help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0210
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, S.
Right arrow Articles by Gazit, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, S.
Right arrow Articles by Gazit, D.
Molecular Endocrinology 17 (1): 56-66
Copyright © 2003 by The Endocrine Society

Estrogens Activate Bone Morphogenetic Protein-2 Gene Transcription in Mouse Mesenchymal Stem Cells

Shuanhu Zhou, Gadi Turgeman, Stephen E. Harris, Dale C. Leitman, Barry S. Komm, Peter V. N. Bodine and Dan Gazit

Skeletal Biotechnology Laboratory (S.Z., G.T., D.G.), Hebrew University-Hadassah Medical Center, Jerusalem 91120, Israel; University of California-San Francisco (D.C.L.), San Francisco, California 94143; University of Texas Health Science Center (S.E.H.), San Antonio, Texas 78229; and Women’s Health Research Institute (B.S.K., P.V.N.B.), Wyeth Research, Collegeville, Pennsylvania 19426

Address all correspondence and requests for reprints to: Dan Gazit, D.M.D., Ph.D., Molecular Pathology Laboratory, Hebrew University-Hadassah Medical and Gene Therapy Center, P. O. Box 12272, Jerusalem 91120, Israel. E-mail: dgaz{at}cc.huji.ac.il.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogens exert their physiological effects on target tissues by interacting with the estrogen receptors, ER{alpha} and ERß. Estrogen replacement is one the most common and effective strategies used to prevent osteoporosis in postmenopausal women. Whereas it was thought that estrogens work exclusively by inhibiting bone resorption, our previous results show that 17ß-estradiol (E2) increases mouse bone morphogenetic protein (BMP)-2 mRNA, suggesting that estrogens may also enhance bone formation. In this study, we used quantitative real-time RT-PCR analysis to demonstrate that estrogens increase BMP-2 mRNA in mouse mesenchymal stem cells. The selective ER modulators, tamoxifen, raloxifene, and ICI-182,780 (ICI), failed to enhance BMP-2 mRNA, whereas ICI inhibited E2 stimulation of expression. To investigate if estrogens increase BMP-2 expression by transcriptional mechanisms and if the response is mediated by ER{alpha} and/or ERß, we studied the effects of estrogens on BMP-2 promoter activity in transient transfected C3H10T1/2 cells. E2 produced a dose-dependent induction of the mouse -2712 BMP-2 promoter activity in cells cotransfected with ER{alpha} and ERß. At a dose of 10 nM E2, ER{alpha} induced mouse BMP-2 promoter activity 9-fold, whereas a 3-fold increase was observed in cells cotransfected with ERß. Tamoxifen and raloxifene were weak activators of the mouse BMP-2 promoter via ER{alpha}, but not via ERß. ICI blocked the activation of BMP-2 promoter activity by E2 acting via both ER{alpha} and ERß, indicating that mouse BMP-2 promoter activation is ER dependent. In contrast to E2 and selective ER modulators, the phytoestrogen, genistein was more effective at activating the mouse BMP-2 promoter with ERß, compared with ER{alpha}. Using a deletion series of the BMP-2 promoter, we determined that AP-1 or Sp1 sites are not required for E2 activation. A mutation in a sequence at -415 to -402 (5'-GGGCCActcTGACCC-3') that resembles the classical estrogen-responsive element abolished the activation of the BMP-2 promoter in response to E2. Our studies demonstrate that E2 activation of mouse BMP-2 gene transcription requires ER{alpha} or ERß acting via a variant estrogen-responsive element binding site in the promoter, with ER{alpha} being the more efficacious regulator. Estrogenic compounds may enhance bone formation by increasing the transcription of the BMP-2 gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
BONE MORPHOGENETIC PROTEINS (BMPs) are members of the TGF-ß superfamily that were originally identified in bone-inductive extracts of demineralized bone (1). Recombinant human BMP-2 induces de novo cartilage and bone formation in vivo (1, 2, 3) and osteogenic differentiation of several mesenchymal cell types in vitro (3, 4, 5, 6, 7, 8, 9, 10, 11). BMP-2 shows diverse expression patterns throughout embryonic development and is thought to regulate proliferation, apoptosis, and morphogenesis in multiple organ systems (12, 13).

BMP-2 is expressed by normal osteoblasts and is a crucial regulator of osteogenic differentiation that has been shown to stimulate osteoblast differentiation and osteogenic nodule formation in vitro, as well as bone formation in vivo (7, 14, 15). Forced expression of BMP-2 in mesenchymal stem cells (MSCs) and osteoblasts has resulted in increased osteogenic differentiation of these cells in vitro and in bone and cartilage formation in vivo (3, 10, 11, 16, 17). These observations clearly indicate the high potency of BMP-2 as an inducer of osteogenesis and that BMP-2 may be a novel therapeutic agent for diseases associated with bone loss and requiring bone repair (18).

Another potential approach to exploit the beneficial actions of BMP-2 on bone formation in vivo (19) is to discover agents that activate BMP-2 gene expression in bone cells. However, this requires a greater understanding of the elements in the BMP-2 promoter that controls gene expression in osteoblasts. The mouse BMP-2 promoter has been cloned and sequenced (18). It does not contain typical TATA or CAAT boxes but has a number of DNA response elements, including Sp1, AP-1, AP-2, p53, E-box, and homeobox domains (18).

Estrogens exert their physiological effects on target tissues by interacting with estrogen receptors (ERs), which are members of the superfamily of ligand-regulated nuclear transcription factors (20, 21). Two ERs have been discovered to date, ER{alpha} and ERß. Both receptors have been identified in osteoblasts and osteoclasts as well as in their precursors (22, 23, 24, 25), but the precise roles of ER{alpha} and ERß in bone turnover remains to be fully elucidated. However, several studies indicate that ER{alpha} and ERß may elicit distinct functions in bone because they exhibit different transcriptional activity. For example, selective ER modulators (SERMs) are more effective in activating AP-1 elements with ERß compared with ER{alpha} (26). Furthermore, An et al. (27, 28) have found that estrogens and phytoestrogens are more effective at transcriptional repression in the presence of ERß compared with ER{alpha}.

One of the most effective strategies to prevent osteoporosis is to replace estrogen at the onset of menopause. The prevention of bone loss by estrogens has been attributed mainly to its inhibitory action on bone resorption. However, several studies suggest that estrogens may also prevent osteoporosis by stimulating bone formation. Exposing postmenopausal women to relatively high doses of estrogens results in a sustained stimulation of osteoblast function (29). In addition, systemically administered 17ß-estradiol (E2) enhanced bone formation in animals (30, 31, 32, 33, 34, 35). Although the precise mechanism of E2-induced bone formation is not clear (36), the BMP-2 gene is a potential target for estrogens. In fact, E2 has been shown to up-regulate BMP-2 mRNA expression in the murine osteogenic cell line MN7 (37). In addition, our previous work (38) showed that E2 up-regulates mouse BMP-2 gene expression in mouse bone marrow MSCs, which express both ER{alpha} and ERß. Moreover, ovariectomy decreased basal levels of BMP-2 mRNA in the mouse MSCs. Finally, when systemically treating mice suffering from osteoporosis after ovariectomy with BMP-2, bone mass was restored to its normal values and MSCs restored their proliferation and differentiation activity (39). These findings indicate that estrogens may promote bone formation by stimulating BMP-2 gene transcription. To test this hypothesis, we investigated whether or not estrogens regulate BMP-2 gene transcription in MSCs and C3H10T1/2 cells. Our study demonstrates that E2 activates BMP-2 gene transcription by recruiting ER{alpha} and ERß to a variant estrogen-responsive element (ERE) binding site in the BMP-2 promoter. These findings suggest in addition to its well-recognized inhibitory effect on bone resorption, estrogens may also promote bone formation by enhancing production of BMP-2.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
E2 Increases BMP-2 mRNA Expression in Mouse MSCs
Bone marrow MSCs obtained from ovariectomized (OVX) mice (5 months after surgery) express BMP-2 mRNA as shown by real-time RT-PCR (Fig. 1AGo). After 24 h of 100 nM E2 treatment, mouse BMP-2 mRNA levels increased significantly by 2.4-fold from 570 ± 81 copies to 1337 ± 177 copies (P < 0.05, ANOVA) (Fig. 1DGo). The internal control, ribosomal protein L19 (RPL19), was not altered by E2 treatment (Fig. 1BGo). The PCR product was sequenced to verify that it corresponds to the mouse BMP-2, and then cloned into a vector and used in real-time RT-PCR to generate the standard curve for the mouse BMP-2 gene (Fig. 1CGo). We chose to use a 24-h treatment to measure BMP-2 mRNA to relate these results to the transfection studies with the BMP-2 promoter, which required sufficient time for the expression of the transfected ERs.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 1. E2 Increases Mouse BMP-2 mRNA Expression in MSCs Obtained from OVX Mice

After 24 h of 100 nM E2 treatment, mouse BMP-2 mRNA levels were significantly increased confirmed by real-time RT-PCR from 570 ± 81 copies to 1337 ± 177 copies (P < 0.05, ANOVA) in 2 µg of total RNA (A and D). The internal control RPL19 indicated that the same amount of RNA was used in real-time RT-PCR (B). The mouse BMP-2 mRNA copy number (D) was obtained by standard curve (C), as described in Materials and Methods.

 
E2 Induction of BMP-2 mRNA Expression in Mouse MSCs Is ER Dependent
As shown in Fig. 2AGo, after 4 h of treatment of mouse MSCs with 100 nM E2, the regulation of BMP-2 mRNA levels as determined by RT-PCR was not blocked by cycloheximide. In contrast, cyclohexamide caused a super-induction of c-myc mRNA, demonstrating that it inhibited protein synthesis in the MSCs (40) (Fig. 2BGo). This result demonstrates that E2 induction of mouse BMP-2 mRNA in MSCs is independent of ongoing protein synthesis. Whereas the results with cycloheximide indicate that new protein synthesis is not required for induction of BMP-2, it is possible posttranslational regulation of proteins may be involved in estrogen regulation.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. E2 Directly Regulates BMP-2 mRNA Expression in MSCs Obtained from OVX Mice

A 5-µM cycloheximide did not block the up-regulation of BMP-2 by E2 treatment for 4 h (A), but the same concentration of cycloheximide caused superinduction of c-myc (B), indicating that it was active. C, ICI (10-5 M) blocked the up-regulation of BMP-2 mRNA expression in MSCs by E2 (10-7 M) treatment for 24 h as shown by RT-PCR. D, BMP-2 mRNA expression was up-regulated in MSCs by E2 (10-7 M) treatment for 24 h, but not by tamoxifen (10-6 M) or raloxifene (10-7 M). RT-PCR was performed three times in independent experiments by using total RNA that was isolated from MSCs of three to six animals each time.

 
To determine if the action of E2 requires interaction with ERs, we investigated if SERMs block the up-regulation of BMP-2 mRNA by E2. Figure 2CGo shows that ICI-182,780 (ICI) (10 µM), tamoxifen (1.0 µM), or raloxifene (100 nM) (Fig. 2DGo) do not activate the BMP-2 gene 24 h after treatment. However, ICI blocked the up-regulation of BMP-2 mRNA expression by E2 (100 nM) in MSCs, demonstrating that E2 regulates mouse BMP-2 gene expression in MSCs via ERs.

E2 Dose Dependency Increases BMP-2 Promoter Activity via ER{alpha} and ERß in C3H10T1/2 Cells
Our studies indicate that estrogens increase BMP-2 mRNA via transcriptional mechanisms. To test this hypothesis directly, we investigated whether estrogens activate the BMP-2 promoter cloned upstream of the luciferase reporter gene in transient transfected MSCs. We chose the C3H10T1/2 cell line, because these cells do not express detectable levels of ERs (Fig. 3AGo) and therefore require trans-fection of ERs to elicit E2 effects on transcription (Fig. 3Go, B and C). E2 does not activate either classical ERE-tk-luciferase or full-length mouse BMP-2 promoter-luciferase in C3H10T1/2 cells without cotransfection of ER{alpha} or ERß expression vectors (Fig. 3Go, B and C), and showed no functional ERs in C3H10T1/2 cells. Furthermore, C3H10T1/2 cells are capable of differentiating into osteogenic cells as shown by our previous studies (3, 10). Full-length mouse BMP-2 promoter (-2712)-luciferase plasmids were cotransfected into C3H10T1/2 cells with human ER{alpha} or ERß expression vectors. The cells were then treated for 24 h with increasing concentrations of E2, and were assayed for luciferase activity. E2 produced a dose-dependent activation of the -2712 BMP-2 promoter with ER{alpha} or ERß (Fig. 3DGo). However, ER{alpha} was more efficacious than ERß at activating the BMP-2 promoter (Fig. 3DGo). As shown in Fig. 4Go, the ER antagonist ICI produced a dose-dependent decrease of the E2 stimulation of the -2712 BMP-2 promoter with ER{alpha} or ERß. The transfection studies are consistent with BMP-2 mRNA expression data obtained with mouse bone marrow MSCs that were cotreated with E2 and ICI (Fig. 2Go).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 3. E2 Stimulates Mouse BMP-2 Promoter Activity via ER{alpha} and ERß in C3H10T1/2 Cells

A, Wild-type mouse C3H10T1/2 cells do not express ERs. RNA was isolated from either wild-type (WT) or stable C3H10T1/2 cell lines that overexpressed either human ER{alpha} or human ERß and RT-PCR was preformed for the ERs or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Lanes: M, 1-kb molecular weight ladder; 1, WT cells analyzed for ERß; 2, C3H10T1/2-ERß cells analyzed for ERß; 3, ERß cDNA control; 4, WT cells analyzed for GAPDH; 5, C3H10T1/2-ERß cells analyzed for GAPDH; 6, WT cells analyzed for ER{alpha}; 7, C3H10T1/2-ER{alpha} cells analyzed for ER{alpha}; 8, ER{alpha} cDNA control; 9, WT cells analyzed for GAPDH; 10, C3H10T1/2-ER{alpha} cells analyzed for GAPDH. B and C, C3H10T1/2 cells do not express functional ERs and require transfection of either ER{alpha} or ERß. C3H10T1/2 cells were transiently cotransfected with 5 µg of ERE-tk-luciferase plasmids (B) or BMP-2 full-length promoter-luciferase plasmids (C) plus or minus either 2 µg of ER{alpha} or ERß expression vectors, treated with 10 nM E2 for 24 h, and assayed for luciferase activity by a luminometer. The results are shown as the fold induction of E2-treated cells over vehicle control cells. Error bars show the SE among five experiments, each done in triplicate. D, E2 regulated dose dependently full-length mouse BMP-2 promoter (-2712) activity via ERs. Five micrograms of BMP-2 promoter-luciferase plasmid (BMP-2 full-length promoter linked to luciferase in the pGL3 vector) were transiently cotransfected into mouse C3H10T1/2 cells with 2 µg each of either human ER{alpha} or human ERß expression vectors. The cells were then treated with different doses of E2 for 24 h, and luciferase activity was assayed by luminometer. The results are shown as the fold induction of E2-treated cells over vehicle control cells. Error bars show the SE among five experiments, each done in triplicate.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. ICI Dose Dependently Inhibits the Stimulation of E2 on Mouse BMP-2 Promoter Activity via ER{alpha} and ERß

Mouse C3H10T1/2 cells were transfected with mouse BMP-2 FL promoter-luciferase vectors (-2712) and ER{alpha} (A) or ERß (B) expression vectors as described in Fig. 3Go. The cells were treated for 24 h with 10 nM E2 and different doses of ICI. Luciferase activity was assayed with a luminometer, and the results are shown as the fold induction of E2- and ICI-treated over vehicle control cells. Error bars represent the SE of three different experiments, each done in triplicate.

 
Location of an ER Regulatory Site in the Mouse BMP-2 Promoter
The mouse -2712 BMP-2 promoter (18) contains two AP-1 response elements, one GC-rich Sp1 site and a possible variant ERE (5'-GGGCCActcTGACCC-3') at -415 to -402. ERs might interact with any of these elements to activate the BMP-2 promoter. To map the ERE in the mouse BMP-2 promoter, we prepared a deletion series of the BMP-2 promoter and a construct that contains a mutation in the putative variant ERE (Fig. 5Go). The -838 fragment contains the Sp1 site and the putative variant ERE but lacks the two AP-1 response elements, whereas the -150 fragment lacks both sites. The -448 fragment contains the Sp1 and variant ERE site, whereas the -400 fragment lacks the variant ERE, but retains the Sp1 site. Finally, the putative variant ERE was also mutated ({Delta}variant ERE: 5'-GAACCActcTACCTC-3') in the full-length promoter (-2712), while leaving the other regulatory sites intact. These different mouse BMP-2 promoter-luciferase constructs were transiently cotransfected with either human ER{alpha} or ERß expression vectors into C3H10T1/2 cells, and luciferase activity was assayed after 24 h of treatment with 10 nM E2.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 5. The Location of the ER Regulation Site in the Mouse BMP-2 Promoter

Specific deletions of the mouse BMP-2 promoter were obtained by digestion with restriction enzymes (-838 and -150) from the full-length promoter (-2712). The promoter fragments were then subcloned as PCR products into the pGL3-basic vector (-448 to +23 and -400 to +23). Mutation of the wild-type BMP-2 promoter variant ERE ({Delta}variant ERE: 5'-GAACCActcTACCTC-3') in the full-length promoter-luciferase plasmid was accomplished as described in the Materials and Methods. Transient transfection of mouse C3H10T1/2 cells with the BMP-2 promoter constructs and either hER{alpha} or hERß expression vectors was performed as described in Fig. 3Go. Luciferase activity was assayed after 24 h of 10 nM E2 treatment. The results are shown as the fold induction of E2-treated over vehicle-treated cells. The error bars represent the SE of four experiments, each done in triplicate.

 
As shown in Fig. 5Go, E2 acting through either ER{alpha} or ERß activated the -2712, -838, and -448 BMP-2 promoters, but not the -150 promoter, which lacks all regulatory sites. These results demonstrate that the AP-1 response elements are not required for E2 induction. In contrast, deleting the promoter to -400 or mutating ({Delta}variant ERE) the putative variant ERE eliminated the ability of E2 to increase BMP-2 promoter activity via ER{alpha} or ERß. Thus, the Sp1 site is not essential for ER action, whereas the putative variant ERE seems to be critical for E2 activation of the BMP-2 promoter. Whereas Sp1 and ERE may interact to enhance the activation of the BMP-2 promoter, we found that the BMP-ERE confers responsiveness to estradiol when placed upstream of the heterologous minimal thymidine kinase promoter (Fig. 6BGo). This finding suggests that the variant ERE can function independently of the Sp1 site. The direct interaction between ER{alpha} or ERß proteins and variant ERE of BMP-2 promoter was analyzed by mobility shift DNA-binding assays using gel electrophoresis with DNA probe containing suspected ERE of BMP-2 promoter (top strand: CAATGCGGGGCCACTCTGACCCAGGAGTG). The results (Fig. 6AGo) demonstrated that both ER{alpha} and ERß are able to bind onto variant ERE sites of mouse BMP-2 gene promoter.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 6. ER{alpha} and ERß Protein Bind to the Variant ERE of BMP-2 Promoter and Activate Its Transcription

A, The direct interaction between ER{alpha} or ERß protein and the ERE of BMP-2 promoter was performed by EMSAs. The 32P-labeled DNA probe contained the variant ERE of BMP-2 promoter (top strand: CAATGCGGGGCCACTCTGACCCAGGAGTG). The binding reaction was initiated by adding ER{alpha} or ERß that had been prepared with an in vitro transcription/translation kit (Promega Corp.). Lane 1, Mock control; lane 2, 1:5 of ER{alpha}:probe; lane 3, 1:5 of ERß:probe. B, The variant ERE of BMP-2 promoter confers responsiveness to E2 when placed upstream of the heterologous minimal thymidine kinase promoter. Five micrograms of BMP-ERE-tk-luciferase plasmids were transiently cotransfected into C3H10T1/2 cells with 2 µg of either ER{alpha} or ERß expression vectors as described in Materials and Methods. Luciferase activity was assayed after 24 h of 10 nM E2 treatment. The results are shown as the fold induction of E2-treated over vehicle-treated cells. The error bars represent the SE of four experiments, each done in triplicate.

 
Stimulation of the Mouse BMP-2 Promoter by SERMs and Genistein
To test whether SERMs as well as E2 regulated BMP-2 promoter (-2712) activity, BMP-2 full-length promoter-luciferase (-2712) (Fig. 7AGo) were transiently cotransfected into C3H10T1/2 cells with ER{alpha}, ERß, or ER{alpha} and ERß expression vector. Cells were treated with vehicle ethanol (control), 10-8 M E2, 10-7 M raloxifene, 10-6 M tamoxifen, 10-7 M genistein, or 10-7 M ICI for 24 h, luciferase activity was assayed by luminometer. The results (Fig. 7AGo) were shown as the fold activation of treated over control. SERMs such as tamoxifen and raloxifene are partial antagonist in BMP-2 promoter via ER{alpha}, but not ERß. The partial antagonist activity of SERMs through ER{alpha} in BMP-2 promoter was completely abolished by coexpression of ERß. These results are in correspondence to the BMP-2 mRNA levels detected in mouse bone marrow MSCs, which express both ER{alpha} and ERß, as was reported previously (38), and is shown here when bone marrow MSCs were treated with tamoxifen or raloxifene and analyzed by RT-PCR (Fig. 2Go). ERß modulated the activity of E2 through ER{alpha} in classical ERE (41), but not in BMP-2 promoter (Fig. 7AGo). Genistein stimulates BMP-2 promoter activity via ERß, but not ER{alpha}. The mutation of ERE from BMP-2 promoter abolished the stimulation of SERMs and genistein on BMP-2 promoter activity (Fig. 7BGo), demonstrating that BMP-2 ERE is the binding site for the stimulation of BMP-2 promoter by SERMs via ER{alpha} and genistein via ERß.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 7. The Effects of E2, SERMs, and Genistein on Mouse BMP-2 Promoter Activity via ER{alpha} and/or ERß

A, Five micrograms of BMP-2 promoter-Luciferase vectors were transiently transfected into C3H10T1/2 cells with 2 µg of hER{alpha} and/or hERß expression vectors as described in Fig. 3Go. Note activation of BMP-2 promoter by SERMs only when transfected with ER{alpha} alone. B, The mutated ERE BMP-2 full-length promoter-luciferase vectors (5 µg) were transiently transfected into C3H10T1/2 cells with hER{alpha} or hERß expression vectors (2 µg). The cells were treated with 10 nM E2, 10 µM tamoxifen, 100 nM raloxifene, 100 nM ICI, or 100 nM genistein. Luciferase activity was assayed 24 h later, and the results are shown as the fold induction of E2-treated over vehicle-treated cells. Note no effect with all administered agents. The error bars represent the SE of four experiments, each done in triplicate.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogen deficiency in postmenopausal women results in enhanced bone resorption that leads to osteoporosis. Long-term hormone replacement therapy at appropriate doses reduces the risk of hip fractures by 50–60% and the risk of vertebral deformations by up to 90% (42). Estrogens maintain bone mass in postmenopausal women by restoring the balance between osteoblastic bone formation and osteoclastic bone resorption (22). The protective effect of estrogens on bone in postmenopausal women is considered to be primarily mediated by the suppression of bone resorption. However, more recent studies in animal models as well as in humans demonstrate an impaired proliferation and osteogenic activity of marrow MSCs after estrogen depletion (38, 43). Others have demonstrated that prolonged exposure of postmenopausal women to relatively high doses of estrogens results in sustained stimulation of osteoblast function (29). In addition, systemically administered E2 enhances bone formation in animals (30, 31, 32, 33, 34). These findings clearly demonstrate that E2 promotes osteogenesis in addition to its effect on inhibiting osteoclastogenesis. That E2 physiologically affects osteogenesis is reflected in these studies both in the pathophysiology of postmenopausal osteoporosis as well as in the treatment of osteoporosis with E2. However, the precise mechanism of E2-induced bone formation is not clear (36).

One potential target gene of estrogen effect on bone formation is BMP-2. BMP-2 is a potent key inducer of osteogenic differentiation as is evident by its ability to induce de novo cartilage and bone in vivo (1, 2, 3) and osteogenic differentiation in several MSC types in vitro (3, 4, 5, 6, 7, 8, 9, 10). BMPs, including BMP-2, are crucial for osteogenic differentiation in osteoblasts (7, 15). Moreover, expression of BMP-2 in human bone marrow-derived MSCs obtained from a patient suffering from osteoporosis, was able to induce osteogenic differentiation in these cells and restore their osteogenic potential (11). Therefore, agents that locally up-regulate BMP-2 production may provide a novel approach to prevent and treat bone diseases such as osteoporosis (44, 45, 46). Even a small elevation in BMP-2 expression may exert a physiological response because BMP-2 expression is increased by a feedback autocrine effect (47). Indeed we have found that mouse bone marrow MSCs contain both ER{alpha} and ERß, and that E2 regulates mouse BMP-2 gene mRNA (38). Moreover, we have found that systemic administration of BMP-2 to mice suffering from osteoporosis after ovariectomy was able to restore bone mass to normal values (39). This effect on bone mass was correlated with increased proliferation and osteogenic activity of bone marrow MSCs (39). These findings strongly suggest that the regulation of BMP-2 gene transcription by ERs is a possible anabolic mechanism for estrogens in osteogenic tissues. The focus of our current study was to characterize the mechanism responsible for the regulation of BMP-2 expression by E2 in MSCs by determining if estrogens activate BMP-2 gene transcription and identifying the ER subtype that mediates the regulation of the BMP-2 gene.

Experiments performed on mouse bone marrow-derived MSCs treated with E2, tamoxifen, raloxifene, and ICI indicated that E2 interacts with ERs to directly enhance BMP-2 mRNA levels (Figs. 1Go and 2Go). To determine if E2 directly activates the BMP-2 promoter, we transiently transfected mouse BMP-2 promoter-luciferase reporter gene constructs into pluripotent mouse mesenchymal C3H10T1/2 cells. We chose to work with this cell line because it is more easily manipulated and transfected in vitro compared with primary bone marrow mouse MSCs. Moreover, as we have found (Fig. 3AGo) C3H10T1/2 do not express endogenous ERs and therefore the differential effect of ER{alpha} and ERß on the BMP-2 promoter can be easily studied by cotransfecting each of the ERs. E2 produced a dose-dependent increase in BMP-2 promoter activity in C3H10T1/2 cells cotransfected with either ER{alpha} or ERß. However, ER{alpha} was more potent than ERß. This result confirmed the RT-PCR results of BMP-2 mRNA expression in mouse bone marrow MSCs and indicates that estrogens increase BMP-2 mRNA by a transcriptional mechanism. Interestingly, raloxifen and tamoxifen had weakly activated BMP-2 promoter in C3H10T1/2 cells when ER{alpha} alone was expressed (Fig. 7Go). However, this mild effect was abolished in C3H10t1/2 cells when both ERs were expressed. This result also corresponds to the results obtained with marrow-derived MSCs where SERMs were unable to elicit BMP-2 mRNA expression, but where both ERs are expressed (38).

The mouse BMP-2 promoter (-2712 to +165) contains several consensus transcription response elements including Sp1 and AP-1 sites. A nonpalindromic sequence located at -415 to -402 (5'-GGGCCAnnnTGACCC-3') has a 3-bp variation from the classical vitellogenin A2 ERE (5'-AGGTCAnnnTGACCT-3') over a 15-bp sequence. However, over the core 13-bp consensus ERE sequence (5'-GGCCAnnnTGACC-3'), only 1 bp is altered (48). By comparing the activity of different deletions of the mouse BMP-2 promoter and a construct with a mutation in the ERE-like sequence, we mapped the site of regulation by ER{alpha} and ERß to this variant ERE binding site (Fig. 5Go). EMSA has shown both ER{alpha} and ERß to bind to the variant ERE sequence (Fig. 6Go). ERs can also activate gene transcription by interacting with alternative DNA elements, such as Sp1 and AP-1 in a ligand-, cell-, and ER subtype-dependent manner (26, 49, 50, 51, 52, 53). Our studies demonstrate that the AP-1 or Sp1 sites are not required for estrogen regulation of the BMP-2 promoter (Figs. 5Go and 6Go). We cannot exclude the possible interaction between the variant ERE and SP1 site in the BMP-2 promoter by E2; however, it is not essential for the activation of the promoteras was reported for c-myc and Cathepsin D (54, 55). It is possible, however, that factors bound to these elements may interact with ERs bound to the BMP-ERE to alter the magnitude of activation. Estrogens also activate the vascular endothelial growth factor promoter via an imperfect ERE, rather than the AP-1 site in the promoter (56). SERMs such as tamoxifen and raloxifene are therapeutic agents for several indications including the treatment and/or prevention of breast cancer and osteoporosis (26, 57, 58, 59, 60). Recently, raloxifene was approved for prevention and treatment of osteoporosis (61). Raloxifene is less potent than steroidal estrogens at maintaining bone mineral density (58). Although it is assumed that raloxifene increases BMD by inhibiting bone resorption, its precise mechanism of action in the bone in unknown. Our results showed that SERMs such as tamoxifen and raloxifene are weak activators of the mouse BMP-2 promoter via ER{alpha}, but not ERß. These SERMs have similar effects on the stimulation of human BMP-4 promoter activity (44). Based on these studies, it is conceivable that SERMs may increase BMD by enhancing the production of BMPs.

Phytoestrogens, such as genistein, exhibit some preference for ERß vs. ER{alpha} (28). In fact, genistein reduces both trabecular and compact bone loss after ovariectomy in rats (62). Furthermore, soy isoflavones attenuate bone loss from the spine in perimenopausal and postmenopausal women (63, 64). Our study demonstrates that genistein triggers transcriptional activation of the mouse BMP-2 gene with ERß, but not with ER{alpha}, suggesting a possible mechanism whereby isoflavones may attenuate bone loss.

Finally, we conclude that a greater understanding of the regulation of BMP-2 production by osteoblasts may lead to the discovery of agents that can be used to control its expression and thus leading to increased bone formation (19). Our findings may provide a potential partial mechanistic explanation for the role of estrogens in the pathophysiology of osteoporosis and the anabolic effects of high doses of estrogens on the skeleton. A greater understanding of the mechanisms whereby estrogenic compounds regulate BMP-2 transcription in MSCs may pave the way for the development of new modalities that may enhance BMP-2 production in osteogenic tissues to prevent and treat bone diseases.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chemical Reagents
All materials were purchased from Sigma (St. Louis, MO) unless otherwise stated. DMEM, penicillin-streptomycin, and L-glutamine were purchased from Biological Industries (Beit Haemek, Israel). ICI was obtained from AstraZeneca Pharmaceuticals (Bedfordshire, UK). All experiments conducted with animals described in this paper were conducted according to standards of humane animal care under the guidelines of the animal facility of Hadassah Medical Center and the Hebrew University in Jerusalem.

Plasmid Construction
Expression vectors for human ER{alpha} and human ERß (485) were previously described (65). Full-length (-2712 to +165) and 5'-end deletions of the mouse BMP-2 promoter (-838 to +165, and -150 to +165) were cloned upstream of the luciferase cDNA in the pGL3 vector (Promega Corp., Madison, WI) as previously described (18). Mutation of the mouse BMP-2 variant ERE ({Delta}variant ERE: 5'-GAACCActcTACCTC-3') in the full-length promoter, plasmid was accomplished using the QuikChange site-directed mutatgenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s protocol. The promoter fragments were subcloned as PCR products into the pGL3-basic vector (-448 to +23 and -400 to +23). BMP-ERE-tk-luciferase vectors (BMP-ERE was placed upstream of the heterologous minimal thymidine kinase promoter) and ERE-tk-luciferase vectors (one copy of the ERE from the frog vitellogenin A2 gene) were constructed as previously described (27).

Animal and Cell Culture
Two-month-old Swiss-Webster female mice (ICR) were OVX in accordance with mandated standards of humane care, and the animals were maintained in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Five months post surgery, bone marrow was isolated from femurs and tibias, and the MSCs were cultured as described previously (38, 66). The bone marrow cells were maintained in DMEM (phenol red free, 1.0 g/liter glucose, Biological Industries) with 15% fetal bovine serum [FBS; charcoal stripped (CS), heat inactivated], 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine. At d 4, the cultures were supplemented with 50 µg/ml ascorbic acid, 10 mM ß-glycerophosphate, and 10 nM dexamethasone, to induce MSCs osteogenic differentiation (38). These supplements are required for the establishment of MSC cultures and the removal of hematopoietic cells. From d 10, the cells were cultured in DMEM with 2% charcoal-stripped FBS without osteogenic supplements (50 µg/ml ascorbic acid, 10 mM ß-glycerophosphate, and 10 nM dexamethasone), to reduce the possible intervention of serum factors and osteogenic supplements with the effect of E2 treatment. At d 11, the cultures were treated with E2 (Sigma), ICI (AstraZeneca Pharmaceuticals), tamoxifen (Sigma), or raloxifene for 24 h. RNA was then isolated on day 12. To block protein synthesis in mouse MSCs, 5.0 µM cycloheximide was added to cultures with fresh DMEM plus 2% CS-FBS for 45 min before 100 nM E2 treatment, and RNA was isolated 4 h after E2 treatment. Mouse C3H10T1/2 cells were maintained cultured with DMEM (Sigma and Biological Industries) containing 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM glutamine.

Cell Transfection and Luciferase Assays
Transient transfections were performed as previously described (27). Briefly, C3H10T1/2 cells were grown in culture in 100-mm dishes until they reached confluence. The cells were harvested after trypsinization, resuspended in medium, counted, centrifuged at 800 rpm for 5 min, and 1.5 x 107 cells were resuspended in 0.5 ml PBS containing 0.1% glucose. The cell suspension was mixed with 5 µg luciferase reporter plasmids and 2 µg human ER (hER){alpha} or hERß expression vectors. The cells were transferred to a cuvette and electroporated using a Bio-Rad Laboratories, Inc. gene pulser. After electroporation, the cells were suspended in DMEM (phenol red free) containing 2% CS-FBS and seeded at 1 ml per well into 12-well multiplates. The cells were treated with drugsor ethanol (vehicle) for 24 h, and luciferase activity was assayed using a kit from Promega Corp. with a luminometer (TD-20/20, Turner Designs, Sunnyvale, CA). The efficiency of transfection was monitored by cotransfection of 0.5 µg of pNGVL1-nt-ßGal plasmids (National Gene Vector Laboratory at the University of Michigan, Ann Arbor, MI), and ß-galactosidase activity was measured using the Galacto-Light Chemiluminescent Reporter Assay System Kit (Tropix of PE Biosystems, Foster City, CA). The transfection results were reported as the fold induction of relative light units for drug over vehicle treated cells after normalization to ß- galactosidase expression. Error bars represent the standard error for five experiments, with each data point done in triplicate.

EMSA
The direct interaction between ER{alpha} or ERß protein and the ERE of BMP-2 promoter was performed by EMSA as previously described (27). The 32P-labeled DNA probe contained ERE of BMP-2 promoter (top strand: CAATGCGGGGCCACTCTGACCCAGGAGTG). The binding reaction was initiated by adding ER{alpha} or ERß that had been prepared with an in vitro transcription/translation kit (Promega Corp.).

RNA Isolation, RT-PCR, and Real-Time RT-PCR
RNA was isolated by using TRIzol Reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer’s protocol. RT-PCR was performed as described previously (38). Mouse BMP-2 (505 bp; Ref.38), internal control RPL19 (190 bp; Ref.67), and c-myc (550 bp; Ref.68) primers were described previously. The PCR conditions used for mouse BMP-2 RT-PCR were 30 cycles of 94 C for 1 min, 55 C for 1 min, and 72 for 2 min in an MJ MiniCycler (MJ Research, Inc., Waltham, MA). RT-PCR products of mouse BMP-2 were cloned into the pGEM-T Easy vector (Promega Corp.), and the pGEM-T-mouse BMP-2 vectors were sequenced by a T7 sequence sequencing kit (United States Biochemical Corp., Cleveland, OH) according to the manufacturer’s protocols. DNA sequence analysis confirmed that mouse BMP-2 was amplified.

Real-time PCR was performed by using a Roche LightCycler according to the manufacturer’s protocol (Roche Molecular Biochemicals, Indianapolis, IN). After reverse transcription reaction (20 µl) using 2 µg of total RNA, real-time PCR was carried out in a 20-µl final volume using the LightCycler-FastStart DNA Master SYBR Green I kit (Roche). The reaction mix contained 1x LightCycler-FastStart Master SYBR Green I, 0.5 µM of each primer, 4 mM MgCl2, and 2 µl cDNA from (20 µl of) reverse transcription reaction. The conditions of the real-time PCR were as follows: 95 C 10 min for one cycle to activate the modified FastStart Taq DNA polymerase, followed by 45 cycles at 95 C for 15 sec, 60 C to 55 C touchdown at steps of 0.5 C for 10 sec, and 72 C for 25 sec. Fluorescence was measured at 82 C for 5 sec. To quantitate the copy number of the mouse BMP-2 mRNA in MSCs, pGEM-T-mouse BMP-2 plasmids (102–108 copies) were used in standard curve.

Statistical Analysis
All experiments were performed three to five times independently. Data are presented as the mean values ± the SEM. The RT-PCR and real-time RT-PCR were performed three times in independent experiments using total RNA that was isolated from MSCs derived from three to six animals each time. Quantitative data were analyzed using either the nonparameteric Mann-Whitney test or the ANOVA test.


    ACKNOWLEDGMENTS
 
We thank Drs. Yoel Sadovsky and Geri Gross for valuable advice about plasmid constructs, and Drs. Julia Billiard, Boris Cheskis, and Heather Harris for comments on the manuscript.


    FOOTNOTES
 
This study was supported by a grant from the Women’s Health Research Institute of Wyeth Pharmaceuticals, a division of American Home Products, USA.

Abbreviations: BMP, Bone morphogenetic protein; CS, charcoal-stripped; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen-responsive element; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hER, human ER; ICI, ICI-182,780; MSCs, mesenchymal stem cells; OVX, ovariectomized; SERM, selective ER modulator.

Received for publication June 7, 2002. Accepted for publication September 9, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz R, Hewick R, Wang EA 1988 Novel regulators of bone formation: molecular clones and activities. Science 242:1528–1534[Abstract/Free Full Text]
  2. Wang EA, Rosen V, D’Alessandro JS, Bandy M, Cordes P, Harada T, Israel DI, Hewick RM, Kerns KM, Lapan P, Luxenberg DP, McQuaid D, Moutsatsos IK, Nove J, Wozney JM 1990 Recombinant human bone morphogenetic protein induces bone formation. Proc Natl Acad Sci USA 87:2220–2224[Abstract/Free Full Text]
  3. Gazit D, Turgeman G, Kelley P, Wang E, Jalenak M, Zilberman Y, Moutsatsos I 1999 Engineered pluripotent mesenchymal cells integrate and differentiate in regenerating bone: a novel cell mediated gene therapy. J Gene Med 1:121–133[CrossRef][Medline]
  4. Katagiri T, Yamaguchi A, Ikeda T, Yoshiki S, Wozney JM, Rosen V, Wang EA, Tanaka H, Omura S, Suda T 1990 The non-osteogenic mouse pluripotent cell line C3H10T1/2 is induced to differentiate into osteoblastic cells by recombinant human bone morphogenetic protein-2. Biochem Biophys Res Commun 172:295–299[CrossRef][Medline]
  5. Theis RS, Bauduy M, Ashton BA, Kurtzberg L, Wozney JM, Rosen V 1992 Recombinant bone morphogenetic protein-2 induces osteoblastic differentiation in W-20–17 stromal cells. Endocrinology 130:1318–1324[Abstract/Free Full Text]
  6. Wang EA, Israel DI, Kelly S, Luxenberg DP 1993 human bone morphogenetic protein-2 causes commitment and differentiation in C3H10T1/2 and 3T3 cells. Growth Factors 9:57–71[Medline]
  7. Yamaguchi A, Ishizuya T, Kintou N, Wada Y, Ketagiri T, Wozney JM, Rosen V, Yoshiki S 1996 Effects of BMP-2, BMP-4, and BMP-6 on osteoblastic differentiation of bone marrow derived stromal cell lines, ST2 and MC3T3-G2/PA6. Biochem Biophys Res Commun 220:366–371[CrossRef][Medline]
  8. Feng JQ, Chen D, Ghosh-Choudhury N, Esparza J, Mundy GR, Harris SE 1997 Bone morphogenetic protein 2 transcripts in rapidly developing deer antler tissue contain an extended 5' non-coding region arising from a distal promoter. Biochim Biophys Acta 1350:47–52[Medline]
  9. Hanada K, Dennis JE, Caplan AJ 1997 Stimulatory effects of basic fibroblast growth factor and bone morphogenetic protein-2 on osteogenic differentiation of rat bone marrow derived mesenchymal stem cells. J Bone Miner Res 12:1606–1614[CrossRef][Medline]
  10. Moutsatsos IK, Turgeman G, Zhou S, Kurkalli BG, Pelled G, Tzur L, Kelley P, Stumm N, Mi S, Mueller R, Zilberman Y, Gazit D 2001 Exogenously regulated stem cell-mediated gene therapy for bone regeneration. Mol Ther 3:449–461[CrossRef][Medline]
  11. Turgeman G, Pittman D, Muller R, Kurkalli BG, Zhou S, Pelled G, Peyser A, Zilberman Y, Moutsatsos I, Gazit D 2001 Engineered human mesenchymal stem cells: a novel platform for skeletal cell mediated gene therapy. J Gene Med 3:240–251[CrossRef][Medline]
  12. Lyons KM, Pelton RW, Hogan BIM 1990 Organogenesis and pattern formation in the mouse: RNA distribution patterns suggest a role for bone morphogenetic protein-2A (BMP2A). Development 109:833–844[Abstract/Free Full Text]
  13. Hogan BLM 1996 Bone mophogenetic proteins in development. Curr Opin Genet Dev 6:432–438[CrossRef][Medline]
  14. Harris SE, Bonewald LF, Harris MA, Sabatini M, Dallas S, Feng JQ, Ghosh-Choudhury N, Wozney J, Mundy GR1994 Expression of transforming growth factor ß on bone nodule formation and expression of bone morphogentic protein 2, osteocalcin, osteopontin, alkaline phosphatase, and type I collagen mRNA in long-term cultures of fetal rat calvarial osteoblasts. J Bone Miner Res 9:389–394
  15. Xiao G, Gopalakrishnan R, Jiang D, Reith E, Benson MD, Franceschi RT 2002 Bone morphogenetic proteins, extracellular matrix, and mitogen-activated protein kinase signaling pathways are required for osteoblast-specific gene expression and differentiation in MC3T3-E1 cells. J Bone Miner Res 17:101–110[CrossRef][Medline]
  16. Huang W, Rudkin GH, Carlsen B, IshidaK, Ghasri P, Anvar B, Yamaguchi DT, Miller TA 2002 Overexpression of BMP-2 modulates morphology, growth, and gene expression in osteoblastic cells. Exp Cell Res 274:226–234[CrossRef][Medline]
  17. Partridge K, Yang X, Clarke NM, Okubo Y, Bessho K, Sebald W, Howdle SM, Shakesheff KM, Oreffo RO 2002 Adenoviral BMP-2 gene transfer in mesenchymal stem cells: in vitro and in vivo bone formation on biodegradable polymer scaffolds. Biochem Biophys Res Commun 292:144–152[CrossRef][Medline]
  18. Harris, SE, Mundy, GM, Ghosh-Choudhury N, Feng JQ 2000 Methods and compositions for identifying osteogenic agents. U.S. patent 6,083,690
  19. Helvering LM, Sharp RL, Ou X, Geiser AG 2000 Regulation of the promoters for the human bone morphogenetic protein 2 and 4 genes. Gene 256:123–138[CrossRef][Medline]
  20. Carson-Jurica MA, Schrader WT, O’Malley BW 1990 Steroid receptor family: structure and functions. Endocr Rev 11:201–220[Abstract/Free Full Text]
  21. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 58:851–857
  22. Turner RT, Riggs BL, Spelsberg TC 1994 Skeletal effects of estrogen. Endocr Rev 15:275–300[Abstract/Free Full Text]
  23. Eriksen EF, Colvard DS, Berg NJ, Graham ML, Mann KG, Spelsberg TC, Riggs BL 1988 Evidence of estrogen receptors in normal human osteoblast-like cells. Science 241:84–86[Abstract/Free Full Text]
  24. Ohashi T, Kusuhara S 1993 Immunoelectron microscopic detection of estrogen target cells in the bone marrow of estrogen-treated male Japanese quail. Bone Miner 20:31–39[Medline]
  25. Windahl SH, Norgard M, Kuiper GGJM, Gustafsson J-A, Andersson G 2000 Cellular distribution of estrogen receptor ß in neonatal rat bone. Bone 26:117–121[Medline]
  26. Paech K, Webb P, Kuiper GGJM, Nilsson S, Gustafsson J-A, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP-1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  27. An J, Ribeiro RJ, Webb P, Gustafsson J-A, Kushner PJ, Baxter JD, Leitman DC 1999 Estradiol repression of tumor necrosis factor-{alpha} transcription requires estrogen receptor activation function-2 and is enhanced by coactivators. Proc Natl Acad Sci USA 96:15161–15166[Abstract/Free Full Text]
  28. An J, Tzagarakis-Foster C, Scharschmidt TC, Lomri N, Leitman DC 2001 Estrogen receptor ß-selective transcriptional activity and recruitment of coregulators by phytoestrogens. J Biol Chem 276:17808–17814[Abstract/Free Full Text]
  29. Tobias JH, Compston JE 1999 Does estrogen stimulate osteoblast function in postmenopausal women? Bone 24:121–124[Medline]
  30. Bain SD, Bailey MC, Celino DL, Lantry MM, Edwards MW 1993 High-dose estrogen inhibits bone resorption and stimulates bone formation in the ovariectomized mouse. J Bone Miner Res 8:435–442[Medline]
  31. Chow J, Lean JM, Chambers TJ 1992 17ß-estradiol stimulates cancellous bone formation in female rats. Endocrinology 130:3025–3032[Abstract/Free Full Text]
  32. Chow J, Tobias JH, Colston KW, Chambers TJ 1992 Estrogen maintains trabecular bone volume in rats not only by suppression of bone resorption but also by stimulation of bone formation. J Clin Invest 89:74–78
  33. Takano-Yamamoto T, Rodan GA 1990 Direct effects of 17ß-estradiol on trabecular bone in ovariectomized rats. Proc Natl Acad Sci USA 87:2172–2176[Abstract/Free Full Text]
  34. Samuels A, Perry MJ, Tobias JH 1999 High-dose estrogen induces de novo medullary bone formation in female mice. J Bone Miner Res 14:178–186[CrossRef][Medline]
  35. Zhou H, Shen V, Dempster DW, Lindsay R 2001 Continuous parathyroid hormone and estrogen administration increases vertebral cancellous bone volume and cortical width in the estrogen-deficient rat. J Bone Miner Res 16:1300–1307[CrossRef][Medline]
  36. Turner RT 1999 Mice, estrogen, and postmenopausal osteoporosis. J Bone Miner Res 14:187–191[CrossRef][Medline]
  37. Zhou S, Zilberman Y, Wasserman K, Bain S, Sadovsky Y, Gazit D 2001 Estrogen modulates Estrogen receptor {alpha} and ß expression, osteogenic activity and apoptosis in marrow stromal cells (MSCs) of osteoporotic mice. J Cell Biochem 81(S36):144–155
  38. Mathieu E, Merregaert J 1994 Characterization of the stromal osteogenic cell line MN7: mRNA steady-state level of selected osteogenic markers depends on cell density and is influenced by 17 ß-estradiol. J Bone Miner Res 9:183–192[Medline]
  39. Turgeman G, Zilberman Y, Zhou S, Kelly P, Moutsatsos IK, Kharode YP, Borella LE, Bex FJ, Komm BS, Bodine PVN, Gazit D 2002 Systemically administered rhBMP-2 promotes MSC activity and reverses bone and cartilage loss in osteopenic mice. J Cell Biochem 86:461–474[CrossRef][Medline]
  40. Hauguel de Mouzon S, Kahn CR 1991 Insulin-like growth factor-mediated phosphorylation and protooncogene induction in Madin-Darby canine kidney cells. Mol Endocrinol 5:51–60[Abstract/Free Full Text]
  41. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity is a key regulator of the cellular response to estrogen and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  42. Notelovitz M 1997 Estrogen therapy and osteoporosis: principles & practice. Am J Med Sci 313:2–12[CrossRef][Medline]
  43. Rodriguez JP, Garat S, Gajardo H, Pino AM, Seitz G 1999 Abnormal osteogenesis in osteoporotic patients is reflected by altered mesenchymal stem cells dynamics. J Cell Biochem 75:414–423[CrossRef][Medline]
  44. van den Wijngaard A, Mulder WR, Dijkema R, Boersma CJ, Mosselman S, van Zoelen EJ, Olijve W 2000 Antiestrogens specifically up-regulate bone morphogenetic protein-4 promoter activity in human osteoblastic cells. Mol Endocrinol 14:623–633[Abstract/Free Full Text]
  45. Wang EA 1993 Bone morphogenetic proteins (BMPs): therapeutic potential in healing bone defects. Trends Biotechnol 11:379–383[CrossRef][Medline]
  46. Wozney JM, Rosen V 1998 Bone morphogenetic protein and bone morphogenetic protein gene family in bone formation and repair. Clin Orthop 346:26–37
  47. Erickson DM, Harris SE, Dean DD, Harris MA, Wozney JM, Boyan BD, Schwartz Z 1997 Recombinant bone Morphogenetic protein (BMP)-2 regulates costochondral growth plate chondrocytes and induces expression of BMP-2 and BMP-4 in a cell maturation-dependent manner. J Orthop Res 15:371–380[CrossRef][Medline]
  48. Driscol MD, Sathya G, Muyan M, Klinge CM, Hilf R, Bambara RA 1998 Sequence requirements for estrogen receptor binding to estrogen response elements. J Biol Chem 273:29321–29330[Abstract/Free Full Text]
  49. Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson J-A, Safe S 2000 Ligand-, cell-, and estrogen receptor subtype ({alpha}/ß)-dependent activation at GC-rich (Sp1) promoter elements. J Biol Chem 275:5379–5387[Abstract/Free Full Text]
  50. Webb P, Lopez G, Uht R, Kushner P 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract/Free Full Text]
  51. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P 2000 Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74:311–317[CrossRef][Medline]
  52. Kushner PJ, Agard D, Feng WJ, Lopez G, Schiau A, Uht R, Webb P, Greene G 2000 Oestrogen receptor function at classical and alternative response elements. Novartis Found Symp 230:20–26; discussion 27–40[Medline]
  53. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S, Kushner PJ 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol 13:1672–1685[Abstract/Free Full Text]
  54. Dubik D, Shiu RP 1992 Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7:1587–1594[Medline]
  55. Krishnan V, Wang X, Safe S 1994 Estrogen receptor-Sp1 complexes mediate estrogen-induced cathepsin D gene expression in MCF-7 human breast cancer cells. J Biol Chem 269:15912–15917[Abstract/Free Full Text]
  56. Mueller MD, Vigne J-L, Minchenko A, Lebovic DI, Leitman DC, Taylor RN 2000 Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors {alpha} and ß. Proc Natl Acad Sci USA 97:10972–10977[Abstract/Free Full Text]
  57. Black LJ, Sato M, Rowley ER, Magee DE, Bekele A, Williams DC, Cullinan GJ, Bendele R, Kauffman RF, Bensch WR 1994 raloxifene (LY139481 HCI) prevents bone loss and reduces serum cholesterol without causing uterine hypertrophy in ovariectomized rats. J Clin Invest 93:63–69
  58. Sato M, Rippy MK, Bryant HU 1996 Raloxifene, tamoxifen, nafoxidine, or estrogen effects on reproductive and nonreproductive tissues in ovariectomized rats. FASEB J 10:905–912[Abstract]
  59. Yang NN, Bryant HU, Hardikar S, Sato M, Galvin RJ, Glasebrook AL, Termine JD 1996 Estrogen and raloxifene stimulate transforming growth factor-ß 3 gene expression in rat bone: a potential mechanism for estrogen- or raloxifene-mediated bone maintenance. Endocrinology 137:2075–2084[Abstract]
  60. Yang NN, Venugopalan M, Hardikar S, Glasebrook A 1996 Identification of an estrogen response element activated by metabolites of 17ß-estradiol and raloxifene. Science 273:1222–1225[Abstract]
  61. Clemett D, Spencer CM 2000 Raloxifene: a review of its use in postmenopausal osteoporosis. Drugs. 60:379–411
  62. Fanti P, Monier-Faugere MC, Geng Z, Schmidt J, Morris PE, Cohen D, Malluche HH 1996 The phytoestrogen genistein reduces bone loss in short-term ovariectomized rats. Osteoporos Int 8: 274–281
  63. Alekel DL, Germain AS, Peterson CT, Hanson KB, Stewart JW, Toda T 2000 Isoflavone-rich soy protein isolate attenuates bone loss in the lumbar spine of perimenopausal women. Am J Clin Nutr 72: 844–852
  64. Messina M, Messina V 2002 Soyfoods, soybean isoflavones, and bone health: a brief overview. J Ren Nutr 10:63–68
  65. Webb, P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang SM, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR, Kushner PJ 1998 Estrogen receptor activation function1 works by binding p160 coactivator proteins. Mol Endocrinol 12:1605–1618[Abstract/Free Full Text]
  66. Gazit D, Zilberman Y, Turgeman G, Zhou S, Kahn A 1999 Recombinant TGF-ß1 stimulates bone marrow osteoprogenitor cell activity and bone matrix synthesis in osteopenic, old male mice. J Cell Biochem 73:379–389[CrossRef][Medline]
  67. Orly J, Rei Z, Greenberg NM, Richards JS 1994 Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids. Endocrinology 134:2336–2346[Abstract/Free Full Text]
  68. Guswami PC, Albee LD, Spitz DR, Ridnour LA 1997 A polymerase chain reaction assay for simultaneous detection and quantitation of proto-oncogene and GAPD mRNA in different cell growth rates. Cell Prolif 30:271–282[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   ERα  |  ERβ
Ligands:   17β-Estradiol  |  Raloxifene



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
R. H. Straub
The Complex Role of Estrogens in Inflammation
Endocr. Rev., August 1, 2007; 28(5): 521 - 574.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-L. Su, C.-Y. Yang, M. Zhao, M.-L. Kuo, and M.-L. Yen
Forkhead Proteins Are Critical for Bone Morphogenetic Protein-2 Regulation and Anti-tumor Activity of Resveratrol
J. Biol. Chem., July 6, 2007; 282(27): 19385 - 19398.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. L. Cho, S. H. Javid, A. M. Carothers, M. Redston, and M. M. Bertagnolli
Estrogen Receptors {alpha} and {beta} Are Inhibitory Modifiers of Apc-Dependent Tumorigenesis in the Proximal Colon of Min/+ Mice
Cancer Res., March 1, 2007; 67(5): 2366 - 2372.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Fukui, Y. Ikeda, T. Ohnuki, A. Hikita, S. Tanaka, S. Yamane, R. Suzuki, L. J. Sandell, and T. Ochi
Pro-inflammatory Cytokine Tumor Necrosis Factor-{alpha} Induces Bone Morphogenetic Protein-2 in Chondrocytes via mRNA Stabilization and Transcriptional Up-regulation
J. Biol. Chem., September 15, 2006; 281(37): 27229 - 27241.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
I. Shur, R. Solomon, and D. Benayahu
Dynamic Interactions of Chromatin-Related Mesenchymal Modulator, a Chromodomain Helicase-DNA-Binding Protein, with Promoters in Osteoprogenitors.
Stem Cells, May 1, 2006; 24(5): 1288 - 1293.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. Morris, J. Thorpe, L. Ambrosio, and M. Santin
The Soybean Isoflavone Genistein Induces Differentiation of MG63 Human Osteosarcoma Osteoblasts
J. Nutr., May 1, 2006; 136(5): 1166 - 1170.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
G. R Mundy
Nutritional modulators of bone remodeling during aging
Am. J. Clinical Nutrition, February 1, 2006; 83(2): 427S - 430S.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. T. Fritz, D. Liu, J. Xu, S. Jiang, and M. B. Rogers
Conservation of Bmp2 Post-transcriptional Regulatory Mechanisms
J. Biol. Chem., November 19, 2004; 279(47): 48950 - 48958.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. L. Abrams, J. Xu, C. Nativelle-Serpentini, S. Dabirshahsahebi, and M. B. Rogers
An Evolutionary and Molecular Analysis of Bmp2 Expression
J. Biol. Chem., April 16, 2004; 279(16): 15916 - 15928.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, S.
Right arrow Articles by Gazit, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, S.
Right arrow Articles by Gazit, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals