| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Skeletal Biotechnology Laboratory (S.Z., G.T., D.G.), Hebrew University-Hadassah Medical Center, Jerusalem 91120, Israel; University of California-San Francisco (D.C.L.), San Francisco, California 94143; University of Texas Health Science Center (S.E.H.), San Antonio, Texas 78229; and Womens Health Research Institute (B.S.K., P.V.N.B.), Wyeth Research, Collegeville, Pennsylvania 19426
Address all correspondence and requests for reprints to: Dan Gazit, D.M.D., Ph.D., Molecular Pathology Laboratory, Hebrew University-Hadassah Medical and Gene Therapy Center, P. O. Box 12272, Jerusalem 91120, Israel. E-mail: dgaz{at}cc.huji.ac.il.
| ABSTRACT |
|---|
|
|
|---|
and ERß. Estrogen replacement is one the most common and effective strategies used to prevent osteoporosis in postmenopausal women. Whereas it was thought that estrogens work exclusively by inhibiting bone resorption, our previous results show that 17ß-estradiol (E2) increases mouse bone morphogenetic protein (BMP)-2 mRNA, suggesting that estrogens may also enhance bone formation. In this study, we used quantitative real-time RT-PCR analysis to demonstrate that estrogens increase BMP-2 mRNA in mouse mesenchymal stem cells. The selective ER modulators, tamoxifen, raloxifene, and ICI-182,780 (ICI), failed to enhance BMP-2 mRNA, whereas ICI inhibited E2 stimulation of expression. To investigate if estrogens increase BMP-2 expression by transcriptional mechanisms and if the response is mediated by ER
and/or ERß, we studied the effects of estrogens on BMP-2 promoter activity in transient transfected C3H10T1/2 cells. E2 produced a dose-dependent induction of the mouse -2712 BMP-2 promoter activity in cells cotransfected with ER
and ERß. At a dose of 10 nM E2, ER
induced mouse BMP-2 promoter activity 9-fold, whereas a 3-fold increase was observed in cells cotransfected with ERß. Tamoxifen and raloxifene were weak activators of the mouse BMP-2 promoter via ER
, but not via ERß. ICI blocked the activation of BMP-2 promoter activity by E2 acting via both ER
and ERß, indicating that mouse BMP-2 promoter activation is ER dependent. In contrast to E2 and selective ER modulators, the phytoestrogen, genistein was more effective at activating the mouse BMP-2 promoter with ERß, compared with ER
. Using a deletion series of the BMP-2 promoter, we determined that AP-1 or Sp1 sites are not required for E2 activation. A mutation in a sequence at -415 to -402 (5'-GGGCCActcTGACCC-3') that resembles the classical estrogen-responsive element abolished the activation of the BMP-2 promoter in response to E2. Our studies demonstrate that E2 activation of mouse BMP-2 gene transcription requires ER
or ERß acting via a variant estrogen-responsive element binding site in the promoter, with ER
being the more efficacious regulator. Estrogenic compounds may enhance bone formation by increasing the transcription of the BMP-2 gene. | INTRODUCTION |
|---|
|
|
|---|
BMP-2 is expressed by normal osteoblasts and is a crucial regulator of osteogenic differentiation that has been shown to stimulate osteoblast differentiation and osteogenic nodule formation in vitro, as well as bone formation in vivo (7, 14, 15). Forced expression of BMP-2 in mesenchymal stem cells (MSCs) and osteoblasts has resulted in increased osteogenic differentiation of these cells in vitro and in bone and cartilage formation in vivo (3, 10, 11, 16, 17). These observations clearly indicate the high potency of BMP-2 as an inducer of osteogenesis and that BMP-2 may be a novel therapeutic agent for diseases associated with bone loss and requiring bone repair (18).
Another potential approach to exploit the beneficial actions of BMP-2 on bone formation in vivo (19) is to discover agents that activate BMP-2 gene expression in bone cells. However, this requires a greater understanding of the elements in the BMP-2 promoter that controls gene expression in osteoblasts. The mouse BMP-2 promoter has been cloned and sequenced (18). It does not contain typical TATA or CAAT boxes but has a number of DNA response elements, including Sp1, AP-1, AP-2, p53, E-box, and homeobox domains (18).
Estrogens exert their physiological effects on target tissues by interacting with estrogen receptors (ERs), which are members of the superfamily of ligand-regulated nuclear transcription factors (20, 21). Two ERs have been discovered to date, ER
and ERß. Both receptors have been identified in osteoblasts and osteoclasts as well as in their precursors (22, 23, 24, 25), but the precise roles of ER
and ERß in bone turnover remains to be fully elucidated. However, several studies indicate that ER
and ERß may elicit distinct functions in bone because they exhibit different transcriptional activity. For example, selective ER modulators (SERMs) are more effective in activating AP-1 elements with ERß compared with ER
(26). Furthermore, An et al. (27, 28) have found that estrogens and phytoestrogens are more effective at transcriptional repression in the presence of ERß compared with ER
.
One of the most effective strategies to prevent osteoporosis is to replace estrogen at the onset of menopause. The prevention of bone loss by estrogens has been attributed mainly to its inhibitory action on bone resorption. However, several studies suggest that estrogens may also prevent osteoporosis by stimulating bone formation. Exposing postmenopausal women to relatively high doses of estrogens results in a sustained stimulation of osteoblast function (29). In addition, systemically administered 17ß-estradiol (E2) enhanced bone formation in animals (30, 31, 32, 33, 34, 35). Although the precise mechanism of E2-induced bone formation is not clear (36), the BMP-2 gene is a potential target for estrogens. In fact, E2 has been shown to up-regulate BMP-2 mRNA expression in the murine osteogenic cell line MN7 (37). In addition, our previous work (38) showed that E2 up-regulates mouse BMP-2 gene expression in mouse bone marrow MSCs, which express both ER
and ERß. Moreover, ovariectomy decreased basal levels of BMP-2 mRNA in the mouse MSCs. Finally, when systemically treating mice suffering from osteoporosis after ovariectomy with BMP-2, bone mass was restored to its normal values and MSCs restored their proliferation and differentiation activity (39). These findings indicate that estrogens may promote bone formation by stimulating BMP-2 gene transcription. To test this hypothesis, we investigated whether or not estrogens regulate BMP-2 gene transcription in MSCs and C3H10T1/2 cells. Our study demonstrates that E2 activates BMP-2 gene transcription by recruiting ER
and ERß to a variant estrogen-responsive element (ERE) binding site in the BMP-2 promoter. These findings suggest in addition to its well-recognized inhibitory effect on bone resorption, estrogens may also promote bone formation by enhancing production of BMP-2.
| RESULTS |
|---|
|
|
|---|
|
|
E2 Dose Dependency Increases BMP-2 Promoter Activity via ER
and ERß in C3H10T1/2 Cells
Our studies indicate that estrogens increase BMP-2 mRNA via transcriptional mechanisms. To test this hypothesis directly, we investigated whether estrogens activate the BMP-2 promoter cloned upstream of the luciferase reporter gene in transient transfected MSCs. We chose the C3H10T1/2 cell line, because these cells do not express detectable levels of ERs (Fig. 3A
) and therefore require trans-fection of ERs to elicit E2 effects on transcription (Fig. 3
, B and C). E2 does not activate either classical ERE-tk-luciferase or full-length mouse BMP-2 promoter-luciferase in C3H10T1/2 cells without cotransfection of ER
or ERß expression vectors (Fig. 3
, B and C), and showed no functional ERs in C3H10T1/2 cells. Furthermore, C3H10T1/2 cells are capable of differentiating into osteogenic cells as shown by our previous studies (3, 10). Full-length mouse BMP-2 promoter (-2712)-luciferase plasmids were cotransfected into C3H10T1/2 cells with human ER
or ERß expression vectors. The cells were then treated for 24 h with increasing concentrations of E2, and were assayed for luciferase activity. E2 produced a dose-dependent activation of the -2712 BMP-2 promoter with ER
or ERß (Fig. 3D
). However, ER
was more efficacious than ERß at activating the BMP-2 promoter (Fig. 3D
). As shown in Fig. 4
, the ER antagonist ICI produced a dose-dependent decrease of the E2 stimulation of the -2712 BMP-2 promoter with ER
or ERß. The transfection studies are consistent with BMP-2 mRNA expression data obtained with mouse bone marrow MSCs that were cotreated with E2 and ICI (Fig. 2
).
|
|
variant ERE: 5'-GAACCActcTACCTC-3') in the full-length promoter (-2712), while leaving the other regulatory sites intact. These different mouse BMP-2 promoter-luciferase constructs were transiently cotransfected with either human ER
or ERß expression vectors into C3H10T1/2 cells, and luciferase activity was assayed after 24 h of treatment with 10 nM E2.
|
or ERß activated the -2712, -838, and -448 BMP-2 promoters, but not the -150 promoter, which lacks all regulatory sites. These results demonstrate that the AP-1 response elements are not required for E2 induction. In contrast, deleting the promoter to -400 or mutating (
variant ERE) the putative variant ERE eliminated the ability of E2 to increase BMP-2 promoter activity via ER
or ERß. Thus, the Sp1 site is not essential for ER action, whereas the putative variant ERE seems to be critical for E2 activation of the BMP-2 promoter. Whereas Sp1 and ERE may interact to enhance the activation of the BMP-2 promoter, we found that the BMP-ERE confers responsiveness to estradiol when placed upstream of the heterologous minimal thymidine kinase promoter (Fig. 6B
or ERß proteins and variant ERE of BMP-2 promoter was analyzed by mobility shift DNA-binding assays using gel electrophoresis with DNA probe containing suspected ERE of BMP-2 promoter (top strand: CAATGCGGGGCCACTCTGACCCAGGAGTG). The results (Fig. 6A
and ERß are able to bind onto variant ERE sites of mouse BMP-2 gene promoter.
|
, ERß, or ER
and ERß expression vector. Cells were treated with vehicle ethanol (control), 10-8 M E2, 10-7 M raloxifene, 10-6 M tamoxifen, 10-7 M genistein, or 10-7 M ICI for 24 h, luciferase activity was assayed by luminometer. The results (Fig. 7A
, but not ERß. The partial antagonist activity of SERMs through ER
in BMP-2 promoter was completely abolished by coexpression of ERß. These results are in correspondence to the BMP-2 mRNA levels detected in mouse bone marrow MSCs, which express both ER
and ERß, as was reported previously (38), and is shown here when bone marrow MSCs were treated with tamoxifen or raloxifene and analyzed by RT-PCR (Fig. 2
in classical ERE (41), but not in BMP-2 promoter (Fig. 7A
. The mutation of ERE from BMP-2 promoter abolished the stimulation of SERMs and genistein on BMP-2 promoter activity (Fig. 7B
and genistein via ERß.
|
| DISCUSSION |
|---|
|
|
|---|
One potential target gene of estrogen effect on bone formation is BMP-2. BMP-2 is a potent key inducer of osteogenic differentiation as is evident by its ability to induce de novo cartilage and bone in vivo (1, 2, 3) and osteogenic differentiation in several MSC types in vitro (3, 4, 5, 6, 7, 8, 9, 10). BMPs, including BMP-2, are crucial for osteogenic differentiation in osteoblasts (7, 15). Moreover, expression of BMP-2 in human bone marrow-derived MSCs obtained from a patient suffering from osteoporosis, was able to induce osteogenic differentiation in these cells and restore their osteogenic potential (11). Therefore, agents that locally up-regulate BMP-2 production may provide a novel approach to prevent and treat bone diseases such as osteoporosis (44, 45, 46). Even a small elevation in BMP-2 expression may exert a physiological response because BMP-2 expression is increased by a feedback autocrine effect (47). Indeed we have found that mouse bone marrow MSCs contain both ER
and ERß, and that E2 regulates mouse BMP-2 gene mRNA (38). Moreover, we have found that systemic administration of BMP-2 to mice suffering from osteoporosis after ovariectomy was able to restore bone mass to normal values (39). This effect on bone mass was correlated with increased proliferation and osteogenic activity of bone marrow MSCs (39). These findings strongly suggest that the regulation of BMP-2 gene transcription by ERs is a possible anabolic mechanism for estrogens in osteogenic tissues. The focus of our current study was to characterize the mechanism responsible for the regulation of BMP-2 expression by E2 in MSCs by determining if estrogens activate BMP-2 gene transcription and identifying the ER subtype that mediates the regulation of the BMP-2 gene.
Experiments performed on mouse bone marrow-derived MSCs treated with E2, tamoxifen, raloxifene, and ICI indicated that E2 interacts with ERs to directly enhance BMP-2 mRNA levels (Figs. 1
and 2
). To determine if E2 directly activates the BMP-2 promoter, we transiently transfected mouse BMP-2 promoter-luciferase reporter gene constructs into pluripotent mouse mesenchymal C3H10T1/2 cells. We chose to work with this cell line because it is more easily manipulated and transfected in vitro compared with primary bone marrow mouse MSCs. Moreover, as we have found (Fig. 3A
) C3H10T1/2 do not express endogenous ERs and therefore the differential effect of ER
and ERß on the BMP-2 promoter can be easily studied by cotransfecting each of the ERs. E2 produced a dose-dependent increase in BMP-2 promoter activity in C3H10T1/2 cells cotransfected with either ER
or ERß. However, ER
was more potent than ERß. This result confirmed the RT-PCR results of BMP-2 mRNA expression in mouse bone marrow MSCs and indicates that estrogens increase BMP-2 mRNA by a transcriptional mechanism. Interestingly, raloxifen and tamoxifen had weakly activated BMP-2 promoter in C3H10T1/2 cells when ER
alone was expressed (Fig. 7
). However, this mild effect was abolished in C3H10t1/2 cells when both ERs were expressed. This result also corresponds to the results obtained with marrow-derived MSCs where SERMs were unable to elicit BMP-2 mRNA expression, but where both ERs are expressed (38).
The mouse BMP-2 promoter (-2712 to +165) contains several consensus transcription response elements including Sp1 and AP-1 sites. A nonpalindromic sequence located at -415 to -402 (5'-GGGCCAnnnTGACCC-3') has a 3-bp variation from the classical vitellogenin A2 ERE (5'-AGGTCAnnnTGACCT-3') over a 15-bp sequence. However, over the core 13-bp consensus ERE sequence (5'-GGCCAnnnTGACC-3'), only 1 bp is altered (48). By comparing the activity of different deletions of the mouse BMP-2 promoter and a construct with a mutation in the ERE-like sequence, we mapped the site of regulation by ER
and ERß to this variant ERE binding site (Fig. 5
). EMSA has shown both ER
and ERß to bind to the variant ERE sequence (Fig. 6
). ERs can also activate gene transcription by interacting with alternative DNA elements, such as Sp1 and AP-1 in a ligand-, cell-, and ER subtype-dependent manner (26, 49, 50, 51, 52, 53). Our studies demonstrate that the AP-1 or Sp1 sites are not required for estrogen regulation of the BMP-2 promoter (Figs. 5
and 6
). We cannot exclude the possible interaction between the variant ERE and SP1 site in the BMP-2 promoter by E2; however, it is not essential for the activation of the promoteras was reported for c-myc and Cathepsin D (54, 55). It is possible, however, that factors bound to these elements may interact with ERs bound to the BMP-ERE to alter the magnitude of activation. Estrogens also activate the vascular endothelial growth factor promoter via an imperfect ERE, rather than the AP-1 site in the promoter (56). SERMs such as tamoxifen and raloxifene are therapeutic agents for several indications including the treatment and/or prevention of breast cancer and osteoporosis (26, 57, 58, 59, 60). Recently, raloxifene was approved for prevention and treatment of osteoporosis (61). Raloxifene is less potent than steroidal estrogens at maintaining bone mineral density (58). Although it is assumed that raloxifene increases BMD by inhibiting bone resorption, its precise mechanism of action in the bone in unknown. Our results showed that SERMs such as tamoxifen and raloxifene are weak activators of the mouse BMP-2 promoter via ER
, but not ERß. These SERMs have similar effects on the stimulation of human BMP-4 promoter activity (44). Based on these studies, it is conceivable that SERMs may increase BMD by enhancing the production of BMPs.
Phytoestrogens, such as genistein, exhibit some preference for ERß vs. ER
(28). In fact, genistein reduces both trabecular and compact bone loss after ovariectomy in rats (62). Furthermore, soy isoflavones attenuate bone loss from the spine in perimenopausal and postmenopausal women (63, 64). Our study demonstrates that genistein triggers transcriptional activation of the mouse BMP-2 gene with ERß, but not with ER
, suggesting a possible mechanism whereby isoflavones may attenuate bone loss.
Finally, we conclude that a greater understanding of the regulation of BMP-2 production by osteoblasts may lead to the discovery of agents that can be used to control its expression and thus leading to increased bone formation (19). Our findings may provide a potential partial mechanistic explanation for the role of estrogens in the pathophysiology of osteoporosis and the anabolic effects of high doses of estrogens on the skeleton. A greater understanding of the mechanisms whereby estrogenic compounds regulate BMP-2 transcription in MSCs may pave the way for the development of new modalities that may enhance BMP-2 production in osteogenic tissues to prevent and treat bone diseases.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Construction
Expression vectors for human ER
and human ERß (485) were previously described (65). Full-length (-2712 to +165) and 5'-end deletions of the mouse BMP-2 promoter (-838 to +165, and -150 to +165) were cloned upstream of the luciferase cDNA in the pGL3 vector (Promega Corp., Madison, WI) as previously described (18). Mutation of the mouse BMP-2 variant ERE (
variant ERE: 5'-GAACCActcTACCTC-3') in the full-length promoter, plasmid was accomplished using the QuikChange site-directed mutatgenesis kit (Stratagene, La Jolla, CA) according to the manufacturers protocol. The promoter fragments were subcloned as PCR products into the pGL3-basic vector (-448 to +23 and -400 to +23). BMP-ERE-tk-luciferase vectors (BMP-ERE was placed upstream of the heterologous minimal thymidine kinase promoter) and ERE-tk-luciferase vectors (one copy of the ERE from the frog vitellogenin A2 gene) were constructed as previously described (27).
Animal and Cell Culture
Two-month-old Swiss-Webster female mice (ICR) were OVX in accordance with mandated standards of humane care, and the animals were maintained in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Five months post surgery, bone marrow was isolated from femurs and tibias, and the MSCs were cultured as described previously (38, 66). The bone marrow cells were maintained in DMEM (phenol red free, 1.0 g/liter glucose, Biological Industries) with 15% fetal bovine serum [FBS; charcoal stripped (CS), heat inactivated], 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine. At d 4, the cultures were supplemented with 50 µg/ml ascorbic acid, 10 mM ß-glycerophosphate, and 10 nM dexamethasone, to induce MSCs osteogenic differentiation (38). These supplements are required for the establishment of MSC cultures and the removal of hematopoietic cells. From d 10, the cells were cultured in DMEM with 2% charcoal-stripped FBS without osteogenic supplements (50 µg/ml ascorbic acid, 10 mM ß-glycerophosphate, and 10 nM dexamethasone), to reduce the possible intervention of serum factors and osteogenic supplements with the effect of E2 treatment. At d 11, the cultures were treated with E2 (Sigma), ICI (AstraZeneca Pharmaceuticals), tamoxifen (Sigma), or raloxifene for 24 h. RNA was then isolated on day 12. To block protein synthesis in mouse MSCs, 5.0 µM cycloheximide was added to cultures with fresh DMEM plus 2% CS-FBS for 45 min before 100 nM E2 treatment, and RNA was isolated 4 h after E2 treatment. Mouse C3H10T1/2 cells were maintained cultured with DMEM (Sigma and Biological Industries) containing 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine.
Cell Transfection and Luciferase Assays
Transient transfections were performed as previously described (27). Briefly, C3H10T1/2 cells were grown in culture in 100-mm dishes until they reached confluence. The cells were harvested after trypsinization, resuspended in medium, counted, centrifuged at 800 rpm for 5 min, and 1.5 x 107 cells were resuspended in 0.5 ml PBS containing 0.1% glucose. The cell suspension was mixed with 5 µg luciferase reporter plasmids and 2 µg human ER (hER)
or hERß expression vectors. The cells were transferred to a cuvette and electroporated using a Bio-Rad Laboratories, Inc. gene pulser. After electroporation, the cells were suspended in DMEM (phenol red free) containing 2% CS-FBS and seeded at 1 ml per well into 12-well multiplates. The cells were treated with drugsor ethanol (vehicle) for 24 h, and luciferase activity was assayed using a kit from Promega Corp. with a luminometer (TD-20/20, Turner Designs, Sunnyvale, CA). The efficiency of transfection was monitored by cotransfection of 0.5 µg of pNGVL1-nt-ßGal plasmids (National Gene Vector Laboratory at the University of Michigan, Ann Arbor, MI), and ß-galactosidase activity was measured using the Galacto-Light Chemiluminescent Reporter Assay System Kit (Tropix of PE Biosystems, Foster City, CA). The transfection results were reported as the fold induction of relative light units for drug over vehicle treated cells after normalization to ß- galactosidase expression. Error bars represent the standard error for five experiments, with each data point done in triplicate.
EMSA
The direct interaction between ER
or ERß protein and the ERE of BMP-2 promoter was performed by EMSA as previously described (27). The 32P-labeled DNA probe contained ERE of BMP-2 promoter (top strand: CAATGCGGGGCCACTCTGACCCAGGAGTG). The binding reaction was initiated by adding ER
or ERß that had been prepared with an in vitro transcription/translation kit (Promega Corp.).
RNA Isolation, RT-PCR, and Real-Time RT-PCR
RNA was isolated by using TRIzol Reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturers protocol. RT-PCR was performed as described previously (38). Mouse BMP-2 (505 bp; Ref.38), internal control RPL19 (190 bp; Ref.67), and c-myc (550 bp; Ref.68) primers were described previously. The PCR conditions used for mouse BMP-2 RT-PCR were 30 cycles of 94 C for 1 min, 55 C for 1 min, and 72 for 2 min in an MJ MiniCycler (MJ Research, Inc., Waltham, MA). RT-PCR products of mouse BMP-2 were cloned into the pGEM-T Easy vector (Promega Corp.), and the pGEM-T-mouse BMP-2 vectors were sequenced by a T7 sequence sequencing kit (United States Biochemical Corp., Cleveland, OH) according to the manufacturers protocols. DNA sequence analysis confirmed that mouse BMP-2 was amplified.
Real-time PCR was performed by using a Roche LightCycler according to the manufacturers protocol (Roche Molecular Biochemicals, Indianapolis, IN). After reverse transcription reaction (20 µl) using 2 µg of total RNA, real-time PCR was carried out in a 20-µl final volume using the LightCycler-FastStart DNA Master SYBR Green I kit (Roche). The reaction mix contained 1x LightCycler-FastStart Master SYBR Green I, 0.5 µM of each primer, 4 mM MgCl2, and 2 µl cDNA from (20 µl of) reverse transcription reaction. The conditions of the real-time PCR were as follows: 95 C 10 min for one cycle to activate the modified FastStart Taq DNA polymerase, followed by 45 cycles at 95 C for 15 sec, 60 C to 55 C touchdown at steps of 0.5 C for 10 sec, and 72 C for 25 sec. Fluorescence was measured at 82 C for 5 sec. To quantitate the copy number of the mouse BMP-2 mRNA in MSCs, pGEM-T-mouse BMP-2 plasmids (102108 copies) were used in standard curve.
Statistical Analysis
All experiments were performed three to five times independently. Data are presented as the mean values ± the SEM. The RT-PCR and real-time RT-PCR were performed three times in independent experiments using total RNA that was isolated from MSCs derived from three to six animals each time. Quantitative data were analyzed using either the nonparameteric Mann-Whitney test or the ANOVA test.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: BMP, Bone morphogenetic protein; CS, charcoal-stripped; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen-responsive element; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hER, human ER; ICI, ICI-182,780; MSCs, mesenchymal stem cells; OVX, ovariectomized; SERM, selective ER modulator.
Received for publication June 7, 2002. Accepted for publication September 9, 2002.
| REFERENCES |
|---|
|
|
|---|
and ERß at AP-1 sites. Science 277:15081510
transcription requires estrogen receptor activation function-2 and is enhanced by coactivators. Proc Natl Acad Sci USA 96:1516115166
and ß expression, osteogenic activity and apoptosis in marrow stromal cells (MSCs) of osteoporotic mice. J Cell Biochem 81(S36):144155
transcriptional activity is a key regulator of the cellular response to estrogen and antiestrogens. Endocrinology 140:55665578
/ß)-dependent activation at GC-rich (Sp1) promoter elements. J Biol Chem 275:53795387
and ß. Proc Natl Acad Sci USA 97:1097210977NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
R. H. Straub The Complex Role of Estrogens in Inflammation Endocr. Rev., August 1, 2007; 28(5): 521 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Su, C.-Y. Yang, M. Zhao, M.-L. Kuo, and M.-L. Yen Forkhead Proteins Are Critical for Bone Morphogenetic Protein-2 Regulation and Anti-tumor Activity of Resveratrol J. Biol. Chem., July 6, 2007; 282(27): 19385 - 19398. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Cho, S. H. Javid, A. M. Carothers, M. Redston, and M. M. Bertagnolli Estrogen Receptors {alpha} and {beta} Are Inhibitory Modifiers of Apc-Dependent Tumorigenesis in the Proximal Colon of Min/+ Mice Cancer Res., March 1, 2007; 67(5): 2366 - 2372. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fukui, Y. Ikeda, T. Ohnuki, A. Hikita, S. Tanaka, S. Yamane, R. Suzuki, L. J. Sandell, and T. Ochi Pro-inflammatory Cytokine Tumor Necrosis Factor-{alpha} Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation J. Biol. Chem., September 15, 2006; 281(37): 27229 - 27241. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Shur, R. Solomon, and D. Benayahu Dynamic Interactions of Chromatin-Related Mesenchymal Modulator, a Chromodomain Helicase-DNA-Binding Protein, with Promoters in Osteoprogenitors. Stem Cells, May 1, 2006; 24(5): 1288 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Morris, J. Thorpe, L. Ambrosio, and M. Santin The Soybean Isoflavone Genistein Induces Differentiation of MG63 Human Osteosarcoma Osteoblasts J. Nutr., May 1, 2006; 136(5): 1166 - 1170. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R Mundy Nutritional modulators of bone remodeling during aging Am. J. Clinical Nutrition, February 1, 2006; 83(2): 427S - 430S. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Fritz, D. Liu, J. Xu, S. Jiang, and M. B. Rogers Conservation of Bmp2 Post-transcriptional Regulatory Mechanisms J. Biol. Chem., November 19, 2004; 279(47): 48950 - 48958. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Abrams, J. Xu, C. Nativelle-Serpentini, S. Dabirshahsahebi, and M. B. Rogers An Evolutionary and Molecular Analysis of Bmp2 Expression J. Biol. Chem., April 16, 2004; 279(16): 15916 - 15928. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |