help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0047
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Steffens, F.
Right arrow Articles by Wieland, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steffens, F.
Right arrow Articles by Wieland, T.
Molecular Endocrinology 17 (10): 2103-2115
Copyright © 2003 by The Endocrine Society

Melatonin Receptor Signaling in Pregnant and Nonpregnant Rat Uterine Myocytes as Probed by Large Conductance Ca2+-Activated K+ Channel Activity

Frank Steffens, Xiao-Bo Zhou, Ulrike Sausbier, Claudia Sailer, Karin Motejlek, Peter Ruth, James Olcese, Michael Korth and Thomas Wieland

Institut für Pharmakologie für Pharmazeuten (F.S., X.-B.Z., K.M., M.K.), Universitätsklinikum Hamburg-Eppendorf; Pharmazeutisches Institut (U.S., P.R.), Pharmakologie und Toxikologie Universität Tübingen, D-72076 Tübingen, Germany; Institut für Biochemische Pharmakologie (C.S.), Universität Innsbruck, A-6020 Innsbruck, Austria; Institut für Hormon-und Fortpflanzungsforschung (J.O.), D-22529 Hamburg, Germany; and Institut für Pharmakologie und Toxikologie (T.W.), Fakultät für Klinische Medizin Mannheim, Universität Heidelberg, D-68169 Mannheim, Germany

Address all correspondence and requests for reprints to: Michael Korth, M.D., Institut für Pharmakologie für Pharmazeuten, Universitätsklinikum Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The mRNAs of MT1 and MT2 melatonin receptors are present in cells from nonpregnant (NPM) and pregnant (PM) rat myometrium. To investigate the coupling of melatonin receptors to Gq- and Gi-type of heterotrimeric G proteins, we analyzed the activity of large-conductance Ca2+-activated K+ (BKCa) channels, the expression of which in the uterus is confined to smooth muscle cells. The melatonin receptor agonist 2-iodomelatonin induced a pertussis toxin (PTX)-insensitive increase in channel open probability that was blocked by the nonselective antagonist luzindole. The 2-iodomelatonin effect on channel open probability was suppressed by overexpression of the Gq{alpha}-inactivating protein RGS16 and the phospholipase C inhibitor U-73122. The activity of BKCa channels is differentially regulated by protein kinase A (PKA) in NPM and PM cells. Thus, the ß-adrenoceptor agonist isoprenaline inhibited the BKCa channel conducted whole-cell outward current (Iout) in NPM cells and enhanced Iout in PM cells. Additional application of 2-iodomelatonin antagonized the isoprenaline effect on Iout in NPM cells but enhanced Iout in PM cells. All 2-iodomelatonin effects on Iout were sensitive to PTX treatment and the PKA inhibitor H-89. We therefore conclude that melatonin activates both the PTX-insensitive Gq/phospholipase C/Ca2+ and the PTX-sensitive Gi/cAMP/PKA signaling pathway in rat myometrium.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
MELATONIN IS THE primary hormone of the vertebrate pineal gland and is secreted in a circadian manner with high levels occurring in all species at night. In mammals, the melatonin rhythm is generated by an endogenous circadian clock in the suprachiasmatic nucleus of the hypothalamus, which is entrained by the light-dark cycle. Melatonin seems to play a key role in a variety of important physiological functions, including regulation of circadian rhythms, as well as visual, reproductive, cerebrovascular, neuroendocrine, and neuroimmunological functions (1). In recent years, it has become increasingly apparent that application of melatonin produced inhibitory effects on growth and functional activity of the female rat reproductive system, including inhibition of LH release from the pars tuberalis (2), inhibition of uterine antimesosomal stromal cell proliferation (3), blockade of uterine prostaglandin generation (4), and reduction of uterine contractility (5, 6). From these studies it appears that melatonin, in addition to its centrally mediated effects on reproduction, plays a direct and integral part in uterine physiology. This view is supported by the recent identification of the transcripts of melatonin MT1 and MT2 receptors in human myometrium (7). Both receptors belong to the seven-transmembrane domain receptor superfamily that signals intracellularly via G proteins (8, 9). Activated MT1 receptors operating via pertussis toxin (PTX)-sensitive G proteins of the Gi/o class exert inhibitory effects on the cAMP signal transduction cascade, resulting in decreases in protein kinase A (PKA) activity and decreases in cAMP response element binding protein phosphorylation (10, 11, 12). Additional signaling pathways activated by MT1 receptors include coupling to PTX-insensitive Gq proteins, mediating Ca2+ mobilization via activation of the inositol-specific phospholipase C (PLC) (12) and activation of protein kinase C (13). On the other hand, melatonin-induced stimulation of PLC has also been assigned to a PTX-sensitive pathway involving ß{gamma}-subunits of Gi/o proteins (14). Furthermore, MT1 receptors have been reported to couple to high-conductance Ca2+-activated K+ (BKCa) channels and to G protein-activated inward rectifier potassium (Kir3) channels, to stimulate c-Jun N-terminal kinase activity and to modulate MAPKs (for review see Ref. 15). Similar to the MT1 receptor, MT2 receptors induce an inhibition of cAMP formation in various transfected cells and stimulate the phosphoinositide signal transduction cascade (16, 17, 18). Because of the highly discrete expression of melatonin receptors, many of the presently known signal transduction pathways coupled to the activation of MT1 and MT2 receptors were discovered in mammalian cell lines expressing the recombinant receptor. Whether the aforementioned Gi/o and/or Gq-mediated signaling cascades play a role in the myometrium is completely unknown. It was therefore the purpose of the present study to investigate signal transduction pathways stimulated by melatonin in myometrial smooth muscle cells isolated from pregnant and nonpregnant rats.

Recently, we have shown, by means of patch-clamp techniques, that the activity of BKCa channels reflects the status of the cellular adenylyl cyclase (AC)/cAMP signaling pathway with a sensitivity superior to biochemical methods (19). By employing the same electrophysiological strategy, we show here for the first time that melatonin induces opposite effects via Gi/o in cells from nonpregnant and pregnant rats. In addition, we show that the high Ca2+ sensitivity of BKCa channels can be used as a reliable probe to monitor increases in intracellular Ca2+ concentration via melatonin-induced Gq activation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Localization of BKCa Channels in the Rat Uterus
Cross-sections of the rat uterus wall are shown in Fig. 1Go. Three distinct layers can be distinguished in the hematoxylin-stained section (left panel); the innermost layer represents the endometrium, followed by the myometrium comprised of an inner circular layer and an outer longitudinal layer of smooth muscle. The right panel shows another section from the same rat uterus stained with a specific antibody directed against the C-terminal region of the BKCa channel. The panel demonstrates that BKCa channels are confined to the two layers of the myometrium, and virtually no channels are found in the endometrial stroma. Figure 1Go provides evidence that all cells that exhibit BKCa channel activity in the electrophysiological experiments described below are myometrial smooth muscle cells.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. Expression of BKCa Channel {alpha}-Subunits in the Rat Uterus Is Confined to the Myometrial Layers

Shown are cross-sections of a rat uterus stained with hematoxylin (left panel) or with antibody directed against the C terminus of the BKCa channel {alpha}-subunit (right panel). Magnification, x200.

 
Detection of MT1 and MT2 Receptor mRNA in Rat Myometrial Smooth Muscle Cells
After isolation, rat myometrial smooth muscle cells were cultured in the presence of the antimetabolite 5'-bromo-desoxy-uridine to obtain a pure culture of nondividing smooth muscle cells. Total RNA of these cells was analyzed for the presence of the mRNA encoding MT1 or MT2 receptors by reverse RT-PCR using specific primers. As shown in Fig. 2Go, from total RNA of rat brain, a tissue known to express both receptors (20, 21), specific cDNA fragments of 388 bp and 351 bp, were amplified for the MT1 and MT2 receptor, respectively. Both fragments were also amplified from rat myometrial smooth muscle cell cDNA, a finding that demonstrates the presence of the mRNA of both receptors in these cells.



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 2. Detection of MT1 and MT2 mRNA in Rat Myometrial Cells

RT-PCR analysis for MT1 and MT2 mRNA in cultivated rat myometrial smooth muscle cells and in rat brain was performed as described in Materials and Methods. Lane M. DNA molecular weight marker (100-bp DNA ladder; Invitrogen); lanes 2 and 5, reagent control with water as template; lane 1, cDNA transcribed from RNA of cultivated rat myometrial smooth muscle cells was amplified using MT1-specific primers; lane 4, cDNA generated from cultivated rat myometrial smooth muscle cells amplified with MT2 specific primers; lanes 3 and 6, cDNA obtained from rat brain RNA containing MT1 and MT2 mRNA was used as positive control. An identical pattern of expression was observed in two replications of the experiment shown.

 
Effects of 2-Iodomelatonin on BKCa Channel Activity
In the presence of physiological potassium in the bath and pipette solutions (5.9 mM) and at different membrane potentials, cell-attached patches of freshly isolated smooth muscle cells from nonpregnant (NPM) and pregnant (PM) rat myometrium exhibited single-channel currents with distinct amplitudes. The majority of channel openings, however, conducted currents with an amplitude five to six times larger than those conducted by the other channels. The mean unitary conductance of the large-conductance channels was voltage dependent and reached 159 ± 14 picosiemens and 147 ± 16 picosiemens in patches of 6 NPM and 6 PM cells when the pipette holding potential was set to -80 mV, respectively. As shown in Fig. 3Go, A and C, channel open probability (NPo) of cell-attached patches of untreated NPM cells varied within 4 min between 0.0019 and 0.02 with a mean value of 0.0092 ± 0.00014 (n = 6). In patches of PM cells, NPo varied between 0.014 and 0.058 and exhibited a mean value over 4 min of 0.035 ± 0.004 (n = 6). Thus, basal NPo is considerably higher (P < 0.001) in cells from pregnant as compared with cells from nonpregnant myometrium. This difference is also illustrated by the original single-channel recordings in Fig. 3Go (insets). Superfusion of the cells with 100 nM 2-iodomelatonin, which was used because of its higher affinity to MT1 receptors compared with melatonin itself (22), resulted within 20–30 sec in an increase of NPo. The effect on NPo was maximal in less than 1 min and attained values 8- to 9-fold higher than those of the drug-free control (NPM cells: 0.082 ± 0.002, n = 6; PM cells: 0.292 ± 0.021, n = 6). Single-channel conductance was not affected by 2-iodomelatonin. As shown in Fig. 3Go, A and C, the effect on NPo was transient, i.e. 2 min after the addition of 2-iodomelatonin, open probability had returned to basal values. When the concentration of 2-iodomelatonin was increased to 1 µM, NPo in NPM (n = 4) and PM cells (n = 4) was enhanced 6.8- and 7.1-fold, respectively, indicating that 100 nM was already a maximally effective concentration. The increase in NPo was receptor mediated because pretreatment of five NPM and five PM cells with the nonselective melatonin receptor antagonist luzindole (10 µM) for 10 min completely abolished the transient effect of 100 nM 2-iodomelatonin (Fig. 3Go, B and D). When 100 nM melatonin instead of 2-iodomelatonin was used, NPo increased 6.2-fold in five NPM and 4.7-fold in four PM cells. These increases in NPo were significantly (P < 0.05) smaller than those induced by 2-iodomelatonin (data not shown). In a further set of experiments it was tested whether the effect of 2-iodomelatonin on NPo was sensitive to PTX. NPM and PM cells were therefore incubated for 5 h in physiological salt solution (PSS) containing 400 ng ml-1 PTX (19). Pretreatment with the toxin neither influenced basal NPo (NPM cells: 0.010 ± 0.0012, n = 7; PM cells: 0.031 ± 0.003, n = 6) nor the 2-iodomelatonin-induced transient increase (NPM cells: 0.089 ± 0.02, n = 7; PM cells: 0.251 ± 0.02, n = 6). Taken together, the results show that 2-iodomelatonin transiently increases NPo in intact NPM and PM cells via a receptor-coupled pathway that does not involve Gi/o-dependent, PTX-sensitive signal transduction.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3. 2-Iodomelatonin Transiently Increases BKCa Channel Activity in NPM and PM Cells

Single channel NPo of BKCa channels was recorded in the cell-attached patch-clamp configuration. Holding potential in the pipette was kept at -80 mV. A and C, Transient increase of NPo induced by 100 nM 2-iodomelatonin (2-I-Mel) in cells from NPM and PM. B and D, Luzindole (Lu; 10 µM) completely prevents the effect of 2-iodomelatonin on NPo. Mean values ± SEM of six (A and C) and of five (B and D) cells, respectively, are shown. Cells were obtained from three (A, C, and D) and from five rats (B), respectively. Insets, Original single-channel recordings before and in the presence of 2-iodomelatonin (A and C), luzindole, or luzindole plus 2-iodomelatonin (B and D). Single-channel openings are upward deflections. Note that basal NPo is higher in PM as compared with NPM cells (different scales).

 
2-Iodomelatonin Activates the Gq/PLC Pathway
BKCa channel activity is highly sensitive to Ca2+, and therefore the enhancement of NPo produced by 2-iodomelatonin in cell-attached patches could have been due to an IP3-mediated rise in cytosolic Ca2+ via a signaling cascade involving Gq proteins and PLC. To investigate the contribution of Gq, NPM cells were cultured for 24 h and subsequently transfected with plasmids encoding either the enhanced green fluorescence protein EGFP alone or an EGFP-RGS16 fusion protein. The growth medium was exchanged 42–48 h later for PSS, and transfected cells were identified by EGFP fluorescence. When basal NPo of transfected cells was analyzed in the cell-attached configuration of the patch clamp technique, no difference was found between cells expressing EGFP alone and cells expressing the fusion protein EGFP-RGS16. NPo was 0.019 ± 0.003 in cells expressing EGFP (n = 7) and 0.018 ± 0.002 in cells expressing EGFP-RGS16 (n = 13). As shown in Fig. 4AGo, superfusion of the transfected cells with 100 nM 2-iodomelatonin resulted in a 50% suppression of NPo in cells expressing the fusion protein EGFP-RGS16 (0.03 ± 0.0037; n = 13) as compared with cells expressing EGFP alone (0.061 ± 0.0072; n = 7). RGS16 is a GTPase-activating protein that inactivates members of the Gi and Gq subfamilies (23). To verify that the inhibitory effect of EGFP-RGS16 is due to the inhibition of Gq{alpha} by the RGS part of the fusion protein, the Gq{alpha}-induced induction of firefly luciferase under control of a serum response element was studied in HEK-293 cells (24) (Fig. 4BGo). Overexpression of the GTPase-deficient but RGS-sensitive Gq{alpha}RC mutant (25) induced luciferase production by about 46.4 ± 1.8-fold above control. Whereas expression of RGS16 or the fusion protein EGFP-RGS16 exhibited no effect on basal luciferase production in HEK cells devoid of Gq{alpha}RC overexpression (control), there was a marked suppression of luciferase production in cells overexpressing Gq{alpha}RC and RGS16 or Gq{alpha}RC and EGFP-RGS16. In the presence of RGS16 and EGFP-RGS16, only 13.5 ± 1.3-fold and 23.2 ± 6.3-fold increases by Gq{alpha}RC were observed (n = 4, respectively). Taken together, these results indicate that the EGFP-RGS16 fusion protein is functionally active and the suppression of the 2-iodomelatonin-induced transient rise of NPo in cultured NPM cells overexpressing EGFP-RGS16 is due to the inactivation of Gq{alpha} by the fusion protein.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. The Rise of NPo Induced by 2-Iodo-Melatonin Is Mediated by Gq

A, EGFP-RGS16 suppresses the rise of NPo induced by 2-iodomelatonin. Maximal enhancement of NPo evoked by 100 nM iodomelatonin (2-I-Mel) in cultured myometrial smooth muscle cells (obtained from nonpregnant rats) overexpressing either EGFP alone or the fusion protein EGFP-RGS16. Bars represent mean values ± SEM of seven (EGFP) and 13 (EGFP-RGS16) cells, which were obtained from five different cell cultures, respectively. Single-channel NPo of BKCa channels was recorded in the cell-attached patch-clamp configuration; the holding potential in the pipette was -80 mV. **, P < 0.01. B, EGFP-RGS16 suppresses Gq{alpha}RC-induced signaling similar to RGS16. HEK-293 cells were cotransfected with the inducible pSRE.L-luciferase reporter plasmid (0.17 µg per well) expressing firefly luciferase and pRL-TK control reporter vector (0.03 µg per well) expressing Renilla luciferase, in the absence and presence of expression plasmids for Gq{alpha}RC (0.15 µg per well), pcDNA3-RGS16 (0.65 µg per well), or pCMV-EGFP-RGS16 (0.65 µg per well) as indicated. The activities of the luciferases were measured 24 h post transfection. The activities of the firefly luciferase were normalized against the level of expressed Renilla luciferase. The ratio of firefly luciferase to Renilla luciferase in noninduced cells is defined as 1-fold. Results are means ± SE (n = 4). ***, P < 0.001; and *, P < 0.05 vs. basal Gq{alpha}RC.

 
Next, it was investigated whether activation of PLC was involved in the 2-iodomelatonin-induced transient increase in NPo. When freshly isolated NPM (n = 9) and PM (n = 8) cells were incubated for 5 min with 2.5 µM U-73122, an effective inhibitor of PLC in smooth muscle (26), and subsequently superfused with 100 nM 2-iodomelatonin, no significant rise of NPo was detectable (Fig. 5Go, A and C). In contrast, incubation of six NPM and five PM cells with 2.5 µM U-73343, an inactive analog of U-73122, resulted in an unopposed (~10-fold) increase in NPo when superfused with 100 nM 2-iodomelatonin (Fig. 5Go, B and D). The results of Fig. 5Go clearly establish the importance of activated PLC for the stimulation of BKCa channel activity by 2-iodomelatonin.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. The Transient Rise of NPo Induced by 2-Iodomelatonin Requires Activation of PLC

Time course of NPo measured over 10 min in NPM and PM rat uterine myocytes incubated for 5 min with 2.5 µM of the PLC inhibitor, U-73122 (A and C), and 2.5 µM of its inactive analog, U-73343 (B and D). NPo is shown before and in the presence of 100 nM 2-iodomelatonin (2-I-Mel; indicated by the line). Mean values ± SEM of nine (A), six (B), eight (C), and five (D) cells, obtained from five, four, and three (B and D) rats, respectively, are shown. Single-channel NPo of BKCa channels was recorded in the cell-attached patch-clamp configuration; the holding potential in the pipette was -80 mV.

 
Effects of Isoprenaline and 2-Iodomelatonin on Whole-Cell Outward Current (Iout)
Activated melatonin receptors have been shown to mediate inhibition of cAMP accumulation via Gi/o proteins (for review see Refs. 9 and 15). Experiments were therefore performed to investigate the effects of 2-iodomelatonin in myometrial smooth muscle cells pretreated with the ß-adrenoceptor agonist isoprenaline. To obtain current-voltage relations, NPM and PM cells were clamped in the whole-cell patch-clamp configuration every 5 sec from a holding potential of -10 mV to -60 mV for 300 msec and then in 10 mV increments to +80 mV. As shown by the current-voltage relations in Fig. 6Go, application of 10 µM isoprenaline induced a pronounced decrease of Iout in nine NPM cells (Fig. 6AGo), whereas an increase was observed in 10 PM cells (Fig. 6BGo). When the effects of isoprenaline were maximal after 4 min, cells were additionally superfused with 10 µM 2-iodomelatonin. In NPM cells 2-iodomelatonin antagonized the isoprenaline effect by partially restoring Iout (Fig. 6AGo). In PM cells, however, 2-iodomelatonin did not antagonize, but further augmented, the isoprenaline-enhanced current at all potentials. Both effects were maximally developed within 5 min and persisted as long as 2-iodomelatonin was present. Although maximal at 10 µM (Fig. 6Go), effects on the isoprenaline-modulated Iout were also detected at 10 and 100 nM of 2-iodomelatonin (not shown). When NPM and PM cells were superfused with 10 µM 2-iodomelatonin in the absence of isoprenaline, no significant change of Iout was observed. The mean current densities at +80 mV were 29.7 ± 3.9 (control) and 27.6 ± 3.1 pA pF-1 (10 µM 2-iodomelatonin) in seven NPM and 59.3 ± 11.8 (control) and 57.2 ± 11.1 pA pF-1 (10 µM 2-iodomelatonin) in eight PM cells. Representative Iout traces obtained from a NPM and PM cell, clamped for 300 ms from -10 to +80 mV, are also presented in Fig. 6Go. It is shown that the control current amplitude is larger in the PM cell (1364 pA vs. 635 pA in the NPM cell), which corresponds with the higher NPo in cell-attached patches. The enhanced current amplitude in PM cells was not due to myometrial smooth muscle hypertrophy because the difference between current amplitudes in NPM and PM cells persisted after normalizing currents to membrane capacitance, as shown by the current-voltage relations in Fig. 6Go.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6. Opposite Effects of 2-Iodomelatonin on Isoprenaline-Modulated Iout

Current-voltage relations from NPM (n = 9; panel A) and PM (n = 10; panel B) rat uterine myocytes are shown. Cells were obtained from five animals in each group. Mean current densities are plotted against the respective test potential. Currents were evoked by applying a 300-msec depolarizing pulse every 10 sec in 10-mV increments from a holding potential of -10 mV. Cells were superfused with 10 µM isoprenaline (Iso) first and then additionally with 10 µM 2-iodomelatonin (2-I-Mel). The insets show representative Iout recordings elicited by 300-msec pulses from a holding potential of -10 to +80 mV. Numbers in parentheses indicate the sequence of drug applications. The pipette solution contained 0.3 µM Ca2+.

 
Luzindole Antagonizes the Effects of 2-Iodomelatonin on Iout
To verify that melatonin receptors are involved in the effects of 2-iodomelatonin on BKCa channel activity, Iout induced in NPM and PM cells was investigated in the presence of the nonselective melatonin receptor antagonist luzindole (10 µM). In the experiments shown in Fig. 7Go, cells were clamped every 5 sec from a holding potential of -10 mV to +80 mV for 300 msec. As can be seen from the original current traces (panels A and B) and from the mean current densities (panels C and D), superfusion of six NPM and six PM cells with luzindole for 10 min had no significant effect on the respective control currents. As expected, 10 µM isoprenaline decreased within 5 min the current of NPM cells by 50% (vs. control; panel C) and enhanced the current of PM cells by 80% (vs. control; panel D). Additional application of 10 µM 2-iodomelatonin for 5 min had no further influence on the isoprenaline-modulated Iout. As described before (Fig. 6Go), a superfusion time of 5 min with 2-iodomelatonin was sufficient to fully antagonize or enhance the currents modulated by isoprenaline. Thus, Fig. 7Go provides evidence that 2-iodomelatonin acts via melatonin receptors. However, when the superfusion time with 2-iodomelatonin in the presence of luzindole plus isoprenaline was prolonged to 15 min in nine NPM cells, current density increased significantly (P < 0.01) from 16.2 ± 2.9 (luzindole plus isoprenaline) to 23.6 ± 2.8 pA pF-1, which in turn was not significantly different from the control current density measured before luzindole was applied (27.9 ± 1.0 pA pF-1). This finding indicates that the antagonism by luzindole is reversible but dissociation of luzindole from its receptor is a slow process.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 7. Luzindole Inhibits the Effects of 2-Iodomelatonin in the Presence of Isoprenaline

Currents were evoked in NPM and PM rat uterine myocytes by applying 300-msec depolarizing pulses from a holding potential of -10 to +80 mV. Original current recordings from a NPM (panel A) and a PM (panel B) cell exposed to the nonselective melatonin receptor antagonist luzindole (Lu; 10 µM for 10 min) first, then to luzindole plus 10 µM isoprenaline (Iso), and then additionally to 10 µM 2-iodomelatonin (2-I-Mel) are shown. Numbers in parentheses denote the sequence of drug applications. C and D, Average results from six NPM and six PM cells, obtained from three rats in each group. Bars represent mean values ± SEM of current densities. The pipette solution contained 0.3 µM Ca2+. **, P < 0.01 vs. luzindole; ns, not significant (P > 0.05).

 
Influence of PTX on 2-Iodomelatonin-Modulated Iout
To determine whether Gi proteins are involved in both the inhibitory and stimulatory effects on Iout when 2-iodomelatonin was applied in the presence of isoprenaline, experiments were carried out on seven NPM and six PM cells pretreated for 5 h with 400 ng ml-1 PTX. Subsequently these cells were clamped in the whole-cell patch configuration every 5 sec from a holding potential of -10 to -60 mV and then by 10-mV increments to +80 mV for 300 msec. The resulting current-voltage relations shown in Fig. 8Go, A and B, demonstrate that the modulating effect of 10 µM isoprenaline on Iout was preserved in the presence of PTX (compare Fig. 6Go). Additional superfusion of cells with 10 µM 2-iodomelatonin, however, produced no further change in current. This failure of 2-iodomelatonin to influence Iout in PTX-treated cells, indicates that Gi proteins are involved in the inhibitory as well as in the stimulatory effects of 2-iodomelatonin.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8. PTX Abolishes the Effects of 2-Iodomelatonin on Isoprenaline-Modulated Iout

Current-voltage relations from NPM (n = 7; panel A) and PM (n = 6; panel B) rat uterine myocytes are shown. NPM and PM cells were obtained from four and five animals, respectively. Mean current densities are plotted against the respective test potential. Currents were evoked by applying 300-msec depolarizing pulses in 10-mV steps from a holding potential of -10 mV. Cells were pretreated for 5 h with 400 ng ml-1 PTX, thereafter superfused with 10 µM isoprenaline (Iso), followed by the additional application of 10 µM 2-iodomelatonin (2-I-Mel). The insets show representative Iout recordings elicited by 300-msec pulses from -10 to +80 mV. Numbers in parentheses indicate the sequence of drug applications. The pipette solution contained 0.3 µM Ca2+.

 
Isoprenaline and 2-Iodomelatonin Act through cAMP-Dependent Pathways
Signal transduction pathways initiated by isoprenaline and 2-iodomelatonin in myometrial smooth muscle cells most likely interfere at the level of adenylyl cyclase regulation and thus are mediated via the cAMP-PKA cascade. We therefore studied whether inhibition of PKA would reverse the effects of isoprenaline and 2-iodomelatonin on Iout of NPM and PM cells. The experiments shown in Fig. 9Go were carried out with 1 µM H-89, a specific inhibitor of PKA at this concentration (27). Iout was elicited by depolarizing NPM and PM cells for 300 msec from a holding potential of -10 to +80 mV. It is shown that H-89 completely reversed the effect of 10 µM isoprenaline on current densities obtained from six NPM and six PM cells (Fig. 9AGo). A similar inhibitory effect of H-89 on current densities was observed in 12 NPM and six PM cells that had been treated previously with isoprenaline plus 2-iodomelatonin (Fig. 9BGo). H-89 alone had no significant effect on Iout. The mean current densities were 40.7 ± 9.8 (control) and 39.9 ± 8.8 pA pF-1 (1 µM H-89) in six NPM and 62.8 ± 12.3 (control) and 64.9 ± 11.6 pA pF-1 (1 µM H-89) in five PM cells. Thus, the findings clearly indicate that both the ß-adrenoceptor- and the melatonin receptor agonists produce their effects on BKCa channel activity in the whole-cell patch configuration exclusively via the cAMP-PKA cascade.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 9. The PKA Inhibitor H-89 Inhibits the Effects of Isoprenaline and 2-Iodomelatonin on Iout

Currents were evoked by applying a 300-msec depolarizing pulse every 10 sec from a holding potential of -10 to +80 mV. After recording control currents from NPM and PM rat uterine myocytes, cells were superfused with 10 µM isoprenaline (Iso) first and then additionally with 1 µM H-89 (A) or with 10 µM isoprenaline plus 10 µM 2-iodomelatonin (2-I-Mel) first and then additionally with 1 µM H-89 (B). Bars represent mean current densities of six NPM and six PM cells from three rats in each group in panel A and of 12 NPM and six PM cells from eight and four rats, respectively, in panel B. **, P < 0.01; ***, P < 0.001.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Recently, the transcripts of MT1 and MT2 melatonin receptors have been detected in the human myometrium by means of RT-PCR, and it has been proposed that melatonin may have the potential to modulate myometrial function in the human (7). Contrary to human myometrium, 2-[125I]iodomelatonin binding sites in rat uterus were localized by autoradiography to the uterine antimesometrial endometrial stroma but were not detected in the myometrium (3, 28). Our results, however, clearly argue for the presence of melatonin receptors in the rat myometrium. First, cells isolated from the rat uterus after removal of the endometrial layer responded regularly with an increase in BKCa channel activity to 2-iodomelatonin but failed to respond when luzindole, a nonselective melatonin receptor antagonist (29), was present. Second, immunohistochemistry of cross-sections of the rat uterus with an antibody highly specific for the BKCa channel {alpha}-subunit confined the expression of BKCa channels to the myometrial layers with virtually no expression in the endometrium (see Fig. 1Go). Because BKCa channel activity was used in the present study to follow signal transduction pathways induced by melatonin (see below), it is concluded that cells with BKCa currents are cells of myometrial origin. Third, transcripts representing MT1 and MT2 receptors could be identified by means of RT-PCR in cultured cells from rat myometrium. These cells consistently exhibited BKCa channel activity and regulation by 2-iodomelatonin when tested in patch-clamp experiments, indicating also that the receptor proteins are expressed. Recently we have shown, by selective blockage of BKCa channels with iberiotoxin (IbTX), that these channels contribute to the whole-cell Iout in NPM and PM cells (19). Only a minor fraction of Iout (10–15%) was insensitive to IbTX and can thus be considered caused by the opening of channels other than BKCa channels. As reported previously (19), recording of Iout was successfully used to demonstrate the signaling of {alpha}2-adrenoceptors via the Gi-AC-PKA pathway. In the same study it was also established that only the Iout conducted through BKCa channels was sensitive to this pathway. Whole-cell Iout was therefore used in the present study to investigate this part of the melatonin receptor signaling. Contrary to the more membrane-delimited Gi-dependent signaling, probing the Gq-mediated Ca2+-release by means of BKCa channel activity required an intact cell and could be best reproduced in the cell-attached configuration. Due to the open access of the patch-pipette filling solution to the cell interior, buffering or loss of cytosolic factors may have hampered Ca2+ release in the whole-cell patch configuration.

Signaling of Melatonin Receptor to BKCa Channels by the Gq/11-PLC Pathway
Sequence analysis of the cloned melatonin receptors indicates that they comprise a novel group within the large G protein-coupled receptor superfamily (8, 9). Activation of melatonin receptors elicits multiple cellular responses that are mediated by both PTX-sensitive (Gi2 and Gi3) and PTX-insensitive (Gq/11) G proteins (for review see Refs. 9 and 15). Superfusion of intact uterine myocytes from nonpregnant and pregnant rats with 2-iodomelatonin resulted in a marked but transient increase in BKCa channel open probability (see Fig. 3Go). BKCa channels are activated by several mechanisms including elevation of free Ca2+ in the vicinity of the channel’s cytoplasmic calcium-sensing domain (30, 31, 32) and phosphorylation of the channel protein via the cAMP/PKA or cGMP/protein kinase G cascade (33, 34, 35). Channel phosphorylation by PKA, however, was an unlikely mechanism for this PTX-insensitive effect because activation of MT1 and MT2 receptors inhibits intracellular cAMP formation via PTX-sensitive Gi proteins (for review see Refs. 9 and 15). Phosphorylation of BKCa channels by protein kinase G can also be ruled out because signaling via melatonin receptors has either no effect (via MT1) or an inhibitory effect on cGMP levels (via MT2) (36). Therefore, a more likely explanation for the transient rise of BKCa channel activity in both NPM and PM cells is the mobilization of Ca2+ from intracellular stores via activation of the phosphoinositol-specific phospholipase C (PLC) pathway. Indeed, U-73122, a potent inhibitor of agonist-induced PLC activation in smooth muscle (26), strongly suppressed the 2-iodomelatonin effect in rat myometrial cells. Our finding, that treatment of the cells with PTX had no influence on the 2-iodomelatonin-induced rise of NPo, excludes a Gi protein-mediated effect on PLC via ß{gamma}-subunits as described previously in NIH 3T3 cells expressing the human MT1 receptor (14). On the other hand, overexpression of RGS16 in cultured myometrial cells from nonpregnant rats markedly decreased the melatonin effect on BKCa channel activity. RGS16 is a GTPase-activating protein that acts on members of the Gi{alpha}- and Gq{alpha}-subfamily and converts the active GTP-bound {alpha}-subunit to the inactive GDP-bound form, which then reassembles with the respective ß{gamma}-dimers (for review see Ref. 23). Because coupling to Gi proteins was already excluded by the PTX experiments, signaling of melatonin to PLC in rat myometrial cells must be dependent on Gq proteins. A similar pathway has been described in ovine pars tuberalis cells endogenously expressing MT1 receptors, and in HEK-293 cells stably transfected with the human MT1 receptor (12). Interestingly, the melatonin-induced Ca2+ transients shown by Brydon and co-workers (12) closely resemble the Ca2+-dependent activation curves of BKCa channel open probability in myometrial cells. Indeed, because of its high Ca2+ sensitivity, BKCa channel activity has been successfully used to monitor intracellular calcium concentration in the subsarcolemmal space of arterial smooth muscle cells (37) and in several types of nonexcitable cells (for review see Ref. 38).

Signaling of Melatonin Receptor to BKCa Channels by the Gi-AC-PKA Pathway
Activation and inactivation of potassium channels by melatonin have been reported. Whereas activation by melatonin of a G protein-activated inward rectifier potassium channel Kir3 through a PTX-sensitive mechanism seems well established (39, 40), more indirect evidence has been presented for inhibition of BKCa channels in rat cerebral arteries (41, 42). In the present study, however, 2-iodomelatonin failed to influence whole-cell Iout conducted through BKCa channels in the absence of isoprenaline, a finding that is compatible with the view that melatonin, except by Ca2+ mobilization, is devoid of any receptor-mediated direct effect on the BKCa channel. Furthermore, a receptor-independent modulation of BKCa channels can be ruled out by our experiments in which luzindole was shown capable of abolishing the response to 2-iodomelatonin.

ß-Adrenoceptor agonists are widely used for prevention of premature labor due to their relaxing effects on the myometrium. They are thought to act via a cascade that involves stimulatory G proteins (Gs), adenylyl cyclase (AC), cAMP, and finally PKA activation. Myometrial relaxation is then induced by pleiotropic mechanisms including activation of BKCa channels, which are important targets for regulation by PKA (43, 44). As described previously (19, 45), the ß-adrenoceptor agonist isoprenaline regulates BKCa channel activity differentially by augmenting the current in pregnant and inhibiting the current in nonpregnant myometrial cells. The mechanism by which BKCa channels are regulated differentially by PKA is presently unknown but may involve expression of BKCa channel isoforms, different heteropolymeric assembly of channel subunits, and/or expression of associated proteins with modulatory function. Activated MT1 and MT2 receptors have been shown to mediate inhibition of forskolin-stimulated cAMP formation via PTX-sensitive Gi proteins without affecting basal cAMP levels (12, 16, 18, 46). In accordance with this signaling pathway, 2-iodomelatonin partially reversed the isoprenaline effect on whole-cell Iout in myocytes from nonpregnant myometrium. Conversely, 2-iodomelatonin potentiated the isoprenaline-stimulated Iout in cells from pregnant myometria. Abolition of all effects on Iout induced by isoprenaline or isoprenaline plus 2-iodomelatonin by H-89, a specific inhibitor of PKA (27), clearly demonstrates the causal relation between kinase activation and channel activity. The finding that both the negative and the positive input of 2-iodomelatonin to Iout was completely abolished in cells treated with PTX points to Gi proteins being responsible for both signal transduction pathways. Recently, a similar switch from inhibitory to stimulatory input in the rat myometrium has been described for the {alpha}2-adrenoceptor agonist clonidine in the presence of isoprenaline (19, 47). Both melatonin receptors and {alpha}2-adrenoceptors couple to Gi proteins, and this indicates that the switch might be a general phenomenon for Gi-coupled receptors. In the pregnant myometrium, convergent stimulation through different receptors could readily contribute to the myometrial quiescence by an increased production of cAMP.

At present the basis for the differential effects of iodomelatonin and clonidine is not known but may involve expression of different adenylyl cyclase (AC) isoforms in the pregnant and nonpregnant myometrium. At least nine separate isoforms of AC that differ in their regulatory mechanism and in their tissue-specific distribution have been identified (48). Among the AC isoforms identified in rat myometrium (49, 50), types II, IV, and VII are unique in that they can be directly stimulated by ß{gamma}-subunits of Gi/o inhibitory proteins in the presence of activated Gs{alpha} (51). Up-regulation of ß{gamma}-sensitive AC isoforms during pregnancy would be a logical explanation for the present results, but studies published so far on AC isoform transcripts in rat myometrium are still inconclusive. Whereas an approximately 2- to 3-fold increase in the mRNA levels for ß{gamma}-sensitive AC isoforms was reported to occur between d 10 and d 17 of pregnancy in rats (50), no significant changes were reported by others (49). Alternatively, melatonin receptors could couple more efficiently to inhibitory G proteins during pregnancy and thus enable ß{gamma}-dimers at high levels to override the inhibitory effect of Gi{alpha}.

In conclusion, the data presented in this study indicate, first, that melatonin activates signal transduction pathways involving both Gi and Gq proteins in the myometrium. Second, the opposing effects of ß-adrenoceptor agonists and melatonin are switched to a synergistic action during pregnancy. Third, the mRNAs of two melatonin receptors MT1 and MT2 are present in the rat myometrium. The data additionally demonstrate that monitoring the activity of BKCa channels under specific settings is a highly sensitive and reliable method to follow both Ca2+ mobilization and the cAMP/PKA cascade in myometrial smooth muscle cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
2-Iodomelatonin was obtained from Tocris (Köln, Germany); luzindole, U-73122, and U-73343 were purchased from Calbiochem (Bad Soden, Germany); the cAMP-dependent protein kinase (PKA) inhibitor H-89 was from Biomol (Hamburg, Germany), (±)-isoprenaline was obtained from Sigma (Taufkirchen, Germany), IbTX was from Alomone Laboratories (Jerusalem, Israel), and PTX was purchased from List Biological Laboratories (Campbell, CA). 2-Iodomelatonin and H-89, U-73122, and U-73343 were dissolved in dimethyl sulfoxide and luzindole was dissolved in ethanol. All other drugs were dissolved in PSS (see below); solutions with IbTX contained 0.1% bovine albumin fraction V (Sigma). Collagenase type H (lot 57H6832), hyaluronidase type I-S, papain, BSA, normal goat serum, Triton X-100, 3,3'-diaminobenzidine tetrahydrochloride, and benzamidine hydrochloride hydrate were purchased from Sigma, and 1,4-dithio-D,L-threitol was from Gerbu Biotechnik (Gaiberg, Germany).

BKCa Channel Antibody Production
A polyclonal serum was raised against the C-terminal residues 674-1115 of the bovine BKCa channel {alpha}-subunit (35) expressed in Escherichia coli BL21(DE3) by using the pLysS vector (Invitrogen, Karlsruhe, Germany). The pure immunogenic protein emulsified in Freund’s adjuvant was injected into rabbits. The recombinant antigen was blotted on polyvinylidene difluoride membrane (Millipore, Schwalbach, Germany). The antiserum was incubated with the membrane at 4 C overnight by gentle rotation, and the antibody was eluated with 0.1 M glycine, pH 2.5. After addition of 1 M K3PO4, pH 8.0, the resulting solution was dialyzed against 0.5 M NaCl, 0.1 M K3PO4, 2 mM EDTA, 2 mM benzamidine hydrochloride, pH 7.0. The dialyzed antibody fraction was up-concentrated in a Vivaspin concentrator (Sartorius, Göttingen, Germany) and stored at 4 C without loss of activity.

Immunohistochemistry
Immunohistochemical experiments were performed using on-slide 12-µm cryosections of nonpregnant rat uteri perfused with 4% paraformaldehyde. These tissue sections were incubated with TBS (150 mM NaCl, 100 mM Tris, pH 7.2) containing 0.2% Triton (TBS-T) for 2 h. The endogenous peroxidase activity was blocked with 0.6% H2O2 and 25% methanol in TBS for 20 min. Afterward, the sections were preincubated for 2.5 h with 2% normal goat serum in TBS-T, pH 7.2, containing 2% BSA and 0.2% milk powder. Then, the uterus sections were incubated for 12 h with anti-BKCa channel antibody diluted to a final concentration of 1:1000 with 1% BSA/TBS-T, pH 7.2. The slices were washed five times with TBS-T and incubated with peroxidase-conjugated goat antirabbit IgG, after which the immunoreaction was visualized by the common 3,3'-diaminobenzidine tetrahydrochloride method. In control sections no immunoreactivity was observed.

Construction of EGFP-RGS16 Expression Vector
The cDNA of mouse RGS16 (52) was amplified by PCR using primer 1, AAAAAAAGATCTATGTGCCGCACCCTAGCC and primer 2, TTTTTTTGGATCCGTGTGTGAAGGATAAGC. The resulting 627-bp fragment was inserted into the BglII-BamHI sites of pEGFP-C1 (CLONTECH), where EGFP indicates enhanced green fluorescent protein, resulting in the vector pCMV-EGFP-RGS16, where CMV indicates cytomegalovirus. The identity of the construct was verified by commercial DNA sequence analysis.

Assay of Serum Response Factor-Induced Luciferase Expression
Rho-dependent activation of serum response factor was measured in HEK-293 cell extracts with the Dual Luciferase Reporter Assay System (Promega, Mannheim, Germany). HEK-293 cells seeded on 12-well plates were cotransfected with different expression plasmids together with pSRE.L-luciferase reporter plasmid, a gift from Drs. J. Mao and D. Wu (University of Rochester, Rochester, NY), and pRL-TK control reporter vector using Polyfect according to the manufacturer’s instructions (QIAGEN, Hilden, Germany). The luciferase activities were determined 24 h post transfection with a Lumat counter (Berthold, Pforzheim, Germany) as described (24). The activity of the experimental reporter was normalized against the activity of the control vector.

Animals
All experimental procedures were carried out according to the animal welfare guidelines of the University Hospital Hamburg-Eppendorf. Female Wistar rats were obtained from a colony bred and maintained at the animal house of the University Hospital Hamburg-Eppendorf. To obtain myometria from pregnant animals, females were caged with males overnight, and successful mating was determined by the presence of spermatozoa in the vaginal smear (d 1 of pregnancy). Animals were killed on d 11 or 12 of gestation, which corresponds to midpregnancy. Myometria were dissected from rats killed by CO2. Usually the animals were killed between 1000 and 1100 h.

Cell Preparation
After the connective tissue was removed and the endometrium was cut away, the uterine smooth muscle was cut into cubes of 1–2 mm side length and incubated at 37 C in Ca2+-free PSS including 0.7 mg ml-1 papain, 1 mg ml-1 1,4-dithio-D,L-threitol, and 1 mg ml-1 fat-free BSA. Thirty minutes later, the tissue pieces were transferred into PSS solution containing 50 µM Ca2+, 1 mg ml-1 collagenase, 1 mg ml-1 hyaluronidase, and 1 mg ml-1 albumin, and digested for another 10–15 min at 37 C. Single cells were released by gentle trituration and stored in PSS at room temperature. After isolation, 30–40% of the cells were relaxed, and only these cells were used for electrophysiological studies. Experiments were conducted within 6 h of cell isolation.

Cell Culture and Transfection of Myometrial Smooth Muscle Cells
Isolated myocytes (~400,000 cells per well) were plated on six-well plates in Waymouth’s MB 7524/1 medium (Invitrogen, Karlsruhe, Germany) containing 10% (vol/vol) fetal calf serum, 1% (by mass) penicillin/streptomycin, and 100 µM 5'-bromo-desoxyuridine. Cells were cultured for at least 6 d to obtain a pure culture of nondividing myometrial smooth muscle cells before isolation of RNA. Twenty-four hours after plating, cells were transfected by calcium phosphate precipitation. Briefly, 2 µg of the vector, pEGFP-N1 or pCMV-EGFP-RGS16, was resolved in a BBS buffer (200 µl total volume) consisting of (in mM concentration) BES, 25; NaCl, 140; Na2HPO4, 0.75. CaCl2 (125 mM final concentration) was added and the mixture was incubated for 20 min at room temperature. The mixture was applied to the cells dropwise and gently mixed. Cells were kept for 18 h at 35 C and 3% CO2 and then washed with PBS. Fresh medium was added and the cells were further cultured at standard conditions (37 C, 5% CO2) for 24 h before electrophysiological recording.

RT-PCR
RNA was isolated from cultured myometrial smooth muscle cells, rat myometrial tissue, or rat brain with TRIzol (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. The RNA was transcribed into cDNA using oligo-dT primers and 200 U Superscript II (Invitrogen) for 90 min at 45 C. PCR conditions for the amplification of MT1- and MT2-specific cDNA fragments were as follows (50 µl): primer, 0.3 µM each; deoxynucleoside triphosphate, 0.3 mM; 1x Advantage 2 PCR buffer; Advantage 2 Taq-Polymerase (CLONTECH), 1.25 U; and 10 µl of cDNA. Forty cycles under the following conditions were performed: denaturation, 94 C, 45 sec; annealing, 66 C (MT1), 64 C (MT2), 50 sec; elongation, 72 C, 45 sec followed by a final acquisition of 5 min at 72 C. Primer sequences: MT1-fw: TGG ACA CTG ACA CTC ATA GCC ATC; MT1-bw: TAA CTA GCC ACG AAG AGC CAC TCC; MT2-fw: CAT CTG TCA CAG TGC GAC CTA; MT2-bw: CAC AAA CAC TGC GAA CAT GGT. The PCR products were visualized by ethidium bromide staining in an 1.5% agarose gel.

Recording Techniques
Standard patch-clamp recording techniques were used to measure currents in the cell-attached or whole-cell patch configuration (53). Currents were recorded at 25 C using a List Electronics EPC-7 patch-clamp amplifier, connected via a 16 bit A/D interface to a pentium IBM clone computer. The data were filtered at 1 kHz by a 10-pole Bessel filter and sampled at 3 kHz. Data acquisition and analysis were performed with an ISO-3 multitasking patch-clamp program (MFK M. Friedrich, Niedernhausen, Germany). The pipette resistance ranged from 2–3 M{Omega} in whole-cell and 3–4 M{Omega} in the cell-attached patch experiments. The amplitude of single-channel currents was derived from an amplitude distribution histogram. Determination of the average channel open probability (NPo) has been described elsewhere (54). After the patch had been equilibrated for at least 5 min, drugs were superfused for another 4–5 min before the mean NPo was determined.

Solutions
For cell-attached patch experiments, the bath solution (PSS) and the pipette solution were identical and contained (in mM concentration): 127 NaCl, 5.9 KCl, 2.4 CaCl2, 1.2 MgCl2, 11 glucose, and 10 HEPES adjusted to pH 7.4 with NaOH.

For whole-cell experiments, the intracellular (pipette) solution contained (in mM concentration): 134 KCl, 6 NaCl, 1.2 MgCl2, 5 EGTA, 11 glucose, 3 dipotassium ATP, and 10 HEPES (pH 7.4). The free Ca2+ concentration was adjusted to 300 nM by adding the appropriate amount of CaCl2 according to a computer program (55) on the basis of the binding constants of Fabiato (56) and checked by fura-2 fluorescence.

Statistics
Origin for Windows (version 6; Microcal Software, Northampton, MA) was used for statistical analyses. Significance was determined by either paired t test or one-way ANOVA for repeated measurements on the same patch. When a significant effect was detected with ANOVA, Student’s t test was used for pair-wise comparisons. P < 0.05 was considered statistically significant. Data are expressed as means ± SE.


    ACKNOWLEDGMENTS
 
We thank Tina Ruttkowski for excellent technical assistance and Cornelia Blume for construction of pCMV-EGFP-RGS16.


    FOOTNOTES
 
This work was supported by a grant from Deutsche Forschungsgemeinschaft to M.K. and T.W.

Abbreviations: AC, Adenylyl cyclase; BKca, large-conductance Ca2+-activated K+ channel; EGFP, enhanced green fluorescent protein; IbTX, iberiotoxin; Iout, whole-cell outward current; NPM, nonpregnant myometrium; NPo, channel open probability; PKA, protein kinase A; PLC, phospholipase C; PM, pregnant myometrium; PSS, physiological salt solution; PTX, pertussis toxin.

Received for publication February 10, 2003. Accepted for publication July 7, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Brzezinski A 1997 Melatonin in humans. N Engl J Med 336:186–195[Free Full Text]
  2. Nakazawa K, Marubayashi U, McCann SM 1991 Mediation of the short-loop negative feedback of luteinizing hormone (LH) on LH-releasing hormone release by melatonin-induced inhibition of LH release from the pars tuberalis. Proc Natl Acad Sci USA 88:7576–7579[Abstract/Free Full Text]
  3. Zhao H, Pang SF, Poon AM 2002 mt1 Receptor-mediated antiproliferative effects of melatonin on the rat uterine antimesometrial stromal cells. Mol Reprod Dev 61:192–199[CrossRef][Medline]
  4. Gimeno MF, Landa A, Sterin-Speziale N, Cardinali DP, Gimeno AL 1980 Melatonin blocks in vitro generation of prostaglandin by the uterus and hypothalamus. Eur J Pharmacol 62:309–317[CrossRef][Medline]
  5. Hertz-Eshel M, Rahamimoff R 1965 Effect of melatonin on uterine contractility. Life Sci 4:1367–1372[CrossRef][Medline]
  6. Ayar A, Kulu S, Yilmaz B, Kelestimur H 2001 Melatonin inhibits spontaneous and oxytocin-induced contractions of rat myometrium in vitro. Neuroendocrinol Lett 22:199–207[Medline]
  7. Schlabritz-Loutsevitch N, Hellner N, Middendorf R, Müller D, Olcese J 2003 The human myometrium as a target for melatonin. J Clin Endocrinol Metab 88:908–913[Abstract/Free Full Text]
  8. Reppert SM, Weaver DR, Godson C 1996 Melatonin receptors step into the light: cloning and classification of subtypes. Trends Pharmacol Sci 17:100–102[CrossRef][Medline]
  9. Masana MI, Dubocovich ML 2001 Melatonin receptor signaling: finding the path through the dark. Sci STKE 107:PE39
  10. Witt-Enderby PA, Dubocovich ML 1996 Characterization and regulation of the human ML1A melatonin receptor stably expressed in Chinese hamster ovary cells. Mol Pharmacol 50:166–174[Abstract]
  11. Witt-Enderby PA, Masana MI, Dubocovich ML 1998 Physiological exposure to melatonin supersensitizes the cyclic adenosine 3',5'-monophosphate-dependent signal transduction cascade in Chinese hamster ovary cells expressing the human mt1 melatonin receptor. Endocrinology 139:3064–3071[Abstract/Free Full Text]
  12. Brydon L, Roka F, Petit L, de Coppet P, Tissot M, Barrett P, Morgan PJ, Nanoff C, Strosberg AD, Jockers R 1999 Dual signalling of human Mel1a melatonin receptors via Gi2, Gi3, and Gq/11 proteins. Mol Endocrinol 13:2025–2038[Abstract/Free Full Text]
  13. McArthur AJ, Hunt AE, Gillette MU 1997 Melatonin action and signal transduction in the rat suprachiasmatic circadian clock: activation of protein kinase C at dusk and dawn. Endocrinology 138:627–634[Abstract/Free Full Text]
  14. Godson C, Reppert SM 1997 The Mel1a melatonin receptor is coupled to parallel signal transduction pathways. Endocrinology 138:397–404[Abstract/Free Full Text]
  15. Witt-Enderby PA, Bennett J, Jarzynka MJ, Firestine S, Melan MA 198 2003 Melatonin receptors and their regulation: biochemical and structural mechanisms. Life Sci 72:2183–2198[CrossRef][Medline]
  16. Reppert SM, Godson C, Mahle CD, Weaver DR, Slaugenhaupt SA, Gusella JF 1995 Molecular characterization of a second melatonin receptor expressed in human retina and brain: the Mel1b melatonin receptor. Proc Natl Acad Sci USA 92:8734–8738[Abstract/Free Full Text]
  17. Ho MKC, Yung LY, Chan JSC, Chan JHP, Wong CSS, Wong YH 2001 G{alpha}14 links a variety of Gi- and Gs-coupled receptors to the stimulation of phospholipase C. Br J Pharmacol 132:1431–1440[CrossRef][Medline]
  18. MacKenzie RS, Melan MA, Passey DK, Witt-Enderby PA 2002 Dual coupling of MT1 and MT2 melatonin receptors to cyclic AMP and phosphoinositide signal transduction cascades and their regulation following melatonin exposure. Biochem Pharmacol 63:587–595[CrossRef][Medline]
  19. Zhou X-B, Wang G-X, Hüneke B, Wieland T, Korth M 2000 Pregnancy switches adrenergic signal transduction in rat and human uterine myocytes as probed by BKCa channel activity. J Physiol 524:339–352[Abstract/Free Full Text]
  20. Guerrero HY, Gauer F, Schuster C, Pévet P, Masson-Pévet M 2000 Melatonin regulates the mRNA expression of the mt1 melatonin receptor in the rat pars tuberalis. Neuroendocrinology 71:163–169[CrossRef][Medline]
  21. Musshoff U, Riewenherm D, Berger E, Fauteck JD, Speckmann EJ 2002 Melatonin receptors in rat hippocampus: molecular and functional investigations. Hippocampus 12:165–173[CrossRef][Medline]
  22. Browning C, Beresford I, Fraser N, Giles H 2000 Pharmacological characterization of human recombinant melatonin mt1 and MT2 receptors. Br J Pharmacol 129:877–886[CrossRef][Medline]
  23. Wieland T, Chen C-K 1999 Regulators of G-protein signalling: a novel protein family involved in timely deactivation and desensitization of signalling via heterotrimeric G proteins. Naunyn Schmiedebergs Arch Pharmacol 360:14–26[CrossRef][Medline]
  24. Blomquist A, Schwörer G, Schablowski H, Psoma A, Lehnen M, Jakobs KH, Rümenapp U 2000 Identification and characterization of a novel Rho-specific guanine nucleotide exchange factor. Biochem J 352:319–325
  25. Hepler JR, Berman DM, Gilman AG, Kozasa T 1997 RGS4 and GAIP are GTPase-activating proteins for Gq{alpha} and block activation of phospholipase Cß by {gamma}-thio-GTP-Gq{alpha}. Proc Natl Acad Sci USA 94:428–432[Abstract/Free Full Text]
  26. Gordienko DV, Bolton TB 2002 Crosstalk between ryanodine receptors and IP3 receptors as a factor shaping spontaneous Ca2+-release events in rabbit portal vein myocytes. J Physiol 542:743–762[Abstract/Free Full Text]
  27. Hidaka H, Kobayashi R 1992 Pharmacology of protein kinase inhibitors. Annu Rev Pharmacol Toxicol 32:377–397[CrossRef][Medline]
  28. Zhao H, Poon AMS, Pang SF 2000 Pharmacological characterization, molecular subtyping, and autoradiographic localization of putative melatonin receptors in uterine endometrium of estrous rats. Life Sci 66:1581–1591[CrossRef][Medline]
  29. Dubocovich ML 1988 Luzindole (N-0774): a novel melatonin receptor antagonist. J Pharmacol Exp Ther 246:902–910[Abstract/Free Full Text]
  30. Marty A 1981 Ca2+-dependent K+ channels with large unitary conductance in chromaffin cell membranes. Nature 231:497–500
  31. Palotta BS, Magleby KL, Barrett JN 1981 Single channel recordings of Ca2+-activated K+ currents in rat muscle cell culture. Nature 293:471–474[CrossRef][Medline]
  32. Schreiber M, Salkoff L 1997 A novel calcium-sensing domain in the BK channel. Biophys J 73:1355–1363[Medline]
  33. Alioua A, Tanaka Y, Wallner M, Hofmann F, Ruth P, Meera P, Toro L 1998 The large conductance, voltage-dependent, and calcium-sensitive K+ channel, hslo, is a target of cGMP-dependent protein kinase phosphorylation in vivo. J Biol Chem 273:32950–32956[Abstract/Free Full Text]
  34. Nara M, Dhulipala PDK, Wang Y-X, Kotlikoff MI 1998 Reconstitution of ß-adrenergic modulation of large conductance, calcium-activated potassium (Maxi-K) channels in Xenopus oocytes. Identification of the cAMP-dependent protein kinase phosphorylation site. J Biol Chem 273:14920–14924[Abstract/Free Full Text]
  35. Zhou X-B, Arntz C, Kamm S, Motejlek K, Sausbier U, Wang G-X, Ruth P, Korth M 2001 A molecular switch for specific stimulation of the BKCa channel by cGMP and cAMP kinase. J Biol Chem 276:43239–43245[Abstract/Free Full Text]
  36. Petit L, Lacroix I, de Coppet P, Strosberg AD, Jockers R 1999 Differential signalling of human Mel1a and Mel1b melatonin receptors through the cyclic guanosine 3'-5'-monophosphate pathway. Biochem Pharmacol 58:633–639[CrossRef][Medline]
  37. Granitkevich VY, Isenberg G 1996 Dissociation of subsarcolemmal from global [Ca2+] in myocytes from guinea-pig coronary artery. J Physiol 490:305–318[Abstract/Free Full Text]
  38. Marty A 1989 The physiological role of calcium-dependent channels. Trends Neurosci 12:420–424[CrossRef][Medline]
  39. Nelson CS, Marino JL, Allen CN 1996 Melatonin receptors activate heteromeric G-protein coupled Kir3 channels. Neuroreport 7:717–720[Medline]
  40. Nelson CS, Ikeda M, Gompf HS, Robinson ML, Fuchs NK, Yoshioka T, Neve KA, Allen CN 2001 Regulation of melatonin 1a receptor signalling and trafficking by asparagine-124. Mol Endocrinol 15:1306–1317[Abstract/Free Full Text]
  41. Geary GG, Krause DN, Duckles SP 1997 Melatonin directly constricts rat cerebral arteries through modulation of potassium channels. Am J Physiol Heart Circ Physiol 273:H1530–H1536
  42. Geary GG, Duckles SP, Krause DN 1998 Effect of melatonin in the rat tail artery: role of K+ channels and endothelial factors. Br J Pharmacol 123:1533–1540[CrossRef][Medline]
  43. Anwer K, Toro L, Oberti C, Stefani E, Sanborn BM 1992 Ca2+-activated K+ channels in pregnant rat myometrium: modulation by a ß-adrenergic agent. Am J Physiol Cell Physiol 263:C1049–C1056
  44. Hamada Y, Nakaya Y, Hamada S, Kamada M, Aono T 1994 Activation of K+ channels by ritodrine hydrochloride in uterine smooth muscle cells from pregnant woman. Eur J Pharmacol 288:45–51[CrossRef][Medline]
  45. Pérez GJ, Toro L 1994 Differential modulation of large-conductance KCa channels by PKA in pregnant and nonpregnant myometrium. Am J Physiol Cell Physiol 266:C1459–C1463
  46. Reppert SM, Weaver DR, Ebisawa T 1994 Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron 13:1177–1185[CrossRef][Medline]
  47. Mhaouty S, Cohen-Tannoudji J, Bouet-Alard R, Limon-Boulez I, Maltier J-P, Legrand C 1995 Characteristics of the {alpha}22-adrenergic receptor-coupled adenylyl cyclasae system in rat myometrium during pregnancy. J Biol Chem 270:11012–11016[Abstract/Free Full Text]
  48. Hanoune J, Pouille Y, Tzavara E, Shen T, Lipskaya L, Miyamoto N, Suzuki Y, Defer N 1997 Adenylyl cyclases: structure, regulation and function in an enzyme superfamily. Mol Cell Endocrinol 128:179–194[CrossRef][Medline]
  49. Mhaouty-Kodja S, Bouet-Alard R, Limon-Boulez I, Maltier JP, Legrand C 1997 Molecular diversity of adenylyl cyclases in human and rat myometrium. J Biol Chem 272:31100–31106[Abstract/Free Full Text]
  50. Suzuki Y, Shen T, Miyamoto N, Defer N, Matsuoka I, Hanoune J 1997 Changes in the expression of adenylyl cyclases in the rat uterus during the course of pregnancy. Biol Reprod 57:778–782[Abstract]
  51. Taussig R, Gilman AG 1995 Mammalian membrane-bound adenylyl cyclases. J Biol Chem 270:1–4[Free Full Text]
  52. Chen CK, Wieland T, Simon MI 1996 RGS-r, a retinal specific RGS protein binds an intermediate conformation of transducin and enhances recycling. Proc Natl Acad Sci USA 93:12885–12889[Abstract/Free Full Text]
  53. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ 1981 Improved patch-clamp techniques for high-resolution current recording from cell and cell-free membrane patches. Pflügers Arch 391:85–100[CrossRef][Medline]
  54. Zhou X-B, Ruth P, Schlossmann J, Hofmann F, Korth M 1996 Protein phosphatase 2A is essential for the activation of Ca2+-activated K+ currents by cGMP-dependent protein kinase in tracheal smooth muscle and Chinese hamster ovary cells. J Biol Chem 271:19760–19767[Abstract/Free Full Text]
  55. Mermi J, Yajima M, Ebner F 1991 The control of the contraction of myocytes from guinea-pig heart by the resting membrane potential. Br J Pharmacol 104:705–713[Medline]
  56. Fabiato A 1988 Computer programs for calculating total from specified free or free from specified total ionic concentrations in aqueous solutions containing multiple metals and ligands. Methods Enzymol 157:378–417[Medline]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
R. J. Reiter, D.-X. Tan, L. C. Manchester, S. D. Paredes, J. C. Mayo, and R. M. Sainz
Melatonin and Reproduction Revisited
Biol Reprod, September 1, 2009; 81(3): 445 - 456.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-B. Zhou, I. Wulfsen, S. Lutz, E. Utku, U. Sausbier, P. Ruth, T. Wieland, and M. Korth
M2 Muscarinic Receptors Induce Airway Smooth Muscle Activation via a Dual, G{beta}{gamma}-mediated Inhibition of Large Conductance Ca2+-activated K+ Channel Activity
J. Biol. Chem., July 25, 2008; 283(30): 21036 - 21044.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Sharkey and J. Olcese
Transcriptional Inhibition of Oxytocin Receptor Expression in Human Myometrial Cells by Melatonin Involves Protein Kinase C Signaling
J. Clin. Endocrinol. Metab., October 1, 2007; 92(10): 4015 - 4019.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
X.-B. Zhou, S. Lutz, F. Steffens, M. Korth, and T. Wieland
Oxytocin Receptors Differentially Signal via Gq and Gi Proteins in Pregnant and Nonpregnant Rat Uterine Myocytes: Implications for Myometrial Contractility
Mol. Endocrinol., March 1, 2007; 21(3): 740 - 752.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. C. Doheny, C. M. Lynch, T. J. Smith, and J. J. Morrison
Functional Coupling of {beta}3-Adrenoceptors and Large Conductance Calcium-Activated Potassium Channels in Human Uterine Myocytes
J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5786 - 5796.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Ruttiger, M. Sausbier, U. Zimmermann, H. Winter, C. Braig, J. Engel, M. Knirsch, C. Arntz, P. Langer, B. Hirt, et al.
Deletion of the Ca2+-activated potassium (BK) {alpha}-subunit but not the BK{beta}1-subunit leads to progressive hearing loss
PNAS, August 31, 2004; 101(35): 12922 - 12927.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Steffens, F.
Right arrow Articles by Wieland, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steffens, F.
Right arrow Articles by Wieland, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals