| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institut National de la Santé et de la Recherche Médicale Unité 145 (C.C., L.P., S.B., F.P., E.V.O.), Institut Féderatif de Recherche 50, Faculté de Médecine, 06107 Nice Cedex 2, and Unité 326 (H.T., B.P.), Hopital Purpan, 31059 Toulouse, France; Institut de Génétique et de Biologie Moléculaire et Cellulaire (F.B., J.L.), 67404 Illkirch, France; and Institute of Biochemistry (S.B.-V., S.R.), University of Fribourg, CH-1700, Switzerland
Address all correspondence and requests for reprints to: E. Van Obberghen, Institut National de la Santé et de la Recherche Medicale, Unité 145, 28, avenue de Valombrose, 06 107 Nice Cedex 2, France. E-mail: vanobbeg{at}unice.fr.
| ABSTRACT |
|---|
|
|
|---|
[32P]Orthophosphate labeling followed by phosphoinositide analysis of differentiated L6 and C2C12 cells expressing myotubularin demonstrated increased PtdIns(3)P levels upon expression of the C375S and D278A mutants. In keeping with its biochemical function, overexpression of wt myotubularin as an enhanced green fluorescent protein fusion disrupted the endosomal punctuated staining of the FYVE (Fab1p/YOTB Vac1p/EEA1)-domain-containing PtdIns(3)P binding protein early endosomal antigen 1 as well as of a gluathione-S-transferase-FYVE probe directed to PtdIns(3)P. Expression of wt myotubularin, although not affecting activation of proximal insulin signal transduction targets such as protein kinase B and MAPK, induced a decrease in insulin-induced glucose uptake, whereas basal glucose uptake was augmented by expression of D278A (DA) and C375S (CS) mutants. Moreover, overexpression of myotubularin in 3T3-L1 adipocytes impaired insulin-induced translocation at the plasma membrane of green fluorescent protein-tagged glucose transporter 4. These data indicate that PtdIns(3)P is required to direct glucose transporter 4 to insulin-responsive compartments and/or to allow the translocation of the latter at the plasma membrane.
We conclude that myotubularin, by modulating the intracellular levels of PtdIns(3)P, plays a role in the control of vesicular traffic related to glucose transport, by counteracting the activities of the PtdIns(3)P-producing phosphatidylinositol 3-kinases.
| INTRODUCTION |
|---|
|
|
|---|
The gene that causes myotubular myopathy, hMTM1, was identified by positional cloning and shown to express a 65-kDa protein termed myotubularin-displaying sequence similarity to dual specificity protein phosphatases (DSPTP) (2). Although initial studies demonstrated an in vitro tyrosine and serine/threonine phosphatase activity of myotubularin (6), more compelling evidence points to its physiological function as a phosphatidylinositol 3-phosphate [PtdIns(3)P] phosphatase. Taylor et al. (7) demonstrated a 2200-fold higher specific activity of myotubularin toward PtdIns(3)P vs. tyrosine-phosphorylated myelin basic protein and increased PtdIns(3)P levels in HEK293 cells expressing a catalytically inactive myotubularin. Blondeau et al. (8) showed that expression of myotubularin in Schizosaccharomyces pombe induces a VPS34-like phenotype, characteristic of yeast with mutation of the PtdIns(3)P-producing Vps34p phosphatidylinositol 3-kinase (PI3K) (9). This work provides the first functional link between the enzymatic activity of myotubularin and a biological effect and suggests a possible function for myotubularin in the regulation of vesicle trafficking via PtdIns(3)P dephosphorylation.
Myotubularin is the prototypic member of a large protein family, conserved from yeast to mammals, which comprises at least 13 members in mammals (4, 6). Some members of the myotubularin family, such as sbf1 (10), are catalytically inactive due to the absence of a key catalytic cysteine and were thought to act as antiphosphatases, preventing dephosphorylation by related phosphatases by competing for the same substrate with the active phosphatase (11). However, very recent data suggest that sbf1 [also named MTM-related (MTMR) 5] is an adaptor for the active homolog MTMR2 (12). Conversely, the related genes MTMR1 and MTMR2 code for catalytically active phosphatases. The MTMR1 muscle-specific isoform is reduced and replaced by aberrant alternative spliced forms in congenital myotonic dystrophy (cDM1) (13), and mutated MTMR2 causes the demyelinating disease Charcot-Marie-Tooth type 4B1 (14). Consistent with an adaptor function of catalytically inactive myotubularins, mutations in the phosphatase dead homolog MTMR13 (sbf2) also leads to a Charcot-Marie-Tooth demyelinating neuropathy (15, 16).
A crucial cellular function in skeletal muscle metabolism that might possibly be affected by myotubularin is the acute stimulation of glucose uptake. This process is mediated by a family of facilitative transporters, of which the insulin-responsive isoform glucose transporter 4 (GLUT4) plays a prominent role in skeletal muscle and adipose tissue. Under basal conditions, GLUT4 is stored in intracellular compartments. Insulin stimulation induces the translocation and fusion at the plasma membrane of GLUT4-containing vesicles, leading to increased glucose uptake. GLUT4 translocation is elicited by a PI3K/protein kinase B (PKB) and c-Cbl-associating protein/Cbl pathways (reviewed in Ref. 17) and occurs via the exploitation of the sorting/recycling endosomal machinery (18), of which PtdIns(3)P is one of the controlling molecules.
A still unanswered question is why mutation in genes belonging to the same family leads to different diseases. Insights into the function of various members of the myotubularin family might be obtained by expression of the related genes into the relevant cell lines. To be able to define the function of myotubularin in muscle cell lines that are poorly transfectable, we constructed recombinant adenoviruses expressing myotubularin. To this end, we used a novel adenoviral vector carrying a cytomegalovirus (CMV) promoter and human ß-globin polyadenylation sequences, which allow the insertion of a transgene cloned into pcDNA3 and other widely used expression vectors. Initial characterization in COS7 cells demonstrates the functionality of adenovirally expressed myotubularin. Next, we show that adenoviral-mediated expression of myotubularin in both L6- and C2C12-differentiated myotubes affects the levels of PtdIns(3)P and causes the redistribution of the FYVE (Fab1p/YOTB Vac1p/EEA1)-domain-containing PtdIns(3)P binding protein early endosomal antigen 1 (EEA1) from endosomal compartments to the cytoplasm. Finally, we demonstrate that overexpression of wild-type (wt) myotubularin leads to a significant decrease in both insulin-stimulated GLUT4 translocation at the plasma membrane and glucose uptake, indicating that PtdIns(3)P is required for proper GLUT4 targeting at insulin-responsive compartments and/or translocation at the plasma membrane.
| RESULTS |
|---|
|
|
|---|
E1 region (VmAdcDNA3). The collapsed CMV/BGH cassette of VmAdcDNA3, once digested by SwaI, allows one to obtain recombinant genomes by homologous recombination with a cDNA cloned in widely used expression vectors such as pCDNA3 and derivatives. A schematic diagram of the procedure to generate recombinant adenoviruses starting from VmAdcDNA3 and pCDNA3 is shown in Fig. 1A
|
|
|
|
|
Ectopic expression of wt myotubularin induced a significant decrease in insulin-induced glucose uptake. On the contrary, overexpression of the D278A and C375S mutants, although not affecting insulin-induced glucose uptake, significantly increased the basal glucose uptake (Fig. 6A
). Increased glucose uptake after insulin stimulation is mainly mediated by the translocation of the glucose transporter GLUT4 at the plasma membrane (26). To ascertain whether MTM1 can affect this response, we sought to directly visualize the translocation of a GLUT4-EGFP fusion protein. To this end, we employed 3T3-L1 adipocytes, which, due to their spherical shape, neatly allow visualization of the translocation of the glucose transporter from a perinuclear compartment to the plasma membrane upon insulin stimulation. Highly infectible 3T3-L1 CAR
1 adipocytes were coinfected with an adenovirus expressing GLUT4-EGFP and wt or C375S myotubularin. Upon insulin stimulation, we observed GLUT4-EGFP translocation defined by a clear florescent rim at the plasma membrane. When wt myotubularin was concomitantly expressed, insulin-induced GLUT4-EGFP translocation was impaired, whereas expression of comparable levels of the C375S catalytically dead myotubularin had no negative effect on GLUT4-EGFP translocation (Fig. 7
). Although expression of GLUT4-EGFP proves, in adipocytes, that modulation of PtdIns(3)P levels affects the insulin-induced translocation of this specific isoform, we cannot presently rule out, relative to muscle cells, a possible effect of PtdIns(3)P levels on the distribution, and thus contribution to glucose uptake, of other highly expressed GLUT isoforms such as GLUT1 and GLUT3 (27).
|
|
| DISCUSSION |
|---|
|
|
|---|
Despite such an apparent redundancy, each member of the myotubularin family seems to fulfill a specialized function, as illustrated by the fact that mutations in the related and ubiquitously expressed MTM-1 and MTMR2 genes give rise to different diseases and that one gene does not complement the defect of the other.
The ability to successfully express each MTM family member in a cellular context relevant to the phenotype observed in the pathological condition (e.g. muscle cells for MTM1 and MTMR1 and Schwann cells for MTMR2) would thus aid in understanding the function of each member.
The use of our adenoviral system is foreseeable for the various members of the MTM family to define in vivo the enzymatic action of each member as dissimilar data are reported in the literature. For example, although the function as PtdIns(3)P 3-phosphatase and PtdIns(3,5)P2 3-phosphatase for myotubularin (7, 8, 28) and for MTMR3 is well established (29), contrasting reports, based on data from in vitro assays, propose MTMR2 either as a specific PtdIns(3)P or PtdIns(3)P/PtdIns (3,5)P2 double-specificity phosphatase (30, 31). However, neither of these activities has been demonstrated in vivo. The possibility of effectively expressing the various myotubularins in mammalian cells should help to clarify these points and should ultimately lead to a better understanding of the molecular events underlying such diverse diseases as myotubular myopathy and Charcot-Marie-Tooth type 4B disease.
To express myotubularin in muscle cells, we have produced adenoviral vectors expressing wt myotubularin as well as the catalytically inactive C375S and putative substrate trap D278A mutants (AdMTMs). To ease the construction of adenoviral vectors, a recombinant adenoviral genome that allows the insertion of a cDNA of interest directly from pCDNA3 and related vectors harboring a CMV and a BGH termination signal was developed (Fig. 1
).
An initial characterization of AdMTM1 (wt and C375S and D278A mutants) in COS7 cells indicated its function as PtdIns(3)P phosphatase by analysis of cellular phosphoinositides. As previously shown in transfected HEK293 cells by Taylor et al. (7), whereas the overexpression of wt MTM-1 had a marginal effect on the decrease of PtdIns(3)P, expression of the mutants increased the levels of PtdIns(3)P in the three different cell types we tested. Thus, we hypothesize that MTM-1 acts on a localized subpool of endogenous PtdIns(3)P. In keeping with this is a recent genetic study in Caenorhabditis elegans whereby it has been demonstrated that the homologs of MTM-1, MTM-R3, and MTM-R6 have specific and nonoverlapping subcellular localization, act on specific pools of PtdIns(3)P, and do not rescue the activity of a missing isoform (32). We have thus monitored localized PtdIns(3)P disappearance, which occurred upon expression of wt (but not CS and DA mutants) myotubularin-EGFP fusion protein, by showing the following: 1) the displacement of an exogenously added GST-2XFYVE probe in COS7 and 2) the similar displacement of EEA1 from a punctuate endosomal compartment to a diffuse cytoplasmic staining in COS7 and L6.
It is of particular importance to note that the GST-2XFYVE has been used as an external probe after cell fixation, as previous observations demonstrated that localization of the same GST-2XFYVE, when transfected in COS7 cells, was not altered by overexpression of myotubularin, likely because of competition for the same endogenous substrate PtdIns(3)P (25).
By employing the AdMTM1 adenoviruses, we next expressed myotubularin in the poorly transfectable muscle cell lines L6 and C2C12 and characterized its biochemical function. PtdIns(3)P levels increased in both L6 and C2C12 myotubes expressing the DA/CS mutants, suggesting a dominant negative action of these mutants. In particular, the DA mutant has a higher dominant negative effect compared with the CS mutant and, taken together with previous results (8, 25), confirms that it has substrate trap abilities. Only the three-dimensional structure would, however, definitely determine whether asp278 is the residue implicated in the release of the substrate. Relative to cells expressing wt myotubularin, we did not observe lowered PtdIns(3)P levels as compared with uninfected cells, likely because myotubularin may act on a subpool of cellular PtdIns(3)P, notably in the compartment(s) in which its allosteric activator PtdIns(5)P is present (28). With respect to a possible site of action of myotubularin, our immunofluorescence observations of EEA1 and the GST-2XFYVE probe displacement in L6 myotubes and COS7 indicate that myotubularin is active at the endosomal level.
Our conclusions about the possible site of action of myotubularin in the context of phosphoinositide metabolism are drawn from experiments in which adenoviral-driven overexpression of human MTM-1 was more than 10-fold higher than the endogenous MTM-1, as assessed by real-time PCR. Overexpression of wt myotubularin clearly affected endosomal PtdIns(3)P levels, as assessed by EEA1 staining. Likewise, the mutated versions D278A and C375S increased intracellular PtdIns(3)P levels.
Complementary information about the function of myotubularin in muscle cells would possibly be provided by gene knockout or knockdown studies. However, preliminary observations indicate that EEA1 and PtdIns(3)P localization (measured with EEA1 antibody and the 2XFYVE probe) are not altered in cultured fibroblasts and myoblasts from patients with myotubular myopathy (Laporte, J., and B. Payrastre, personal communication). The lack of this particular phenotype might be due to the fact that many MTM-1 homologs are simultaneously expressed in muscle cells, including MTMR-1 to 6 and MTMR-8 (see Ref. 33 for a review), which could possibly compensate for MTM-1 gene deletion or lack of a functional MTM-1. Contrarily, overexpression of myotubularin determines its dominant action over the other isoforms, thus allowing one to precisely define its function.
Early indications of a MTM-induced phenotype came from studies in S. pombe and S. cerevisiae, in which overexpression of catalytically active MTM-1, MTMR2, and MTMR3 induced a vacuolar phenotype resembling that induced by deletion or inactivating mutation of the VPS34 allele coding for PI3K (8, 29, 34). On the contrary, little is known about functional, histological, or immunohistological characteristics in mammalian cells, and no distinguishing phenotypes have been observed in nerve-muscle coculture of muscle fibers from donors affected by myotubular myopathy (35).
The modulation of PtdIns(3)P levels in L6 and C2C12 myotubes upon ectopic expression of DA and CS myotubularin prompted us to search for cellular responses affected by PtdIns(3)P. Because PtdIns(3)P controls trafficking of internal membranes (22), we evaluated insulin-induced glucose uptake. Increased glucose uptake after cell exposure to insulin is mediated by the translocation of the glucose transporter GLUT4 from intracellular insulin-responsive GLUT4-containing vesicles to the plasma membrane (36), via a fusion process that might require PtdIns(3)P. In keeping with our hypothesis, previous work employing anti-Vps34 neutralizing antibodies demonstrated a need for PtdIns(3)P in the recycling of endocytosed transferrin (37). When expressing wt myotubularin in L6 myotubes, we observed a significant decrease in insulin-induced glucose uptake. On the contrary, in cells expressing DA and CS mutants, characterized by increased PtsIns(3)P levels, insulin-induced glucose uptake was not affected, whereas we observed an enhanced basal glucose uptake. We suggest that the impairment in glucose transport induced by myotubularin expression acts upon the vesicular traffic machinery and not by affecting the proximal events in insulin signaling, because activation of insulin targets such as PKB and MAPK was not affected by myotubularin expression. Moreover, it is tempting to speculate that the up-regulation of MTM-1 mRNA and protein levels during the process of myoblasts differentiation and fusion (31, 38) contributes, simultaneously to the increased expression of GLUT4, to the more effective insulin-induced glucose uptake observed in myotubes vs. myoblasts.
At the present stage, we cannot exactly define whether the impaired glucose transport is due to an altered amount of GLUT4 in insulin-responsive GLUT4-containing compartments or to a modified translocation and fusion at the plasma membrane of such compartments. However, preliminary observations indicate that myotubularin acts on the targeting of neosynthesized GLUT4 to insulin-responsive subcellular compartments (39). We summarize our present work as follows. First, we describe and employ a new adenoviral vector that facilitates the task of generating and utilizing recombinant adenoviruses expressing a protein of interest. Second, by producing recombinant adenoviruses expressing myotubularin, we prove its in vivo enzymatic function as PtdIns(3)P phosphatase in myotubes, i.e. the most physiologically relevant cellular system to study myotubularin function, both by measuring cellular levels of PtdIns(3)P and by showing EEA1 displacement from endosomal compartments after wt myotubularin expression. Third, we provide evidence for a role of myotubularin in the attenuation of GLUT4 translocation at the plasma membrane and glucose transport in response to insulin stimulation. An urgent question to be addressed is whether this altered insulin action response has a physiological link to the myotubular myopathy during the developmental stages and/or after its installation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
1 cells were provided by Dr. D. Orlicky (University of Colorado, Denver, CO) (40). Cells were maintained at 37 C with 5% (vol/vol) CO2 in DMEM containing 10% (vol/vol) fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Rockville, MD). Differentiation was induced by culturing cells for over 5 d in DMEM containing 2% (vol/vol) horse serum, 100 U/ml penicillin, and 100 µg/ml streptomycin.
Cloning and Expression Vectors
wt Human hMTM1 and the different point mutants [catalytically inactive hMTM1-C375S and substrate trap hMTM1-D278A (8)] in pCDNA3 were used to produce adenoviral AdhMTM-1 vectors. The catalytically inactive C375S mutant results from the elimination of the catalytic cysteine found in the Cys-H5-Arg (CX5R) phosphatase consensus sequence (8). The D278A was produced on the rationale that the myotubularin D278 residue aligns to an aspartic residue of the tyrosine phosphatase PTP1B whose mutation produced a substrate-trapping mutant (41). The substrate-trapping properties of the D278A mutation have been already characterized (8). GFP-hMTM1 fusion proteins were produced by recloning BamHI fragments encompassing the myotubularin cDNA into BamHI-linearized pEGFP-C1 (Clontech Laboratories, Palo Alto, CA). GLUT4-EGFP cDNA cloned in pCDNA3 was provided by J. Pessin (State University of New York, Stony Brook, NY) (42).
VmAdcDNA3 Adenoviral Plasmid and Generation of Recombinant Adenoviruses and Infections
The VmAdcDNA3 plasmid (unpublished data of S.R. and S.B.V., to whom requests should be addressed) is based on the adenovirus serotype 5 genome deleted in the E1/E3 regions (43). The homologous recombination target region placed in the
E1 deletion consists of two common elements of the pCDNA3 vectors, namely the a 363-bp 5' portion of CMV promoter and a segment of the 3' untranslated region of the BGH gene including the polyadenylation signal. These two elements are separated by a segment containing a unique SwaI site (ATTTAAAT). Homologous recombination is expected in this setup not only to eliminate the Swa site and to insert the desired cDNA, but also to reconstitute the entire CMV promoter sequence, thus providing a fixed sequence, the acquisition of which can be verified by PCR. The viral genome is joined via two PacI sites to the miniplasmid pPolyII (44) bearing the E. coli origin of replication and the AmpR gene. PacI digestion allows the separation of the viral genome from pPolyII.
Recombinant adenoviral genomes carrying the gene of interest were generated by homologous recombination (19). Briefly, CaCl2 competent E. coli BJ5183 was cotransformed with 200 ng SwaI-linearized VmAdcDNA3 plasmid and 600 ng linearized (e.g. PvuI digested) pCDNA3<hMTM1> or pCDNA3<GFP-GLUT4> (provided by J. Pessin). Recombinants were screened by PCR with the following set of primers: A, 5'-GAC GGA TGT GGC AAA AGT GA annealing to the leftmost part of the adenoviral genome; and B, 5'-ATG GGG TGG AGA CTT GGA AAT C annealing to portion of the CMV promoter, which is brought in by homologous recombination. Positive clones were further analyzed by restriction analysis or by a second round of PCR with primers A and (C) 5'-GCT TAA TGC GCC GCT ACA GG annealing to the BGH polyadenylation site, which amplify the full-length recombined cDNA. Positive recombinants were large-scale amplified in E. coli XL-1 blue, digested with PacI and transfected by the calcium phosphate methods in HEK293 cells. Cytopathic effect due to virus production was observed 810 d after transfection. Adenoviruses were extracted by three freeze/thaw cycles and stored in PBS, 10% (vol/vol) glycerol at -20 C. Viral titer of stocks was more than 108 plaque-forming units/ml.
Infections were performed at the MOI indicated for each experiment. After 1620 h of incubation in the presence of viral particles, the medium was changed and cells were cultured for 2472 h. Under these conditions, EGFP expression was routinely observed in over 90% of cells upon infection at the maximal MOI.
Immunoblotting and Antibodies
Serum-starved cells were washed with ice-cold PBS [140 mM NaCl, 3 mM KCl, 6 mM Na2HPO4, 1 mM KH2PO4 (pH 7.4)] and solubilized with lysis buffer [20 mM Tris-HCl, 138 mM NaCl, 2.7 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 5% (vol/vol) glycerol, 1% (vol/vol) Nonidet P-40, 5 mM EDTA, 20 µM leupeptin, 18 µM pepstatin, 2 mM Na3VO4, 20 mM NaF, 1 mM DTT (pH 7.4)]. Proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes (Hybond C, Amersham Biosciences, Inc., Piscataway, NJ). The membranes were soaked for 1 h in blocking buffer [20 mM Tris (pH 7.4), 137 mM NaCl, 0.1% (vol/vol) Tween 20] containing 5% (wt/vol) BSA or nonfat milk and then soaked overnight in blocking buffer containing antibodies. Immunoreactive proteins were detected using horseradish peroxidase-linked secondary antibodies and enhanced chemiluminescence according to the manufacturers instructions (Amersham Biosciences, Inc.). The 1G6 monoclonal antibody raised against an N-terminal peptide (amino acids 1332) of human myotubularin was previously described (25). 1G6 specifically recognizes human myotubularin and does not cross-react with rat or mouse myotubularin. The monoclonal antibody directed to the N terminus of EEA1 was from Transduction Laboratories (Lexington, KY) and antibodies to active PKB (phosphoserine 473) and active p42/p44 MAPK were from Cell Signaling Technology (Beverly, MA) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. Monoclonal antibodies directed to GFP were from Chemicon (Temecula, CA) and polyclonal anti-GLUT4 was from Santa Cruz Biotechnology.
Real-Time PCR
Quantification of the relative mRNA levels in C2C12 cells of endogenous mouse MTM-1 mRNA vs. overexpressed human MTM-1 mRNA was performed by using an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). To specifically amplify mouse and human MTM-1, the following pair of oligos (5'-3') have been used to amplify reverse-transcribed polyadenylation RNA: mouse, forward primer, TCTGTGAGACATACCCTGCTCTTTT; reverse primer, TCTAAACGTTGCGATCCTCCTAA; human, forward primer, CCCAGGATCAAGCAACAACAG; reverse primer, TTATGTATTCGTCGCGTAAGGCTAA.
Analysis of Phosphoinositides
Cells were grown and differentiated in 6-cm plates and labeled for 4 h with 150 µCi/ml of [32P]orthophosphate (Amersham Pharmacia Biotech) in phosphate-free DMEM at 37 C with 5% (vol/vol) CO2. Lipid extraction was performed as described previously (45). Briefly, lipids were solubilized in chloroform:methanol (2.4 M), HCl (8:4:3, vol/vol) by vortexing. After centrifugation, the organic lipid-containing lower phase was collected and reextracted with the upper phase from the chloroform:methanol (2.4 M), HCl (8:4:3, vol/vol) mix. The lower phases were evaporated under nitrogen. Lipid extracts were solubilized in 25 µl chloroform:methanol 1:1, vol/vol) and resolved by thin layer chromatography (TLC) on chloroform:acetone:methanol:acetic acid:water (80:30:26:24:14, vol/vol). The spots corresponding to PtdIns(3)P and PtdIns(4)P were scraped, deacylated, and analyzed by HPLC on a Partisphere 5 SAX column (Whatman, Clifton, NJ). Radioactivity eluted from the column was quantified by using a continuous-flow in-line scintillation detector (Beckman Instruments, Fullerton, CA). The elution position of glycero-PtdIns(3)P was determined by using radiolabeled standards. In vivo myotubularin phosphatase action was performed on anti-1G6 immunoprecipitates as described (34).
Fluorescence Microscopy
COS7 cells were grown to 4050% confluence on coverlips and transfected by diethylaminoethyl-dextran or Fugene 6. L6 myoblasts were infected with adenoviruses expressing GFP-hMTM1 fusion proteins. Forty-eight hours later, coverlips were washed twice with ice-cold PBS, fixed with 3% (vol/vol) formaldehyde in PBS for 15 min at 4 C, and permeabilized with 0.2% (vol/vol) Triton X-100 in PBS for 4 min at 4 C. Triton was omitted for the detection of PtdIns(3)P localization with a biotinylated GST-2XFYVE recombinant protein produced in bacteria from a construct provided by H. Stenmark (Department of Biochemistry, Institute for Cancer Research, Oslo, Norway) (24). Cells were then blocked with 1% (vol/vol) fetal calf serum in PBS for 30 min at 4 C and stained in the same buffer with a monoclonal antibody directed to the N terminus of EEA1. A secondary Texas-red-coupled antimouse antibody was used to detect the primary antibody. Coverslips were then mounted in Mowiol (Sigma Aldrich, St. Louis, MO). The cells were examined by sequential excitation at 488 nm (GFP) and 568 nm (Texas red) using a confocal microscope (TCS SP, Leica, Deerfield, IL) and a PL APO 63 x 1.40 oil objective (Leica). The images were combined and merged by using Photoshop (Adobe Systems, Mountain View, CA).
Glucose Uptake
L6 myotubes infected with adenoviruses as indicated were starved overnight and washed twice with prewarmed Krebs Ringer phosphate (KRP) buffer (137 mM NaCl, 4.7 mM KCl, 0.5 mM MgCl2, 1 mM CaCl2, 10 mM phosphate buffer at pH7.4). Cells were then either left untreated or exposed to 1 µM insulin for 10 min in the same buffer. After 10 min, a deoxyglucose (DOG) solution, containing 1 mM DOG and 1 µCi [3H]2-DOG in KRP, was added to cells for 10 min. The assay was stopped by cooling plates on ice and removing unincorporated radioactivity by three washes with ice-cold KRP. Cells were lysed with 500 µl 0.2 M NaOH, followed by 500 µl 0.2 M HCl, and incorporated radioactivity was measured by scintillation counting.
| ACKNOWLEDGMENTS |
|---|
1 cells. We thank M. N. Monthouel for her assistance in performing real-time PCR measurements. We thank J.-L. Mandel for discussion. | FOOTNOTES |
|---|
This work was supported by Institut National de la Santé et de la Recherche Médicale (INSERM), Université de NiceSophia-Antipolis, Centre National de la Recherche Scientifique, Hopital Universitaire de Strasbourg, and by grants from the Association Française Contre les Myopathies. C.C. is a recipient of a Ministère de lEnseignement Supérieur et de la Recherche predoctoral fellowship. L.P. was supported by Fondation pour la Recherche Médicale and in part by an INSERM "Poste Vert" postdoctoral fellowship. S.B. was supported by a grant from the European Community (QLGI-CT-1999-00674).
C.C. and L.P. contributed equally to this work.
Abbreviations: BGH, Bovine GH; CMV, cytomegalovirus; DOG, deoxyglucose; EEA1, early endosomal antigen 1; EGFP, enhanced GFP; FYVE, Fab1p/YOTB Vac1p/EEA1; GFP, green fluorescent protein; GLUT4, glucose transporter 4; KRP, Krebs Ringer phosphate; MOI, multiplicity of infection; MTM1, myotubular myopathy-1; MTMR, MTM-related; PI3K, phosphatidylinositol 3-kinase; PKB, protein kinase B; PtdIns(3)P, phosphatidylinositol 3-phosphate; wt, wild-type.
Received for publication July 3, 2003. Accepted for publication September 8, 2003.
| REFERENCES |
|---|
|
|
|---|
2 is an early key event in Fc
RIIA-mediated activation of human platelets. J Biol Chem 273:2431424321This article has been cited by other articles:
![]() |
A. Shisheva Phosphoinositides in insulin action on GLUT4 dynamics: not just PtdIns(3,4,5)P3 Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E536 - E544. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cao, J. M. Backer, J. Laporte, E. J. Bedrick, and A. Wandinger-Ness Sequential Actions of Myotubularin Lipid Phosphatases Regulate Endosomal PI(3)P and Growth Factor Receptor Trafficking Mol. Biol. Cell, August 1, 2008; 19(8): 3334 - 3346. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rome, V. Lecomte, E. Meugnier, J. Rieusset, C. Debard, V. Euthine, H. Vidal, and E. Lefai Microarray analyses of SREBP-1a and SREBP-1c target genes identify new regulatory pathways in muscle Physiol Genomics, August 1, 2008; 34(3): 327 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Buj-Bello, F. Fougerousse, Y. Schwab, N. Messaddeq, D. Spehner, C. R. Pierson, M. Durand, C. Kretz, O. Danos, A.-M. Douar, et al. AAV-mediated intramuscular delivery of myotubularin corrects the myotubular myopathy phenotype in targeted murine muscle and suggests a function in plasma membrane homeostasis Hum. Mol. Genet., July 15, 2008; 17(14): 2132 - 2143. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Lodhi, D. Bridges, S.-H. Chiang, Y. Zhang, A. Cheng, L. M. Geletka, L. S. Weisman, and A. R. Saltiel Insulin Stimulates Phosphatidylinositol 3-Phosphate Production via the Activation of Rab5 Mol. Biol. Cell, July 1, 2008; 19(7): 2718 - 2728. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Falasca, W. E. Hughes, V. Dominguez, G. Sala, F. Fostira, M. Q. Fang, R. Cazzolli, P. R. Shepherd, D. E. James, and T. Maffucci The Role of Phosphoinositide 3-Kinase C2{alpha} in Insulin Signaling J. Biol. Chem., September 21, 2007; 282(38): 28226 - 28236. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hirsch, C. Costa, and E. Ciraolo Phosphoinositide 3-kinases as a common platform for multi-hormone signaling J. Endocrinol., August 1, 2007; 194(2): 243 - 256. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Naimi, N. Gautier, C. Chaussade, A. M. Valverde, D. Accili, and E. Van Obberghen Nuclear Forkhead Box O1 Controls and Integrates Key Signaling Pathways in Hepatocytes Endocrinology, May 1, 2007; 148(5): 2424 - 2434. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Tosch, H. M. Rohde, H. Tronchere, E. Zanoteli, N. Monroy, C. Kretz, N. Dondaine, B. Payrastre, J.-L. Mandel, and J. Laporte A novel PtdIns3P and PtdIns(3,5)P2 phosphatase with an inactivating variant in centronuclear myopathy Hum. Mol. Genet., November 1, 2006; 15(21): 3098 - 3106. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Robert, C. Gaggioli, O. Bailet, C. Chavey, P. Abbe, E. Aberdam, E. Sabatie, A. Cano, A. Garcia de Herreros, R. Ballotti, et al. SPARC Represses E-Cadherin and Induces Mesenchymal Transition during Melanoma Development. Cancer Res., August 1, 2006; 66(15): 7516 - 7523. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lorenzo, S. Urbe, and M. J. Clague Systematic analysis of myotubularins: heteromeric interactions, subcellular localisation and endosomerelated functions J. Cell Sci., July 15, 2006; 119(14): 2953 - 2959. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yamamoto, M. L. Cremona, and J. E. Rothman Autophagy-mediated clearance of huntingtin aggregates triggered by the insulin-signaling pathway J. Cell Biol., February 27, 2006; 172(5): 719 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Robinson and J. E. Dixon The Phosphoinositide-3-phosphatase MTMR2 Associates with MTMR13, a Membrane-associated Pseudophosphatase Also Mutated in Type 4B Charcot-Marie-Tooth Disease J. Biol. Chem., September 9, 2005; 280(36): 31699 - 31707. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishiki, V. K. Randhawa, V. Poon, L. JeBailey, and A. Klip Insulin Regulates the Membrane Arrival, Fusion, and C-terminal Unmasking of Glucose Transporter-4 via Distinct Phosphoinositides J. Biol. Chem., August 5, 2005; 280(31): 28792 - 28802. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tang, A. M. Powelka, N. A. Soriano, M. P. Czech, and A. Guilherme PTEN, but Not SHIP2, Suppresses Insulin Signaling through the Phosphatidylinositol 3-Kinase/Akt Pathway in 3T3-L1 Adipocytes J. Biol. Chem., June 10, 2005; 280(23): 22523 - 22529. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Maffucci, F. T. Cooke, F. M. Foster, C. J. Traer, M. J. Fry, and M. Falasca Class II phosphoinositide 3-kinase defines a novel signaling pathway in cell migration J. Cell Biol., June 6, 2005; 169(5): 789 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Lorenzo, S. Urbe, and M. J. Clague Analysis of phosphoinositide binding domain properties within the myotubularin-related protein MTMR3 J. Cell Sci., May 1, 2005; 118(9): 2005 - 2012. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tronchere, J. Laporte, C. Pendaries, C. Chaussade, L. Liaubet, L. Pirola, J.-L. Mandel, and B. Payrastre Production of Phosphatidylinositol 5-Phosphate by the Phosphoinositide 3-Phosphatase Myotubularin in Mammalian Cells J. Biol. Chem., February 20, 2004; 279(8): 7304 - 7312. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |