help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0107
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/1/79    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nygård, M.
Right arrow Articles by Bondesson, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nygård, M.
Right arrow Articles by Bondesson, M.
Molecular Endocrinology 17 (1): 79-92
Copyright © 2003 by The Endocrine Society

Hormone-Dependent Repression of the E2F-1 Gene by Thyroid Hormone Receptors

Maria Nygård, Gunilla M. Wahlström, Maria V. Gustafsson, Yasuhito M. Tokumoto and Maria Bondesson

Department of Cell and Molecular Biology (M.N., G.M.W., M.V.G., M.B.), Medical Nobel Institute, Karolinska Institutet, S-171 77 Stockholm, Sweden; and Medical Research Council Laboratory for Molecular Cell Biology and Cell Biology Unit (Y.M.T.), University College London, London WC1E 6BT, United Kingdom

Address all correspondence and requests for reprints to: Maria Bondesson, Karolinska Institutet, Department of Cell and Molecular Biology (CMB), Box 285 S-171 77, Stockholm, Sweden. E-mail: maria.bondesson{at}cmb.ki.se.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Thyroid hormone induces differentiation of many different tissues in mammals, birds, and amphibians. The different tissues all differentiate from proliferating precursor cells, and the normal cell cycle is suspended while cells undergo differentiation. We have investigated how thyroid hormone affects the expression of the E2F-1 protein, a key transcription factor that controls G1- to S-phase transition. We show that during thyroid hormone-induced differentiation of embryonic carcinoma cells and of oligodendrocyte precursor cells, the levels of E2F-1 mRNA and E2F-1 protein decrease. This is caused by the thyroid hormone receptor (TR) regulating the transcription of the E2F-1 gene. The TR binds directly to a negative thyroid hormone response element, called the Z-element, in the E2F-1 promoter. When bound, the TR activates transcription in the absence of ligand but represses transcription in the presence of ligand. In addition, liganded TR represses transcription of the S-phase-specific DNA polymerase {alpha}, thymidine kinase, and dihydropholate reductase genes. These results suggest that thyroid hormone-induced withdrawal from the cell cycle takes place through the repression of S-phase genes. We suggest that this is an initial and crucial step in thyroid hormone-induced differentiation of precursor cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THYROID HORMONE DEFICIENCY during fetal development results in mental retardation and disturbed motor performance, suggesting a role for thyroid hormone in the normal development of the central nervous system (CNS) (reviewed in Ref.1). The effects of thyroid hormone deficiency are thought to result from direct regulation of specific target genes by thyroid hormone receptors (TRs). TRs bind to specific response elements (TREs) within the promoters of target genes and, in this way, activate or repress transcription. The TREs in promoters that are activated by T3 are known as positive TREs, whereas those in promoters that are repressed by T3 are known as negative TREs. When TR binds to a positive TRE in the absence of hormone, it silences basal transcription by binding to specific corepressors, such as the nuclear receptor corepressor (N-CoR) or the silencing mediator for retinoid and TRs (SMRT) (2, 3, 4). These corepressors in turn form complexes with histone deacetylases (HDACs), which remodel chromatin into a closed, transcriptionally inactive conformation (5, 6, 7, 8, 9). In contrast, when T3 is present, the corepressors are released and TR activates transcription via associated coactivators. These coactivators possess or recruit histone acetylransferases (HATs). Examples of coactivators with intrinsic HAT activity are p300/cAMP response element binding protein-binding protein (CPB), steroid receptor coactivator 1, and p300/CPB-associated factor, whereas coactivators that are associated with separate HATs include transcriptional intermediary factor 2 (TIF-2), coactivator for nuclear hormone receptor (ACTR), TR activator molecule (TRAM), and nuclear receptor-interacting factor 3 (NRIF3) (10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20).

Genes that contain positive TREs and are activated by TR in the presence of T3 are, for example, the myelin basic protein, malic enzyme, myoD, and stromelysin-3 genes (ST3) (21, 22, 23, 24). In contrast, a number of genes are repressed in the presence of T3. These include the genes for TSH{alpha} and ß, TRH, ßamyloid precursor protein, rat sodium potassium ATPase {alpha}3 and c-myc (reviewed in Ref.25 ; Refs.26, 27, 28, 29, 30). The mechanism by which TR regulates transcription on negative TREs is less well understood, although TR activates transcription via negative TREs in the absence of T3 and represses transcription in the presence of T3. It has been reported that T3-independent activation only takes place when TR can associate with corepressors (31, 32). It has also been proposed that T3 association recruits HDAC2 to TR, a process that would mediate ligand-dependent repression on negative TREs (33). Recently, it was shown that the retinoic X receptor (RXR) acts as a coregulator for T3-induced repression of the TSH and TRH promoters (34). More genes are likely to be negatively regulated by thyroid hormone than positively regulated, and it is thus important to understand the mechanism behind hormone-induced repression of transcription (35).

Differentiation of oligodendrocyte precursor cells (OPCs) of the optic nerve is controlled both in vivo and in vitro by T3 (36, 37). In this case, T3 functions as an extrinsic signal that, in combination with an intrinsic factor, stops cell division and initiates differentiation. Thyroid hormone also induces the differentiation of other progenitor cells to become, for example, erythrocytes, B-lymphocytes, bone cells and skeletal muscle cells (Refs.23, 38, 39 ; and Ref.40 and references therein). Furthermore, thyroid hormone controls the metamorphosis of tadpoles to frogs (reviewed in Ref.41). Finally, thyroid hormone induces differentiation of murine embryonic carcinoma P19 cells. When treated with a low concentration (10-8 M) of T3, P19 cells develop into spontaneously beating cardiac muscle cells (42). Treatment with retinoic acid (RA) causes P19 cells to differentiate into neurons, and this system has been extensively studied. The neurons express neuronal markers, such as neurofilament proteins and the tetanus toxin receptor (43, 44).

Differentiation is often accompanied, or even proceeded, by a decrease in the level of cell proliferation. The cell cycle is regulated by a complex system of kinases and transcription factors, which are substrates for the kinases. This system is subject to a very precise control. One of the most important transcription factor families in this system is the E2F-family, factors of which drive transcription of S-phase-specific genes. Six different E2F-factors have been cloned, five of which, E2F-1 to -5, activate transcription. The sixth member, E2F-6, lacks an activation domain and instead represses transcription (45, 46). E2F DNA-binding sites are found in promoters of genes that are involved in DNA synthesis, such as DNA polymerase {alpha}, thymidine kinase (TK), dihydropholate reductase (DHFR) and HsOrc1 genes; and in genes that are regulators of the cell cycle, such as cyclin A, cyclin E, and cdc2 genes (reviewed in Ref.47). E2F-1 activates transcription as a heterodimer with one of a family of proteins known as dimerization partner-proteins. In the G1-phase, E2F-1 becomes associated to the retinoblastoma protein (RB), which causes the E2F-sites to function as repressor elements. The RB-mediated repression depends on the association of E2F-1 with HDACs (48, 49, 50, 51, 52).

We have shown that treatment of P19 embryonic carcinoma cells with T3 causes cells to differentiate into neurons (Nygård, M., M. V. Gustafsson, and M. Bondesson, manuscript in preparation). The neuronal development is proceeded by a decrease in cell proliferation. We here show that the levels of E2F-1 mRNA decrease during T3-induced suppression of cell growth of embryonic P19 cells. We also show that the E2F-1 mRNA levels rapidly decrease in T3-treated OPCs. The decrease in expression of E2F-1 results from a direct TR-mediated repression in transcription of the E2F-1 gene. We have identified a negative TRE located in the E2F-1 promoter, the sequence of which resembles those of negative TREs found in the TSH promoters. This element is activated by TR in the absence of T3, and is repressed by TR in the presence of T3. Liganded TR also represses the expression of the DNA polymerase {alpha}, DHFR, and TK genes, which are transcriptionally regulated by E2F-1 during the S-phase. T3 down-regulates E2F-1 expression in differentiating OPCs and P19 cells, and so we suggest that thyroid hormone-dependent induction of differentiation proceeds in general by the arrest of the cell cycle by a mechanism in which TR represses E2F-1 expression and, consequently, repress genes that promote the entry to the S-phase.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
T3 Treatment of Embryonic Cells and OPCs Reduces the Expression of E2F-1
T3 rapidly suppresses proliferation of P19 cells, and the cells then differentiate to neurons (Nygård, M., M. V. Gustafsson, and M. Bondesson, manuscript in preparation). The decrease in the number of cells growing in the presence of T3 was concentration dependent from 1–100 nM of T3 (Fig. 1AGo). No further decrease was seen at 1 µM to 10 µM of T3 (results not shown). P19 cells have a high proliferation rate and divide approximately every 14 h (53). The G1 phase of the cell cycle is short, and approximately 50% of the cells are to be found in the G2 phase (Ref.54 and results not shown). When treated with T3 for 24 h or more, the proportion of cells in the G1/G0- and S-phase increased, whereas the proportion of cells in the G2-phase decreased (Fig. 1BGo). Thus, T3 treatment slows down the proliferation rate of P19 cells by arresting cells in the G1- and S-phase. The T3-induced G1- and S-phase arrest explains in part why the number of cells that was grown in the presence of T3 is lower than the number of cells grown in the absence of T3.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 1. T3-Induced Suppression of Cell Growth and E2F-1 Expression

A, T3-induced growth suppression of P19 cells is concentration dependent. Approximately 50,000 P19 cells were plated out on gelatin-coated cell culture dishes and grown in DMEM supplemented with 5% FCS, in the presence of indicated concentrations of T3. The numbers of cells were counted at 48 h post T3 addition. The total number of cells per 3-cm culture dish is shown, with SD indicated (n = 3). The asterisks indicate that the difference between T3-treated cells and the untreated control is significant at a confidence level of P < 0.05 (*) or P < 0.01 (**) by Student’s t test. B, T3 treatment influences the proportion of cells in each cell cycle phase. P19 cells were treated with 1 µM T3 for 8, 15, 24, 48, and 72 h and then the distribution of the cells in the different cell cycle phases were analyzed using a FACS. The percentage of cells in each cell cycle phase was calculated. The proportion of T3-treated cells relative to untreated cells for each time point and cell cycle phase is shown. SD values are shown (n = 4). The asterisks indicate that the difference of each bar from the 8-h samples is significant at a confidence level of P < 0.05 (*) or P < 0.01 (**) by Student’s t test. C, Expression of E2F-1 transcripts in untreated and in T3-treated P19 cells. Cells were plated out for 24 h before T3 treatment and then treated with 1 µM T3 for indicated time points (h), before harvest. Semiquantitative RT-PCR of total RNA, prepared from the harvested cells, amplified fragments of 344 bp of E2F-1, 370 bp of E2F-3, 268 bp of E2F-4, and 304 bp of E2F-5. Expression of G3PDH, which is not regulated by T3, was analyzed as a control. The negative control is a RT-PCR of total RNA prepared from untreated P19 cells without the addition of reversed transcriptase (-). The DNA size marker is indicated (M). D, Expression of E2F-1 and G3PDH transcripts during T3-induced oligodendrocyte differentiation. RT-PCR of mRNA from OPCs harvested at the indicated time points after T3 treatment. RT-PCR of total RNA from untreated P19 cells were used as a positive control (+). The E2F-1 and G3PDH expression was quantitated using a phosphoimager (Fuji BAS 2500, Fujifilm, Tokyo, Japan). The E2F-1 expression was calculated relative to the G3PDH expression. Fold expression of E2F-1 in T3-treated OPCs relative untreated OPCs is shown (x) with SD indicated ({sigma}) (n = 3). The asterisks indicate that the difference between the untreated and T3-treated OPCs are significant at a confidence level of P < 0.05 (*) or P < 0.01 (**) by Student’s t test. E, T3 treatment suppresses growth of 3T3 cells, but not TR {alpha} and ß knockout 3T3 cells. Cells were grown in DMEM supplemented with 5% FCS in the presence or absence of 100 nM T3 for 48 h and then the cells were counted. The percentage of the number of T3-treated cells compared with untreated cells of each cell type is shown. SD values are shown (n = 3). The asterisk indicates that the difference between the pairs denoted is significant at a confidence level of P < 0.05 by Student’s t test (*).

 
One of the main proteins controlling S-phase progression is the E2F-1 factor. Reversed transcription coupled to semiquantitative PCR showed that the E2F-1 mRNA level decreased after T3 treatment (Fig. 1CGo). The level of E2F-1 protein also decreased after T3 treatment of P19 cells (results not shown). The mRNA levels of E2F-3, E2F-4, and E2F-5 were not repressed by T3 treatment of P19 cells (Fig. 1CGo). We were not able to detect any E2F-2 mRNA, indicating that E2F-2 is not expressed or expressed at very low levels in P19 cells. The RB protein negatively regulates the activity of the E2F-1 protein. However, RB was not expressed at detectable levels in undifferentiated P19 cells (Ref.55 and results not shown). Thus, the level of E2F-1 might be regulated in P19 cells, rather than its activity, and the level in turn regulates the entry of the cells into the S-phase.

T3 induces the differentiation of oligodendrocyte progenitor cells to mature oligodendrocytes (reviewed in Ref.56). This cell system is another case in which T3 induced a rapid decrease in the expression of E2F-1 mRNA, after only 1 h of T3 treatment (Fig. 1DGo). In agreement with this, the level of E2F-1 protein also decreased after T3 treatment of OPCs (results not shown). Thus, cell cycle arrest is accompanied by a decrease in the level of E2F-1 in both P19 cells and OPCs.

Many other cell types are also proliferation-suppressed by T3 treatment. Figure 1EGo shows that 3T3 cells grew slower in the presence of T3 than in the absence of it. In contrast, 3T3 cells that were prepared from TR {alpha} and ß double knockout mouse embryos, and thus lack all functional TRs, were not growth suppressed by T3 treatment. This result shows that the T3-induced suppression of proliferation requires the presence of TRs. The 3T3 cells lacking all TRs divided approximately half as often as wt 3T3 cells do. P19 cells grew double as fast as wild-type (wt) 3T3 cells do and were also more suppressed in cell proliferation by T3 treatment than 3T3 cells (compare Fig. 1Go, A and E).

TR Regulates Transcription of the E2F-1 Promoter
The E2F-1 promoter contains binding sites for the specificity protein 1 (Sp1), metal regulatory element-binding factor (MBF-1), and nuclear factor-{kappa}B transcription factors, and for the E2F-1 factor itself (57). High levels of E2F-1 protein repress its own transcription, and thus E2F-1 autoregulates this site (Refs.58, 59 and results not shown). When transiently transfected into human chorion carcinoma cells (JEG cells), which we have shown contain relatively low amounts of endogenous TR (60) and are easy to transfect by the calcium-phosphate precipitation method, TR in the absence of T3 increased the transcription of an E2F-1 promoter luciferase reporter construct by a factor of approximately 5 (Fig. 2AGo). In contrast, when T3 was added, TR repressed transcription of the E2F-1 promoter to a level below the basal level of transcription (Fig. 2AGo). T3 regulated both positively and negatively a reporter construct with mutations in the E2F-binding sites (E2F mut-luc), which shows that TR does not regulate transcription of the E2F-1 promoter through the E2F-1 factor itself (Fig. 2AGo). T3 affected transcription of the E2F-1 promoter at a concentration of 10 nM (results not shown). However, the highest degree of repression occurred at 1 µM of T3, and this concentration of T3 was used in the subsequent experiments. Similar results were seen in lipofectamin-transfections of P19 cells (results not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. TR Regulates Transcription of the E2F-1 Promoter

A, The E2F-1 promoter coupled to the luciferase reporter gene (E2F-luc) or the E2F-1 promoter with mutations of the E2F binding sites coupled to the same reporter gene (E2F mut-luc) was cotransfected into JEG cells in the presence of an expression vector for TR{alpha} or an empty expression vector. The transfected cells were grown 24 h in the presence or absence of 1 µM T3, as indicated. The cells were harvested and the cell extracts were analyzed for luciferase activity. The y-axis shows the degree of activation as a multiple of the luciferase assay value of the reporter construct E2F1-luc without T3 and TR. SD values are shown (n = 3). The asterisk indicates that the difference between the pairs denoted is significant at a confidence level of P < 0.05 by Student’s t test. #, Difference from the control (reporter only) is significant at a confidence level of P < 0.05 by Student’s t test. B, TR regulation of the E2F-1 promoter requires the sequence at position -211 to -151 relative to the transcription start site. Schematic representation of the deletion mutants of the E2F-1 promoter is shown on the top (57 ). The E2F-1 promoter deletion mutants were cotransfected with or without an expression plasmid for TRß0 or an empty expression plasmid, and the cells were grown in the presence or absence of 1 µM T3, as indicated. The y-axis shows the degree of activation as a multiple of the luciferase assay value of the reporter construct -211/+64 in the absence of TR and T3. SD values are shown (n = 4). The asterisks indicate that the difference between the pairs denoted is significant at a confidence level of P < 0.01 by Student’s t test (**). #, Difference from the control (reporter only) is significant at a confidence level of P < 0.05 by Student’s t test.

 
TR was then transfected with different deletion mutant constructs of the E2F-1 promoter upstream of the reporter gene. Figure 2BGo shows that only the reporter construct containing base pairs positioned from -211 to -151 relative to the transcription start site was activated by unliganded TR and repressed by liganded TR. This indicates that this region might contain a TR regulatory element or that TR affects other transcription factors binding to this region. The constructs -151/+64 and -131/+64 were slightly repressed by T3 but not activated by unliganded TR. The slight repression was lost in -92/+64 construct. This indicates that the region from nt -151 to nt -92 might contain additional TR-regulatory sequences or binding sites for other factors that are regulated by T3. It should be noted, though, that the basal level of transcription was higher from the -211/+64 construct than the other deletion mutant constructs.

Isoforms of TR and other Nuclear Receptors—Their Effects on E2F-1 Transcription
TRs are expressed from two genes known as TR{alpha} and TRß. Each gene in turn expresses isoforms, which have different names in different species. These are TR{alpha}, TR{alpha}2, TRß1, and TRß2 in mammals; and TR{alpha}, TR{alpha}2 (same as in mammals), TRß0, and TRß2 in chicken. The TR{alpha} gene in chicken has two alternative sites of translation initiation, which give rise to two isoforms known as TR{alpha}1 p46 and TR{alpha}1 p40. Recently, two new TR isoforms, TRß3 and TR{Delta}ß3, were described in mammals (61).

TRs from chicken and from mouse were cotransfected with the E2F-1 mut-luc reporter construct. All TR isoforms activated the E2F-1 promoter in a similar manner but to different extents (Fig. 3Go). In the absence of ligand, TRß0 and TR{alpha}1 p46 from chicken were the most potent activators of the E2F1-luciferase reporter construct. Of the mouse TRs, TR{alpha} was the most efficient activator. Surprisingly, chicken TRß0 was remarkably much a better activator of the E2F-1 promoter than chicken TRß2, despite the similarity in their sequences (Fig. 3Go). In the presence of ligand, the different isoforms repressed transcription. A TR mutant lacking the DNA binding domain (TR{alpha}-LBD) had no effect on the E2F-1 promoter, indicating that DNA binding is absolutely required both for activation and repression. Another TR mutant (pSG-C1), in which nine amino acids have been deleted from around helix 12 in a domain known as AF2, efficiently activated the E2F-1 reporter construct, both in the absence and presence of T3. The AF2 mutant has very low ligand binding capacity and does not bind to coactivators (5). This result suggests that ligand-dependent repression requires a functional AF2 domain, but that ligand-independent activation does not need coactivators.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 3. All TR Isoforms Regulate E2F-1 Expression

Schematic representations of the TR isoforms and mutants are shown on the left. Expression plasmids for different TR isoforms and mutants from mouse and chicken, other nuclear receptors, and the E2F-1 mutant luciferase reporter construct (E2F-1 mut-luc) were cotransfected into JEG cells. The cells were grown in the presence or absence of 1 µM T3 or 1 µM RA, as indicated. The y-axis shows the degree of activation as a multiple of the luciferase assay value of the reporter vector E2F-1 mut-luc alone. SD values are shown (n = 3). The asterisks indicate that the difference between the pairs denoted is significant at a confidence level of P < 0.05 (*) or P < 0.01 (**) by Student’s t test. The difference from the control (reporter only) is significant at a confidence level of P < 0.05 (#) or P < 0.01 (##) by Student’s t test.

 
In addition, the RA receptor slightly activated the expression of the E2F-1 promoter in the absence of RA, and repressed it in the presence of RA (Fig. 3Go). RXR in the absence or presence of ligand, and other nuclear receptors, such as the estrogen receptor, vitamin D3 receptor, the orphan receptor Nurr1, and the viral oncogenic homolog to TR, v-erbA, did not have any significant effects on the E2F-1 promoter (Fig. 3Go and results not shown).

TR Binds Directly to the E2F-1 Promoter
T3-dependent repression of transcription has previously been studied mainly using the TSH {alpha} and ß promoters, both of which contain a conserved sequence called the Z-element (CAAAG) (33). We compared the sequence of the E2F-1 promoter to the sequences of the negative TREs in the TSH promoters (Fig. 4Go). This comparison revealed a Z-element positioned approximately 200 bp upstream of the start site for E2F-1 transcription, which is the same region as that required for TR regulation found in the experiments shown in Fig. 2BGo. Gelshifts were performed to investigate whether TR binds directly to this negative TRE. We used TR{alpha} (p46) produced in HeLa cells from a vaccinia virus vector as a source of TR. TR shifted migration of an optimal positive TRE probe (DR4), and it bound this element both as a monomer and a dimer, as previously described (Fig. 5AGo and Ref.62). TR also bound to the Z-element, but mainly as a monomer (Fig. 5AGo). The Apo-site A and Apo-TATA probes served as controls for monomer and dimer binding. TR bound the Apo-site A element only as a dimer, whereas TR bound to the Apo-TATA element also as a monomer (Fig. 5AGo and Ref.63).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. Comparison of the Sequences of Negative TREs from the Human and Quail E2F-1, the Rat Pit1 and the Mouse, Rat, and Human TSH Promoters

Conserved nucleotides are underlined. Additional sequence homologies between the human E2F-1, quail E2F-1, and human TSH {alpha} promoters are shown by dotted lines. The position of the DNA-sequence in relation to the start site of transcription is shown.

 


View larger version (57K):
[in this window]
[in a new window]
 
Figure 5. TR Binds to the Z-Element

A, TR binds to the Z-element as a monomer. Nuclear extracts of a TR containing vaccinia virus vector infected into HeLa cells (TR) or mock-infected nuclear extracts (M) were incubated with labeled probes spanning the Z-, DR4-, Apo-site A- and Apo-TATA-elements. Bound complexes were analyzed on a 6% nondenaturating polyacrylamide gel. Bands migrating as monomers, dimers and free probes are indicated. B, TR monomers, but not RXR monomers, RXR homodimers, or TR/RXR heterodimers bind to the Z-element. Labeled probes spanning the Z- and DR4-elements were incubated with mock-infected extracts (M) or extracts from infected cells with a vaccicnia virus vector containing TR or the RXR. Bound complexes were separated on a 6% nondenaturating polyacrylamide gel. Binding of TR to the labeled Z-element probe was competed with a cold specific competitor (the DR4-element) or an unspecific competitor. A shift of the TR/Z-element complex with T3 is also shown. Bands migrating as monomers, dimers, and free probes are indicated.

 
A specific nonlabeled DR4-element competed efficiently with the TR/Z-element complex, whereas an unspecific DNA sequence did not (Fig. 5BGo). This suggests that the binding of TR to the Z-element is sequence specific. Addition of T3 resulted in a small mobility shift of the TR/Z-element complex, which indicates that the receptor is biologically functional in terms of ligand binding at the Z-element site (Fig. 5BGo). RXR, produced in HeLa cells infected with an RXR vaccinia virus vector, did not alone bind to the DR4- or the Z-element, but together with TR a clear shift toward the TR/RXR heterodimer complex was seen with the DR4-element (Fig. 5BGo and Ref.64). In contrast, RXR did not shift the TR/Z-element complex toward a heterodimer complex (Fig. 5Go), indicating that TR binds the Z-element as a monomer even in the presence of RXR. Neither the viral homologue to TR, v-erbA, nor the RA receptor bound to the Z-element (results not shown).

The Z-Element Is Sufficient for TR Regulation
The experiments described above show the TR binds directly to a Z-element probe with a sequence identical to the sequence at position -200 of the E2F-1 promoter. The sequence from -190 to -221 of the E2F-1 promoter, which contains the Z-element, was cloned into a luciferase reporter plasmid at a position in front of the Simian virus 40 TATA-box. This Z-element reporter construct was cotransfected with TRß0 into JEG cells. Figure 6Go shows that the Z-element reporter was efficiently activated by TRß0 in the absence of T3 and repressed in the presence of T3. Expression of luciferase from the cloning vector pGL2, lacking the Z-element, was not regulated either by TRß0 or by T3.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. The Influence of Different Point Mutations in the Z-Element on Regulation of Transcription by TR

An expression plasmid of TRß0 was cotransfected with the E2F-1 minimal reporter construct (Z), reporter constructs with point mutated Z-elements (pGL2-Z1 to Z14), a reporter plasmid containing positively regulated TREs (+TRE), or the cloning vector for the Z-element constructs (pGL2) into JEG cells. Cells were grown in the presence and absence of 1 µM T3, as indicated. The y-axis shows the degree of activation as a multiple of the luciferase assay value of the reporter vector Z alone. SD values are shown (n = 3). The wt sequence of the Z-element and the specific base pair substitution for each mutant are shown above the diagram. The asterisks indicate that the difference between the pairs denoted is significant at a confidence level of P < 0.05 (*) or P < 0.01 (**) by Student’s t test. The difference from the control (reporter vector alone) is significant at a confidence level of P < 0.05 (#) or P < 0.01 (##) by Student’s t test.

 
We then constructed point mutations in the conserved Z-element core sequence, CAAAG, and in sequences adjacent to the core sequence in the Zelement reporter construct. In these mutations pyri-midines were switched for purines and vice versa. The mutated Z-element reporter constructs were cotransfected with TRß0 into JEG cells and the levels of transcription of the different mutants were analyzed (Fig. 6Go). The reporter construct called Z9, which has the mutation of fifth G in the Z-element core sequence to a T, was neither activated nor repressed by TRß0 in the presence or absence of T3. The mutant Z8, which carries a point mutation in the base pair next to the one mutated in Z9, and mutants Z1 and Z14 were only slightly activated by TRß0 in the absence of T3. Mutants Z10, Z11, and Z12 were activated by TRß0 in the absence of T3, but to lower levels than the wt Z-element reporter. In the presence of T3, TR repressed the transcription of all of these mutants. The other mutants were activated by TRß0 in the absence of T3 and repressed in the presence of T3, similarly to the regulation of the wt Z-element reporter construct. A reporter construct containing a positive TRE in the promoter was used as a control, confirming that TR and T3 activates transcription of genes containing positive TREs. Thus, the Z-element of the E2F-1 promoter is sufficient for transcriptional activation by TR in the absence of T3 and repression in the presence of T3. A point mutation in the fifth G of the Z-element core sequence totally abrogates the function of the Z-element.

Repression of Other S-Phase Genes by TR
When RB has been phosphorylated it releases E2F-1, which is then free to activate E2F-1 transcription of other S-phase-specific genes. To investigate whether TR can regulate the expression of these genes, reporter plasmids containing the promoters of three such genes, coupled to the luciferase gene, were cotransfected with the TR plasmid. Figure 7Go shows that both the DNA polymerase {alpha} promoter and the DHFR promoter were activated by TR in the absence of T3 and efficiently repressed in the presence of it. The TK promoter was not activated by TR in the absence of T3, but it was repressed in the presence of T3.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 7. TR Regulates Expression of S-Phase Genes

The DNA polymerase {alpha}, TK, or DHFR reporter plasmids was cotransfected with expression plasmids for TRß0 and/or E2F-1 into JEG cells. The cells were grown in the presence and absence of 1 µM T3, as indicated. Cells were harvested and cell extracts subjected to luciferase assays. The y-axis shows the degree of activation as a multiple of the luciferase assay value of the reporter vector alone. SD values are indicated (n = 3). The asterisk indicates that the difference between the pairs denoted is significant at a confidence level of P < 0.05 by Student’s t test. #, Difference from the control (reporter vector alone) is significant at a confidence level of P < 0.05 by Student’s t test.

 
TR may regulate the DNA polymerase {alpha} and the DHFR promoters either by direct action or by an indirect effect, in which TR regulates the levels of endogenous E2F-1, which in turn regulates these genes. We circumvented the possibility that the T3 effect was due to the indirect pathway by cotransfecting the cells with a plasmid that expressed E2F-1 from the cytomegalovirus promoter, which is not regulated by TR, together with the TR plasmid and the reporter construct. Addition of exogenous E2F-1 increased activation of the DNA polymerase {alpha} promoter five times, which can be compared with TR activation in the absence of hormone (seven times) (Fig. 7Go). Interestingly, E2F-1 and TR together increased the activation of the DNA polymerase {alpha} promoter approximately 13 times. This shows that TR regulates transcription of the DNA polymerase {alpha} promoter in an E2F-1-independent way, and it shows that activation by TR and E2F-1 is additive. Addition of higher amounts of E2F-1 did not increase the activation further (results not shown). In the presence of T3, the activity of the DNA polymerase {alpha} promoter was again repressed. Transcription from the DHFR promoter was activated three times by E2F-1 and approximately seven times by unliganded TR. This suggests that TR has an E2F-1-independent effect also on the DHFR promoter. However, the activation by TR and E2F-1 together was not additive in the case of the DHFR promoter. The TK promoter was activated neither by TR nor by E2F-1, but liganded TR was still an efficient repressor both in the presence and absence of exogenous E2F-1. This suggests that TR repress the TK promoter independently of the E2F-1 protein.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Repression of gene expression in response to thyroid hormone plays an essential role in the regulation of thyroid hormone levels in the body. Low levels of thyroid hormone in the blood result in increased levels of TRH in the hypothalamus and of TSH {alpha} and ß in the pituitary. These, in turn, stimulate the synthesis of T3 and T4 in the thyroid gland. When the levels of T3 and T4 in the blood become too high, TRH and TSH {alpha} and ß are repressed by liganded TR through their negative TREs, forming an auto regulative loop for thyroid hormone synthesis (reviewed in Ref.65). Our results suggest an additional biological function for T3-dependent repression of transcription, one in which TR regulates the cell cycle. We suggest that this function of TR determines the timing of the differentiation of various tissues during embryonic development.

We have shown that the level of E2F-1 is lower after T3 treatment of embryonic carcinoma cells and OPCs (Fig. 1Go, C and D). We have also shown that TR regulates transcription of the S-phase specific DNA polymerase {alpha}, DHFR, and TK genes (Fig. 7Go). Comparing the sequences of these genes with the E2F-1 and TSH promoters suggested that they contain potential negative TREs. The TK promoter, in particular, contains an identical sequence to the Z-element. It has recently been shown that the expression of c-myc, another cell cycle gene, is repressed by TR in the presence of ligand (28). Perez-Juste et al. (28) suggested that the repression of c-myc mediates two processes that are induced by T3 in neuroblastoma N2A-ß cells: a block of proliferation and induction of differentiation. The c-myc promoter also contains a negative TRE Zelement. In summary, we believe that many genes that control progression from G1- to S-phase are negatively regulated by T3 through negative TREs. The negative TREs of the E2F-1 and TK promoters represents a novel type of TRE, similar to that of the TREs in the TSH genes but markedly different from that of the classical TR half-sites found in positive TREs. However, the exact consensus sequence of the negative TRE is not fully known and there seems to be a tolerance for single base pair substitutions within it (Fig. 6Go).

It has been reported recently that protein levels of E2F-1 decrease in postmitotic neurons that have differentiated after RA treatment of P19 cells (66, 67). The decrease was due to increased ubiquination and subsequent degradation of E2F-1. Further, it has also recently been shown that E2F-1 transcriptional activity, DNA binding, and protein stability are regulated by acetylation (68). It appears that the expression and activity of E2F-1 is regulated at many levels; its transcription is regulated by TR, protein levels are regulated by ubiquitination, and the functional activity of the E2F-1 protein is regulated by RB or by acetylation. Furthermore, the mouse double minute 2 proto-oncoprotein binds both to RB and to E2F-1, resulting in a stimulation of E2F transcriptional activity (69, 70). It has also recently been shown that TR activates transcription of the mouse double minute 2 gene in the presence of ligand (71). This would functionally counteract the ligand-dependent TR-mediated transcriptional repression of E2F-1 described here. Thus, it is clear that levels and activity of E2F-1 and the cell cycle are regulated in a very complex manner. The regulation of E2F-1 provides a link between TR and RB. With this in mind, it is interesting to note that transgenic mice carrying a germ-line mutation of the RB-1 gene have a nearly 100% incidence of spontaneous tumors in the pituitary, a tissue in which TR is highly expressed (72). Recently, it has been described that renal cell carcinomas and thyroid papillary cancers contain a high incidence of mutated TR{alpha} and ß genes (73, 74). Many of these mutated TRs have a deficient ligand binding, and because of that they might be activators of E2F-1 expression even in the presence of T3, similarly to mutant pSG-C1 in Fig. 3Go.

Thyroid hormone deficiency in early life has profound effects on the development and function of the CNS. The defects that occur in patients with thyroid hormone deficiency are in some aspects similar to those that are seen for the syndrome known as RTH (resistance to thyroid hormone). In this syndrome, one of the TR ß receptor alleles is mutated, and thyroid hormone cannot bind to the receptor. Transgenic mice carrying a TR gene with an RTH mutation show severe abnormalities in cerebellar development (75). On the other hand, TR knockout mice surprisingly exhibit a milder phenotype disorder than hypothyroid animals and RTH transgenic animals, and CNS structure and function is quite normal in these mice (76, 77). This discrepancy indicates that unliganded TR mediates the defects in the CNS that are seen in hypothyroidism. Mice in which RB function has been knocked out die in utero and show an extensive apoptosis of the CNS and peripheral nervous system neurons. This is consistent with increased free E2F DNA-binding activity in the CNS (78, 79, 80, 81). Overexpression of E2F-1 promotes apoptosis especially of neurons both in vitro and in vivo (82, 83, 84). In addition, E2F-1 deficiency in cultured cortical neurons confers significant protection to staurosporine-induced apoptosis (82). These results show that an increased expression of E2F-1 in the CNS induces neuron death. Unliganded TR efficiently activates transcription of the E2F-1 promoter (Fig. 2AGo). This indicates that the levels of E2F-1 expression in the CNS might be increased in a hypothyroid state, something that might result in increased apoptosis of neurons and, consequently, developmental defects of the CNS.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmid Constructs
The E2F-1 luciferase reporter construct, the E2F-1 mut-luciferase reporter construct, and the reporter plasmids with deletion mutants of the E2F-1 promoter have been described (57, 85). The chicken TR{alpha} (p40 and p46) and TRß0 and ß2 genes were cloned into the pSG5 expression vector (60, 86). Plasmids expressing mouse TR{alpha} and TRß1 and ß2 receptors (87), mouse RXR (86), Nurr1 (88), E2F-1 (89) and TR mutants pSG-C1 (90) and TRLBD (91) have all been described, as have the DNA polymerase {alpha}, TK, and DHFR reporter plasmids (92). The E2F-1 minimal reporter plasmid (pGL2-Z luciferase) was cloned by the insertion of a DNA oligomer into the KpnI to XhoI sites of the pGL2-promoter vector (Promega Corp., Madison, WI). The sequence of the inserted oligomer was:

5'-C CTG CAG CCT GGT ACC ATC CGG ACA AAG CCT GCG CGC GC

3'-C ATG GAC GTC GGA CCA TGG TAG GCC TGT TTC GGA CGC GCG CGA GCT

The pGL2-Z luciferase plasmid was used as a mutagenesis template to introduce point mutations. Fourteen primer pairs were designed to introduce the specific mutations and the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used to construct the plasmids as described in the manufacturer’s instruction manual. The introduced mutations were confirmed by sequencing. The resultant point mutations of the plasmids were pGL2-Z1 AGGACAAAGCCTGC, pGL2-Z2 CTGACAAAGCCTGC, pGL2-Z3 CGTACAAAGCCTGC, pGL2-Z4 CGGCCAAAGCCTGC, pGL2-Z5 CGGAAAAAGCCTGC, pGL2-Z6 CGGACCAAGCCTGC, pGL 2-Z7 CGGACACAGCCTGC, pGL2-Z8 CGGACAACGCC-TG C, pGL2-Z9 CGGACAAATCCTGC, pGL2-Z10 CGGACAAAGACTGC, pGL2-Z11 CGGACAAAGCATGC, pGL2-Z12 CGGACAAAGCCGGC, pGL2-Z13 CGGACAAAGCCTTC and pG L2-Z14 CGGACAAAGCCTGA. The reporter plasmid containing a positive TRE, pTLUC109 F2Tx2, has been described (93).

Transfections
JEG cells were plated in a 24-well plate in DMEM (Biochrom, Berlin, Germany) supplemented with 10% fetal calf serum (FCS). One day later, the medium was replaced with DMEM containing 10% FCS depleted of RA and/or T3 and T4 by ion exchange resin (94). Approximately 1 h later, the cells were cotransfected by the calcium phosphate method with expression vectors encoding 100 ng TR and 150–200 ng of reporter constructs. The cells were maintained in the presence or absence of 0.1–1 µM T3 (Sigma, St. Louis, MO), harvested 24 h after hormone treatment and assayed for luciferase activity. All transfections were done at least three times, employing duplicate or triplicate sample points in each experiment.

Cell Counting
P19 cells were grown on tissue culture dishes coated with 0.1% gelatin. P19, 3T3, and TR{alpha}ß double knockout 3T3 cells were grown in DMEM supplemented with 3–5% T3/T4-depleted FCS. T3 was added to concentrations of 100 nM, if not otherwise indicated. At different time points of incubation, the number of living cells (attached) was counted using a Coulter counter.

Fluorescence-Activated Cell Sorter (FACS)
P19 cells were cultured as described above in absence or presence of 1 µM T3, and harvested at different time points (8, 15, 24, 48, and 72 h). Cells were washed with PBS and fixed in cold 70% ethanol. Fixed cells were resuspended in PBS containing 40 µg/ml propidium iodide, and 40 µg/ml ribonuclease (RNase), and then incubated at 37 C for 1 h. Four samples of each time point were analyzed for DNA content on a Becton Dickinson and Co. (Franklin Lakes, NJ) FACScan (Calibur) using CellQuest software.

RNA Preparation, Amplification of E2F mRNA
Total RNA was prepared from P19 cells growing in DMEM containing T3/T4-depleted FCS. The cells were treated with 0.1–1 µM T3 for various time points. Cells were washed with cold PBS and lysed in 1 ml of Tri Reagent (Sigma). Two hundred microliters of 200 µl chloroform was added before centrifugation. The RNA in the aqueous phase was precipitated with isopropanol. The pellet was resuspended in 160 µl distilled water and deoxyribonuclease (DNase)-treated (20 U DNase, Sigma-Aldrich Corp., Schnelldorf, Germany) at 37 C for 30 min using 20 µl DNase buffer (44 mM Tris, pH 8.0; 100 mM NaCl; 60 mM MgCl2; 50 mM dithiothreitol) and 160 U RNasin (Promega Corp. Madison, WI). The solution was extracted twice using phenol:chloroform:isoamylalcohol (25:24:1 vol/vol), and RNA was precipitated with ethanol.

For cDNA synthesis, 2 µg of total RNA were incubated with 10 pmol of oligo(deoxythymidine) primer or gene-specific primers for 10 min at 70 C. Fifty units of SuperScript RNaseH- Reverse Transcriptase (Life Technologies, Inc., Gaithersburg, MD), 1x First Strand Buffer (Life Technologies, Inc.), 10 mM dithiothreitol, 20 µM deoxy (d)-NTPs, and 20 U RNaseOUT (Life Technologies, Inc.) were added to give a final volume of 25 µl. The tubes were incubated at 42 C for 1 h.

One to 5 µl of cDNA were used in the PCR to amplify the E2F or glyceraldehyde-3-phosphate dehydrogense (G3PDH) cDNA. Primers used for amplification of E2F-1 were; forward primer at position 1996 relative to the transcription start site 5'-GCAGGGCAGCAAGAGCACTGCTTA A and reverse primer 5'-GCAGGAGGGAACAGAACTGTTAGG A, that gave a product of 443 bp, or forward primer at position 2032 5'-TCGAAGCTTTAATGGAGCGT and reverse primer 5'-AGAGGAGCACTCCAGCCATA, that gave a product of 344 bp. Primers used for PCR of the G3PDH cDNA were; forward primer at position 1 5'-ACCACAGTCCATGCCATCAC and reverse primer 5'-ATGTCGTTGTCCCACCACCT (CLONTECH Laboratories, Inc., Palo Alto, CA), that gave a product of 450 bp. The sequences of the primers for amplification of E2F-3, E2F-4, and E2F-5 were: E2F-3 forward primer: 5'-GCTGTACCCTGGACCTCAAA and reverse primer 5'-GAGGCCAGAGGAGAGAGGTT, E2F-4 forward primer 5'-GCACGAGAAGAGTCTGGGA and reverse primer 5'-CTCCTCGATCTCTGCCTTGA, and E2F-5 forward primer 5'-GTGGCTACAGCAAAGCATCA and reverse primer 5'-GGAAGGCTGTGTGAGGTCAT. Ten picomoles of each primer were added to 5 U of Taq polymerase (Ampli Taq, Applied Biosystems, Foster City, CA), 1x PCR buffer II (Ampli Taq, Applied Biosystems), 2.5 mM MgCl2, 500 µM dATP, deoxythymidine triphosphate, dGTP, 250 µM dCTP, and 3 µCi ({alpha}-32P)-dCTP for radioactively labeled PCR, or 500 µM dCTP for nonlabeled reactions. PCR was performed for 24–25 cycles at the cycling temperatures 94 C for 1 min, 57–60 C for 1 min, and 72 C for 1 min. cDNA preparation from OPCs have been described (95). OPC cDNA was used to amplify the E2F-1 gene and the G3PDH gene in the same way as with the P19 cDNA.

Gel Retardation Assays
Binding studies of receptor/DNA complexes were carried out essentially as previously described (60). Appropriate receptor-encoding cDNAs were cloned into the pATA-18gpt, used for recombination into the vaccinia genome after infection into HeLa cells, and nuclear extract was prepared as previously described (60). One to 3 µg of these nuclear extracts were incubated for 15 min on ice with approximately 4 ng of 32P-labeled oligonucleotides in band shift buffer [4% Ficoll; 80 mM KCl; 10 mM HEPES, pH 7.9; 5 mM MgCl2; and 100 µg/ml poly(deoxyinosine-deoxycytidine)] in the presence or absence of 1 µM T3. To verify the specificity of the binding, the receptor/DNA complexes were competed with either unlabeled specific or nonspecific oligonucleotides. Samples were finally loaded and complexes separated on a running 6% nondenaturating polyacrylamide gel. The oligonucleotide probes were annealed, and labeled using the Klenow fragment of Escherichia coli polymerase I (New England Biolabs, Inc., Hertfordshire, UK). The sequences of the probes were: DR4 probe 5'-AGCTTCAGGTCACTTCAGGTCA E2F-Z probe 5'-GGGCCATCCGGACAAAGCCTGCGCApo-TATA probe 5'-GGGCACACATATATAGGTCAGGGAAGAAGACCTG (63) Apo-SiteA probe 5'-GGGAGCTACTCCCCGCTGCCCCCACCTCAACCCTTGATCCCAGCTCTGC (63).


    ACKNOWLEDGMENTS
 
We are very grateful to Drs. P. J. Farnham, H. Stunnenberg, M. Kaelin, and D. G. Johnson for gifts of plasmids and Drs K. Nordström and B. Vennström for the gift of TR knockout 3T3 cells. We also thank Dr. B. Vennström for valuable comments on the manuscript.


    FOOTNOTES
 
This work was supported by Harald and Greta Jeansson’s Foundation and Harald Jeansson’s Foundation, Åke Wiberg’s Foundation, the Swedish Research Council, Magn Bervall’s Foundation, the Swedish Society of Medicine, the Novo Nordisk Foundation and Karolinska Institutet.

Abbreviations: CNS, Central nervous system; d, deoxy; DHFR, dihydropholate reductase; DNase, deoxyribonuclease; DR4, optimal positive TRE probe; FACS, fluorescence-activated cell sorter; FCS, fetal calf serum; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; HATs, histone acetyltransferases; HDACs, histone deacetylases; JEG cells, human chorion carcinoma cells; N-CoR, nuclear receptor corepressor; OPC, oligodendrocyte precursor cells; RNase, ribonuclease; RA, retinoic acid; RB, retinoblastoma protein; RTH, resistance to thyroid hormone; RXR, retinoic X receptor; SMRT, silencing mediator for retinoid and TRs; ST3, stromelysin-3; TK, thymidine kinase; TR, thyroid hormone receptor; TRE, TR response element; wt, wild-type.

Received for publication March 20, 2002. Accepted for publication October 10, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Chan S, Kilby MD 2000 Thyroid hormone and the central nervous system development. J Endocrinol 165:1–8[CrossRef][Medline]
  2. Hörlein AJ, Näär AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Söderström M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377:397–404[CrossRef][Medline]
  3. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  4. Sande S, Privalsky ML 1996 Identification of TRACs (T3 receptor-associating cofactors), a family of cofactors that associate with, and modulate the activity of, nuclear hormone receptors. Mol Endocrinol 10:813–825[Abstract]
  5. Nagy L, Kao HY, Chakravarti D, Lin RJ, Hassig CA, Ayer DE, Schreiber SL, Evans RM 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  6. Laherty CD, Yang WM, Sun JM, Davie JR, Seto E, Eisenman RN 1997 Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression. Cell 89:349–356[CrossRef][Medline]
  7. Li J, Wang J, Nawaz Z, Liu JM, Qin J, Wong J 2000 Both corepressor proteins SMRT and N-CoR exist in large protein complexes containing HDAC3. EMBO J 19:4342–4350[CrossRef][Medline]
  8. Wen YD, Perissi V, Staszewski LM, Yang WM, Krones A, Glass CK, Rosenfeld MG, Seto E 2000 The histone deacetylase-3 complex contains nuclear receptor corepressors. Proc Natl Acad Sci USA 97:7202–7207[Abstract/Free Full Text]
  9. Huang EY, Zhang J, Miska EA, Guenther MG, Kouzarides T, Lazar MA 2000 Nuclear receptor corepressors partner with class II histone deacetylases in a Sin3-independent repression pathway. Genes Dev 14:45–54[Abstract/Free Full Text]
  10. Bannister AJ, Kouzarides T 1996 The CBP co-activator is a histone acetyltransferase. Nature 384:641–643[CrossRef][Medline]
  11. Eckner R, Ewen ME, Newsome D, Gerdes M, DeCaprio JA, Lawrence JB, Livingston DM 1994 Molecular cloning and functional analysis of the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev 8:869–884[Abstract/Free Full Text]
  12. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  13. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  14. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  15. Blanco JC, Minucci S, Lu J, Yang XJ, Walker KK, Chen H, Evans RM, Nakatani Y, Ozato K 1998 The histone acetylase PCAF is a nuclear receptor coactivator. Genes Dev 12:1638–1651[Abstract/Free Full Text]
  16. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y 1996 A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382:319–324[CrossRef][Medline]
  17. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  18. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  19. Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW 1997 TRAM-1, A novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:27629–27634[Abstract/Free Full Text]
  20. Li D, Desai-Yajnik V, Lo E, Schapira M, Abagyan R, Samuels HH 1999 NRIF3 is a novel coactivator mediating functional specificity of nuclear hormone receptors. Mol Cell Biol 19:7191–7202[Abstract/Free Full Text]
  21. Farsetti A, Mitsuhashi T, Desvergne B, Robbins J, Nikodem VM 1991 Molecular basis of thyroid hormone regulation of myelin basic protein gene expression in rodent brain. J Biol Chem 266:23226–23232[Abstract/Free Full Text]
  22. Hodnett DW, Fantozzi DA, Thurmond DC, Klautky SA, MacPhee KG, Estrem ST, Xu G, Goodridge AG 1996 The chicken malic enzyme gene: structural organization and identification of triiodothyronine response elements in the 5'-flanking DNA. Arch Biochem Biophys 334:309–324[CrossRef][Medline]
  23. Muscat GE, Downes M, Dowhan DH 1995 Regulation of vertebrate muscle differentiation by thyroid hormone: the role of the myoD gene family. Bioessays 17:211–218[CrossRef][Medline]
  24. Damjanovski S, Puzianowska-Kuznicka M, Ishuzuya-Oka A, Shi YB 2000 Differential regulation of three thyroid hormone-responsive matrix metalloproteinase genes implicates distinct functions during frog embryogenesis. FASEB J 14:503–510[Abstract/Free Full Text]
  25. Chin WW, Carr FE, Burnside J, Darling DS 1993 Thyroid hormone regulation of thyrotropin gene expression. Recent Prog Horm Res 48:393–414
  26. Lezoualc’h F, Hassan AH, Giraud P, Loeffler JP, Lee SL, Demeneix BA 1992 Assignment of the ß-thyroid hormone receptor to 3,5,3'-triiodothyronine-dependent inhibition of transcription from the thyrotropin-releasing hormone promoter in chick hypothalamic neurons. Mol Endocrinol 6:1797–1804[Abstract]
  27. Belandia B, Latasa MJ, Villa A, Pascual A 1998 Thyroid hormone negatively regulates the transcriptional activity of the ß-amyloid precursor protein gene. J Biol Chem 273:30366–30371[Abstract/Free Full Text]
  28. Perez-Juste G, Garcia-Silva S, Aranda A 2000 An element in the region responsible for premature termination of transcription mediates repression of c-myc gene expression by thyroid hormone in neuroblastoma cells. J Biol Chem 275:1307–1314[Abstract/Free Full Text]
  29. Madison LD, Ahlquist JA, Rogers SD, Jameson JL 1993 Negative regulation of the glycoprotein hormone {alpha} gene promoter by thyroid hormone: mutagenesis of a proximal receptor binding site preserves transcriptional repression. Mol Cell Endocrinol 94:129–136[CrossRef][Medline]
  30. Chin S, Apriletti J, Gick G 1998 Characterization of a negative thyroid hormone response element in the rat sodium, potassium-adenosine triphosphatase {alpha}3 gene promoter. Endocrinology 139:3423–3431[Abstract/Free Full Text]
  31. Tagami T, Madison LD, Nagaya T, Jameson JL 1997 Nuclear receptor corepressors activate rather than suppress basal transcription of genes that are negatively regulated by thyroid hormone. Mol Cell Biol 17:2642–2648[Abstract]
  32. Tagami T, Park Y, Jameson JL 1999 Mechanisms that mediate negative regulation of the thyroid-stimulating hormone {alpha} gene by the thyroid hormone receptor. J Biol Chem 274:22345–22353[Abstract/Free Full Text]
  33. Sasaki S, Lesoon-Wood LA, Dey A, Kuwata T, Weintraub BD, Humphrey G, Yang WM, Seto E, Yen PM, Howard BH, Ozato K 1999 Ligand-induced recruitment of a histone deacetylase in the negative-feedback regulation of the thyrotropin ß gene. EMBO J 18:5389–5398[CrossRef][Medline]
  34. Laflamme L, Hamann G, Messier N, Maltais S, Langlois M-F 2002 RXR acts as a coregulator in the regulation of genes of the hypothalamo-pituitary axis by thyroid hormone receptors. J Mol Endocrinol 29:61–72[Abstract]
  35. Feng X, Jiang Y, Meltzer P, Yen PM 2000 Thyroid hormone regulation of hepatic genes in vivo detected by complementary DNA microarray. Mol Endocrinol 14:947–955[Abstract/Free Full Text]
  36. Ahlgren SC, Wallace H, Bishop J, Neophytou C, Raff MC 1997 Effects of thyroid hormone on embryonic oligodendrocyte precursor cell development in vivo and in vitro. Mol Cell Neurosci 9:420–432[CrossRef][Medline]
  37. Barres BA, Lazar MA, Raff MC 1994 A novel role for thyroid hormone, glucocorticoids and retinoic acid in timing oligodendrocyte development. Development 120:1097–1108[Abstract]
  38. Paavonen T 1982 Enhancement of human B lymphocyte differentiation in vitro by thyroid hormone. Scan J Immunol 15:211–215[CrossRef][Medline]
  39. Klaushofer K, Varga F, Glantschnig H, Fratzl-Zelman N, Czerwenka E, Leis HJ, Koller K, Peterlik M 1995 The regulatory role of thyroid hormones in bone cell growth and differentiation. J Nutr 125:1996S–2003S
  40. Bauer A, Mikulits W, Lagger G, Stengl G, Brosch G, Beug H 1998 The thyroid hormone receptor functions as a ligand-operated developmental switch between proliferation and differentiation of erythroid progenitors. EMBO J 17:4291–4303[CrossRef][Medline]
  41. Su Y, Damjanovski S, Shi Y, Shi YB 1999 Molecular and cellular basis of tissue remodeling during amphibian metamorphosis. Histol Histopathol 14:175–183[Medline]
  42. Rodriguez ER, Tan CD, Onwuta US, Yu ZX, Ferrans VJ, Parrillo JE 1994 3,5,3'-Triiodo-L-thyronine induces cardiac myocyte differentiation but not neuronal differentiation in P19 teratocarcinoma cells in a dose dependent manner. Biochem Biophys Res Commun 205:652–658[CrossRef][Medline]
  43. Edwards MK, McBurney MW 1983 The concentration of retinoic acid determines the differentiated cell types formed by a teratocarcinoma cell line. Dev Biol 98:187–191[CrossRef][Medline]
  44. Jones-Villeneuve EM, Rudnicki MA, Harris JF, McBurney MW 1983 Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Mol Cell Biol 3:2271–2279[Abstract/Free Full Text]
  45. Trimarchi JM, Fairchild B, Verona R, Moberg K, Andon N, Lees JA 1998 E2F-6, a member of the E2F family that can behave as a transcriptional repressor. Proc Natl Acad Sci USA 95:2850–2855[Abstract/Free Full Text]
  46. Cartwright P, Muller H, Wagener C, Holm K, Helin K 1998 E2F-6: a novel member of the E2F family is an inhibitor of E2F-dependent transcription. Oncogene 17:611–623[CrossRef][Medline]
  47. Johnson DG, Schneider-Broussard R 1998 Role of E2F in cell cycle control and cancer. Front Biosci 3:d447–d448
  48. Weintraub SJ, Prater CA, Dean DC 1992 Retinoblastoma protein switches the E2F site from positive to negative element. Nature 358:259–261[CrossRef][Medline]
  49. Magnaghi-Jaulin L, Groisman R, Naguibneva I, Robin P, Lorain S, Le Villain JP, Troalen F, Trouche D, Harel-Bellan A 1998 Retinoblastoma protein represses transcription by recruiting a histone deacetylase. Nature 391:601–605[CrossRef][Medline]
  50. Luo RX, Postigo AA, Dean DC 1998 Rb interacts with histone deacetylase to repress transcription. Cell 92:463–473[CrossRef][Medline]
  51. Brehm A, Miska EA, McCance DJ, Reid JL, Bannister AJ, Kouzarides T 1998 Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391:597–601[CrossRef][Medline]
  52. Robertson KD, Ait-Si-Ali S, Yokochi T, Wade PA, Jones PL, Wolffe AP 2000 DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters. Nat Genet 25:338–342[CrossRef][Medline]
  53. Rudnicki MA, McBurney MW 1987 Cell culture methods and induction of differentiation of embryonic carcinoma cell lines. In: Robertson EJ, ed. Teratocarcinomas and embryonic stem cells, a practical approach. Oxford: IRL Press; 19–49
  54. Glozak MA, Rogers MB 1996 Specific induction of apoptosis in P19 embryonal carcinoma cells by retinoic acid and BMP2 and BMP4. Dev Biol 179:458–470[CrossRef][Medline]
  55. Slack RS, Hamel PA, Bladon TS, Gill RM, McBurney MW 1993 Regulated expression of the retinoblastoma gene in differentiating embryonal carcinoma cells. Oncogene 8:1585–1591[Medline]
  56. Durand B, Raff M 2000 A cell-intrinsic timer that operates during oligodendrocyte development. Bioessays 22:64–71[CrossRef][Medline]
  57. Neuman E, Flemington EK, Sellers WR, Kaelin Jr WG 1994 Transcription of the E2F-1 gene is rendered cell cycle dependent by E2F DNA-binding sites within its promoter. Mol Cell Biol 14:6607–6615[Abstract/Free Full Text]
  58. Hsiao KM, McMahon SL, Farnham PJ 1994 Multiple DNA elements are required for the growth regulation of the mouse E2F1 promoter. Genes Dev 8:1526–1537[Abstract/Free Full Text]
  59. Johnson DG, Ohtani K, Nevins JR 1994 Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression. Genes Dev 8:1514–1525[Abstract/Free Full Text]
  60. Wahlström GM, Vennström B, Bondesson M 1999 The adenovirus E1A protein is a potent coactivator for thyroid hormone receptors. Mol Endocrinol 13:1119–1129[Abstract/Free Full Text]
  61. Williams GR 2000 Cloning and characterization of two novel thyroid hormone receptor ß isoforms. Mol Cell Biol 20:8329–8342[Abstract/Free Full Text]
  62. Wahlström GM, Sjöberg M, Andersson M, Nordström K, Vennström B 1992 Binding characteristics of the thyroid hormone receptor homo- and heterodimers to consensus AGGTCA repeat motifs. Mol Endocrinol 6:1013–1022[Abstract]
  63. Taylor AH, Wishart P, Lawless DE, Raymond J, Wong NC 1996 Identification of functional positive and negative thyroid hormone-responsive elements in the rat apolipoprotein AI promoter. Biochemistry 35:8281–8288[CrossRef][Medline]
  64. Harbers M, Wahlström GM, Vennström B 1998 Identification of DNA binding sites for the V-erbA oncoprotein, the viral homolog to thyroid hormone receptor {alpha}. J Steroid Biochem Mol Biol 67:181–191[CrossRef][Medline]
  65. Larsen PR 1989 The pituitary-thyroid regulatory system. Adv Exp Med Biol 261:11–26[Medline]
  66. Azuma-Hara M, Taniura H, Uetsuki T, Niinobe M, Yoshikawa K 1999 Regulation and deregulation of E2F1 in postmitotic neurons differentiated from embryonal carcinoma P19 cells. Exp Cell Res 251:442–451[CrossRef][Medline]
  67. Kusek JC, Greene RM, Pisano MM 2001 Expression of the E2F and retinoblastoma families of proteins during neural differentiation. Brain Res Bull 54:187–198[CrossRef][Medline]
  68. Martinez-Balbas MA, Bauer UM, Nielsen SJ, Brehm A, Kouzarides T 2000 Regulation of E2F1 activity by acetylation. EMBO J 19:662–671[CrossRef][Medline]
  69. Martin K, Trouche D, Hagemeier C, Sorensen TS, La Thangue NB, Kouzarides T 1995 Stimulation of E2F1/DP1 transcriptional activity by MDM2 oncoprotein. Nature 375:691–694[CrossRef][Medline]
  70. Xiao ZX, Chen J, Levine AJ, Modjtahedi N, Xing J, Sellers WR, Livingston DM 1995 Interaction between the retinoblastoma protein and the oncoprotein MDM2. Nature 375:694–698[CrossRef][Medline]
  71. Qi JS, Yuan Y, Desai-Yajnik V, Samuels HH 1999 Regulation of the mdm2 oncogene by thyroid hormone receptor. Mol Cell Biol 19:864–872[Abstract/Free Full Text]
  72. Hu N, Gutsmann A, Herbert DC, Bradley A, Lee WH, Lee EY 1994 Heterozygous Rb-1{delta}20/+mice are predisposed to tumors of the pituitary gland with a nearly complete penetrance. Oncogene 9:1021–1027[Medline]
  73. Kamiya Y, Puzianowska-Kuznicka M, McPhie P, Nauman J, Cheng SY, Nauman A 2002 Expression of mutant thyroid hormone nucle