help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0244
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pascussi, J. M.
Right arrow Articles by Vilarem, M.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pascussi, J. M.
Right arrow Articles by Vilarem, M.-J.
Molecular Endocrinology 17 (1): 42-55
Copyright © 2003 by The Endocrine Society

Transcriptional Analysis of the Orphan Nuclear Receptor Constitutive Androstane Receptor (NR1I3) Gene Promoter: Identification of a Distal Glucocorticoid Response Element

Jean Marc Pascussi, Maryvonne Busson-Le Coniat, Patrick Maurel and Marie-José Vilarem

Institut National de la Santé et de la Recherche Médicale (INSERM) 128 (J.M.P., P.M., M.-J.V.) Institut Fédératif de Recherche No. 24, 34293 Montpellier, France; and INSERM 434 (M.B.-L.), Institut de Génétique Moléculaire, 75010 Paris, France

Address all correspondence and requests for reprints to: Jean Marc Pascussi, Institut National de la Santé et de la Recherche Médicale 128, Institut Fédératif de Recherche No. 24, 1919 Route de Mende, 34293 Montpellier cedex 5, France. E-mail: pascussi{at}montp.inserm.fr.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The constitutive androstane receptor (CAR, NR1I3) transcriptionally activates cytochrome P450 2B6, 2C9, and 3A4 when activated by xenobiotics, such as phenobarbital. Information on the human CAR promoter was obtained by searching the NCBI human genome database. A contig (NT026945) corresponding to a fragment of chromosome 1q21 was found to contain the complete CAR gene. These data were confirmed using chromosomal in situ hybridization. Both primer extension and 5'-rapid amplification of the cDNA end PCR analysis were carried out to determine the transcriptional start site of human CAR, which was found to be 32 nucleotides downstream of a potential TATA box (CATAAAA). In addition, we found that the 5'-untranslated region of CAR mRNA is 110 nucleotides shorter than previously reported. Using genomic PCR, we amplified and cloned approximately 4.9 kb (-4711/+144) of the CAR gene promoter. The activity of this promoter was measured by transient transfection. Deletion analysis suggested the presence of a glucocorticoid responsive element in its distal region (-4477/-4410). From cotransfection experiments, mutagenesis, and gel shift assays, we identified a glucocorticoid response element at -4447/-4432 that was recognized and transactivated by the human glucocorticoid receptor. Finally, using the chromatin immunoprecipitation assay, we demonstrated that the glucocorticoid receptor binds to the distal region of CAR promoter in cultured hepatocytes only in the presence of dexamethasone. Identification of this functional element provides a rational mechanistic basis for CAR induction by glucocorticoids. CAR appears to be a primary glucocorticoid receptor-response gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
CYTOCHROME P-450s (CYPs) comprise a superfamily of heme-thiolate proteins. They function as monooxygenases and display diverse functions, from the synthesis and degradation of biological signaling molecules, such as steroid hormones and fatty acid derivatives, to the metabolism of xenobiotic chemicals including pharmaceutical drugs and environmental contaminants and carcinogens. The metabolic activity of these enzymes is a widely employed defense mechanism against exposure to toxic xenobiotics (1). A central part of this defense is the adaptative increase of CYP gene expression (induction), which leads to enhanced metabolism and suppression of the pharmacological action of drugs (2). The mechanisms of induction of the major drug metabolizing CYP genes have been studied intensively, and recent findings indicate that a common pathway is used: exposure to drugs activates specific members of the nuclear receptor superfamily, which in turn bind their cognate DNA elements and stimulate the transcription of CYP target genes (3). This leads to increased synthesis of CYP enzymes and enhanced metabolism and clearance of the drugs. These receptors include members of the nuclear receptor superfamily of ligand-activated transcription factors: CAR (constitutive androstane receptor, NR1I3), pregnane X receptor, NR1I2, and PPAR (peroxisome proliferator-activated receptor, NR1C1–3).

CAR was initially characterized as a constitutive activator of a set of retinoic acid response elements (4). It binds DNA, generally composed of a direct repeat of the AGGTCA hexamer separated by four nucleotides (nt) (DR4), as a heterodimer with RXR (retinoid X receptor) (4, 5). Recently, CAR has been identified as the mediator of the effects of phenobarbital (PB) (6, 7). PB is the prototype of a large group of structurally diverse xenobiotic chemicals that induce CYP genes within the CYP2A, CYP2B, CYP2C, and CYP3A subfamilies, with the CYP2B genes being the most effectively induced (8). The PB-responsive enhancers of rat CYP2B2, mouse cyp2B10, and human CYP2B6 contain two nuclear receptor binding sites (NR1 and NR2), flanking a nuclear factor 1 binding site (9). In PB-treated mice, the binding of the CAR to the NR1 site is greatly increased (10). In fact, in contrast to other nuclear receptors, CAR is sequestered in the cytosol and translocates into the nucleus upon activation, presumably through several steps of phosphorylation (10). Only a few molecules among CYP inducers have been shown to bind directly to human CAR. These include androstenol, clotrimazole, and 5-ß-pregnane-3,20-dione (11). However, both androstenol and clotrimazole appear to be deactivators rather than activators of hCAR, whereas 5-ß-pregnane-3,20-dione appears as a true activator. PB, a compound that has been shown to induce CAR translocation, is not a ligand of CAR (11, 12). However, CAR is essential for the PB effect as demonstrated in CAR -/- mice (13). CAR has been found to transactivate several major hepatic CYPs involved in drug metabolism in humans: including CYP2B6 (9), CYP2C9 (14), and CYP3A4 (9, 15). Indeed, CAR plays a general role in regulating a number of drug/steroid-metabolizing enzymes, as it also regulates the expression of cytochrome P450 reductase (16), which represents an essential component of CYP-dependent metabolic activity. On the other hand, other unexplained functions of CAR have been reported, notably the increase in liver weight and DNA synthesis in response to PB (13).

In addition to the lack of knowledge of the mechanisms involved in CAR activation by chemicals, very little is known about its transcriptional regulation. The mouse CAR gene has two known mRNA isoforms (mCAR1 and mCAR2). The mCAR1 is closely related to the human CAR. In contrast, mCAR2 is truncated, lacking a C-terminal region of the ligand binding domain, resulting from alternative exon splicing leading to the loss of exon 8 (5). In humans, CAR is predominantly expressed in hepatocytes, and the most prominent mRNA band migrates as a rather broad band spanning approximately 1.3–1.7 kb (4). The human CAR (hCAR) isoform homologous to mCAR2 has not been clearly identified, even though its existence is suspected (17). It has long been known that dexamethasone, or glucocorticoids, are required for efficient PB response (3, 18, 19, 20, 21, 22), whereas proinflammatory cytokines, such as IL-1 or IL-6, decrease PB-mediated CYP induction (23, 24, 25). Indeed, we previously reported that CAR mRNA and protein expression are induced in cultured human hepatocytes by glucocorticoids, such as dexamethasone, prednisone, and hydrocortisone (17). The results obtained in this earlier work strongly suggested that a ligand-activated glucocorticoid receptor (GR) positively regulates hCAR gene expression. In contrast, we have shown that IL-6 produces a dramatic decrease of CAR mRNA expression (26). From these findings, we proposed that CAR expression should be considered as a limiting factor of CYP induction, subject to cross-talk interactions with other signaling pathways.

As an initial step in the investigation of the transcriptional regulatory mechanisms involved in CAR expression, we cloned the 5'-flanking region of the hCAR gene. In this report, we describe a distal glucocorticoid response element (GRE) located within the CAR promoter and present evidence that this element is capable of conferring transcriptional activation via the glucocorticoid pathway.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Genomic Structure of the hCAR Gene
The hCAR mRNA [(4), GenBank accession no. NM005122) sequence was used to search the BLAST human genome NCBI database. The corresponding hCAR gene was found to map to chromosome 1q21–23. This region is located on the contig NT026945 spanning approximately 8.5 kb. The genomic structure of the CAR gene (Fig. 1Go) consists of nine exons; exon 2 through exon 9 contain the coding region of 348 amino acids (GenBank accession no. NP005113) as determined by aligning the cDNA sequence to the genomic sequence. Its closest genes are the apolipoprotein A-II and the myelin protein zero.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 1. Gene Structure of the hCAR Gene

Gene structure of the hCAR gene. Upper panel shows the cDNA size and the location of the coding region. The gene is 8.5 kb. Lower panel aligns the cDNA to the genomic sequence. Open boxes are exons. The first 110 bp of MB67 cDNA are not present on the genomic sequence of chromosome 1 but are found on chromosome X (contig NT025273).

 
The initial CAR cDNA reported by Baes et al. (4) has a different 110-nt-long 5'-sequence compared with the contig sequence. In fact, we observed that this region maps very well (100%) to a portion of the chromosome X (contig NT025273, data not shown). Thus, this region seems to represent a contamination of the cDNA library used by these authors. In support of this, using RT-PCR performed with a primer corresponding to this region [untranslated region (UTR) 55–76 forward primer], we failed to amplify any band from two different human liver RNAs. In contrast, using the same approach with a primer downstream of this region, UTR 179–198, we successfully amplified the expected bands (data not shown). Similar results were obtained with 5'-rapid amplification of the cDNA end (5'-RACE) (Fig. 3BGo). These data strongly suggest that the untranslated region of hCAR is 110 nt shorter than previously described.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Transcription Start Site of the hCAR Gene

A, To map the transcription start site, primer extension analysis was carried out using total RNA from human hepatocytes. Lane 1 represents the extended transcript. A sequencing ladder of the corresponding genomic fragment, which was primed with the identical oligonucleotide, was electrophoresed in parallel. B, Transcriptional starts site identified by both primer extension (+) and 5'-RACE (*) analysis. The putative TATA-like box is underlined. Note that both techniques identified a cDNA 110 nt shorter than previously reported (4 ). C, CAR promoter activity in HepG2 cells. A series of reporter constructs was generated containing 4711 bp of the 5'-flanking sequences from the hCAR gene. Smaller fragments generated using PCR amplification were linked to a luciferase reporter. The constructs were transfected into a human hepatocarcinoma cell line (HepG2). The luciferase activities from two separate transfections performed in triplicate were normalized to the ß-galactosidase values.

 
Identification and Chromosomal Location of the hCAR Gene and Promoter
We cloned about 4.9 kb of the hCAR promoter using genomic PCR with primers designed according to the sequence indicated in the contig NT026945. Restriction analysis (data not shown) and full-length sequencing confirmed that the fragment cloned was similar to the expected contig sequence, and only a few differences were found (two mismatches/4.9 kb). Chromosomal assignment was confirmed by fluorescence in situ hydridization (FISH) of normal metaphase chomosomes using probes generated both from the cDNA and the cloned hCAR gene promoter. As shown in Fig. 2Go, we observed a strict colocalization between the NR1I3 cDNA and the promoter probe signal on chromosome 1, in an area corresponding to 1q21 (19 metaphases counted with the cDNA probe and 13 metaphases with the gene promoter probe). Significant secondary signals were not observed but background was present in many metaphases.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 2. Chromosomal Localization of hCAR Gene

FISH of normal metaphase chromosomes with the CAR cDNA (A) or CAR -4711/+144 gene promoter (B) biotin-labeled probes localizes CAR to chromosome 1q21.

 
Transcription Start Site
The transcriptional start site was first determined by primer extension assay using a 28-nt end-labeled primer, which hybridizes 48 nt upstream of the ATG codon. Two major bands were detected in human liver RNA (Fig. 3AGo), which place the transcriptional start point -160 bp upstream of the ATG codon. Using 5'-RACE PCR, we obtained results similar to those summarized in Fig. 3BGo. The apparent start site of transcription identified by these studies lies approximately 30 nt from a TATA-like box (CATAAAA). This atypical TATA box has already been identified in the gene promoter of a hepatic enzyme that is a CAR target gene, the mouse cyp2B10 (27). To confirm that the 5'-flanking sequences of the CAR gene can confer promoter activity, different 5'-flanking regions of CAR were cloned upstream of a promoterless luciferase reporter gene (-4711/+144 to -120/+144pGL3b). The positions indicated are based on the transcription start site predicted by the contig NT026945 sequence and determined by both primer extension analysis and 5'-RACE results. These constructs were transfected in the human hepatocarcinoma HepG2 cell line. As indicated in Fig. 3CGo, full activity was observed with a rather short fragment from -237 to +144, with a further deletion to -120 showing significantly decreased expression. Thus, these results map the minimal CAR sequences necessary for the promoter activity in HepG2 cells to approximately -237 to +144, mostly contributed by sequences between -237 and -120. Deletion of the proximal region -337/+144 resulted in a dramatic decrease in luciferase activity of the -4771/-335pGL3b construct, to a level similar to that observed with the parental pGL3basic vector, as this construct does not contain a transcription start site. Analysis of the -237 to -120 CAR promoter DNA sequence, revealed numerous potential hepatocyte-specific transcription factor binding sites such as CCAAT enhancer binding protein-{alpha}, hepatocyte nuclear factor 3, and hepatocyte nuclear factor 4, consistent with the liver-enriched expression of CAR.

Identification of a Functional Glucocorticoid-Responsive Element in the Distal Regulatory Region of Gene CAR
In recent work, we observed that induction of CAR mRNA by dexamethasone paralleled that of TAT, a gene product known to be controlled by GR (28), in terms of time and concentration dependence in primary human hepatocytes. This glucocorticoid stimulation was inhibited by RU486, a specific glucocorticoid antagonist. Moreover, the induction was not suppressed by cycloheximide treatment of the hepatocytes, indicating that it was mediated by a preexisting GR (17). This prompted us to look for a functional GRE in the CAR promoter gene. For this purpose, the 5'-flanking region of CAR from -4711 to +144 was cloned upstream of a luciferase reporter gene (-4711/+144pGL3b). This reporter plasmid and the parental pGL3basic vector were then transfected into human hepatocytes (which express endogenous GR), and hepatic (HepG2) and nonhepatic (CV1, monkey fibroblast) cell lines in which GR expression is undetectable, with or without a plasmid expressing human GR (pSG5-hGR). Cells were treated for 16 h in the presence or absence of 100 nM dexamethasone, and the luciferase activity was measured. As shown in Fig. 4Go, dexamethasone treatment provoked a strong induction (6-fold) of luciferase activity of the -4711/+144pGL3b construct in human hepatocytes, whereas the activity of the empty vector was unaffected. In HepG2 or CV1 cell lines, dexamethasone-mediated induction was observed only in the presence of hGR cotransfection. These results suggest that GR is required for hCAR expression by dexamethasone. The magnitude of dexamethasone-induced luciferase gene transcription is similar to the magnitude of hCAR mRNA stimulation in cultured human hepatocytes [6-fold induction (17)], suggesting that transcriptional activation of this region is sufficient to account for the effect of dexamethasone on steady state hCAR mRNA levels.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Transactivation of CAR Promoter by Dexamethasone

Plasmids -4711/+144pGL3b (harboring the 4.7-kb hCAR promoter) and the parental pGL3b were transfected into human hepatocytes in primary culture (HHPC), human hepatocarcinoma (HepG2), or monkey fibroblast (CV-1) with or without hGR expression vector (pSG5hGR). pSV-ß-galactosidase was added as internal control. Cells were treated with dexamethasone (black bars) or solvent (DMSO 0.1%, white bars) for 16 h. Cell extracts were assayed for luciferase activity, which was normalized to the ß-galactosidase activity. Induction is expressed as the ratio of normalized luciferase in the presence of dexamethasone to this activity in the absence of dexamethasone. Error bars represent the SD of two independent experiments performed in triplicate.

 
In HepG2 cells, as shown in Fig. 5AGo, plasmids -4711/+144pGL3b or pTAT-GRE2-TK-luc (harboring two copies of the GRE from TAT) exhibited parallel responses to increasing concentrations of dexamethasone in the presence of hGR cotransfection, a plateau being reached at 10–100 nM. These concentrations are known to saturate hGR. As expected, dexamethasone- or hydrocortisone-mediated induction was inhibited by the GR antagonist mifepristone (RU486) in a dose-dependent manner (Fig. 5BGo). Finally, cotransfection of the dominant negative human GR-DNA-binding domain (DBD) (GR amino acids 1–500) expression vector, which contains only the DBD of the GR, provoked a dose-dependent inhibition of ligand-activated GR-mediated induction (Fig. 5CGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 5. Transactivation of CAR Promoter by GR

A, Plasmids -4711/+144pGL3b and pTAT-GRE2-TK-luc (containing two copies of the GRE from TAT) were cotransfected into HepG2 cells with pSG5hGR and with pSV-ß-galactosidase as a transfection control. Cells were then treated with increasing concentrations of dexamethasone for 16 h. Induction of -4711/+144pGL3b (black bars) is indicated by the left-hand scale and induction of the pTAT-GRE2-TK-luc (curve) is indicated by the right-hand scale. Induction is expressed as the ratio of normalized luciferase in the presence of dexamethasone to this activity in the presence of solvent alone (0.1%). B, Effect of RU486 on transactivation of CAR promoter by hGR. HepG2 cells were cotransfected with pSG5hGR and -4711/+144pGL3b reporter vector. pSV-ß-galactosidase was added as internal control. Twenty-four hours later, cells were treated for 24 h with 100 nM dexamethasone or hydrocortisone and increasing concentrations of RU486 (100 and 1000 nM). Induction is expressed as the ratio of normalized luciferase in the presence of chemicals to this activity in the presence of solvent alone (0.2%). C, GR-DBD compete for hGR transactivation of CAR promoter. Plasmid -4711/+144pGL3b was cotransfected into HepG2 cells with pSG5hGR and increasing amounts of the pCMV GR-DBD expression vector. Empty vector, pSG5 was added to keep the amount of DNA similar during transfections, and pSV-ß-galactosidase was added as an internal control. Twenty-four hours later, cells were treated and analyzed as indicated in Fig. 6AGo. Error bars represent the SD of two independent experiments performed in triplicate.

 
As these results strongly suggested the presence of a GRE located on the -4710/+144 region of the CAR promoter, a more detailed analysis of hGR-mediated transactivation of CAR promoter deletion constructs was undertaken. For this purpose, several plasmids containing deletion constructs were generated. The results are presented in Fig. 6AGo. No significant induction of the reporter gene was observed without hGR transfection in any of the constructs examined. In contrast, when these plasmids were cotransfected with the hGR expression vector, similar induction (6- to 8-fold) was observed in response to 100 nM dexamethasone for -4477/+144pGL3b, -4561/+144pGL3b, and -4711/+144pGL3b constructs. However, a major decrease in luciferase activity was observed with the construction -4410/+144pGL3b and shorter constructs. Similar results were obtained in CV1 cells (data not shown). To examine whether the GC-responsive domain exhibited enhancer properties, fragments of the 5'-flanking region were inserted downstream of a minimal simplex virus thymidine kinase promoter vector (pGL3TK) and cotransfected with GR in HepG2 cells (Fig. 6BGo). A strong and inducible expression (20-fold increase) was observed with -4711/-61pGL3TK, -4711/-2146pGL3TK, -47711/-4311pGL3TK, -4561/ -4311pGL3TK, and -4477/-4311pGL3TK constructs upon dexamethasone treatment. In contrast, no induction was observed with -4410/-4311pGL3TK or -4410/-61pGL3TK constructs. These results show that there is a glucocorticoid-responsive element in the distal hCAR promoter, between -4477 and -4410 nt upstream of the transcription start site.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Identification of a Functional GRE in the CAR Promoter

A, Transactivation of homologous CAR promoter constructs by hGR. Plasmids harboring the CAR promoter constructs were cotransfected in HepG2 with pSG5 (white bars) or pSG5hGR (black bars). pSV-ß-galactosidase was added as internal control. hGR was activated by treatment of cells with 100 nM dexamethasone for 16 h. Cell extracts were assayed for luciferase activity, which was normalized to the ß-galactosidase activity. Induction is expressed as the ratio of normalized luciferase in the presence of dexamethasone to this activity in the absence of dexamethasone. B, Transactivation of heterologous CAR promoter constructs by hGR. Plasmids harboring the CAR promoter linked to the pGL3TK constructs were cotransfected in HepG2 with pSG5 (white bars) or pSG5hGR (black bars). pSV-ß-galactosidase was added as internal control. Cells were treated and analyzed as indicated in Fig. 7AGo. Error bars represent the SD of three independent experiments performed in triplicate.

 
Characterization of the hCAR-GRE
Computer analysis of this region demonstrated that there is no perfect GRE in this 67-nt-long sequence, but that the central region (-4447/-4432) contains two putative imperfect GRE half-sites (indicated by capital letters) separated by 3 nt (GGAACAacaAG GGCA, Fig. 7AGo). Moreover, this region contains all the relevant guanines shown to be necessary for GR binding [G or complementary C that are underlined; Beato, M., personal communication (29)]. To evaluate the role of these sites, they were mutated sequentially, and the corresponding 33-nt-long oligonucleotides (-4458/-4425) were cloned downstream of the pGL3TK vector.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Identification of the CAR-GRE

A, Sequence of the putative CAR-GRE of the hCAR promoter and oligonucleotides used for both transient transfection and gel shift assay analysis. The putative GRE half-sites are indicated in bold letters, whereas mutations generated are underlined. B, HepG2 cells were cotransfected with pSG5hGR and heterologous constructs containing one copy of the CAR-GRE wild type in normal (GREwt) or reverse orientation (GREinv) or mutated (MUT1, MUT2, MUT3) fused to the pGL3TK reporter vector. pSV-ß-galactosidase was added as internal control. Cells were treated and analyzed as indicated in Fig. 7AGo. Error bars represent the SD of two independent experiments performed in triplicate.

 
Plasmids hCAR-GREwt-pGL3TK (wild-type sequence), hCAR-GREinv-pGL3TK (wild-type sequence in inverse orientation), hCAR-MUT1-pGL3TK (mutations outside of the putative GRE), hCAR-MUT2-pGL3TK (mutations in the 5'-half site), and hCAR-MUT3-pGL3TK (mutations in the 3'-half-site) were transfected in HepG2 cells in the presence or absence of hGR expression vector. Twenty-four hours later, cells were treated with 100 nM dexamethasone for 16 h. As shown in Fig. 7BGo, the hCAR-GREwt-pGL3TK and hCAR-GREinv-pGL3TK constructions were induced. Indeed, as expected for a classic enhancer, this element was able to function in both orientations to confer glucocorticoid responsiveness to this heterologous promoter. These inductions were dependent on hGR cotransfection (data not shown). Mutation of either putative half-site was sufficient to abolish transcriptional activation of the construct upon dexamethasone treatment. In contrast, the hCAR-MUT1-pGL3TK construct, where mutations were generated outside of the GGAACAacaAGGGCA motif, was still inducible. The hCAR promoter region -4458/-4425 acts as an enhancer, and is hereafter referred to as hCAR-GRE. However, this region was less responsive (3-fold induction) than the -4477/-4311 fragment (15-fold induction), whereas in contrast, the basal expression of the hCAR-GREwt-pGL3K or hCAR-GREinv-pGL3TK reporter constructs were approximately 10-fold stronger than the 4477/-4311pGL3TK construct (data not shown). These results suggest that additional sites within this fragment may increase the overall effect of GR action by affecting its accessibility to the GRE.

To determine whether GR interacts directly with this region, a gel shift analysis was performed with the 32P-radiolabeled hCAR-GRE (-4458/-4425) oligonucleotide probe and baculovirus-expressed hGR. As shown in Fig. 8AGo, GR homodimers bound the CAR-GRE as a single complex (line 1), The specificity of the GR homodimer-hCAR-GRE interaction was demonstrated by competition studies. TAT-GRE oligonucleotide competed with the hCAR-GRE-GR complex (lines 7 and 8), with slightly greater efficiency than the hCAR-GRE itself (lines 3 and 4), whereas the TAT-GRE mutant did not (lines 5 and 6). In addition, the specific complex was supershifted with anti-GR antisera (line 2). Oligonucleotides corresponding to hCAR-GRE mutants 2 (lines 11 and 12) and 3 (lines 13 and 14) were not competitors for this binding, whereas hCAR-GRE mutant 1 was a good competitor (lines 9 and 10).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 8. Identification of the CAR-GRE

A, Analysis of CAR-GRE binding to hGR by EMSA. Radiolabeled -4458/-4425 fragment (CAR-GRE) of the CAR promoter (50,000 cpm 32P) was incubated in the presence of diethylaminoethyl-dextran-purified extracts of sf9 cells transfected with recombinant hGR baculovirus before loading onto the gel. In parallel experiments, incubation was performed in the presence of anti-hGR antibodies ({alpha}GR, lane 2), 25- to 100-fold molar excess of unlabeled CAR-GRE (WT, lanes 3 and 4), 25- to 100-fold molar excess of unlabeled TAT-GRE wild type (GRE cons, lanes 7 and 8), or mutated in the GR-binding sites (GRE mut, lanes 5 and 6), 25- to 100-fold molar excess of unlabeled oligonucleotides corresponding to the MUT1 (lanes 9 and 10), MUT2 (lanes 11 and 12), or MUT3 (lanes 13 and 14), as defined in panel A. S., Shift; S.S, supershift. B, HepG2 cells were cotransfected with pSG5hGR and heterologous constructs corresponding to the native pGL3TK, the wild-type -4477/-4311-pGL3TK, or the mutated -4477/-4311GREmut-pGL3TK, where the GGAACAacaAGGGCA motif was changed to GTTACAacaATTGCA). pSV-ß-galactosidase was added as internal control. Cells were treated and analyzed as indicated in Fig. 7AGo. Error bars represent the SD of two independent experiments performed in triplicate.

 
Using PCR-mediated mutagenesis, we confirmed that mutation of this motif (GTTACAacaATTGCA, mutations are underlined) resulted in the loss of dexamethasone responsiveness of the corresponding -4477/-4311GREmut-pGL3TK reporter compared with the native -4477/-4311pGL3TK construct (Fig. 8BGo). These observations confirm that hCAR-GRE located between -4447 and -4432 nt upstream of the transcriptional start site binds to and is transactivated by ligand-activated hGR. To verify the in vivo relevance of the data obtained by both EMSA and transient-transfection assays in the context of chromatin in intact human hepatocyte cells, we performed a chromatin immunoprecipitation assay. We observed that only antibodies raised against hGR could efficiently immunoprecipitate the distal -4557 to -4157 region of the CAR promoter DNA. These observations were dependent on the presence of dexamethasone in the medium (Fig. 9Go), suggesting stable in vivo association of the ligand-activated GR with the distal CAR promoter. In contrast, we failed to amplify a fragment corresponding to the proximal CAR promoter (-360 to +144 region) after GR immunoprecipitation.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 9. ChIP Assay to Detect the Binding of GR to the Distal Promoter of hCAR Gene in Human Hepatocytes

Human hepatocytes were treated for 24 h with either dexamethasone (100 nM) or DMSO (0.1%). Before immunoprecipitation, 5 µl from each sample were used for PCR amplification of the distal (-4557/-4157) and proximal (-360/+144) CAR promoter regions (input). The association of GR with the distal CAR promoter region was detected by immunoprecipitation with antibodies against GR (sc1002X or sc1003X from Santa Cruz Biotechnology, Inc.), followed by PCR amplification. As a control, sample lysates were also incubated without antibody (NoAb) or control rabbit IgG antibody (Control IgG).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
It is well established that glucocorticoids are required for the maintenance of cytochrome P450 expression and induction in hepatocytes. In addition, it is well known that PB induction of rat, mouse, or human CYP2B either requires or is potentiated by glucocorticoids (17, 18, 21, 22); however, glucocorticoids themselves are not inducers (3, 17, 30, 31). The molecular mechanism of this phenomenon remained to be elucidated. One possible explanation is that glucocorticoids control the expression of transcription factors involved in both CYP expression and induction by xenobiotics. Mice deficient in CAR (CAR -/-) show a complete loss of CYP2B and CYP3A induction in response to PB (13). Thus, if CAR is a rate-limiting factor, increased expression of CAR by glucocorticoids would lead to the enhancement of the transcriptional activity of this receptor in the presence of its cognate activators. For example, in rat hepatocytes, glucocorticoids, such as dexamethasone, and PPAR activators synergically induce PPAR target genes, and notably those involved in lipid catabolism (32). In fact, it has been reported that glucocorticoids directly activate the transcription of the PPAR{alpha} gene in vitro and in vivo (33, 34).

In previous work, we showed that expression of CAR in human hepatocytes is regulated by glucocorticoid hormones (17). The involvement of transcriptional control through the classical glucocorticoid pathway was strongly suggested because 1) dexamethasone did not affect the degradation of CAR mRNA; 2) CAR mRNA induction was blocked by the glucocorticoid antagonist RU486; 3) the induction was not suppressed by cycloheximide treatment, indicating that it was mediated by preexisting GR; and 4) the RNA synthesis inhibitor actinomycin D abolished the stimulatory effect of dexamethasone. In this work, we cloned the hCAR regulatory region. The results of the analysis presented herein demonstrate transcriptional control of hCAR gene expression by glucocorticoids. Computer analysis of 4.7 kb of the hCAR 5'-regulatory region revealed the presence of numerous GRE half-sites, most of which was nonfunctional. In a first step, transient transfection studies suggested the presence of a glucocorticoid responsive unit located between -4477 and -4410 upstream of the transcription start. Indeed, the GRE that was characterized (-4447/-4432) has a classical GRE structure, i.e. two half-sites separated by 3 nt, and mutations of this GRE in either half-site drastically decreased both binding and transactivation by hGR. These in vitro experiments were confirmed by a chromatin immunoprecipitation assay, as we found that dexamethasone treatment of cultured human hepatocytes causes binding of GR to this DNA region of the CAR promoter in intact cells. Of particular significance is that the murine CAR promoter gene contains a precise match to the human GRE (starting at chromosome 1, position 172485157), suggesting that similar glucocorticoid-dependent regulation should be observed in this species.

Interaction of this regulatory pathway with the CAR-mediated xenobiotic-signaling pathway suggests the existence of an activation cascade involving the following steps: 1) activation of the GR by glucocorticoids; 2) induction of the CAR gene by activated GR; 3) activation of the CAR by its cognate activators; 4) induction of the expression of CAR target genes by the activated CAR. According to this model, both glucocorticoids and CAR activators must be present for the cascade to work. Hence, it may explain the cooperative effect observed between glucocorticoids and PB and PB-like inducers on the expression of several CAR target genes (17, 18, 21, 22), and the inhibitory effect of RU486 on PB-mediated CYP induction (21, 31, 35).

In vivo, such a regulatory cascade would be of great physiological significance because many CAR target genes are involved in the metabolism of xenobiotics, but also in the metabolism of endogenous compounds, such as steroids. Glucocorticoids would therefore have a permissive and even stimulatory function in this catabolism. Moreover, we might speculate that CAR expression in vivo would increase in situations where glucocorticoid hormone levels are high, e.g. in stress conditions or during the peak of the corticosterone circadian rhythm, as observed for PPAR{alpha} (33). Finally, our finding that GR controls the expression of CAR, involved in the regulation of CYP gene expression mediating the oxidative metabolism of natural steroid hormones, may reveal the existence of a regulatory network governing endocrine GC homeostasis. Moreover, in view of the well known functional interference between glucocorticoids and proinflammatory transcription factors such as activator protein 1 (Fos-Jun heterodimers), and nuclear factor-{kappa}B (P65-p50 heterodimers), these results provide a possible explanation for the decrease of CAR expression (26) and PB-mediated CYP induction during infectious or inflammatory processes (23, 24, 25).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials and Reagents
DMEM was purchased from Invitrogen (Cergy Pontoise, France). Dexamethasone, mifepristone (RU486), hydroxycortisone, and dimethyl sulfoxide (Me2SO) were purchased from Sigma (Saint Quentin Fallavier, France). [{gamma}-32P]ATP was purchased from Amersham (Amersham, UK).

Chromosomal in Situ Hybridization
Chromosomal localization was performed by FISH to high-resolution metaphase chromosomes obtained from a phytohemagglutinin-stimulated blood cell culture of a healthy male (with his informed consent) with our usual technique (36). The biotinylated MB67 cDNA (4) was used at a dilution of 25 ng/µl. A second probe corresponding to the +4711/+144 region of the hCAR gene promoter (see below) was also used with the same technique at a dilution of 25 ng/µl and competition with 5 µg Cot1 DNA. The hybridization signals appeared as double yellow spots (fluorescein isothiocyanate) on red metaphase chromosomes (counterstained with propidium iodine and 4,6-diamidino-2-phenylindole to allow banding recognition).

RT-PCR and 5'-RACE
Primary cultures of human hepatocytes were prepared and cultured on collagen-coated dishes (37), and total RNA was isolated using Trizol reagent (Invitrogen) from 107 cells. For RT-PCR analysis, cDNA synthesis was performed using SuperScript reverse transcriptase (Invitrogen), random hexamer primers, and 1 µg of total RNA from human hepatocytes. One tenth of the cDNAs were directly used for PCR sets for the hCAR 5'-UTR according to the published cDNA sequence (4): UTR55–76 hCAR forward (5'-CCTAAGTCCATCCCTCATGAAA), UTR179–198 hCAR forward (5'-GGAGAGGCATTCCATACCAG) and GSP1 hCAR reverse primer (5'-TCCTGAAGAAACCCTTGCAG), corresponding to nt +362 to +381.

For 5'-RACE assay, cDNA was synthesized, using the 5'-RACE kit system (Invitrogen), from 10 µg of human hepatocyte total RNA with GSP1 hCAR reverse primer. 5'-RACE PCR products were amplified using Abridged Anchor Primer (Invitrogen) and the GSP2 hCAR reverse primer, 5'-ACAGATTTCCTACCTGCTTCTCTTAGGC, corresponding to nt +228 to +256 of the hCAR cDNA, and then cloned in pCR4-TOPO vector (Invitrogen). Sequencing reactions were performed using T3 primer and the BigDye sequencing kit (Perkin-Elmer Corp., Norwalk, CT).

Primer Extension Analysis
32P-Labeled GSP2 hCAR oligonucleotide probe (10 µM) was hybridized to 100 µg of total RNA prepared from human hepatocytes in a buffer containing 40 mM piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.4; 1 mM EDTA; 0.4 M NaCl; and 80% formamide. The annealed products were precipitated and resuspended in a buffer containing 50 mM Tris, pH 8.3; 40 mM KCl; 6 mM MgCl2; 1 mM dithiothreitol; 0.5 mM deoxynucleotide triphosphates; and 10 U of RnaseOut (Invitrogen). After addition of 10 U of SuperScript reverse transcriptase (Invitrogen), the reaction was allowed to proceed for 60 min at 37 C, followed by a 30-min digestion with 5 µg of deoxyribonuclease-free ribonuclease (Roche Clinical Laboratories, Indianapolis, IN). The reaction products were extracted with phenol-chloroform, precipitated with ethanol, and electrophoresed in 5% polyacrylamide gels. A sequencing ladder of the corresponding genomic fragment generated with the Thermo Sequenase Cycle Sequencing Kit (Amersham), using the -4711/+144pGL3b vector (see below) as a template and the 5'-32P-labeled GSP2 hCAR primer, was electrophoresed in parallel.

hCAR Promoter Cloning and Reporter Constructions
Sequence information from the 5'-end of the hCAR locus was provided to us by the BLAST human genome project interrogation with the MB67 mRNA sequence (Z30425). A 4.9-kb fragment of hCAR 5'-flanking region was cloned in pCR-XL TOPO vector (Invitrogen) after amplification by PCR using human genomic male DNA (Promega Corp., Madison, WI) as a template and the Expand Long Template PCR System (Roche Clinical Laboratories). Nucleotides used were 5'-AGTACATAAGACCCTAAGGATCCCCAAA and GSP2 hCAR primer. This plasmid was then digested by SacI/XhoI and the hCAR promoter fragment was subcloned in SacI/XhoI-linearized pGL3basic vector (Promega Corp.) upstream of the firefly luciferase coding region to generate the hCAR-4710/+144pGL3b construct. The hCAR promoter was then totally sequenced (primer walking).

Homologous hCAR promoter deletions were obtained by PCR using SacI-hCAR forward 18-oligomer oligonucleotide primers and the reverse Glprimer2 (Promega Corp.) and the hCAR-4710/+144pGL3b plasmid as a template. Products PCR were then digested by SacI/XhoI and subcloned in SacI/XhoI-linearized pGL3basic vector.

pGL3TK plasmid was obtained by ligation of the HindIII/BglII TK-SEAP vector (CLONTECH Laboratories, Inc., Palo Alto, CA) fragment, corresponding to the minimal 147 nt long TK promoter, into the HindIII/BglII-linearized pGL3basic vector. Heterologous constructs were generated by PCR using SacI-hCAR forward and XhoI-hCAR reverse 18-oligomer oligonucleotide primers and the hCAR-4711/+144pGL3b plasmid as a template. PCR products were then digested by SacI/XhoI and subcloned in SacI/XhoI-linearized pGL3TK vector.

Double-stranded oligonucleotides corresponding to the native hCAR GRE (5'-CCAACCAGAGGGAACAACAA GGG CAG TTGTTCA) and mutated (mutated bases are underlined) MUT1 (5'-CCATTCAGAGGGAACAACAAGGGCAGTTGTTCA), MUT2 (5'-CCAACCAGAGGTTACAACAAGGGCAGTTGTTCA), and MUT3 (5'-CCAACCAGAGGGAACAACAATTGCAGTTGTTCA), were phosphorylated using T4 polynucleotide kinase (Invitrogen) and cloned into the pGL3TK vector digested with SmaI. Both inverse and native orientations of the hCAR-GRE region were generated (hCAR-GREwt-pGL3 and hCAR-GREinv-pGL3b) to test the glucocorticoid-responsive enhancer in reverse orientation and with a heterologous promoter.

Site-Directed Mutagenesis
Site-directed mutagenesis was performed using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the method recommended by the manufacturer, and oligonucleotides 5'-CCAACCAGAGGTTACAACAATTGCAGTTGTTCA and its reverse complement. The plasmid -4477/-4311 was used as template to generate the -4477/-4311GREmut-pGL3TK.

Other Plasmids
The pTAT-GRE2-TK Luc containing two copies of the consensus GRE upstream of a minimal simplex virus thymidine kinase promoter and a luciferase reporter gene, and the hGR DBD expression vector (pCMV GR-DBD) were kindly provided by Dr. L. Poellinger (Karolinska Institute, Stockholm, Sweden) and described elsewhere (38). The hGR expression vector (pSG5-hGR) was kindly provided by Dr. J. C. Nicolas (INSERM, Montpellier, France). The pSG5 vector was from Stratagene (Amsterdam, The Netherlands).

Cell Culture, DNA Transient Transfections, and Reporter Gene Expression Assays
The HepG2 and CV1 cell lines were obtained from the NIH ATCC repository (Manassas, VA), and were propagated in DMEM plus 10% fetal bovine serum, nonessential amino acids, sodium pyruvate, and antibiotics (Invitrogen). Human hepatocytes, HepG2, and CV1 were transfected with fugene-6 transfection reagent (Roche Clinical Laboratories) according to the manufacturer’s instructions. Briefly, 80,000 cells were transfected with 200 ng of reporter plasmid, 25 ng of pSV-ß-galactosidase control vector (Promega Corp.), and expression vector as mentioned in the legends to the figures. Twenty-four hours after transfection, cells were treated with the compounds indicated or 1:1000 (vol/vol) solvent [dimethylsulfoxide (DMSO)] in medium complemented with 5% delipidated and charcoal-stripped bovine calf serum (Sigma). Thirty-six hours later, cells were washed in 1x PBS and lysed in Lysis Buffer (Promega Corp.). Luciferase and ß-galactosidase assays were performed according to the specifications of the manufacturer (Promega Corp.). Plasmid DNAs were purified using the Nucleobond DNA isolation system from Macherey-Nagel (Duren, Germany).

EMSA
EMSAs were performed using 5'-32P-labeled double-stranded oligonucleotide 5'-CCAACCAGAGGGAACAACAAGGGCAGTTGTTCA. Fifty thousand counts per minute were incubated as described elsewhere (14) with 4 µg of total protein from Sf9 cells transfected with a recombinant GR-expression baculovirus (kindly provided by F. Cadepond). Competition assays were performed with unlabeled oligonucleotides, including native TAT-GRE and TAT-GRE mutant (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and CAR-GRE mutants (mutated bases are underlined): MUT1 (5'-CCATTCAGAGGGAACAACAAGGGCAGTTGTTCA), MUT2 (5'- CCAACCAGAGGTTACAACAAGGGCAGTTGTTCA), and MUT3 (5'-CCAACCAGAGGGAACAACAATTGCAGTTGTTCA). For supershift assays, extracts were preincubated with 1 µg of GR antibody (sc1002X, Santa Cruz Biotechnology, Inc.). Samples were loaded on a 4% polyacrylamide gel and submitted to electrophoresis at 20 mA in 0.25x Tris-buffered EDTA.

Chromatin Immunoprecipitation (ChIP) Assay
Human hepatocytes (10 x 106) were maintained in 10-cm dishes with or without 100 nM dexamethasone for 24 h. Formaldehyde was then added directly to the tissue culture media to a final concentration of 1%, and the plates were incubated for 10 min at room temperature on a rocker. The cross-linking reaction was stopped by adding glycine to a final concentration of 125 mM over a period of 5 min. The plates were then rinsed twice with ice-cold PBS. The cells were scraped off the plates and collected by centrifugation (600 x g for 5 min at 4 C). The pellet was washed once with PBS, resuspended in 1 ml of permeabilization buffer [5 mM piperazine-N,N'-bis(2-ethanesulfonic acid), pH 8; 85 mM KCl; 0.5% Nonidet P-40; 1 mM phenylmethylsulfonyl fluoride; and a protease inhibitor cocktail (Roche Clinical Laboratories)] and incubated for 5 min on ice. The samples were then centrifuged at 600 x g for 5 min at 4 C, and resuspended in 1 ml of lysis buffer [1% sodium dodecyl sulfate (SDS); 10 mM EDTA; 50 mM Tris, pH 8.1; protease inhibitor cocktail]. Samples were incubated for 10 min at 4 C with gentle agitation and sonicated into DNA fragments of 0.3–1.5 kb. Two hundred microliters of the supernatant were diluted 10-fold in ChIP buffer (0.01% SDS; 1.1% Triton X-100; 1.2 mM EDTA; 16.7 mM Tris, pH 8.1; 0.1 mM phenylmethylsulfonyl fluoride; protease inhibitor cocktail) in a clean tube, and 5 µg of antibody (control rabbit antibody, or anti-hGR antibodies from Santa Cruz Biotechnology, Inc.) was added. The mixtures were incubated overnight at 4 C with gentle agitation and then protein A beads (Euromedex, Mundolsheim, France) were added and left standing for 4 h. The beads were sequentially washed three times with 2 ml of wash buffer 1 (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris, pH 8.1; 150 mM NaCl; protease inhibitor cocktail), wash buffer 2 (wash buffer 1 with 300 mM NaCl), and TE (50 mM Tris, pH 8; 1 mM EDTA). Elution was performed twice with 1% SDS, 0.1 M NaHCO3 at room temperature for 15 min with gentle agitation. After addition of 20 µl of 5 M NaCl to the 500-µl eluate, the samples were incubated 4 h at 65 C to reverse the cross-linking. DNA was recovered by phenol/chloroform extraction, ethanol precipitation, and then resuspended in 40 µl of water. Twenty microliters of each sample were used for PCR amplification (40 cycles) with the Expand Long Template PCR System (Roche Clinical Laboratories). The primers for PCR of the distal GRE region of CAR promoter (-4557 to -4157) were 5'-GGCTCACAGAGGTGATCTGC and 5'-CATCCTCCATGCTGTTGCTA. After gel migration, the 400-bp amplified fragments from the GR-immunoprecipitation samples were pooled, purified using the Nucleospin extract kit (Macherey-Nagel), cloned in pCR4-TOPO (Invitrogen) vector, and verified by sequencing. The primers for PCR of the 504-nt-long proximal negative control fragment of the CAR promoter (-360 to +144) were 5'-TGA CATACTGCGTGTGAAAAAGCTTGC forward and GSP2 hCAR primers.


    ACKNOWLEDGMENTS
 


    FOOTNOTES
 
Abbreviations: CAR, Constitutive androstane receptor; ChIP, chromatin immunoprecipitation; CYP, cytochrome P-450; DBD, DNA-binding domain; DMSO, dimethylsulfoxide; FISH, fluorescence in situ hybridization; GR, glucocorticoid receptor; GRE, glucocorticoid response element; hCAR, human CAR; hGR, human GR; nt, nucleotide; PB, phenobarbital; PPAR, peroxisome proliferator-activated receptor; RACE, rapid amplification of the cDNA end; SDS, sodium dodecyl sulfate; UTR, untranslated region.

Received for publication July 11, 2002. Accepted for publication September 24, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Conney AH 1982 Induction of microsomal enzymes by foreign chemicals and carcinogenesis by polycyclic aromatic hydrocarbons: G. H. A. Clowes Memorial Lecture. Cancer Res 42:4875–4917[Free Full Text]
  2. Okey AB 1990 Enzyme induction in the cytochrome P-450 system. Pharmacol Ther 45:241–298[CrossRef][Medline]
  3. Waxman DJ, Morrissey JJ, Naik S, Jauregui HO 1990 Phenobarbital induction of cytochromes P-450. High-level long-term responsiveness of primary rat hepatocyte cultures to drug induction, and glucocorticoid dependence of the phenobarbital response. Biochem J 271:113–119[Medline]
  4. Baes M, Gulick T, Choi HS, Martinoli MG, Simha D, Moore DD 1994 A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements. Mol Cell Biol 14:1544–1551[Abstract/Free Full Text]
  5. Choi HS, Chung M, Tzameli I, Simha D, Lee YK, Seol W, Moore DD 1997 Differential transactivation by two isoforms of the orphan nuclear hormone receptor CAR. J Biol Chem 272:23565–23571[Abstract/Free Full Text]
  6. Corcos L, Lagadic-Gossmann D 2001 Gene induction by phenobarbital: an update on an old question that receives key novel answers. Pharmacol Toxicol 89:113–122[CrossRef][Medline]
  7. Honkakoski P, Zelko I, Sueyoshi T, Negishi M 1998 The nuclear orphan receptor CAR-retinoid X receptor heterodimer activates the phenobarbital-responsive enhancer module of the CYP2B gene. Mol Cell Biol 18:5652–5658[Abstract/Free Full Text]
  8. Zelko I, Negishi M 2000 Phenobarbital-elicited activation of nuclear receptor CAR in induction of cytochrome P450 genes. Biochem Biophys Res Commun 277:1–6[CrossRef][Medline]
  9. Sueyoshi T, Kawamoto T, Zelko I, Honkakoski P, Negishi M 1999 The repressed nuclear receptor CAR responds to phenobarbital in activating the human CYP2B6 gene. J Biol Chem 274:6043–6046[Abstract/Free Full Text]
  10. Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washburn K, Negishi M 1999 Phenobarbital-responsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol Cell Biol 19:6318–6322[Abstract/Free Full Text]
  11. Moore LB, Parks DJ, Jones SA, Bledsoe RK, Consler TG, Stimmel JB, Goodwin B, Liddle C, Blanchard SG, Willson TM, Collins JL, Kliewer SA 2000 Orphan nuclear receptors constitutive androstane receptor and pregnane X receptor share xenobiotic and steroid ligands. J Biol Chem 275:15122–15127[Abstract/Free Full Text]
  12. Tzameli I, Pissios P, Schuetz EG, Moore DD 2000 The xenobiotic compound 1,4-bis[2-(3, 5-dichloropyridyloxy)]benzene is an agonist ligand for the nuclear receptor CAR. Mol Cell Biol 20:2951–2958[Abstract/Free Full Text]
  13. Wei P, Zhang J, Egan-Hafley M, Liang S, Moore DD 2000 The nuclear receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature 407:920–923[CrossRef][Medline]
  14. Gerbal-Chaloin S, Daujat M, Pascussi JM, Pichard- Garcia L, Vilarem MJ, Maurel P 2002 Transcriptional regulation of CYP2C9 gene. Role of glucocorticoid receptor and constitutive androstane receptor. J Biol Chem 277:209–217[Abstract/Free Full Text]
  15. Pascussi JM, Drocourt L, Gerbal-Chaloin S, Fabre JM, Maurel P, Vilarem MJ 2001 Dual effect of dexamethasone on CYP3A4 gene expression in human hepatocytes. Sequential role of glucocorticoid receptor and pregnane X receptor. Eur J Biochem 268:6346–6358[Medline]
  16. Ueda A, Hamadeh HK, Webb HK, Yamamoto Y, Sueyoshi T, Afshari CA, Lehmann JM, Negishi M 2002 Diverse roles of the nuclear orphan receptor CAR in regulating hepatic genes in response to phenobarbital. Mol Pharmacol 61:1–6[Abstract/Free Full Text]
  17. Pascussi JM, Gerbal-Chaloin S, Fabre JM, Maurel P, Vilarem M 2000 Dexamethasone enhances constitutive androstane receptor expression in human hepatocytes: consequences on cytochrome P450 gene regulation. Mol Pharmacol 58:1441–1450[Abstract/Free Full Text]
  18. Jaiswal AK, Haaparanta T, Luc PV, Schembri J, Adesnik M 1990 Glucocorticoid regulation of a phenobarbital-inducible cytochrome P-450 gene: the presence of a functional glucocorticoid response element in the 5'-flanking region of the CYP2B2 gene. Nucleic Acids Res 18:4237–4242[Abstract/Free Full Text]
  19. Kocarek TA, Schuetz EG, Guzelian PS 1994 Biphasic regulation of cytochrome P450 2B1/2 mRNA expression by dexamethasone in primary cultures of adult rat hepatocytes maintained on matrigel. Biochem Pharmacol 48:1815–1822[CrossRef][Medline]
  20. Schuetz EG, Schmid W, Schutz G, Brimer C, Yasuda K, Kamataki T, Bornheim L, Myles K, Cole TJ 2000 The glucocorticoid receptor is essential for induction of cytochrome P-4502B by steroids but not for drug or steroid induction of CYP3A or P-450 reductase in mouse liver. Drug Metab Dispos 28:268–278[Abstract/Free Full Text]
  21. Shaw PM, Adesnik M, Weiss MC, Corcos L 1993 The phenobarbital-induced transcriptional activation of cytochrome P-450 genes is blocked by the glucocorticoid-progesterone antagonist RU486. Mol Pharmacol 44:775–783[Abstract]
  22. Stoltz C, Vachon MH, Trottier E, Dubois S, Paquet Y, Anderson A 1998 The CYP2B2 phenobarbital response unit contains an accessory factor element and a putative glucocorticoid response element essential for conferring maximal phenobarbital responsiveness. J Biol Chem 273:8528–8536[Abstract/Free Full Text]
  23. Abdel-Razzak Z, Corcos L, Fautrel A, Guillouzo A 1995 Interleukin-1 ß antagonizes phenobarbital induction of several major cytochromes P450 in adult rat hepatocytes in primary culture. FEBS Lett 366:159–164[CrossRef][Medline]
  24. Clark MA, Bing BA, Gottschall PE, Williams JF 1995 Differential effect of cytokines on the phenobarbital or 3-methylcholanthrene induction of P450 mediated monooxygenase activity in cultured rat hepatocytes. Biochem Pharmacol 49:97–104[CrossRef][Medline]
  25. Williams JF, Bement WJ, Sinclair JF, Sinclair PR 1991 Effect of interleukin 6 on phenobarbital induction of cytochrome P-450IIB in cultured rat hepatocytes. Biochem Biophys Res Commun 178:1049–1055[CrossRef][Medline]
  26. Pascussi JM, Gerbal-Chaloin S, Pichard-Garcia L, Daujat M, Fabre JM, Maurel P, Vilarem MJ 2000 Interleukin-6 negatively regulates the expression of pregnane X receptor and constitutively activated receptor in primary human hepatocytes. Biochem Biophys Res Commun 274:707–713[CrossRef][Medline]
  27. Honkakoski P, Moore R, Gynther J, Negishi M 1996 Characterization of phenobarbital-inducible mouse Cyp2b10 gene transcription in primary hepatocytes. J Biol Chem 271:9746–9753[Abstract/Free Full Text]
  28. Bradshaw MS, Tsai MJ, O’Malley BW 1988 A steroid response element can function in the absence of a distal promoter. Mol Endocrinol 2:1286–1293[Abstract/Free Full Text]
  29. Beato M, Chalepakis G, Schauer M, Slater EP 1989 DNA regulatory elements for steroid hormones. J Steroid Biochem 32:737–747[CrossRef][Medline]
  30. Sidhu JS, Omiecinski CJ 1995 Modulation of xenobiotic-inducible cytochrome P450 gene expression by dexamethasone in primary rat hepatocytes. Pharmacogenetics 5:24–36[CrossRef][Medline]
  31. Wright MC, Wang XJ, Pimenta M, Ribeiro V, Paine AJ, Lechner MC 1996 Glucocorticoid receptor-independent transcriptional induction of cytochrome P450 3A1 by metyrapone and its potentiation by glucocorticoid. Mol Pharmacol 50:856–863[Abstract]
  32. Sorensen HN, Hvattum E, Paulssen EJ, Gautvik KM, Bremer J, Spydevold O 1993 Induction of peroxisomal acyl-CoA oxidase by 3-thia fatty acid, in hepatoma cells and hepatocytes in culture is modified by dexamethasone and insulin. Biochim Biophys Acta 1171:263–271[Medline]
  33. Lemberger T, Saladin R, Vazquez M, Assimacopoulos F, Staels B, Desvergne B, Wahli W, Auwerx J 1996 Expression of the peroxisome proliferator-activated receptor {alpha} gene is stimulated by stress and follows a diurnal rhythm. J Biol Chem 271:1764–1769[Abstract/Free Full Text]
  34. Lemberger T, Staels B, Saladin R, Desvergne B, Auwerx J, Wahli W 1994 Regulation of the peroxisome proliferator-activated receptor {alpha} gene by glucocorticoids. J Biol Chem 269:24527–24530[Abstract/Free Full Text]
  35. Davidson BP, Dogra SC, May BK 2001 The antiglucocorticoid RU486 inhibits phenobarbital induction of the chicken CYP2H1 gene in primary hepatocytes. Mol Pharmacol 60:274–281[Abstract/Free Full Text]
  36. Romana SP, Le Coniat M, Berger R 1994 t(12;21): a new recurrent translocation in acute lymphoblastic leukemia. Genes Chromosomes Cancer 9:186–191[Medline]
  37. Pichard L, Fabre I, Daujat M, Domergue J, Joyeux H, Maurel P 1992 Effect of corticosteroids on the expression of cytochromes P450 and on cyclosporin A oxidase activity in primary cultures of human hepatocytes. Mol Pharmacol 41:1047–1055[Abstract]
  38. Gradin K, Whitelaw ML, Toftgard R, Poellinger L, Berghard A 1994 A tyrosine kinase-dependent pathway regulates ligand-dependent activation of the dioxin receptor in human keratinocytes. J Biol Chem 269:23800–23807[Abstract/Free Full Text]

NURSA Molecule Pages Link:

Nuclear Receptors:   CAR  |  CAR-β  |  AR
Ligands:   Dexamethasone  |  Hydrocortisone  |  RU486



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
Y. Kanno, Y. Miyama, M. Ando, and Y. Inouye
Dependence on the Microtubule Network and 90-kDa Heat Shock Protein of Phenobarbital-Induced Nuclear Translocation of the Rat Constitutive Androstane Receptor
Mol. Pharmacol., February 1, 2010; 77(2): 311 - 316.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
K. Monostory, J.-M. Pascussi, P. Szabo, M. Temesvari, K. Kohalmy, J. Acimovic, D. Kocjan, D. Kuzman, B. Wilzewski, R. Bernhardt, et al.
Drug Interaction Potential of 2-((3,4-Dichlorophenethyl)(propyl)amino)-1-(pyridin-3-yl)ethanol (LK-935), the Novel Nonstatin-Type Cholesterol-Lowering Agent
Drug Metab. Dispos., February 1, 2009; 37(2): 375 - 385.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
R. S. Sane, D. J. Buckley, A. R. Buckley, S. C. Nallani, and P. B. Desai
Role of Human Pregnane X Receptor in Tamoxifen- and 4-Hydroxytamoxifen-Mediated CYP3A4 Induction in Primary Human Hepatocytes and LS174T Cells
Drug Metab. Dispos., May 1, 2008; 36(5): 946 - 954.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
T. Onica, K. Nichols, M. Larin, L. Ng, A. Maslen, Z. Dvorak, J.-M. Pascussi, M.-J. Vilarem, P. Maurel, and G. M. Kirby
Dexamethasone-Mediated Up-Regulation of Human CYP2A6 Involves the Glucocorticoid Receptor and Increased Binding of Hepatic Nuclear Factor 4{alpha} to the Proximal Promoter
Mol. Pharmacol., February 1, 2008; 73(2): 451 - 460.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
K. Kohalmy, V. Tamasi, L. Kobori, E. Sarvary, J.-M. Pascussi, P. Porrogi, D. Rozman, R. A. Prough, U. A. Meyer, and K. Monostory
Dehydroepiandrosterone Induces Human CYP2B6 through the Constitutive Androstane Receptor
Drug Metab. Dispos., September 1, 2007; 35(9): 1495 - 1501.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
C. Forster, T. Kahles, S. Kietz, and D. Drenckhahn
Dexamethasone induces the expression of metalloproteinase inhibitor TIMP-1 in the murine cerebral vascular endothelial cell line cEND
J. Physiol., May 1, 2007; 580(3): 937 - 949.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
H. Sakai, H. Iwata, E.-Y. Kim, O. Tsydenova, N. Miyazaki, E. A. Petrov, V. B. Batoev, and S. Tanabe
Constitutive Androstane Receptor (CAR) as a Potential Sensing Biomarker of Persistent Organic Pollutants (POPs) in Aquatic Mammal: Molecular Characterization, Expression Level, and Ligand Profiling in Baikal Seal (Pusa sibirica)
Toxicol. Sci., November 1, 2006; 94(1): 57 - 70.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Ding, K. Lichti, I. Kim, F. J. Gonzalez, and J. L. Staudinger
Regulation of Constitutive Androstane Receptor and Its Target Genes by Fasting, cAMP, Hepatocyte Nuclear Factor {alpha}, and the Coactivator Peroxisome Proliferator-activated Receptor {gamma} Coactivator-1{alpha}
J. Biol. Chem., September 8, 2006; 281(36): 26540 - 26551.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Duret, M. Daujat-Chavanieu, J.-M. Pascussi, L. Pichard-Garcia, P. Balaguer, J.-M. Fabre, M.-J. Vilarem, P. Maurel, and S. Gerbal-Chaloin
Ketoconazole and Miconazole Are Antagonists of the Human Glucocorticoid Receptor: Consequences on the Expression and Function of the Constitutive Androstane Receptor and the Pregnane X Receptor
Mol. Pharmacol., July 1, 2006; 70(1): 329 - 339.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
C. Forster, C. Silwedel, N. Golenhofen, M. Burek, S. Kietz, J. Mankertz, and D. Drenckhahn
Occludin as direct target for glucocorticoid-induced improvement of blood-brain barrier properties in a murine in vitro system
J. Physiol., June 1, 2005; 565(2): 475 - 486.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Swales and M. Negishi
CAR, Driving into the Future
Mol. Endocrinol., July 1, 2004; 18(7): 1589 - 1598.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
C. Handschin and U. A. Meyer
Induction of Drug Metabolism: The Role of Nuclear Receptors
Pharmacol. Rev., December 1, 2003; 55(4): 649 - 673.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
Z. Dvorak, M. Modriansky, L. Pichard-Garcia, P. Balaguer, M.-J. Vilarem, J. Ulrichova, P. Maurel, and J.-M. Pascussi
Colchicine Down-Regulates Cytochrome P450 2B6, 2C8, 2C9, and 3A4 in Human Hepatocytes by Affecting Their Glucocorticoid Receptor-Mediated Regulation
Mol. Pharmacol., July 1, 2003; 64(1): 160 - 169.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Gascoyne, R. M. Kypta, and M. d. M. Vivanco
Glucocorticoids Inhibit Apoptosis during Fibrosarcoma Development by Transcriptionally Activating Bcl-xL
J. Biol. Chem., May 9, 2003; 278(20): 18022 - 18029.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. Huang, J. Zhang, S. S. Chua, M. Qatanani, Y. Han, R. Granata, and D. D. Moore
Induction of bilirubin clearance by the constitutive androstane receptor (CAR)
PNAS, April 1, 2003; 100(7): 4156 - 4161.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pascussi, J. M.
Right arrow Articles by Vilarem, M.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pascussi, J. M.
Right arrow Articles by Vilarem, M.-J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals