help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0192
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glozak, M. A.
Right arrow Articles by Rogers, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glozak, M. A.
Right arrow Articles by Rogers, M. B.
Molecular Endocrinology 17 (1): 27-41
Copyright © 2003 by The Endocrine Society

Trapping and Characterization of Novel Retinoid Response Elements

Michele A. Glozak1, Yong Li1, Rae Reuille, Kwan Hee Kim, My-Nuong Vo and Melissa B. Rogers

Department of Biology (M.A.G., Y.L., R.R., M.B.R.) and Institute for Biomolecular Science (M.B.R.), University of South Florida, Tampa, Florida 33620; Departments of Genetics, Cell Biology, and Biochemistry (K.H.K., M.-N.V.), Washington State University, Pullman, Washington 99164; and Department of Biochemistry and Molecular Biology (M.B.R.), UMDNJ-New Jersey Medical School, Newark, New Jersey 07103

Address all correspondence and requests for reprints to: Dr. Melissa Rogers, Biochemistry & Molecular Biology (MSB E627), UMDNJ-New Jersey Medical School, 185 South Orange Avenue, Newark, New Jersey 07103-2714. E-mail: rogersmb{at}umdnj.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Retinoids, such as retinoic acid (RA), play a critical role in normal vertebrate development and physiology. However, embryonic exposure to excess retinoids also causes severe malformations. Retinoids bind RA receptors and retinoid X receptors, thus activating a plethora of genes. Separating the genes induced directly by retinoid-bound receptors from those induced subsequently by other transcription factors is difficult. The loose consensus defining known RA responsive elements (RAREs) further complicates this effort. We developed a yeast-based system to trap functional RAREs in the mouse genome. Several of the clones contain RAREs near RA-induced genes. Mammalian reporter gene analyses and EMSAs showed that these are bona fide RAREs. This functional genomics approach should identify RA-regulated genes that initiate critical signaling cascades in cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
VITAMIN A (RETINOL) and other retinoids are crucial mediators of normal development and physiology. Vitamin A deficiency also elevates the risk of developing cancer. Paradoxically, retinoids are teratogenic at high doses. Interestingly, vitamin A deficiency, blocks in retinoid signal transduction, or retinoid overdose induce similar malformations (1, 2). The most extensively studied retinoid, all-trans-retinoic acid [RA (1)], affects embryonic or adult cell behavior by altering proliferation or differentiation, or by inducing cell death (3). Retinoids exert their influence on cells by controlling the expression of specific genes. Identifying these directly regulated genes will provide critical insight into these processes.

RA-regulated gene expression is mediated by nuclear receptors that act as retinoid-dependent transcription factors. These receptors are encoded by six different genes, RA receptor (RAR) {alpha}, ß, and {gamma} and retinoid X receptor (RXR) {alpha}, ß, and {gamma}, and act as homodimers and heterodimers (4). The sequences bound by these receptors are highly pleiotropic. Although a loose consensus sequence of two directly repeated PuG(G/T)TCA motifs (half-sites) separated by five nucleotides (DR5) occurs in many genes, the spacing, relative position, and number of these repeats are highly variable (4). Indeed, RARs have been shown to bind and activate transcription via half-sites separated by up to 150 nucleotides (5). Variation in the consensus half-site sequence is also common. The diversity of receptors and binding elements makes it difficult to identify RA response elements (RAREs) from sequence alone.

Like many other enhancers, RAREs may be located within distant control regions. Although the natural tendency to study regulatory elements near promoters creates a strong bias toward discovering upstream RAREs, RAREs have been identified in introns [e.g. the major histocompatability complex (MHC) H2Kb and CD38 genes (6, 7)] or kilobases downstream of their genes [e.g. erythropoietin and Hoxa1, b1, a4, b4, and d4, (8, 9, 10, 11)]. The pattern of RAREs regulating the Hoxb1 gene strongly supports the need for an RARE screen unbiased by location. The Hoxb1 gene is controlled by three, highly conserved RAREs that independently mediate part of the endogenous expression pattern and response to retinoid exposure in vivo (Ref.11 and references therein). One RARE is upstream and two are 3 kb and 6.5 kb downstream of the transcribed region. The presence and requirement for all three elements were only uncovered after nearly a decade of transgenic mouse labor by several laboratories. Similarly, in vivo Hoxd4 expression requires both upstream and downstream RAREs.

Retinoid-responsive genes have been discovered by serendipity and methods such as differential hybridization (12); subtractive hybridization (13); enhancer/gene traps (14, 15); and PCR-assisted binding site selection from chromatin (16). Because retinoid receptor isoforms and accessory transcription factors differ in various cell types, a gene that is not RA responsive in the chosen cells will be missed. For example, because embryonal carcinoma or embryonic stem cells were used in the published examples, genes induced in adult cells may be underrepresented. Approaches such as differential hybridization rely on differences in mRNA abundance between untreated and RA-treated cells. Because retinoids can induce other transcription factors or signaling molecules, the induction of a particular gene in an RA-treated cell may be only indirectly due to RA. Also, due to an experimental bias toward strongly induced genes, weakly induced genes may be missed. Another difficulty with screening for RA-regulated genes in mammalian cells is that many mammalian cells stop growing or undergo apoptosis in the presence of RA (3). Thus, cell lines must be replicated to a master plate and a test plate containing RA. Although trivial for microbes, replica plating mammalian tissue culture cells is laborious.

Directly regulated genes should be associated with RAREs. Thus, we devised a method to trap RAREs based on their functionality in yeast and have begun to analyze the expression of nearby genes. This approach avoids many of the biases described above.

Yeast lack retinoid receptors and exhibit little retinoid-metabolizing activity. However, if transformed with receptor expression vectors, yeast can synthesize functional receptors. These receptors drive the RA-dependent expression of yeast reporter genes under the control of mammalian RAREs (17, 18, 19). We previously showed that an RARE near the key developmental gene bone morphogenetic protein (Bmp)2 can function in yeast expressing mammalian retinoid receptors (20). A major advantage of using yeast is the absence of retinoid-induced gene-regulatory proteins that might activate mammalian genes. Thus, only elements directly activated by retinoid-bound receptors can function in yeast. We used this approach to screen the mouse genome for RAREs responsive to RARß and RXR{gamma} homo- or heterodimers. We demonstrated that RAREs trapped in yeast can drive mammalian reporter genes in response to RA and can bind RARß/RXR{gamma} directly in vitro. Furthermore, RA induces the transcription of genes associated with these RAREs in mammalian cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Preparation of a Murine Genomic DNA Library in a Yeast Reporter Vector
We showed previously that a 57-bp sequence between -2373 to -2316 bp relative to the Bmp2 translation start site drove RA-responsive ß-galactosidase (ß-gal) expression in yeast (20). Because trapping a RARE near the Bmp2 gene suggested that trapping RAREs from the mouse genome was feasible, we constructed a mouse genomic DNA library in the yeast ß-gal vector p{Delta}ss (21). This plasmid encodes ß-gal under the control of a minimal cyc1 promoter. An enhancer is required to activate this promoter. The ß-gal gene was specifically chosen over selectable markers to permit the trapping of both weak and strong RAREs. Genomic DNA was partially digested with Sau3AI into fragments of approximately 2 kb, which were inserted upstream of the cyc1 promoter. The probability (P) of having any individual 2-kb sequence represented in a typical murine genomic library can be calculated from the formula: n = ln (1 - P)/ln [1 - (2 x 103/3 x 109)], where n is the number of independent clones in the library (22). Because the size of the mouse genome is 3 x 109 bp and this library contained 1.3 x 106 independent clones (2.6 x 109 bp), any individual genomic DNA sequence has a 58% probability of representation in this library.

Selection of RA-Induced Clones
The strategy to screen the library for RARE-containing plasmids is illustrated in Fig. 1Go. The host strain, BJ5409, is auxotrophic for uracil, tryptophan, and histidine. This allows transformation with two different receptor expression vectors and a reporter vector. The ß-gal reporter plasmid, p{Delta}ss, confers the ability to grow on plates lacking uracil (21). The retinoid receptor expression vectors p2HG-RARß and pG1-RXR{gamma} confer the ability to grow on plates lacking histidine and tryptophan, respectively (18).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Strategy to Select Genomic Sequences Containing RAREs in Yeast

Sau3AI-generated fragments were inserted upstream of the cyc1 promoter and the ß-gal coding region of p{Delta}ss. BJ5409 cells expressing both RARß and RXR{gamma} were transformed with these plasmids and selected on plates containing Xgal and 5 µM all-trans-RA. ß-gal-positive (blue) colonies were streaked onto plates without or with RA. Streaks that were darker blue on plates containing RA were considered induced ( ). Streaks that were equally blue in the presence or absence of RA were considered constitutive (C).

 
Competent BJ5409 cells expressing both RARß and RXR{gamma} were transformed with the genomic DNA library plasmids. Transformants were selected on plates containing Xgal with 5 µM all-trans-RA added to ensure the expression of ß-gal controlled by trapped RAREs. Transformants (2 x 105), equivalent to about 9% of the mouse genome, were grown 4 d at 30 C. A total of 1544 colonies were blue, indicating that these murine sequences activated the minimal cyc1 promoter. Blue colonies contained either sequences that specifically responded to RA or sequences that constitutively induced ß-gal expression. To identify the blue colonies specifically induced by RA, blue colonies were streaked and replica-plated onto Xgal plates containing or lacking RA (Fig. 1Go). Sixty-four colonies were blue on Xgal plus RA plates but not on Xgal minus RA plates, suggesting that these reporter plasmids contained RAREs.

The activity of the trapped RAREs was quantified using liquid ß-gal assays. Because the yeast clones may have had more than one reporter plasmid, rescued plasmids were transformed back into yeast to confirm that one plasmid was responsible for the observed induction. Thirty-two reporter plasmids exhibited at least 2-fold inducibility upon preliminary analysis.

Receptor Heterodimers Activate the Trapped RAREs Most Efficiently
The isolated RAREs drove RA-responsive ß-gal gene transcription in yeast transformed with both RARß and RXR{gamma}. Because the in vivo receptor complex can be either heterodimers or homodimers of RARß and RXR{gamma}, we examined which receptors optimally activate the isolated RAREs. A subset of trapped clones, selected on the basis of their strength or close proximity to transcribed sequences (A24 and D6), was transformed into yeast expressing no receptor, RARß alone, RXR{gamma} alone, or both receptors. These cultures were treated with the RAR/RXR panagonist, 9-cis RA, to activate both the homo- and heterodimeric forms of the receptors. Two control reporter genes also were tested. The YRpßRE plasmid contains a natural RARE from the RARß gene (17). The YRpCRBPII plasmid contains a natural RARE from the cellular retinol binding protein (CRBP) II gene that is induced exclusively by 9-cis RA-activated RXRs in yeast (17). The ß-gal activity of untreated cultures or cultures treated with 1 µM 9-cis RA was compared (Table 1Go). The most robust induction occurred in yeast expressing both RARß and RXR{gamma}, suggesting that these elements are preferentially activated by RA-bound heterodimers in yeast. However, RARß alone (A18, B12, C13) or RXR{gamma} alone (B9, B10, B12) also activated a subset of clones to levels similar to those achieved by these homodimers in ßRE or CRBPII control plasmid-containing yeast, respectively.


View this table:
[in this window]
[in a new window]
 
Table 1. Fold Induction Mediated by RA in Yeast Expressing Various Receptor Combinations

 
RARE Structure and Functionality in Mammalian Cells
A subset of clones was selected to identify the specific RARE sequences and to test their ability to induce transcription in RA-treated mammalian cells. The sequences of these clones were also compared with GenBank to identify transcripts potentially regulated by the trapped DNA.

RA Induction of the Nonclassical MHC Class I Gene, T20d
Many genes are induced by retinoids (23). Isolating a known gene would validate our yeast assay. The MHC class I genes encode highly polymorphic membrane antigens involved in the cellular immune response. RA has long been known to induce classical MHC class Ia genes (24) and RAREs have been identified in or near these genes (6, 25). Our genomic clone D7 overlapped an MHC class Ib gene.

Part of clone D7 is 98% identical to the available sequence for exon 5 and flanking intronic sequences of the nonclassical MHC gene T20d formerly known as T15c [Genbank accession no. X16220 (26, 27)]. Six mismatches out of 328 nucleotides may be accounted for by strain differences because our clone was isolated from a strain 129 library and the GenBank sequence was from BALB/c mice.

Although RA has been shown to induce several classical MHC genes in F9 embryonal carcinoma cells, the RA inducibility of the nonclassical MHC gene T20d has not been tested. Because MHC genes readily cross-hybridize, we used the specific RT-PCR assay devised by Eghtesady et al. (28) to measure the abundance of the T20d transcript in RNA isolated from F9 cells treated for 24 h with 250 µM dibutyryl-cAMP, and 500 µM theophylline (CT) alone or with 1.0 µM all-trans-RA (RACT). As shown in Fig. 2AGo, a 334-bp fragment was specifically amplified from RNA from RACT-treated cells, but not from cells treated with CT. Cells treated for several days with RACT differentiate into parietal endoderm, whereas CT alone has no effect. Differentiation is a stepwise process during which a few directly regulated genes are induced early, within 24 h, before morphological differentiation. In contrast, many genes are not induced until later when cells express the terminally differentiated phenotype. The induction of T20d within 24 h is consistent with direct regulation by RA.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. An RARE Near the T20d Gene

A, T20d is induced in RACT-treated F9 cells. Oligo-deoxythymidine-primed cDNA was synthesized from RNA isolated from F9 cells treated for 24 h with 250 µM dibutyryl cAMP, and 500 µM theophylline with (RACT) or without (CT) 1.0 µM all-trans-RA. T20d-specific primers were used for PCR amplification. To avoid amplifying genomic DNA that might contaminate the RNA, all RT reactions were pretreated with XbaI, which cleaves within the amplified region. The PCR products were Southern blotted and hybridized to a T20d-specific probe. The same RT products were also amplified with actin-specific primers and hybridized to an actin-specific probe. B, The D7 RARE drives RA-dependent reporter gene expression in yeast and F9 cells. The 1301-bp Sau3AI (Sa) insert in the D7 clone is shown with arrows indicating the locations of the DR5s. The entire fragment (n = 8) or a 756-bp Sau3AI subclone (n = 2) in p{Delta}ss was transformed into yeast. The average fold induction of ß-gal by 1 µM 9-cis-RA ± SEM is shown. Two luciferase reporter constructs generated from a 417-bp XbaI (Xb) fragment and a 306-bp XbaI-Sau3AI fragment were transfected into F9 cells in duplicate. Cells were grown in media containing ethanol vehicle alone or media containing 1 µM all-trans-RA for 24 h. Extracts were assayed for luciferase activity in duplicate. The average fold induction by all-trans-RA ± SEM is shown; n = 2–4 transfections. Fold induction mediated by the XbaI fragment did not differ significantly from that mediated by pLucTK2 alone.

 
Both the entire 1301-bp insert and a 756-bp subclone of the D7 clone drove 9-cis RA-dependent ß-gal activity in yeast (Fig. 2BGo). The 756-bp subclone contains two DR5-like motifs located at nucleotides 687–703 (AGGTAAattgaAGGTCA) and 1065–1081 (AGGTCAgggtgATGTCA). DR5 indicates that two PuG(G/T)TCA motifs are separated by five nucleotides. We used reporter gene analyses to measure their respective RARE activities in mammalian cells. Placing fragments containing nucleotides 541–847 (Sa to Xb) or 847-1264 (Xb to Xb) upstream of the minimal thymidine kinase (TK) promoter in pLucTK2 separated the putative RAREs (Fig. 2BGo). Only the construct containing the DR5 element at 687–703 induced reporter gene expression after 24 h of 1 µM all-trans-RA treatment. Thus, this sequence is a functional RARE in both mammalian and yeast reporter gene assays. This suggests that, like other MHC genes, RA may regulate T20d.

A Gene Involved in Spermatogenesis (D6)
A portion of clone D6 matched the sperizin gene (29). Exclusively expressed in round spermatids, sperizin encodes a RING zinc-finger protein. Proteins with these motifs often exhibit ubiquitin E3 ligase activity (30, 31), suggesting sperizin may be involved in the dramatic cellular remodeling occurring during spermiogenesis. The D6 clone includes 390 bp of this intronless gene and 1007 bp of downstream sequence (Fig. 3BGo). Vitamin A (retinol) is vital in maintaining mammalian spermatogenesis (32). Dietary treatment of vitamin A-deficient animals with retinoids can reinitiate spermatogenesis. Several genes regulated by RA in testes have been identified by various means including gene traps (14, 33, 34, 35, 36). To test the hypothesis that vitamin A can induce sperizin transcription in vivo, we compared the levels of sperizin RNA in the testes of vitamin A-sufficient and vitamin A-deficient rats (Fig. 3AGo). Because only A-type spermatogonia and preleptotene spermatocytes remain in vitamin A-deficient rats, it was not surprising that the round spermatid-specific sperizin transcript was undetectable (36). We also measured sperizin RNA in testes in which spermatogenesis was reinitiated by retinol injection. The sperizin transcript was induced within 4 h of injection and levels continued to rise 8 h post injection (Fig. 3AGo, lanes 2–4).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Activation of Sperizin by Retinoids

A, Retinol induces sperizin in vitamin A-deficient rat testes. Total RNA was isolated from the testes of rats fed vitamin A-sufficient diets (Normal) and rats fed vitamin A-deficient diets for 10 wk (VAD). Retinol-replenished rats were fed vitamin A-deficient diets for 10 wk followed by the injection of 7.5 mg retinol. RNA was isolated 4 (VAD + 4 h ROH) or 8 h (VAD + 8 h ROH) after injection (36 ). Blots were probed with an EST encoding sperizin (IMAGE clone 602592, GenBank accession no. AA144720). The blot was stripped and hybridized to actin to control for loading. B, A sequence downstream of sperizin drives all-trans-RA-inducible luciferase gene expression in yeast and F9 cells. The D6 1397 bp Sau3AI (Sa) insert is shown with arrows indicating the DR5 elements located 218 and 553 bp downstream of the sperizin polyadenylation site. The 3'-end of the sperizin gene is indicated by a solid black box. The entire 1397-bp fragment in p{Delta}ss was transformed into yeast. The average fold induction of ß-gal by 1 µM 9-cis-RA ± SEM is shown; n = 4. The 1179-bp XhoI (X) subclone in pLucTK2 was transfected in duplicate into F9 cells that were then treated with ethanol vehicle or 1 µM all-trans-RA as described in Fig. 2Go; n = 3 independent transfections, shown with the SEM.

 
Two putative DR5 class RAREs, AGTGCAcacggGGTTCC and AGTTCAaattcGGGTCC were identified in the D6 sequence 218 and 553 bp downstream from the sperizin polyadenylation signal. A fragment containing these RAREs induced luciferase reporter gene expression in the presence of 1 µM all-trans-RA (Fig. 3BGo). The level of reporter gene induction in F9 cells was comparable to that observed in yeast cells. The identification of a functional RARE downstream of the sperizin gene and the rapid induction of sperizin transcription by retinol suggest that retinoids directly induce sperizin.

A Highly Conserved Trapped Gene (A24)
Analysis of the genomic clone A24 revealed a sequence resembling a DR5 RARE: AGGTCAgctggGGGGCA. To test whether or not this element can mediate RA-regulated expression in mammalian cells, several subclones of A24 were inserted into mammalian reporter vectors. The luciferase activity of these sequences in the presence or absence of retinoid was tested. A 145-bp subclone containing the intact DR5 element induced luciferase activity fold in response to all-trans-RA in the context of two different promoters, TK (3.17 ± 0.23, n = 4 in pLucTK2, Fig. 4AGo) and SV40 (3.87 ± 0.02, n = 2, in pGL3pro, not shown). 9-cis-RA also induced the TK subclone to similar levels (2.87 ± 0.33, n = 2, not shown). In contrast, the fold induction mediated by clones containing only one half-site did not differ significantly from that of the empty vector, pLucTK2 (Fig. 4AGo).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 4. The A24 RARE Functions in Vitro and in Vivo

A, The A24 RARE drives all-trans-RA-inducible luciferase gene expression in F9 cells. The 986-bp Sau3AI (Sa) insert in the A24 clone is shown with an arrow indicating the DR5 located 85 bp downstream from the S8 polyadenylation site. Three luciferase reporter constructs generated from the entire 145-bp SspI (Ss)-StyI (St) fragment containing the RARE or 30-bp or 115-bp subclones generated by PvuII digestion were transfected into F9 cells in duplicate. The PvuII (Pv) site bisects the RARE. Cells were then treated with ethanol vehicle alone or with media containing 1 µM all-trans-RA for 24 h. Extracts were assayed for luciferase activity in duplicate. The average fold induction by all-trans-RA ± SEM is shown; n = 2–4 independent transfections. B, RARß/RXR{gamma} heterodimers bind the A24 RARE. Oligonucleotides containing wild-type (TCGAGAAGGTCAGCTGGGGGGCAGG) or mutated (mutated nucleotides are indicated by lowercase letters: TCGAGAAcGagcGCTGGaGGGacGG) A24 RAREs were radiolabeled and incubated with in vitro transcribed and translated RARß and RXR{gamma}, and then electrophoresed through nondenaturing gels. WGE indicates unprogrammed wheat germ extract. C, Competition for binding to the A24 RARE. Unlabeled wild-type or mutant competitor oligonucleotides (25-, 50-, and 100-fold molar excess, as indicated by the triangles) were added to compete with the labeled wild-type oligonucleotide for binding to RARß and RXR{gamma}. The fraction of bound oligonucleotide in the presence of competitor oligonucleotide is plotted relative to the amount bound in the absence of competitor (None). Error bars indicate the SEM, n = 3. One binding reaction also contained 1 µM all-trans-RA (None + RA). D, All-trans-RA induces the A24 transcript in embryonic stem cells. D3 ES cells were grown as aggregates for 3 d in the absence or presence of 50 nM all-trans-RA. RNA was Northern blotted and hybridized to cDNA clone S8. The blot was stripped and hybridized to 36B4 (plasmid encoding a constitutive ribosomal protein) to control for loading. Treatment with all-trans-RA induced the A24 transcript by 2.1-fold. E, The A24 transcript is ubiquitously expressed in midgestation embryos (E8–E14) and adult tissues. RNA was analyzed as described in panel D. Actin was an additional loading control.

 
9-cis-RA transactivated A24-controlled ß-gal reporter genes in yeast expressing RARß and RXR{gamma}. In contrast, no induction occurred in yeast lacking the retinoid receptors. The fact that the A24 clone induced RA-responsive ß-gal expression only in yeast expressing mammalian receptors indicates that the A24 RARE interacts directly with the receptors in vivo (Table 1Go). This was confirmed with EMSA (Fig. 4Go, B and C). Oligonucleotides containing the wild-type and mutated RARE were synthesized. In vitro transcribed and translated RARß and RXR{gamma} heterodimers bound the wild-type oligonucleotide, but not the mutated oligonucleotide. Neither RARß nor RXR{gamma} homodimers bound either oligonucleotide (Fig. 4BGo). Heterodimer binding was equivalent in the presence or absence of all-trans-RA (Fig. 4CGo). We also used both the wild-type and mutant A24 RARE oligonucleotides as cold competitors for RARß/RXR{gamma} binding to the wild-type A24 RARE. As shown in Fig. 4CGo, 100-fold molar excess of the mutant oligonucleotide did not affect binding to the wild-type probe. However, adding cold wild-type oligonucleotide inhibited binding to the wild-type probe. Together, these data indicate that this yeast-trapped RARE functions in mammalian cells and binds mammalian receptors. Thus, the A24 RARE may regulate a gene that directly responds to RA.

We used the A24 sequence to search GenBank for nearby genes and identified several expressed sequence tags (ESTs) derived from various tissues. IMAGE EST clone 734988 was used to screen a cDNA library prepared from RA-treated P19 cells (37). A 1909-bp clone (S8) overlapping the genomic clone A24 was isolated and sequenced. The DR5 sequence is positioned 85 bp downstream of the 3'-end of this cDNA. Similarly, other RAREs (e.g. Refs.8, 9, 10, 11), are located downstream of genes.

This cDNA clone was used to probe Northern blots of total RNA isolated from tissue culture cells, embryos, and adult organs. As shown in Fig. 4DGo, RA more than doubled the abundance of a transcript in D3 embryonic stem cells. Thus, the A24 RARE is immediately downstream of a transcript regulated by RA. The transcript was also present in RNA isolated from all tested adult organs and throughout midgestation (Fig. 4EGo). After normalization to a constitutively expressed ribosomal protein gene, 36B4 (38), and actin (Fig. 4EGo) and comparison to the rRNA intensities (not shown), the transcript abundance was found to be elevated in liver, brain, and cortex.

The A24 cDNA clone contains an open reading frame that may encode a 276-amino-acid peptide. The entire peptide is highly conserved across vertebrate species (Fig. 5Go). Substantially conserved regions can also be identified in nonvertebrate genomes, specifically the sea squirt, Halocynthia roretzi, the fly, Drosophila melanogaster, and the nematode, Caenorhabditus elegans. Indeed, whereas the overall amino acid identity between the Drosophila and mouse sequences is 40%, several motifs are entirely conserved as shown in Fig. 5Go. Interestingly, the A24 open reading frame is 88% identical to that encoded by a human gene located on chromosome 6. A partial sequence of this gene was previously isolated in a screen for brain cDNA clones containing CAG trinucleotide repeats [TNRC5, GenBank accession no. U80744, (39)], indicating expression in human brain as well as mouse.



View larger version (118K):
[in this window]
[in a new window]
 
Figure 5. The A24 Transcript Encodes a Highly Conserved Protein

ClustalW alignment of open reading frames occurring in GenBank as indicated by the accession numbers. In some cases, several submitted sequences were concatenated to obtain the longest open reading frame. Danio rerio (zebrafish, AI794368), D. melanogaster (fruit fly, AE003518), H. roretzi (sea squirt, AV383368), Sus scrofa (pig, BE014121, BE032471, BF442963), Bos taurus (cow, AV597535, AW656420), Homo sapiens (human, AL035587), Mus musculus (mouse clone S8, AF361644), Gallus gallus (chick, AI981252, AJ394068), Ictalurus punctatus (catfish, BE212618), C. elegans (nematode, Z70205, AL031265). Amino acids that are evolutionarily conserved between all ten species are boxed. An asterisk (*) indicates fully conserved residues, a colon (:) indicates conservation of strong side chains, and a period (.) indicates conservation of weak side chains. The conserved cysteines are underlined.

 
Analysis of a Complex RARE
Clone C13 activated the yeast ß-gal reporter gene 10-fold in response to 9-cis RA-treatment (10.5 ± 3.3, n = 7). Similarly, C13 strongly activated the mammalian luciferase reporter gene in the context of two different promoters [Simian virus 40 (SV40) in pGL3pro, Fig. 6Go; and TK in pLucTK2, not shown]. Upon treatment with all-trans-RA, transcription was activated by 5- to 9-fold (Fig. 6Go). Treatment with 9-cis-RA induced the full-length construct to similar levels (8.18 ± 1.03, n = 3).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. The C13 Clone Contains a RARE That Drives all-trans-RA-Inducible Luciferase Gene Expression in F9 Cells

The indicated fragments were inserted into the luciferase reporter vector pGL3-Promoter. The arrows indicate the orientation of the insert relative to the SV40 promoter. Each of the mutant constructs had a single half-site mutated (X), as shown in Fig. 7Go (mutant 1, MT1; mutant 2, MT2; mutant 3, MT3). The constructs were transfected in duplicate into F9 cells that were then treated with ethanol vehicle or 1 µM all-trans-RA, and assayed as described in Fig. 2Go. Bars indicate the fold induction by RA, shown with the SEM; n = 2–10 independent transfections. Sa, Sau3AI; Xc, XcmI.

 
Maximal transactivation in yeast depended on cotransfection with both mammalian RARß and RXR{gamma} expression vectors (Table 1Go). This supports a direct interaction between the C13 insert and the receptor heterodimers in vivo. Inspection of the C13 sequence identified three perfect PuG(G/T)TCA motifs at the extreme 3'-end of the clone, arranged in an overlapping DR5 and DR1 pattern (position 891–914, Figs. 6Go and 7Go). To determine whether or not these half-sites influenced RA-dependent transcription, luciferase constructs containing (771–925) or lacking (1–770) the DR5/1 element were prepared. As shown in Fig. 6Go, RA did not affect reporter gene activity driven by the 770-bp fragment lacking the DR5/1. In contrast, RA induced reporter gene activity driven by the 155-bp DR5/1-containing fragment by approximately 6-fold. These data support the hypothesis that this composite DR5/1 element is an RARE.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 7. C13 Contains DR5 and DR1 Motifs that Bind Retinoid Receptors in Vitro

A, Sequence of oligonucleotides used in EMSA analysis. The indicated double-stranded oligonucleotides were used as probes and/or cold competitors in panels B and C. The DR5/1 oligonucleotide corresponds to nucleotides 886–919 of the C13 trapped genomic clone. Each half-site is indicated by an arrow. Mutated nucleotides are indicated by lowercase letters. B, RARß/RXR{gamma} heterodimers bind the C13 RAREs, but mutation of half-site 2 abrogates binding. Oligonucleotides containing the wild-type composite C13 RARE (DR5/1), the wild-type DR5 only (DR5), the wild-type DR1 only (DR1), or the composite RARE mutated in each half-site (DR5/1 mutants 1, 2, 3) were analyzed by EMSA as described in Fig. 4Go. WGE, Unprogrammed wheat germ extract. C, Competition for binding to the composite C13 RARE. Unlabeled competitor oligonucleotides (1-, 4.2-, and 125-fold molar excess as indicated by the triangles) were added to compete with the labeled composite C13 DR5/1 wild-type RARE for binding to RARß and RXR{gamma}. These included the unlabeled composite RARE (wild type), or each of the DR5/1 mutants shown in panel A. D, Competition quantification. The fraction of bound oligonucleotide in the presence of competitor oligonucleotide is plotted relative to the amount bound in the absence of competitor. Error bars indicate the SEM, n = 2, except n = 3 in the absence of competitor.

 
To confirm the ability of this sequence to bind receptors, EMSA was performed using oligonucleotides containing the entire composite element (DR5/1), the DR5, or the DR1 elements (Fig. 7BGo). In vitro transcribed and translated RARß and RXR{gamma} heterodimers bound all three oligonucleotides as demonstrated by the shifted bands. By quantifying the intensity of the shifted bands, we determined that the DR5/1 and the DR5 oligonucleotides bound receptors comparably. The DR1-containing oligonucleotide bound receptors with one-half the intensity of the DR5/1 oligonucleotide, respectively (47 ± 6%, n = 2). As observed for the A24 element, adding all-trans-RA did not influence in vitro receptor binding (data not shown).

To further delineate the contribution of each half-site to RARß-RXR{gamma} heterodimer binding, we prepared oligonucleotides containing mutations in each of the half-sites (Fig. 7AGo) and performed EMSA (Fig. 7BGo). Mutating the first or third half-site did not affect the ability of the RARß-RXR{gamma} heterodimer to bind to the oligonucleotide. In contrast, mutating the second half-site abrogated binding by the heterodimer. This indicates that an intact DR1 (mutant 1) or DR5 (mutant 3), but not a DR12, is sufficient for heterodimer binding. RARß or RXR{gamma} homodimers did not bind to any of the oligonucleotides.

We next analyzed binding specificity of the half-sites by competition analysis, using wild-type and mutant oligonucleotides (Fig. 7Go, C and D). As expected, adding cold wild-type oligonucleotide completely inhibited binding of the heterodimer to the wild-type probe. Similarly, mutant 3, which contains an intact DR5, completely inhibited binding to the wild-type probe. Mutant 2 failed to compete with the wild-type probe, consistent with its inability to bind receptor (Fig. 7CGo). Mutant 1, containing an intact DR1, inhibited binding only at the highest concentration, indicating that the DR5 site has a higher affinity for the receptors.

EMSAs determined the contribution of each half-site in our composite RARE to RARß-RXR{gamma} heterodimer binding. To determine the role of each motif in a functional assay, we generated the same mutations in the context of the 155-bp luciferase reporter construct. These constructs were transfected into F9 cells that were then treated with all-trans-RA (Fig. 6Go, last four bars). Mutating either the first (MT1) or second (MT2) half-sites reduced RA inducibility to levels approaching background, indicating the importance of these motifs. In contrast, mutation of the third half-site (MT3) had little effect. Together, the EMSA and luciferase data indicate that, although RARß-RXR{gamma} heterodimers can bind the DR1, only the DR5 drives RA inducibility in cells. These data are in keeping with previous observations indicating that DR5 elements mediate stronger transcriptional responses than DR1 elements (Ref.5 and references therein).

To identify a gene that the C13 complex RARE might regulate, we queried GenBank with the C13 genomic clone sequence using BlastN. The terminal 740 bp of the mouse genomic clone UUGC1M0544E01 in the GSS database were 98.4% identical to the end of C13. This match ended 166 bp from the DR5/1 RARE. We fully sequenced this clone (6.88 kb) and queried GenBank; however, no additional matches were observed. BlastP analysis indicated that open reading frames within this sequence differed from those of any known proteins. This suggests that the potent C13 RARE regulates either a completely novel gene or one without sequence deposited in GenBank.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Unbiased genetic screens have been proven to elucidate key developmental mechanisms in genetically tractable organisms. For example, enhancer or gene trapping strategies have directly identified elements that regulate key genes in lower organisms. However, similar large-scale genetic screens are difficult in mammals. Gene or promoter traps combined with murine embryonic stem cell technology (see Refs. 40 and 41 and references therein) have identified developmentally regulated genes, but using this approach to completely survey the genome for specific regulatory elements is impractical. Also, because gene traps are designed to select the 5'-end of genes, enhancers acting distantly from the promoter will be missed. We have exploited the advantages of yeast to trap enhancers (RAREs) that drive gene expression in response to RA. We present here our initial analysis of these trapped sequences.

The number of RAREs activated by specific receptor combinations is unknown. By transforming yeast expressing various receptor combinations with a representative sample of the mouse genomic DNA library, one can estimate the total number of RAREs in the genome by extrapolation. The number of trapped reporter genes in each receptor background provides an estimate of the number of RAREs activated by that receptor combination. For example, our isolation of 32 confirmed RAREs from 9% of the murine genome suggests that RARß and RXR{gamma} could activate approximately 350 RAREs in the entire genome. This estimate is plausible, considering that RA directly regulates only a subset of the many hundreds of RA-regulated genes. We now have the tools to estimate the number of RAREs activated by specific receptor combinations.

Because the receptor-expressing yeast lack other mammalian transcription factors, this estimate specifically reflects the influence of receptor binding. Thus, this assay is stringent because only those RAREs that can be independently activated by receptors will be isolated. Some RAREs, however, require binding by nonreceptor transcription factors. For example, the tissue plasminogen activator RARE also requires binding by Sp1 (42). We may not isolate these complex RAREs. Alternatively, they may be trapped, but induce weakly in yeast or cells lacking the contributing transcription factor. The RARE associated with sperizin (D6) may fall into this class. In the unique cells normally expressing sperizin, specifically the male germ cells, other transcription factors may stabilize the interaction between retinoid receptors and this RARE. Similarly, the absence of specific transcriptional repressors in yeast would permit the detection of RAREs, the activity of which is masked by repressors in some mammalian cells.

In mammalian cells, coactivators and corepressors modulate receptor activity by remodeling chromatin (43, 44). Likewise, gene expression in yeast is regulated via highly conserved chromatin remodeling complexes. The general transcription apparatus and many coactivators with histone acetylase activity are highly conserved and are required for the activity of all nuclear receptors. Other coactivators are highly receptor and ligand specific. These factors contribute to the highly cell-specific effects of hormones. Homologs to the steroid receptor coactivator (SRC)/p160 family of coactivators have not been identified in yeast and insects (Refs.45, 46, 47 and our recent Medline searches). However, transfected murine GRIP1 (glucocorticoid receptor-interacting protein 1)/SRC2/transcriptional intermediary factor 2 has been shown to strongly stimulate the activity of transfected RARs on the ßRE element in yeast (46). Interestingly, RARß, but not RAR{alpha} or RAR{gamma}, homodimers did exhibit some GRIP-independent activity and binding in yeast (47). Our initial trapping protocol using RARß would have selectively trapped RAREs that lack a strong SRC/p160 coactivator requirement. It will be interesting to test whether or not GRIP1 can stimulate the activity of these RAREs in yeast.

Unliganded nuclear hormone receptors can repress basal transcription by recruiting corepressors and histone deacetylases (48, 49). Ligand-mediated relief of this repression contributes to the ability of hormones to greatly induce transcription. Hormone-mediated repression has been observed on response elements in various promoter contexts in mammalian cells, but not in yeast. This may be due to the absence of silencing mediator of retinoid and thyroid hormone receptor or nuclear receptor corepressor homologs capable of interacting with mammalian receptors (Ref.47 and our recent Medline searches). We also found that unliganded retinoid receptors failed to repress ß-gal transcription driven by 13 different RAREs in yeast (ßRE, CRBPII, A18, A20, A24, B9, B10, B12, C9, C13, D4, D7, E2; data not shown). This supports the hypothesis that the yeast repressor apparatus cannot interact with mammalian receptors.

We have scanned the 32 trapped sequences for canonical RAREs consisting of two directly repeated PuG(G/T)TCA motifs. Despite being able to activate reporter gene activity only in yeast expressing retinoid receptors, only C13 contained perfect direct repeats in a DR5 pattern (Fig. 7Go). We demonstrated that several of the sequences lacking canonical RAREs also induced mammalian reporter genes (D7, D6, and A24, Figs. 2–4GoGoGo; C9 and E2, not shown). The relative flexibility of the half-site is supported by in vitro measurements of receptor binding. Hauksdóttir and Privalsky (50) compared the in vitro binding of RAR or RXR homodimers or heterodimers to oligonucleotides mutated systematically at each position of each half-site relative to AGGTCA. The A24, D6, and D7 sequences each contain DR5-like elements that vary from the consensus at a single nucleotide. These variations were shown to permit in vitro binding (Fig. 4Go and Ref.50). The flexible nature of the RARE highlights the need for a genetic analysis of RAREs based on functionality.

Three of the trapped RAREs are located near RA-regulated genes (Figs. 2–4GoGoGo). D6 and D7 are proximal to known genes, the round spermatid-specific gene sperizin and the nonclassical MHC gene T20d, respectively. The A24 RARE is 85 bp downstream of a novel and highly conserved gene regulated by RA in embryonic stem cells. In all mammalian sequences, the transcribed region contains an open reading frame that encodes a string of leucines and other nonpolar amino acids typical of a signal peptide (Fig. 5Go). In addition, the A24 open reading frame encodes six conserved cysteine residues. An even number of cysteines suggests that the protein can form intramolecular disulfide bonds like many secreted proteins. A consensus N-linked glycosylation site at amino acid 153 is another feature common in secreted proteins. Thus, the trapped A24 RARE may influence the expression of a highly conserved secreted protein in mammalian cells.

In conclusion, we developed a functional assay to efficiently isolate RAREs from whole genomes. We identified 32 sequences that functioned as RAREs in RA-treated yeast expressing RARß and RXR{gamma}. Analysis of four selected sequences showed that these RAREs also drove RA-dependent transcription in mammalian cells. This approach relies only on the ability of an enhancer to mediate RA-induced reporter gene expression in yeast. Genes proximal to these RAREs are highly likely to be regulated directly by retinoids. Indeed, three of these RAREs (A24, D6, and D7) are located near transcripts induced by RA. Because directly regulated genes may launch signaling processes controlling key cellular decisions, this approach will provide insight into the action of retinoids. Specifically, it should be possible to identify genes whose normal expression requires natural retinoid signals as well as genes induced by teratogenic levels of retinoids. Finally, this method may also be used to identify the target genes for any cellular signal whose receptor can function in yeast.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
Male Sprague Dawley rats were made vitamin A deficient as described in Ref.36 . Briefly, 20-d-old animals (30–40 g) were placed on a VAD diet (Ralston Purina Co., Richmond, IN) for 10 wk. Arrest of spermatogenesis was verified histologically. Procedures were approved by the Institutional Animal Care and Use Committee of Washington State University.

Plasmids
The yeast reporter vector, p{Delta}ss, contains the ß-gal gene driven by the yeast cytochrome c1 (cyc1) minimal promoter (21). The expression vectors p2HG-RARß and pG1-RXR{gamma} encode RARß and RXR{gamma}, respectively (18). pLucTK2 was generated by inserting a SmaI-KpnI polylinker fragment from pBluescript II SK(+) (Stratagene, La Jolla, CA) into the SmaI and KpnI site of pLucTK (51).

D7.
The D7 trapped genomic clone (1301-bp Sau3AI fragment) was partially digested with Sau3AI. A 759-bp fragment was filled in with deoxy (d)ATP and dGTP and inserted into the XhoI site of p{Delta}ss, which was partially filled in with deoxythymidine triphosphate and dCTP. This same 759-bp Sau3AI fragment was also inserted into the BamHI site of pBluescriptSK. This plasmid was then digested with XbaI, producing a 417-bp fragment and a 306-bp fragment. These fragments were filled in with Klenow enzyme and deoxynucleotide triphosphates (dNTPs) and inserted into the SmaI site of pLucTK2.

D6.
The D6 trapped genomic clone (1397-bp Sau3AI fragment) was digested with XhoI, releasing an 1179-bp fragment (positions 209-1388) containing two putative RAREs. This fragment was ligated into XhoI-digested pLucTK2.

A24.
A 145-bp SspI-StyI fragment containing the A24 RARE was isolated from the A24 trapped genomic clone. After filling in the StyI end with Klenow enzyme, the fragment was inserted into the SmaI site of pLucTK2 in both orientations. Two additional constructs were prepared by digesting plasmids containing the insert in both orientations with PvuII and XhoI (vector polylinker site). The XhoI site was then filled in and the plasmids were religated, yielding subclones containing inserts of 115 or 30 bp.

C13.
To facilitate subcloning of the C13 genomic clone, positions 15–940 were PCR amplified and inserted into the pCRII vector (Invitrogen, San Diego, CA). This 925-bp insert was released by digestion with EcoRI (vector polylinker sites), filled in with dNTPs and Klenow enzyme, and inserted into SmaI-digested pGL3-Promoter (Promega Corp., Madison, WI) in both orientations. The 925-bp fragment in pCRII was also digested with EcoRV (vector polylinker site) and XcmI and treated with mung bean nuclease. The resulting 770-bp fragment was inserted into SmaI-digested pGL3-Promoter in the forward orientation relative to the luciferase gene (see Fig. 6Go). The 925-bp fragment in pCRII was also digested with EcoRI (vector polylinker site) and XcmI and treated with mung bean nuclease. The resulting 155-bp fragment was inserted into SmaI-digested pGL3-Promoter in the reverse orientation relative to the luciferase gene. This construct was the starting material for the subsequent half-site mutations described below. To reverse the orientation of the 155-bp fragment, the insert was released by digestion with XhoI and NheI (pGL3-Promoter polylinker sites) and ligated into pBluescript digested with XhoI and XbaI. The resulting pBS construct was digested with NotI (pBS polylinker site), filled in with dNTPs and Klenow enzyme, and then digested with KpnI (also in the pBS polylinker). This fragment was then inserted into KpnI-SmaI-digested pGL3-Promoter, producing the plasmid containing the 155-bp fragment in the forward orientation. The C13 half-site mutants were generated by overlap extension PCR as described in Ref.22 . Sequences of the mutated oligonucleotides are shown in Fig. 7AGo. To prepare each half-site mutant, two separate PCRs were performed, each using one mutant oligonucleotide and one vector polylinker oligonucleotide to amplify overlapping portions of the 155-bp fragment. These two overlapping products were then mixed and amplified using the two vector polylinker oligonucleotides. The full-length product was then digested with XhoI and SstI (vector polylinker sites) and inserted into XhoI-SstI-digested pGL3-Promoter. Each mutant was verified by sequencing to ensure that only the desired mutations were introduced.

Construction of a Murine Genomic DNA Library in a Yeast Reporter Plasmid
D3 embryonic stem cell DNA was purified as described in Ref.22 . After partial digestion with Sau3AI, fragments of approximately 2 kb were partially filled in with dATP and dGTP and inserted into the XhoI site of p{Delta}ss, which was partially filled in with deoxythymidine triphosphate and dCTP. The ligated DNA was used to transform DH5{alpha} competent cells (22). The transformed colonies were harvested and amplified in liquid culture for 2 h before plasmid isolation.

Yeast Transformations and ß-gal Assays
The yeast strain BJ5409 (leu2-{Delta}, his3{Delta}200, ura3–52, trp1) was transformed as described in Ref.52 . Double or triple transformants were selected by plating on medium lacking the appropriate nutrients. Plates were incubated at 30 C for 2–4 d to recover transformants. Plate and liquid ß-gal assays are described in Ref.22 . Yeast were RA treated for 24 h as described (20).

Isolation of Reporter Plasmids from Yeast
Yeast reporter plasmids were rescued by preparing DNA as described in Ref.53 and transforming Escherichia coli strain DH5{alpha}.

RT-PCR
RT-PCR was performed essentially as described in (28). Briefly, oligo-deoxythymidine-primed (Fig. 2AGo) or random hexamer-primed cDNA (not shown) was synthesized from total cellular RNA. To avoid amplifying genomic DNA that might contaminate the RNA, all reverse transcription (RT) reactions were pretreated with XbaI, which cleaves within the amplified region. T20d-specific (28) or actin-specific primers were used for PCR amplification. The PCR products were Southern blotted and probed with a 252-bp XbaI-BstNI fragment specific for T20d, or with an actin-specific probe (Ambion, Inc., Austin, TX).

F9 Cell Transfections and Luciferase Reporter Assays
F9 cells were grown and transfected as described in Ref.20 with the following modifications. After removing the CaPO4 precipitate, cells were incubated with fresh media containing ethanol vehicle alone or 1 µM all-trans-RA. After 24 h, the cells were lysed and the luciferase activity was measured using the Luciferase Assay System (Promega Corp.). Transfection efficiency was normalized by cotransfecting the ß-gal expression vector (pßAclacZ), which contains the ß-gal-coding region driven by the constitutive ß-actin promoter (54).

cDNA Cloning
A cDNA library (4 x 105 plaques) made from RA-treated P19 embryonal carcinoma cells (37) was screened using a gel-purified insert from IMAGE EST clone 734988 (GenBank accession no. AA260027), corresponding to positions 84–656 of the A24 trapped genomic clone. After plaque purification, plasmids were excised by in vivo excision and purified. Six independent clones were isolated and partially mapped and sequenced. These clones differed only by the length of their 5'- and 3'-ends. The longest clone, S8 (1909 bp), was fully sequenced.

Northern Analysis
Northern analysis procedures are described in Ref.55 .

EMSAs
Expression vectors encoding human RARß and murine RXR{gamma} (obtained from R. Evans) were linearized with BamHI and in vitro transcribed and translated using the TnT T7-coupled wheat germ extract system (Promega Corp.) according to the manufacturer’s instructions. Binding reactions contained 20 mM HEPES (pH 7.9), 40 mM KCl, 6 mM MgCl2, 1 mM dithiothreitol, 2.5–5 µg BSA, 1 µg poly-(deoxyinosine-deoxycytidine), 0.5 µg sonicated salmon sperm DNA, 2% Ficoll, 20,000 cpm (~0.2 ng) 32P-labeled oligonucleotide probe, and 4 µl receptor protein or unprogrammed extract. All components except probe were allowed to prebind on ice for 10 min, and then probe was added and the reactions proceeded at room temperature for 20 min. Reactions were loaded on 5% nondenaturing polyacrylamide gels, electrophoresed, dried, and exposed to x-ray film. When used, competitor oligonucleotides were added as indicated in the figure legends. Probes were prepared by end labeling oligonucleotides (Integrated DNA Technologies, Coralville, IA) with T4 polynucleotide kinase and 32P-{gamma}ATP. Complementary oligonucleotides were annealed and then purified by passage over Sephadex G50 spin columns. Quantification was performed using ImageQuant Software (Molecular Dynamics, Inc., Sunnyvale, CA).


    ACKNOWLEDGMENTS
 
We thank S. Chao and C. Roland for expert technical assistance and Drs. J. Garey, J. Szostak, and D. Rogers for advice. We also thank Drs. R. Heyman, E. Allegretto, M. Privalsky, and C. Woolford for gifts of plasmids and yeast strains.


    FOOTNOTES
 
This work was supported in part by the Molecular Imaging and Molecular Biology Core Facilities at the H. Lee Moffitt Cancer Center and Research Institute, by National Institute of Child Health and Human Development Grant HD-31117, and by Research Grant 1-FY00-381 from the March of Dimes Birth Defects Foundation.

1 M.A.G. and Y.L. contributed equally to this work. Back

Abbreviations: ß-gal, ß-Galactosidase; BMP, bone morphogenetic protein; CRBP, cellular retinol binding protein; CT, cAMP and theophylline; d, deoxy; dNTP, deoxynucleotide triphosphate; EST, expressed sequence tag; GRIP, glucocorticoid receptor interacting protein; MHC, major histocompatability complex; RA, retinoic acid; RACT, all-trans-RA + CT; RAR, RA receptor; RXR, retinoid X receptor; RARE, RA-responsive element; RT, reverse transcription; SRC, steroid receptor coactivator; SV40, Simian virus 40; TK, thymidine kinase.

Received for publication May 23, 2002. Accepted for publication September 17, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kastner P, Mark M, Chambon P 1995 Nonsteroid nuclear receptors: what are genetic studies telling us about their role in real life? Cell 83:859–869[CrossRef][Medline]
  2. Zile M 1998 Vitamin A and embryonic development: an overview. J Nutr 128:455S–458S[Abstract/Free Full Text]
  3. Rogers M 1997 Life and death decisions influenced by retinoids. Curr Top Dev Biol 35:1–46[Medline]
  4. Chambon P 1996 A decade of molecular biology of retinoic acid receptors. FASEB J 10:940–954[Abstract]
  5. Kato S, Sasaki H, Suzawa M, Masushige S, Tora L, Chambon P, Gronemeyer H 1995 Widely spaced, directly repeated PuGGTCA elements act as promiscuous enhancers for different classes of nuclear receptors. Mol Cell Biol 15:5858–5867[Abstract]
  6. Jansa P, Forejt J 1996 A novel type of retinoic acid response element in the second intron of the mouse H2Kb gene is activated by the RAR/RXR heterodimer. Nucleic Acids Res 24:694–701[Abstract/Free Full Text]
  7. Kishimoto H, Hoshino S, Ohori M, Kontani K, Nishina H, Suzawa M, Kato S, Katada T 1998 Molecular mechanism of human CD38 gene expression by retinoic acid. Identification of retinoic acid response element in the first intron. J Biol Chem 273:15429–15434[Abstract/Free Full Text]
  8. Makita T, Hernandez-Hoyos G, Chen TH, Wu H, Rothenberg EV, Sucov HM 2001 A developmental transition in definitive erythropoiesis: erythropoietin expression is sequentially regulated by retinoic acid receptors and HNF4. Genes Dev 15:889–901[Abstract/Free Full Text]
  9. Kambe T, Tada-Kambe J, Kuge Y, Yamaguchi-Iwai Y, Nagao M, Sasaki R 2000 Retinoic acid stimulates erythropoietin gene transcription in embryonal carcinoma cells through the direct repeat of a steroid/thyroid hormone receptor response element half-site in the hypoxia- response enhancer. Blood 96:3265–3271[Abstract/Free Full Text]
  10. Morrison A, Ariza-McNaughton L, Gould A, Featherstone M, Krumlauf R 1997 HOXD4 and regulation of the group 4 paralog genes. Development 124:3135–3146[Abstract]
  11. Langston AW, Thompson JR, Gudas LJ 1997 Retinoic acid-responsive enhancers located 3' of the Hox A and Hox B homeobox gene clusters. Functional analysis. J Biol Chem 272:2167–2175[Abstract/Free Full Text]
  12. Wang S-Y, Gudas LJ 1983 Isolation of cDNA clones specific for collagen IV and laminin from mouse teratocarcinoma cells. Proc Natl Acad Sci USA 80: 5880–5884
  13. LaRosa GJ, and Gudas, LJ 1988 An early effect of retinoic acid: cloning of an mRNA (Era-1) exhibiting rapid and protein synthesis-independent induction during teratocarcinoma stem cell differentiation. Proc Natl Acad Sci USA 85:329–333[Abstract/Free Full Text]
  14. Komada M, McLean DJ, Griswold MD, Russell LD, Soriano P 2000 E-MAP-115, encoding a microtubule-associated protein, is a retinoic acid-inducible gene required for spermatogenesis. Genes Dev 14:1332–1342[Abstract/Free Full Text]
  15. Forrester L, Nagy A, Sam M, Watt A, Stevenson L, Bernstein A, Joyner A, Wurst W 1996 An induction gene trap screen in embryonic stem cells: identification of genes that respond to retinoic acid in vitro. Proc Natl Acad Sci USA 93:1677–1682[Abstract/Free Full Text]
  16. Shago M, Giguere V 1996 Isolation of a novel retinoic acid-responsive gene by selection of genomic fragments derived from CpG-island-enriched DNA. Mol Cell Biol 16:4337–4348[Abstract]
  17. Allegretto EA, McClurg MR, Lazarchik SB, Clemm DL, Kerner SA, Elgort MG, Boehm MF, White SK, Pike JW, Heyman RA 1993 Transactivation properties of retinoic acid and retinoid X receptors in mammalian cells and yeast. Correlation with hormone binding and effects of metabolism [published erratum appears in J Biol Chem 1994 Mar 11;269(10):7834]. J Biol Chem 268:26625–26633[Abstract/Free Full Text]
  18. Hall B, Smit-McBride Z, Privalsky M 1993 Reconstitution of retinoid X receptor function and combinatorial regulation of the nuclear hormone receptors in the yeast Saccharomyces cerevisiae. Proc Natl Acad Sci USA 90:6929–6933[Abstract/Free Full Text]
  19. Heery D, Zacharewski T, Pierrat B, Gronemeyer H, Chambon P 1993 Efficient transactivation by retinoic acid receptors in yeast requires retinoid X receptors. Proc Natl Acad Sci USA 90:4281–4285[Abstract/Free Full Text]
  20. Heller LC, Li Y, Abrams KA, Rogers MB 1999 Transcriptional regulation of the Bmp2 gene: retinoic acid induction in F9 embryonal carcinoma cells and Saccharomyces cerevisiae. J Biol Chem 274:1394–1400[Abstract/Free Full Text]
  21. Schena M, Yamamoto K 1988 Mammalian glucocorticoid receptor derivatives enhance transcription in yeast. Science 241:965–967[Abstract/Free Full Text]
  22. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1997 Current protocols in molecular biology. New York: Wiley and Sons
  23. Sporn M, Roberts A, Goodman D 1994 The retinoids: biology, chemistry, and medicine. New York: Raven Press
  24. Croce CM, Linnenbach A, Huebner K, Parnes JR, Margulies DH, Appella E, Seidman JG 1981 Control of expression of histocompatibility antigens (H-2) and ß2- microglobulin in F9 teratocarcinoma stem cells. Proc Natl Acad Sci USA 78:5754–5758[Abstract/Free Full Text]
  25. Nagata T, Segars JH, Levi BZ, Ozato K 1992 Retinoic acid-dependent transactivation of major histocompatibility complex class I promoters by the nuclear hormone receptor H-2RIIBP in undifferentiated embryonal carcinoma cells. Proc Natl Acad Sci USA 89:937–941[Abstract/Free Full Text]
  26. Brorson KA, Hunt SWD, Hunkapiller T, Sun YH, Cheroutre H, Nickerson DA, Hood L 1989 Comparison of exon 5 sequences from 35 class I genes of the BALB/c mouse. J Exp Med 170:1837–1858[Abstract/Free Full Text]
  27. Klein J, Benoist C, David CS, Demant P, Lindahl KF, Flaherty L, Flavell RA, Hammerling U, Hood LE, Hunt SWD, Jones PP, Kourilsky P, McDevitt HO, Merelo D, Murphy DB, Nathenson SG, Sachs DH, Steinmetz M, Tonegawa S, Wakeland EK, Weiss EH 1990 Revised nomenclature of mouse H-2 genes. Immunogenetics 32:147–149[CrossRef][Medline]
  28. Eghtesady P, Brorson KA, Cheroutre H, Tigelaar RE, Hood L, Kronenberg M 1992 Expression of mouse Tla region class I genes in tissues enriched for {gamma}{delta} cells. Immunogenetics 36: 377–388
  29. Fujii T, Tamura K, Copeland NG, Gilbert DJ, Jenkins NA, Yomogida K, Tanaka H, Nishimune Y, Nojima H, Abiko Y 1999 Sperizin is a murine RING zinc-finger protein specifically expressed in haploid germ cells. Genomics 57:94–101[CrossRef][Medline]
  30. Tyers M, Jorgensen P 2000 Proteolysis and the cell cycle: with this RING I do thee destroy. Curr Opin Genet Dev 10:54–64[CrossRef][Medline]
  31. Joazeiro CA, Weissman AM 2000 RING finger proteins: mediators of ubiquitin ligase activity. Cell 102:549–552[CrossRef][Medline]
  32. Griswold MD, Bishop PD, Kim K-H, Ping R, Siiteri JE, Morales C 1989 Function of vitamin A in normal and synchronized seminiferous tubules. Ann NY Acad Sci 564:154–172[Medline]
  33. Cupp AS, Dufour JM, Kim G, Skinner MK, Kim KH 1999 Action of retinoids on embryonic and early postnatal testis development. Endocrinology 140:2343–2352[Abstract/Free Full Text]
  34. Gaemers IC, van Pelt AM, van der Saag PT, Hoogerbrugge JW, Themmen AP, de Rooij DG 1997 Effect of retinoid status on the messenger ribonucleic acid expression of nuclear retinoid receptors {alpha}, ß, and {gamma}, and retinoid X receptors {alpha}, ß, and {gamma} in the mouse testis. Endocrinology 138:1544–1551[Abstract/Free Full Text]
  35. Gaemers IC, Van Pelt AM, Themmen AP, De Rooij DG 1998 Isolation and characterization of all-trans-retinoic acid-responsive genes in the rat testis. Mol Reprod Dev 50:1–6[CrossRef][Medline]
  36. Akmal KM, Dufour JM, Vo M, Higginson S, Kim KH 1998 Ligand-dependent regulation of retinoic acid receptor {alpha} in rat testis: in vivo response to depletion and repletion of vitamin A. Endocrinology 139:1239–1248[Abstract/Free Full Text]
  37. Bouillet P, Oulad-Abdelghani M, Vicaire S, Garnier JM, Schuhbaur B, Dolle P, Chambon P 1995 Efficient cloning of cDNAs of retinoic acid-responsive genes in P19 embryonal carcinoma cells and characterization of a novel mouse gene, Stra1 (mouse LERK-2/Eplg2). Dev Biol 170:420–433[CrossRef][Medline]
  38. Rio MC, Bellocq JP, Gairard B, Rasmussen UB, Krust A, Koehl C, Calderoli H, Schiff V, Renaud R, Chambon P 1987 Specific expression of the pS2 gene in subclasses of breast cancers in comparison with expression of the estrogen and progesterone receptors and the oncogene ERBB2. Proc Natl Acad Sci USA 84:9243–9247[Abstract/Free Full Text]
  39. Margolis RL, Abraham MR, Gatchell SB, Li SH, Kidwai AS, Breschel TS, Stine OC, Callahan C, McInnis MG, Ross CA 1997 cDNAs with long CAG trinucleotide repeats from human brain. Hum Genet 100:114–122[CrossRef][Medline]
  40. Hill DP, Wurst W 1993 Screening for novel pattern formation genes using gene trap approaches. Methods Enzymol 225:664–681[Medline]
  41. Friedrich G, Soriano P 1993 Insertional mutagenesis by retroviruses and promoter traps in embryonic stem cells. Methods Enzymol 225:681–701[Medline]
  42. Rickles RJ, Darrow AL, Strickland S 1989 Differentiation-responsive elements in the 5' region of the mouse tissue plasminogen activator gene confer two-stage regulation by retinoic acid and cyclic AMP in teratocarcinoma cells. Mol Cell Biol 9:1691–1704[Abstract/Free Full Text]
  43. McKenna NJ, O’Malley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474[CrossRef][Medline]
  44. Rosenfeld MG, Glass CK 2001 Coregulator codes of transcriptional regulation by nuclear receptors. J Biol Chem 276:36865–36868[Free Full Text]
  45. Freedman LP 1999 Increasing the complexity of coactivation in nuclear receptor signaling. Cell 97:5–8[CrossRef][Medline]
  46. Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744[Abstract]
  47. Walfish PG, Yoganathan T, Yang YF, Hong H, Butt TR, Stallcup MR 1997 Yeast hormone response element assays detect and characterize GRIP1 coactivator-dependent activation of transcription by thyroid and retinoid nuclear receptors. Proc Natl Acad Sci USA 94:3697–3702[Abstract/Free Full Text]
  48. Privalsky ML 2001 Regulation of SMRT and N-CoR corepressor function. Curr Top Microbiol Immunol 254:117–136[Medline]
  49. Wolffe AP 1997 Transcriptional control. Sinful repression [news; comment]. Nature 387:16–17[CrossRef][Medline]
  50. Hauksdóttir H, Privalsky ML 2001 DNA recognition by the aberrant retinoic acid receptors implicated in human acute promyelocytic leukemia. Cell Growth Differ 12:85–98[Abstract/Free Full Text]
  51. Turkson J, Bowman T, Garcia R, Caldenhoven E, De Groot RP, Jove R 1998 Stat3 activation by Src induces specific gene regulation and is required for cell transformation. Mol Cell Biol 18:2545–2552[Abstract/Free Full Text]
  52. Gietz R, Schiestl R 1995 Transforming yeast with DNA. Methods Mol Cell Biol 5:255–269
  53. Strathern J, Higgins D 1991 In: Guthrie C, Fink G, eds. Guide to yeast genetics and molecular biology, vol. 194. San Diego, CA: Academic Press, Inc.; 319–329
  54. Vasios GW, Gold JD, Petkovich M, Chambon P, Gudas LJ 1989 A retinoic acid-responsive element is present in the 5' flanking region of the laminin B1 gene. Proc Natl Acad Sci USA 86:9099–9103[Abstract/Free Full Text]
  55. Rogers MB, Rosen V, Wozney JM, Gudas LJ 1992 Bone morphogenetic proteins-2 and 4 are Involved in the retinoic acid-induced differentiation of embryonal carcinoma cells. Mol Biol Cell 3:189–196[Abstract]

NURSA Molecule Pages Link:

Nuclear Receptors:   RARβ  |  RXRγ
Ligands:   all-trans-Retinoic acid  |  9-cis-Retinoic acid



This article has been cited by other articles:


Home page
J EndocrinolHome page
K. Han, H. Song, I. Moon, R. Augustin, K. Moley, M. Rogers, and H. Lim
Utilization of DR1 as true RARE in regulating the Ssm, a novel retinoic acid-target gene in the mouse testis
J. Endocrinol., March 1, 2007; 192(3): 539 - 551.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Wakabayashi, M. Kobayashi, S. Akashi-Takamura, N. Tanimura, K. Konno, K. Takahashi, T. Ishii, T. Mizutani, H. Iba, T. Kouro, et al.
A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR4
J. Immunol., August 1, 2006; 177(3): 1772 - 1779.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. L. Abrams, J. Xu, C. Nativelle-Serpentini, S. Dabirshahsahebi, and M. B. Rogers
An Evolutionary and Molecular Analysis of Bmp2 Expression
J. Biol. Chem., April 16, 2004; 279(16): 15916 - 15928.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glozak, M. A.
Right arrow Articles by Rogers, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glozak, M. A.
Right arrow Articles by Rogers, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals