receptor; VDRE, vitamin D response element.

Received for publication October 4, 2001. Accepted for publication May 20, 2002.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Juppner H, Abou-Samra A, Freeman M, Kong XF, Schipani E, Richards J, Kolakowski Jr LF, Hock J, Potts Jr JT, Kronenberg HM, Segre GV 1991 A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254:1024–1026[Abstract/Free Full Text]
  2. Clohisy JC, Scott DK, Brakenhoff KD, Quinn CO, Partridge NC 1992 Parathyroid hormone induces c-fos and c-jun messenger RNA in rat osteoblastic cells. Mol Endocrinol 6:1834–1842[Abstract/Free Full Text]
  3. Greenfield EM, Horowitz MC, Lavish SA 1996 Stimulation by parathyroid hormone of interleukin-6 and leukemia inhibitory factor expression in osteoblasts is an immediate-early gene response induced by cAMP signal transduction. J Biol Chem 271:10984–10989[Abstract/Free Full Text]
  4. Scott DK, Brakenhoff KD, Clohisy JC, Quinn CO, Partridge NC 1992 Parathyroid hormone induces transcription of collagenase in rat osteoblastic cells by a mechanism using cyclic adenosine 3',5'-monophosphate and requiring protein synthesis. Mol Endocrinol 6:2153–2159[Abstract/Free Full Text]
  5. Tetradis S, Pilbeam CC, Liu Y, Kream BE 1996 Parathyroid hormone induces prostaglandin G/H synthase-2 expression by a cyclic adenosine 3', 5'-monophosphate-mediated pathway in the murine osteoblastic cell line MC-3T3-E1. Endocrinology 137:5435–5440[Abstract]
  6. Noda M, Yoon K, Rodan GA 1988 Cyclic AMP-mediated stabilization of osteocalcin mRNA in rat osteoblast-like cells treated with parathyroid hormone. J Biol Chem 263:18574–18577[Abstract/Free Full Text]
  7. Noda M, Rodan GA 1989 Transcriptional regulation of osteopontin production in rat osteoblast-like cells by parathyroid hormone. J Cell Biol 108:713–718[Abstract/Free Full Text]
  8. Armbrecht HJ, Hodam TL, Boltz MA, Partridge NC, Brown AJ, Kumar VB 1998 Induction of the vitamin D 24-hydroxylase (CYP24) by 1,25-dihydroxyvitamin D3 is regulated by parathyroid hormone in UMR 106 osteoblastic cells. Endocrinology 139:3375–3381[Abstract/Free Full Text]
  9. Van Leeuwen JP, Birkenhager JC, van den Bemd GC, Pols HA 1996 Evidence for coordinated regulation of osteoblast function by 1,25-dihydroxyvitamin D3 and parathyroid hormone. Biochim Biophys Acta 1312:54–62[Medline]
  10. Krishnan AV, Cramer SD, Bringhurst FR, Feldman D 1995 Regulation of 1,25-dihydroxyvitamin D3 receptors by parathyroid hormone in osteoblastic cells: role of second messenger pathways. Endocrinology 136:705–712[Abstract]
  11. Yang W, Hyllner SJ, Christakos S 2001 Interrelationship between signal transduction pathways and 1,25(OH)2D3 in UMR 106 osteoblastic cells. Am J Physiol Endocrinol Metab 281:E162–E170
  12. Reddy GS, Tserng KY 1989 Calcitroic acid, end product of renal metabolism of 1,25-dihydroxyvitamin D3 through C-24 oxidation pathway. Biochemistry 28:1763–1769[CrossRef][Medline]
  13. St-Arnaud R, Arabian A, Travers R, Barletta F, Raval-Pandya M, Chapin K, Depovere J, Mathieu C, Christakos S, Demay MB, Glorieux FH 2000 Deficient mineralization of intramembranous bone in vitamin D-24-hydroxylase-ablated mice is due to elevated 1,25-dihydroxyvitamin D and not to the absence of 24,25-dihydroxyvitamin D. Endocrinology 141:2658–2666[Abstract/Free Full Text]
  14. Denhardt DT, Noda M 1998 Osteopontin expression and function: role in bone remodeling. J Cell Biochem (Suppl 30–31):92–102
  15. Molina CA, Foulkes NS, Lalli E, Sassone-Corsi P 1993 Inducibility and negative autoregulation of CREM: an alternative intronic promoter directs the expression of ICER, an early response repressor. Cell 75:875–886[CrossRef][Medline]
  16. Stehle JH, Foulkes NS, Molina CA, Simonneaux V, Pevet P, Sassone-Corsi P 1993 Adrenergic signals direct rhythmic expression of transcriptional repressor CREM in the pineal gland. Nature 365:314–320[CrossRef][Medline]
  17. Lamas M, Sassone-Corsi P 1997 The dynamics of the transcriptional response to cyclic adenosine 3',5'-monophosphate: recurrent inducibility and refractory phase. Mol Endocrinol 11:1415–1424[Abstract/Free Full Text]
  18. Lalli E, Sassone-Corsi P 1995 Thyroid-stimulating hormone (TSH)-directed induction of the CREM gene in the thyroid gland participates in the long-term desensitization of the TSH receptor. Proc Natl Acad Sci USA 92:9633–9637[Abstract/Free Full Text]
  19. Monaco L, Foulkes NS, Sassone-Corsi P 1995 Pituitary follicle-stimulating hormone (FSH) induces CREM gene expression in Sertoli cells: involvement in long-term desensitization of the FSH receptor. Proc Natl Acad Sci USA 92:10673–10677[Abstract/Free Full Text]
  20. Bodor J, Spetz AL, Strominger JL, Habener JF 1996 cAMP inducibility of transcriptional repressor ICER in developing and mature human T lymphocytes. Proc Natl Acad Sci USA 93:3536–3541[Abstract/Free Full Text]
  21. Walker WH, Daniel PB, Habener JF 1998 Inducible cAMP early repressor ICER down-regulation of CREB gene expression in Sertoli cells. Mol Cell Endocrinol 143:167–178[CrossRef][Medline]
  22. Kameda T, Mizutani T, Minegishi T, Ibuki Y, Miyamoto K 1999 Regulation of cAMP responsive element binding modulator isoforms in cultured rat ovarian granulosa cells. Biochim Biophys Acta 1445:31–38[Medline]
  23. Thommesen L, Norsett K, Sandvik AK, Hofsli E, Laegreid A 2000 Regulation of inducible cAMP early repressor expression by gastrin and cholecystokinin in the pancreatic cell line AR42J. J Biol Chem 275:4244–4250[Abstract/Free Full Text]
  24. Inada A, Someya Y, Yamada Y, Ihara Y, Kubota A, Ban N, Watanabe R, Tsuda K, Seino Y 1999 The cyclic AMP response element modulator family regulates the insulin gene transcription by interacting with transcription factor IID. J Biol Chem 274:21095–21103[Abstract/Free Full Text]
  25. Foulkes NS, Sassone-Corsi P 1992 More is better: activators and repressors from the same gene. Cell 68:411–414[CrossRef][Medline]
  26. Tetradis S, Nervina JM, Nemoto K, Kream BE 1998 Parathyroid hormone induces expression of the inducible cAMP early repressor in osteoblastic MC3T3-E1 cells and mouse calvariae. J Bone Miner Res 13:1846–1851[CrossRef][Medline]
  27. Mellon PL, Clegg CH, Correll LA, McKnight GS 1989 Regulation of transcription by cAMP dependent protein kinase. Proc Natl Acad Sci USA 86:4887–4891[Abstract/Free Full Text]
  28. Miyamoto K, Kesterson RA, Yamamoto H, Taketani Y, Nishiwaki E, Tatsumi S, Inoue Y, Morita K, Takeda E, Pike JW 1997 Structural organization of the human vitamin D receptor chromosomal gene and its promoter. Mol Endocrinol 11:1165–1179[Abstract/Free Full Text]
  29. Sun T, Zhao Y, Mangelsdorf DJ, Simpson ER 1998 Characterization of a region upstream of exon I.1 of the human CYP19 (aromatase) gene that mediates regulation by retinoids in human choriocarcinoma cells. Endocrinology 139:1684–1691[Abstract/Free Full Text]
  30. Liu F, Thompson MA, Wagner S, Greenberg ME, Green MR 1993 Activating transcription factor-1 can mediate Ca(2+)- and cAMP-inducible transcriptional activation. J Biol Chem 268:6714–6720[Abstract/Free Full Text]
  31. Masquilier D, Sassone-Corsi P 1992 Transcriptional cross-talk: nuclear factors CREM and CREB bind to AP-1 sites and inhibit activation by Jun. J Biol Chem 267:22460–22466[Abstract/Free Full Text]
  32. Pfeffer M, Maronde E, Molina CA, Korf HW, Stehle JH 1999 Inducible cyclic AMP early repressor protein in rat pinealocytes: a highly sensitive natural reporter for regulated gene transcription. Mol Pharmacol 56:279–289[Abstract/Free Full Text]
  33. Tinti C, Conti B, Cubells JF, Kim K-S, Baker H, Joh TH 1996 Inducible cAMP early repressor can modulate tyrosine hydroxylase gene expression after stimulation of cAMP synthesis. J Biol Chem 271:25375–25381[Abstract/Free Full Text]
  34. Christakos S, Raval-Pandya M, Wernyj RP, Yang W 1996 Genomic mechanisms involved in the pleiotropic actions of 1,25-dihydroxyvitamin D3. Biochem J 316:361–371
  35. Haussler MR, Jurutka PW, Hsieh J-C, Thompson PD, Selznick SH, Haussler CA, Whitfield GK 1995 New understanding of the molecular mechanism of receptor-mediated genomic actions of the vitamin D hormone. Bone 17:33S–38S[CrossRef]
  36. Krishnan AV, Feldman D 1991 Activation of protein kinase-C inhibits vitamin D receptor gene expression. Mol Endocrinol 5:605–612[Abstract/Free Full Text]
  37. Krishnan AV, Feldman D 1992 Cyclic adenosine 3',5'-monophosphate up-regulates 1,25-dihydroxyvitamin D3 receptor gene expression and enhances hormone action. Mol Endocrinol 6:198–206[Abstract/Free Full Text]
  38. Sassone-Corsi P 1998 Coupling gene expression to cAMP signaling: role of CREB and CREM. Int J Biochem Cell Biol 30:27–38[CrossRef][Medline]
  39. Candeliere GA, Jurutka PW, Haussler MR, St-Arnaud R 1996 A composite element binding the vitamin D receptor, retinoid X receptor {alpha}, and a member of the CTF/NF-1 family of transcription factors mediates the responsiveness of the c-fos promoter. Mol Cell Biol 16:584–592[Abstract]
  40. Gardiner EM, Baldock PA, Thomas GP, Sims NA, Henderson NK, Hollis B, White CP, Sunn KL, Morrison NA, Walsh WR, Eisman JA 2000 Increased formation and decreased resorption of bone in mice with elevated vitamin D receptor in mature cells of the osteoblastic lineage. FASEB J 14:1908–1916[Abstract/Free Full Text]
  41. Nantel F, Monaco L, Foulkes NS, Masquilier D, Le Meur M, Henriksen K, Dierich A, Parvinen M, Sassone-Corsi P 1996 Spermiogenesis deficiency and germ-cell apoptosis in CREM-mutant mice. Nature 380:159–162[CrossRef][Medline]
  42. Blendy J, Kaestner K, Weinbauer G, Nieschlag E, Schutz G 1996 Severe impairment of spermatogenesis in mice lacking the CREM gene. Nature 380:162–165[CrossRef][Medline]
  43. Pike JW, Kesterson RA, Scott RA, Kerner SA, McDonnell DP, O’Malley BW 1988 Vitamin D receptors: molecular structures of the protein and its chromosomal gene. In: Norman AW, Grogoleit KS, Herrath D, eds. Vitamin D molecular, cellular, and clinical endocrinology: proceedings of the seventh workshop on vitamin D. New York: de Gruyter; 215–224
  44. Ohyama Y, Noshiro M, Okuda K 1991 Cloning and expression of cDNA encoding 25-hydroxyvitamin D3 24-hydroxylase. FEBS Lett 278:195–198[CrossRef][Medline]
  45. Smith JH, Denhardt DT 1987 Molecular cloning of a tumor promoter-inducible mRNA found in JB6 mouse epidermal cells: induction is stable at high, but not at low, cell densities. J Cell Biochem 34:13–22[CrossRef][Medline]
  46. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  47. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  48. Omdahl J, May B 1997 The 25-hydroxy-vitamin D 24-hydroxylase. In: Feldman D, Glorieux F, Pike JW, eds. Vitamin D. San Diego, CA: Academic Press; 69–86
  49. Craig AM, Denhardt DT 1991 The murine gene encoding secreted phosphoprotein 1 (osteopontin): promoter structure, activity and induction in vivo by estrogen and progesterone. Gene 100:163–171[CrossRef][Medline]
  50. Ausubel FM, Brent R, Kingston E, Moore DD, Steidman JG, Smith JA, Struhl K 1992 Current protocols in molecular biology. New York: Wiley
  51. Gorman CM, Moffat LF, Howard BH 1982 Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 2:1044–1051[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   VDR  |  ERα
Ligands:   Calcitriol  |  17β-Estradiol



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
P. Dhawan, R. Weider, and S. Christakos
CCAAT Enhancer-binding Protein {alpha} Is a Molecular Target of 1,25-Dihydroxyvitamin D3 in MCF-7 Breast Cancer Cells
J. Biol. Chem., January 30, 2009; 284(5): 3086 - 3095.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Maiti, N. C. Hait, and M. J. Beckman
Extracellular Calcium-sensing Receptor Activation Induces Vitamin D Receptor Levels in Proximal Kidney HK-2G Cells by a Mechanism That Requires Phosphorylation of p38{alpha} MAPK
J. Biol. Chem., January 4, 2008; 283(1): 175 - 183.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
V. Morales, I. Gonzalez-Robayna, M. P. Santana, I. Hernandez, and L. F. Fanjul
Tumor Necrosis Factor-{alpha} Activates Transcription of Inducible Repressor Form of 3',5'-Cyclic Adenosine 5'-Monophosphate-Responsive Element Binding Modulator and Represses P450 Aromatase and Inhibin {alpha}-Subunit Expression in Rat Ovarian Granulosa Cells by a p44/42 Mitogen-Activated Protein Kinase-Dependent Mechanism
Endocrinology, December 1, 2006; 147(12): 5932 - 5939.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
L. A. Zella, S. Kim, N. K. Shevde, and J. W. Pike
Enhancers Located within Two Introns of the Vitamin D Receptor Gene Mediate Transcriptional Autoregulation by 1,25-Dihydroxyvitamin D3
Mol. Endocrinol., June 1, 2006; 20(6): 1231 - 1247.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos
Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase
Mol. Cell. Biol., January 1, 2005; 25(1): 472 - 487.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
F. Barletta, P. Dhawan, and S. Christakos
Integration of hormone signaling in the regulation of human 25(OH)D3 24-hydroxylase transcription
Am J Physiol Endocrinol Metab, April 1, 2004; 286(4): E598 - E608.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huening, M.
Right arrow Articles by Christakos, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huening, M.
Right arrow Articles by Christakos, S.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*PARATHYROID HORMONE

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals