help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0261
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chaussade, C.
Right arrow Articles by Van Obberghen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chaussade, C.
Right arrow Articles by Van Obberghen, E.
Molecular Endocrinology 17 (12): 2448-2460
Copyright © 2003 by The Endocrine Society

Expression of Myotubularin by an Adenoviral Vector Demonstrates Its Function as a Phosphatidylinositol 3-Phosphate [PtdIns(3)P] Phosphatase in Muscle Cell Lines: Involvement of PtdIns(3)P in Insulin-Stimulated Glucose Transport

Claire Chaussade, Luciano Pirola, Stéphanie Bonnafous, François Blondeau, Stefano Brenz-Verca, Hélène Tronchère, Fiorella Portis, Sandro Rusconi, Bernard Payrastre, Jocelyn Laporte and E. Van Obberghen

Institut National de la Santé et de la Recherche Médicale Unité 145 (C.C., L.P., S.B., F.P., E.V.O.), Institut Féderatif de Recherche 50, Faculté de Médecine, 06107 Nice Cedex 2, and Unité 326 (H.T., B.P.), Hopital Purpan, 31059 Toulouse, France; Institut de Génétique et de Biologie Moléculaire et Cellulaire (F.B., J.L.), 67404 Illkirch, France; and Institute of Biochemistry (S.B.-V., S.R.), University of Fribourg, CH-1700, Switzerland

Address all correspondence and requests for reprints to: E. Van Obberghen, Institut National de la Santé et de la Recherche Medicale, Unité 145, 28, avenue de Valombrose, 06 107 Nice Cedex 2, France. E-mail: vanobbeg{at}unice.fr.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
X-linked myotubular myopathy is a muscle disorder caused by mutations on the myotubular myopathy-1 (MTM-1) gene, coding for myotubularin a 65-kDa polypeptide similar to protein phosphatases. Biochemical and in vivo studies define myotubularin as a phosphatidylinositol 3-phosphate [PtdIns(3)P] phosphatase. To efficiently express myotubularin in muscle cell lines and adipocytes, we used an adenoviral genome recombinogenic to pcDNA3, and to other widely used expression vectors, to produce adenoviruses expressing wild-type (wt), catalytically inactive C375S, and substrate trap D278A myotubularin.

[32P]Orthophosphate labeling followed by phosphoinositide analysis of differentiated L6 and C2C12 cells expressing myotubularin demonstrated increased PtdIns(3)P levels upon expression of the C375S and D278A mutants. In keeping with its biochemical function, overexpression of wt myotubularin as an enhanced green fluorescent protein fusion disrupted the endosomal punctuated staining of the FYVE (Fab1p/YOTB Vac1p/EEA1)-domain-containing PtdIns(3)P binding protein early endosomal antigen 1 as well as of a gluathione-S-transferase-FYVE probe directed to PtdIns(3)P. Expression of wt myotubularin, although not affecting activation of proximal insulin signal transduction targets such as protein kinase B and MAPK, induced a decrease in insulin-induced glucose uptake, whereas basal glucose uptake was augmented by expression of D278A (DA) and C375S (CS) mutants. Moreover, overexpression of myotubularin in 3T3-L1 adipocytes impaired insulin-induced translocation at the plasma membrane of green fluorescent protein-tagged glucose transporter 4. These data indicate that PtdIns(3)P is required to direct glucose transporter 4 to insulin-responsive compartments and/or to allow the translocation of the latter at the plasma membrane.

We conclude that myotubularin, by modulating the intracellular levels of PtdIns(3)P, plays a role in the control of vesicular traffic related to glucose transport, by counteracting the activities of the PtdIns(3)P-producing phosphatidylinositol 3-kinases.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
X-LINKED MYOTUBULAR MYOPATHY is a severe congenital muscle disorder characterized by hypotonia and generalized muscle weakness, leading in most cases to death during the first year of life (1, 2, 3). Muscle fibers of affected individuals resemble fetal myotubes, containing large and centrally located nuclei surrounded by a halo devoid of myofibrils. This phenotype results either from defective muscle fiber development during late myogenesis or from a failure in the maintenance of a normal muscle fiber state (4). The second hypothesis appears as the most likely according to a recently described myotubular myopathy-1 (MTM-1) knockout mouse model (5).

The gene that causes myotubular myopathy, hMTM1, was identified by positional cloning and shown to express a 65-kDa protein termed myotubularin-displaying sequence similarity to dual specificity protein phosphatases (DSPTP) (2). Although initial studies demonstrated an in vitro tyrosine and serine/threonine phosphatase activity of myotubularin (6), more compelling evidence points to its physiological function as a phosphatidylinositol 3-phosphate [PtdIns(3)P] phosphatase. Taylor et al. (7) demonstrated a 2200-fold higher specific activity of myotubularin toward PtdIns(3)P vs. tyrosine-phosphorylated myelin basic protein and increased PtdIns(3)P levels in HEK293 cells expressing a catalytically inactive myotubularin. Blondeau et al. (8) showed that expression of myotubularin in Schizosaccharomyces pombe induces a VPS34-like phenotype, characteristic of yeast with mutation of the PtdIns(3)P-producing Vps34p phosphatidylinositol 3-kinase (PI3K) (9). This work provides the first functional link between the enzymatic activity of myotubularin and a biological effect and suggests a possible function for myotubularin in the regulation of vesicle trafficking via PtdIns(3)P dephosphorylation.

Myotubularin is the prototypic member of a large protein family, conserved from yeast to mammals, which comprises at least 13 members in mammals (4, 6). Some members of the myotubularin family, such as sbf1 (10), are catalytically inactive due to the absence of a key catalytic cysteine and were thought to act as antiphosphatases, preventing dephosphorylation by related phosphatases by competing for the same substrate with the active phosphatase (11). However, very recent data suggest that sbf1 [also named MTM-related (MTMR) 5] is an adaptor for the active homolog MTMR2 (12). Conversely, the related genes MTMR1 and MTMR2 code for catalytically active phosphatases. The MTMR1 muscle-specific isoform is reduced and replaced by aberrant alternative spliced forms in congenital myotonic dystrophy (cDM1) (13), and mutated MTMR2 causes the demyelinating disease Charcot-Marie-Tooth type 4B1 (14). Consistent with an adaptor function of catalytically inactive myotubularins, mutations in the phosphatase dead homolog MTMR13 (sbf2) also leads to a Charcot-Marie-Tooth demyelinating neuropathy (15, 16).

A crucial cellular function in skeletal muscle metabolism that might possibly be affected by myotubularin is the acute stimulation of glucose uptake. This process is mediated by a family of facilitative transporters, of which the insulin-responsive isoform glucose transporter 4 (GLUT4) plays a prominent role in skeletal muscle and adipose tissue. Under basal conditions, GLUT4 is stored in intracellular compartments. Insulin stimulation induces the translocation and fusion at the plasma membrane of GLUT4-containing vesicles, leading to increased glucose uptake. GLUT4 translocation is elicited by a PI3K/protein kinase B (PKB) and c-Cbl-associating protein/Cbl pathways (reviewed in Ref. 17) and occurs via the exploitation of the sorting/recycling endosomal machinery (18), of which PtdIns(3)P is one of the controlling molecules.

A still unanswered question is why mutation in genes belonging to the same family leads to different diseases. Insights into the function of various members of the myotubularin family might be obtained by expression of the related genes into the relevant cell lines. To be able to define the function of myotubularin in muscle cell lines that are poorly transfectable, we constructed recombinant adenoviruses expressing myotubularin. To this end, we used a novel adenoviral vector carrying a cytomegalovirus (CMV) promoter and human ß-globin polyadenylation sequences, which allow the insertion of a transgene cloned into pcDNA3 and other widely used expression vectors. Initial characterization in COS7 cells demonstrates the functionality of adenovirally expressed myotubularin. Next, we show that adenoviral-mediated expression of myotubularin in both L6- and C2C12-differentiated myotubes affects the levels of PtdIns(3)P and causes the redistribution of the FYVE (Fab1p/YOTB Vac1p/EEA1)-domain-containing PtdIns(3)P binding protein early endosomal antigen 1 (EEA1) from endosomal compartments to the cytoplasm. Finally, we demonstrate that overexpression of wild-type (wt) myotubularin leads to a significant decrease in both insulin-stimulated GLUT4 translocation at the plasma membrane and glucose uptake, indicating that PtdIns(3)P is required for proper GLUT4 targeting at insulin-responsive compartments and/or translocation at the plasma membrane.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Use of a Recombinant Adenoviral Vector Expressing Myotubularin and Characterization in COS7 Cells
Generation of recombinant adenoviruses has been greatly facilitated by the introduction of homologous recombination in Escherichia coli in place of recombination in a helper mammalian cell line (19, 20, 21). Here, we use the VmAdCDNA3 backbone consisting of an E1/E3-deleted Ad5 genome into which contiguous CMV promoter and bovine GH (BGH) polyadenylation/termination sequences were inserted in the {Delta}E1 region (VmAdcDNA3). The collapsed CMV/BGH cassette of VmAdcDNA3, once digested by SwaI, allows one to obtain recombinant genomes by homologous recombination with a cDNA cloned in widely used expression vectors such as pCDNA3 and derivatives. A schematic diagram of the procedure to generate recombinant adenoviruses starting from VmAdcDNA3 and pCDNA3 is shown in Fig. 1AGo and details are given in Materials and Methods. Positive recombinants between VmAdcDNA3 and pCDNA3 harboring hMTM-1 and GLUT4-enhanced green fluorescent protein (EGFP) cDNAs were selected by a double PCR screening with primers A,B and A,C, respectively (Fig. 1Go, B and C), and further confirmed by restriction analysis (data not shown). Adenovirus infectivity and MTM-1 transgene expression were first evaluated in HEK293 and COS7 cells. Multiplicity of infection (MOI)-dependent expression of myotubularin was observed for wt myotubularin and the D278A and C375S mutants in both cell lines (Figs. 1DGo and 2AGo) and for GLUT4-EGFP in COS7 cells (Fig. 1EGo). Next, we demonstrated, by [32P]orthophosphate labeling, an increase in PtdIns(3)P in substrate trap D278A (and to a lesser extent in catalytically inactive C375S)-expressing cells as compared with cells expressing wt myotubularin (Fig. 2BGo). In mammalian cells, PtdIns(3)P functions as a molecule coordinating endosomal traffic (22) via the interaction with FYVE-domain-containing proteins such as EEA1 (23). Therefore, we asked whether subcellular localization of myotubularin is consistent with its physiological function as a PtdIns(3)P 3-phosphatase, acting on this lipid, which is localized to early endosomes and to the intralumenal membranes of multivesicular bodies (24). Green fluorescent protein (GFP)-MTM-1 wt and D278A (DA) and C375S (CS) mutants exhibited an intracellular distribution restricted to a dense cytoplasmic network with a perinuclear concentration associated with a plasma membrane labeling (25), and, in cells expressing GFP-MTM-1 wt (but not GFP-MTM-1 DA nor GFP-MTM-1 CS, Fig. 2CGo), a relocalization of EEA1 from the endosomal compartment to a more diffuse cytoplasmic staining was observed (Fig. 2DGo). We also demonstrate dephosphorylation of the PtdIns(3)P endosomal pool by wt myotubularin overexpression by monitoring the displacement of a biotinylated external GST-2XFYVE probe (Fig. 2EGo).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1. Generation of Recombinant Adenoviruses Based on Homologous Recombination between VmAdcDNA3 and pCDNA3

A, Schematic diagram of the adenoviral vectorVmAdcDNA3 and pcDNA3 highlighting the CMV promoter and BGH polyadenylation recombinogenic sequences. Arrows indicate the position of oligonucleotides used for the screening of positive recombinants. B, First round of PCR screening with set of primers A and B. Positive recombinants produce a 721-bp amplicon (for details see Materials and Methods). C, Second round of PCR screening with primers 1 and 3 confirms the insertion of full-length hMTM1 cDNA into VmAdcDNA3 (lanes 2 and 3; lane 1, control PCR on VmAdcDNA3). D, Adenovirus-driven expression of myotubularin in HEK293 cells. HEK293 cells were incubated for 12 h with increasing amounts of viral suspension. Two days after infection, whole-cell lysates were analyzed by Western blotting using antibodies to hMTM1. E, Adenovirus-driven expression of GLUT4-EGFP COS7 cells. GLUT4-EGFP-expressing adenoviruses have been constructed by employing the same procedure as described for MTM1. COS7 cells were incubated for 12 h at the indicated MOI. Two days after infection, whole-cell lysates were analyzed by Western blotting using antibodies to GLUT4 (left blot) or GFP (right blot).

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. Myotubularin Expression in COS7 Cells Affects PtdIns(3)P Intracellular Content

A, COS7 cells were infected with increasing MOI of Ad hMTM1 wt, D278A, and C375S as indicated. Cells were lysed 48 h after infection and myotubularin expression was visualized by Western blotting. B, COS7 cells were infected at a MOI of 20. Forty-eight hours after infection cells were starved in phosphate-free DMEM and labeled with [32P]orthophosphate. Phosphoinositides were extracted and deacylated and the resulting glyceroinositides separated on a SAX-10 HPLC column. PtdIns(3)P levels were normalized to PtdIns(4)P levels and expressed relatively to the PtdIns(3)P level in uninfected cells. At least two independent experiments for each condition were performed. C, GFPhMTM-1 fusions were generated and expression verified in COS7 cells 48 h after transfection by Western blotting with antibodies to myotubularin (top) and GFP (bottom). +, Cells transfected with plasmids for myotubularin (top) or GFP (bottom). D, COS7 cells transfected as in C were fixed and analyzed by immunofluorescence with an antibody to EEA1. GFPhMTM-1 wt (but not DA or CS mutants) causes a relocalization of EEA1 from the endosomal compartment to a more diffuse cytoplasmic staining. The figure shows images obtained for GFP or GFPhMTM1 (DA and CS, in green) and EEA1 (in red). E, COS7 cell were fixed and treated with the biotinylated GST-2XFYVE external probe as described in Materials and Methods. Heterochromatin was visualized with 4',6'-diamidino-2-phenylindole staining. -, Nontransfected cells; WT, cells expressing ectopic wt myotubularin; DA, cells expressing ectopic D278A myotubularin. Red staining, PtdIns(3)P labeled with an external probe GST-2XFYVE. Green staining N-terminal GFP-labeled myotubularin constructs. Blue, 4',6'-Diamidino-2-phenylindole staining. In D and E the arrows indicate wt myotubularin-expressing cells in which EEA1 endosomal punctuate staining or PtdIns(3)P labeling is lost. Bar, 5 µm.

 
Expression of Myotubularin in Myotubes Alters PtdIns(3)P Levels, Displaces EEA1, and Affects Insulin-Stimulated Glucose Transport
After characterization of the adenoviral constructs in COS7 cells, we next expressed myotubularin in L6 and C2C12 myotubes. In contrast to various transfection protocols we tested, which allow the target of only a small fraction of cells, adenoviral infection resulted in the expression of the transgene in nearly all the cells as visualized by AdEGFP infection (Fig. 3CGo). Infection resulted in sustained expression in a MOI-dependent manner (Fig. 3AGo). To evaluate the extent of overexpression of human MTM-1 vs. endogenous MTM-1, which is not recognized by the 1G6 antibody, we performed real-time PCR measurements of endogenous MTM-1 and adenovirally expressed human MTM-1 at the lowest MOI of 10 (Fig. 3BGo). Under these conditions, we measured a 4-fold excess of human MTM-1 mRNA compared with mouse MTM-1 mRNA. This translates to a more than 10-fold overexpression of human MTM-1 at the highest MOI condition used throughout the subsequent metabolic labeling experiments. That myotubularin expression in C2C12 yields an active phosphatase was first evaluated by an in vitro activity using fluorescent PtdIns(3)P as substrate (Fig. 4AGo). Next, we performed [32P]orthophosphate labeling to determine the biochemical function of myotubularin in differentiated L6 and C2C12 myotubes. In both cell types, when infected with substrate trap D278A, myotubularin displayed a 1.5- to 1.75-fold increase in PtdIns(3)P (Fig. 4BGo); likewise, an increase in PtdIns(3)P levels was observed upon expression of the catalytically inactive C375S mutant (Fig. 4CGo). In contrast, ectopic expression of wt myotubularin did not yield a measurable decrease in the endogenous PtdIns(3)P levels as compared with mock-infected or uninfected cells. This result suggests either that myotubularin acts on a small subset of the total PtdIns(3)P cellular pool or that a fast turnover rate of [32P]-labeled 3-phosphorylated molecules does not allow one to visualize wt myotubularin-induced PtdIns(3)P decrease. To test this second hypothesis, myotubularin-expressing cells were double-labeled with [32P]orthophosphate and [3H]inositol for 24 h to reach isotopic equilibrium for both nuclides. Even under these conditions, we could not visualize a PtdIns(3)P decrease either in the [32P] or in the [3H] radioactivity associated with PtdIns(3)P (data not shown). This indicates that only a small fraction of the PtdIns(3)P pool is dephosphorylated by myotubularin. However, as was the case in transfected COS cells (Fig. 2Go, D and E), PtdIns(3)P dephosphorylation indeed occurs in endosomes and is demonstrated by immunofluorescence studies on EGFP-MTM1-expressing L6 cells, in which EEA1 displacement is observed upon expression of wt EGFP-MTM1 but not D278A EGFP-MTM1, expressed at low MOI to distinguish among infected vs. noninfected cells (Fig. 5Go).



View larger version (83K):
[in this window]
[in a new window]
 
Fig. 3. Efficient Expression of hMTM-1 in Muscle Cell Lines by Adenoviral-Mediated Gene Expression

A, L6 (left) and C2C12 (right) cells were infected with Ad hMTM1 wt, D278A, and C375S at increasing MOI as indicated (1 refers to an MOI of 10). Cells were lysed 48 h after infection and myotubularin expression was visualized by Western blotting. B, Real-time PCR quantification of endogenous mouse (m) MTM-1 and overexpressed human (h) MTM-1 after infection of C2C12 cells at a MOI of 10. Quantification from two independent experiments yielded identical results. C, Adenoviral infectivity in C2C12 by AdEGFP (left) was compared with transfection of pEGFP-C1 with Fugene. Top, Phase contrast picture of infected cells; bottom, visualization of GFP expression.

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. hMTM-1 Expression in Muscle Cell Lines Affects PtdIns(3)P Intracellular Content

A, Myotubularin in vitro PtdIns(3)P phosphatase activity was evaluated in immunoprecipitates from myotubularin-expressing C2C12 myotubes as described in Materials and Methods. B, HPLC elution profiles of deacylated phosphoinositides from wt or Ad hMTM1 infected L6 and C2C12. The peaks corresponding to PtdIns(3)P and PtdIns(4)P are indicated by arrows. C, PtdIns(3)P levels in L6 and C2C12 from at least three independent traces, as in B, are calculated as percentage of PtdIns(4)P and expressed relatively to the PtdIns(3)P level in uninfected cells.

 


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. Suppression of EEA1 Targeting to Endosomes in L6 Cells Expressing Myotubularin

L6 cells were infected with low MOI (<1) of adenoviruses driving expression of EGFP-hMTM1 wt, D278A, or EGFP alone. Cells were treated for confocal analysis as described in Materials and Methods. Endogenous EEA1 was detected using specific monoclonal antibodies, followed by Texas red-coupled antimouse secondary antibodies. The figure shows images obtained for GFP or GFPhMTM1 (in green) and EEA1 (in red).

 
Because PtdIns(3)P is involved in the coordination of vesicle trafficking (22), we next evaluated whether myotubularin, by altering PtdIns(3)P levels, might affect the insulin-induced translocation of glucose transporters at the plasma membrane and, consequently, whether myotubularin might affect glucose uptake.

Ectopic expression of wt myotubularin induced a significant decrease in insulin-induced glucose uptake. On the contrary, overexpression of the D278A and C375S mutants, although not affecting insulin-induced glucose uptake, significantly increased the basal glucose uptake (Fig. 6AGo). Increased glucose uptake after insulin stimulation is mainly mediated by the translocation of the glucose transporter GLUT4 at the plasma membrane (26). To ascertain whether MTM1 can affect this response, we sought to directly visualize the translocation of a GLUT4-EGFP fusion protein. To this end, we employed 3T3-L1 adipocytes, which, due to their spherical shape, neatly allow visualization of the translocation of the glucose transporter from a perinuclear compartment to the plasma membrane upon insulin stimulation. Highly infectible 3T3-L1 CAR{Delta}1 adipocytes were coinfected with an adenovirus expressing GLUT4-EGFP and wt or C375S myotubularin. Upon insulin stimulation, we observed GLUT4-EGFP translocation defined by a clear florescent rim at the plasma membrane. When wt myotubularin was concomitantly expressed, insulin-induced GLUT4-EGFP translocation was impaired, whereas expression of comparable levels of the C375S catalytically dead myotubularin had no negative effect on GLUT4-EGFP translocation (Fig. 7Go). Although expression of GLUT4-EGFP proves, in adipocytes, that modulation of PtdIns(3)P levels affects the insulin-induced translocation of this specific isoform, we cannot presently rule out, relative to muscle cells, a possible effect of PtdIns(3)P levels on the distribution, and thus contribution to glucose uptake, of other highly expressed GLUT isoforms such as GLUT1 and GLUT3 (27).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 6. Myotubularin Overexpression Affects Insulin-Stimulated Glucose Uptake in L6 Myotubes, without Altering Proximal Insulin Signaling Cascade

A, L6 myoblasts were left untreated or infected with wt/mutant myotubularin at a MOI of 20 as indicated. Three days after infection, cells were serum depleted 12 h before addition (black bars) or not (white bars) of 1 µM insulin for 10 min and glucose transport assays were performed as described in Materials and Methods. Results are expressed as percentage of uninfected, unstimulated cells (n = 2, six measurements per experiment). **, P < 0,0005; *, P < 0,005, compared with insulin infection value. B, Data in A are expressed as insulin stimulation vs. no stimulation ratio for each experimental condition. Decreased ratio for wt expression results from decreased insulin-stimulated glucose uptake, whereas the decreased ratio for DA and CS depends on the increased basal glucose uptake. C, Activation of the insulin downstream targets PKB and MAPK is not affected by myotubularin overexpression, indicating that myotubularin acts as inhibitor of glucose uptake distally to the insulin receptor, likely by affecting intracellular vesicle trafficking.

 


View larger version (60K):
[in this window]
[in a new window]
 
Fig. 7. Overexpression of Wild-Type Myotubularin Impairs Insulin-Stimulated GLUT4-EGFP Translocation in 3T3-L1 CAR{Delta}1 Adipocytes

Differentiated 3T3-L1 CAR{Delta}1 were coinfected for 36 h with adenoviruses expressing GLUT4-EGFP (A–D) and wt (C) or C375S (D) myotubularin at a MOI of 10 each, as described in the figure. Cells were then serum depleted for 3 h before a 10-min stimulation with 100 nM insulin. After stimulation, cells were fixed and GLUT4-EGFP distribution analyzed by confocal microscopy.

 
Collectively, these observations demonstrate that modulation of intracellular PtdIns(3)P levels affects glucose transport. To obtain further insight on possible mechanisms responsible for impairment of glucose transport by myotubularin, we analyzed the proximal steps of insulin action by evaluating the activation status of PKB and MAPK after insulin treatment. PKB and MAPK are readily activated by insulin, and PKB activation requires the PI3K-mediated production of the lipid second messenger PtdIns(3,4,5)P3, which, contrary to the monophosphorylated PtdIns3P, is not a substrate for myotubularin. Because we found similar activation levels of both the PKB and MAPK signaling molecules, irrespective of the absence or presence of myotubularin-expressing adenoviruses (Fig. 6CGo), we conclude that MTM1, by modulating the intracellular levels of PtdIns(3)P, acts downstream of these insulin signaling molecules.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
After the identification of MTM-1 as the causative gene of myotubular myopathy (2) and the demonstration of the catalytic function of myotubularin as a PtdIns(3)P phosphatase (7, 8), several homologs, both functional or enzymatically inactive, have been described and have provided evidence for the existence of a gene family consisting of at least 13 related members in humans (4, 6).

Despite such an apparent redundancy, each member of the myotubularin family seems to fulfill a specialized function, as illustrated by the fact that mutations in the related and ubiquitously expressed MTM-1 and MTMR2 genes give rise to different diseases and that one gene does not complement the defect of the other.

The ability to successfully express each MTM family member in a cellular context relevant to the phenotype observed in the pathological condition (e.g. muscle cells for MTM1 and MTMR1 and Schwann cells for MTMR2) would thus aid in understanding the function of each member.

The use of our adenoviral system is foreseeable for the various members of the MTM family to define in vivo the enzymatic action of each member as dissimilar data are reported in the literature. For example, although the function as PtdIns(3)P 3-phosphatase and PtdIns(3,5)P2 3-phosphatase for myotubularin (7, 8, 28) and for MTMR3 is well established (29), contrasting reports, based on data from in vitro assays, propose MTMR2 either as a specific PtdIns(3)P or PtdIns(3)P/PtdIns (3,5)P2 double-specificity phosphatase (30, 31). However, neither of these activities has been demonstrated in vivo. The possibility of effectively expressing the various myotubularins in mammalian cells should help to clarify these points and should ultimately lead to a better understanding of the molecular events underlying such diverse diseases as myotubular myopathy and Charcot-Marie-Tooth type 4B disease.

To express myotubularin in muscle cells, we have produced adenoviral vectors expressing wt myotubularin as well as the catalytically inactive C375S and putative substrate trap D278A mutants (AdMTMs). To ease the construction of adenoviral vectors, a recombinant adenoviral genome that allows the insertion of a cDNA of interest directly from pCDNA3 and related vectors harboring a CMV and a BGH termination signal was developed (Fig. 1Go).

An initial characterization of AdMTM1 (wt and C375S and D278A mutants) in COS7 cells indicated its function as PtdIns(3)P phosphatase by analysis of cellular phosphoinositides. As previously shown in transfected HEK293 cells by Taylor et al. (7), whereas the overexpression of wt MTM-1 had a marginal effect on the decrease of PtdIns(3)P, expression of the mutants increased the levels of PtdIns(3)P in the three different cell types we tested. Thus, we hypothesize that MTM-1 acts on a localized subpool of endogenous PtdIns(3)P. In keeping with this is a recent genetic study in Caenorhabditis elegans whereby it has been demonstrated that the homologs of MTM-1, MTM-R3, and MTM-R6 have specific and nonoverlapping subcellular localization, act on specific pools of PtdIns(3)P, and do not rescue the activity of a missing isoform (32). We have thus monitored localized PtdIns(3)P disappearance, which occurred upon expression of wt (but not CS and DA mutants) myotubularin-EGFP fusion protein, by showing the following: 1) the displacement of an exogenously added GST-2XFYVE probe in COS7 and 2) the similar displacement of EEA1 from a punctuate endosomal compartment to a diffuse cytoplasmic staining in COS7 and L6.

It is of particular importance to note that the GST-2XFYVE has been used as an external probe after cell fixation, as previous observations demonstrated that localization of the same GST-2XFYVE, when transfected in COS7 cells, was not altered by overexpression of myotubularin, likely because of competition for the same endogenous substrate PtdIns(3)P (25).

By employing the AdMTM1 adenoviruses, we next expressed myotubularin in the poorly transfectable muscle cell lines L6 and C2C12 and characterized its biochemical function. PtdIns(3)P levels increased in both L6 and C2C12 myotubes expressing the DA/CS mutants, suggesting a dominant negative action of these mutants. In particular, the DA mutant has a higher dominant negative effect compared with the CS mutant and, taken together with previous results (8, 25), confirms that it has substrate trap abilities. Only the three-dimensional structure would, however, definitely determine whether asp278 is the residue implicated in the release of the substrate. Relative to cells expressing wt myotubularin, we did not observe lowered PtdIns(3)P levels as compared with uninfected cells, likely because myotubularin may act on a subpool of cellular PtdIns(3)P, notably in the compartment(s) in which its allosteric activator PtdIns(5)P is present (28). With respect to a possible site of action of myotubularin, our immunofluorescence observations of EEA1 and the GST-2XFYVE probe displacement in L6 myotubes and COS7 indicate that myotubularin is active at the endosomal level.

Our conclusions about the possible site of action of myotubularin in the context of phosphoinositide metabolism are drawn from experiments in which adenoviral-driven overexpression of human MTM-1 was more than 10-fold higher than the endogenous MTM-1, as assessed by real-time PCR. Overexpression of wt myotubularin clearly affected endosomal PtdIns(3)P levels, as assessed by EEA1 staining. Likewise, the mutated versions D278A and C375S increased intracellular PtdIns(3)P levels.

Complementary information about the function of myotubularin in muscle cells would possibly be provided by gene knockout or knockdown studies. However, preliminary observations indicate that EEA1 and PtdIns(3)P localization (measured with EEA1 antibody and the 2XFYVE probe) are not altered in cultured fibroblasts and myoblasts from patients with myotubular myopathy (Laporte, J., and B. Payrastre, personal communication). The lack of this particular phenotype might be due to the fact that many MTM-1 homologs are simultaneously expressed in muscle cells, including MTMR-1 to 6 and MTMR-8 (see Ref. 33 for a review), which could possibly compensate for MTM-1 gene deletion or lack of a functional MTM-1. Contrarily, overexpression of myotubularin determines its dominant action over the other isoforms, thus allowing one to precisely define its function.

Early indications of a MTM-induced phenotype came from studies in S. pombe and S. cerevisiae, in which overexpression of catalytically active MTM-1, MTMR2, and MTMR3 induced a vacuolar phenotype resembling that induced by deletion or inactivating mutation of the VPS34 allele coding for PI3K (8, 29, 34). On the contrary, little is known about functional, histological, or immunohistological characteristics in mammalian cells, and no distinguishing phenotypes have been observed in nerve-muscle coculture of muscle fibers from donors affected by myotubular myopathy (35).

The modulation of PtdIns(3)P levels in L6 and C2C12 myotubes upon ectopic expression of DA and CS myotubularin prompted us to search for cellular responses affected by PtdIns(3)P. Because PtdIns(3)P controls trafficking of internal membranes (22), we evaluated insulin-induced glucose uptake. Increased glucose uptake after cell exposure to insulin is mediated by the translocation of the glucose transporter GLUT4 from intracellular insulin-responsive GLUT4-containing vesicles to the plasma membrane (36), via a fusion process that might require PtdIns(3)P. In keeping with our hypothesis, previous work employing anti-Vps34 neutralizing antibodies demonstrated a need for PtdIns(3)P in the recycling of endocytosed transferrin (37). When expressing wt myotubularin in L6 myotubes, we observed a significant decrease in insulin-induced glucose uptake. On the contrary, in cells expressing DA and CS mutants, characterized by increased PtsIns(3)P levels, insulin-induced glucose uptake was not affected, whereas we observed an enhanced basal glucose uptake. We suggest that the impairment in glucose transport induced by myotubularin expression acts upon the vesicular traffic machinery and not by affecting the proximal events in insulin signaling, because activation of insulin targets such as PKB and MAPK was not affected by myotubularin expression. Moreover, it is tempting to speculate that the up-regulation of MTM-1 mRNA and protein levels during the process of myoblasts differentiation and fusion (31, 38) contributes, simultaneously to the increased expression of GLUT4, to the more effective insulin-induced glucose uptake observed in myotubes vs. myoblasts.

At the present stage, we cannot exactly define whether the impaired glucose transport is due to an altered amount of GLUT4 in insulin-responsive GLUT4-containing compartments or to a modified translocation and fusion at the plasma membrane of such compartments. However, preliminary observations indicate that myotubularin acts on the targeting of neosynthesized GLUT4 to insulin-responsive subcellular compartments (39). We summarize our present work as follows. First, we describe and employ a new adenoviral vector that facilitates the task of generating and utilizing recombinant adenoviruses expressing a protein of interest. Second, by producing recombinant adenoviruses expressing myotubularin, we prove its in vivo enzymatic function as PtdIns(3)P phosphatase in myotubes, i.e. the most physiologically relevant cellular system to study myotubularin function, both by measuring cellular levels of PtdIns(3)P and by showing EEA1 displacement from endosomal compartments after wt myotubularin expression. Third, we provide evidence for a role of myotubularin in the attenuation of GLUT4 translocation at the plasma membrane and glucose transport in response to insulin stimulation. An urgent question to be addressed is whether this altered insulin action response has a physiological link to the myotubular myopathy during the developmental stages and/or after its installation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Culture
Rat L6 myoblasts, COS7 cells, and HEK293 cells were obtained from the American Type Culture collection (Rockville, MD). Mouse C2C12 myoblasts were a generous gift from Dr. P. Grimaldi (Institut National de la Santé et de la Recherche Médicale Unité 470, Nice, France). 3T3-L1 CAR{Delta}1 cells were provided by Dr. D. Orlicky (University of Colorado, Denver, CO) (40). Cells were maintained at 37 C with 5% (vol/vol) CO2 in DMEM containing 10% (vol/vol) fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies, Rockville, MD). Differentiation was induced by culturing cells for over 5 d in DMEM containing 2% (vol/vol) horse serum, 100 U/ml penicillin, and 100 µg/ml streptomycin.

Cloning and Expression Vectors
wt Human hMTM1 and the different point mutants [catalytically inactive hMTM1-C375S and substrate trap hMTM1-D278A (8)] in pCDNA3 were used to produce adenoviral AdhMTM-1 vectors. The catalytically inactive C375S mutant results from the elimination of the catalytic cysteine found in the Cys-H5-Arg (CX5R) phosphatase consensus sequence (8). The D278A was produced on the rationale that the myotubularin D278 residue aligns to an aspartic residue of the tyrosine phosphatase PTP1B whose mutation produced a substrate-trapping mutant (41). The substrate-trapping properties of the D278A mutation have been already characterized (8). GFP-hMTM1 fusion proteins were produced by recloning BamHI fragments encompassing the myotubularin cDNA into BamHI-linearized pEGFP-C1 (Clontech Laboratories, Palo Alto, CA). GLUT4-EGFP cDNA cloned in pCDNA3 was provided by J. Pessin (State University of New York, Stony Brook, NY) (42).

VmAdcDNA3 Adenoviral Plasmid and Generation of Recombinant Adenoviruses and Infections
The VmAdcDNA3 plasmid (unpublished data of S.R. and S.B.V., to whom requests should be addressed) is based on the adenovirus serotype 5 genome deleted in the E1/E3 regions (43). The homologous recombination target region placed in the {Delta}E1 deletion consists of two common elements of the pCDNA3 vectors, namely the a 363-bp 5' portion of CMV promoter and a segment of the 3' untranslated region of the BGH gene including the polyadenylation signal. These two elements are separated by a segment containing a unique SwaI site (ATTTAAAT). Homologous recombination is expected in this setup not only to eliminate the Swa site and to insert the desired cDNA, but also to reconstitute the entire CMV promoter sequence, thus providing a fixed sequence, the acquisition of which can be verified by PCR. The viral genome is joined via two PacI sites to the miniplasmid pPolyII (44) bearing the E. coli origin of replication and the AmpR gene. PacI digestion allows the separation of the viral genome from pPolyII.

Recombinant adenoviral genomes carrying the gene of interest were generated by homologous recombination (19). Briefly, CaCl2 competent E. coli BJ5183 was cotransformed with 200 ng SwaI-linearized VmAdcDNA3 plasmid and 600 ng linearized (e.g. PvuI digested) pCDNA3<hMTM1> or pCDNA3<GFP-GLUT4> (provided by J. Pessin). Recombinants were screened by PCR with the following set of primers: A, 5'-GAC GGA TGT GGC AAA AGT GA annealing to the leftmost part of the adenoviral genome; and B, 5'-ATG GGG TGG AGA CTT GGA AAT C annealing to portion of the CMV promoter, which is brought in by homologous recombination. Positive clones were further analyzed by restriction analysis or by a second round of PCR with primers A and (C) 5'-GCT TAA TGC GCC GCT ACA GG annealing to the BGH polyadenylation site, which amplify the full-length recombined cDNA. Positive recombinants were large-scale amplified in E. coli XL-1 blue, digested with PacI and transfected by the calcium phosphate methods in HEK293 cells. Cytopathic effect due to virus production was observed 8–10 d after transfection. Adenoviruses were extracted by three freeze/thaw cycles and stored in PBS, 10% (vol/vol) glycerol at -20 C. Viral titer of stocks was more than 108 plaque-forming units/ml.

Infections were performed at the MOI indicated for each experiment. After 16–20 h of incubation in the presence of viral particles, the medium was changed and cells were cultured for 24–72 h. Under these conditions, EGFP expression was routinely observed in over 90% of cells upon infection at the maximal MOI.

Immunoblotting and Antibodies
Serum-starved cells were washed with ice-cold PBS [140 mM NaCl, 3 mM KCl, 6 mM Na2HPO4, 1 mM KH2PO4 (pH 7.4)] and solubilized with lysis buffer [20 mM Tris-HCl, 138 mM NaCl, 2.7 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 5% (vol/vol) glycerol, 1% (vol/vol) Nonidet P-40, 5 mM EDTA, 20 µM leupeptin, 18 µM pepstatin, 2 mM Na3VO4, 20 mM NaF, 1 mM DTT (pH 7.4)]. Proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes (Hybond C, Amersham Biosciences, Inc., Piscataway, NJ). The membranes were soaked for 1 h in blocking buffer [20 mM Tris (pH 7.4), 137 mM NaCl, 0.1% (vol/vol) Tween 20] containing 5% (wt/vol) BSA or nonfat milk and then soaked overnight in blocking buffer containing antibodies. Immunoreactive proteins were detected using horseradish peroxidase-linked secondary antibodies and enhanced chemiluminescence according to the manufacturer’s instructions (Amersham Biosciences, Inc.). The 1G6 monoclonal antibody raised against an N-terminal peptide (amino acids 13–32) of human myotubularin was previously described (25). 1G6 specifically recognizes human myotubularin and does not cross-react with rat or mouse myotubularin. The monoclonal antibody directed to the N terminus of EEA1 was from Transduction Laboratories (Lexington, KY) and antibodies to active PKB (phosphoserine 473) and active p42/p44 MAPK were from Cell Signaling Technology (Beverly, MA) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. Monoclonal antibodies directed to GFP were from Chemicon (Temecula, CA) and polyclonal anti-GLUT4 was from Santa Cruz Biotechnology.

Real-Time PCR
Quantification of the relative mRNA levels in C2C12 cells of endogenous mouse MTM-1 mRNA vs. overexpressed human MTM-1 mRNA was performed by using an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). To specifically amplify mouse and human MTM-1, the following pair of oligos (5'-3') have been used to amplify reverse-transcribed polyadenylation RNA: mouse, forward primer, TCTGTGAGACATACCCTGCTCTTTT; reverse primer, TCTAAACGTTGCGATCCTCCTAA; human, forward primer, CCCAGGATCAAGCAACAACAG; reverse primer, TTATGTATTCGTCGCGTAAGGCTAA.

Analysis of Phosphoinositides
Cells were grown and differentiated in 6-cm plates and labeled for 4 h with 150 µCi/ml of [32P]orthophosphate (Amersham Pharmacia Biotech) in phosphate-free DMEM at 37 C with 5% (vol/vol) CO2. Lipid extraction was performed as described previously (45). Briefly, lipids were solubilized in chloroform:methanol (2.4 M), HCl (8:4:3, vol/vol) by vortexing. After centrifugation, the organic lipid-containing lower phase was collected and reextracted with the upper phase from the chloroform:methanol (2.4 M), HCl (8:4:3, vol/vol) mix. The lower phases were evaporated under nitrogen. Lipid extracts were solubilized in 25 µl chloroform:methanol 1:1, vol/vol) and resolved by thin layer chromatography (TLC) on chloroform:acetone:methanol:acetic acid:water (80:30:26:24:14, vol/vol). The spots corresponding to PtdIns(3)P and PtdIns(4)P were scraped, deacylated, and analyzed by HPLC on a Partisphere 5 SAX column (Whatman, Clifton, NJ). Radioactivity eluted from the column was quantified by using a continuous-flow in-line scintillation detector (Beckman Instruments, Fullerton, CA). The elution position of glycero-PtdIns(3)P was determined by using radiolabeled standards. In vivo myotubularin phosphatase action was performed on anti-1G6 immunoprecipitates as described (34).

Fluorescence Microscopy
COS7 cells were grown to 40–50% confluence on coverlips and transfected by diethylaminoethyl-dextran or Fugene 6. L6 myoblasts were infected with adenoviruses expressing GFP-hMTM1 fusion proteins. Forty-eight hours later, coverlips were washed twice with ice-cold PBS, fixed with 3% (vol/vol) formaldehyde in PBS for 15 min at 4 C, and permeabilized with 0.2% (vol/vol) Triton X-100 in PBS for 4 min at 4 C. Triton was omitted for the detection of PtdIns(3)P localization with a biotinylated GST-2XFYVE recombinant protein produced in bacteria from a construct provided by H. Stenmark (Department of Biochemistry, Institute for Cancer Research, Oslo, Norway) (24). Cells were then blocked with 1% (vol/vol) fetal calf serum in PBS for 30 min at 4 C and stained in the same buffer with a monoclonal antibody directed to the N terminus of EEA1. A secondary Texas-red-coupled antimouse antibody was used to detect the primary antibody. Coverslips were then mounted in Mowiol (Sigma Aldrich, St. Louis, MO). The cells were examined by sequential excitation at 488 nm (GFP) and 568 nm (Texas red) using a confocal microscope (TCS SP, Leica, Deerfield, IL) and a PL APO 63 x 1.40 oil objective (Leica). The images were combined and merged by using Photoshop (Adobe Systems, Mountain View, CA).

Glucose Uptake
L6 myotubes infected with adenoviruses as indicated were starved overnight and washed twice with prewarmed Krebs Ringer phosphate (KRP) buffer (137 mM NaCl, 4.7 mM KCl, 0.5 mM MgCl2, 1 mM CaCl2, 10 mM phosphate buffer at pH7.4). Cells were then either left untreated or exposed to 1 µM insulin for 10 min in the same buffer. After 10 min, a deoxyglucose (DOG) solution, containing 1 mM DOG and 1 µCi [3H]2-DOG in KRP, was added to cells for 10 min. The assay was stopped by cooling plates on ice and removing unincorporated radioactivity by three washes with ice-cold KRP. Cells were lysed with 500 µl 0.2 M NaOH, followed by 500 µl 0.2 M HCl, and incorporated radioactivity was measured by scintillation counting.


    ACKNOWLEDGMENTS
 
We thank J. Pessin for providing the GLUT4-EGFP cDNA and D. Orlicky for providing 3T3-L1 CAR{Delta}1 cells. We thank M. N. Monthouel for her assistance in performing real-time PCR measurements. We thank J.-L. Mandel for discussion.


    FOOTNOTES
 
Requests for VmAdCDNA3 should be sent to S.R. at sandro.rusconi{at}unifr.ch.

This work was supported by Institut National de la Santé et de la Recherche Médicale (INSERM), Université de Nice–Sophia-Antipolis, Centre National de la Recherche Scientifique, Hopital Universitaire de Strasbourg, and by grants from the Association Française Contre les Myopathies. C.C. is a recipient of a Ministère de l’Enseignement Supérieur et de la Recherche predoctoral fellowship. L.P. was supported by Fondation pour la Recherche Médicale and in part by an INSERM "Poste Vert" postdoctoral fellowship. S.B. was supported by a grant from the European Community (QLGI-CT-1999-00674).

C.C. and L.P. contributed equally to this work.

Abbreviations: BGH, Bovine GH; CMV, cytomegalovirus; DOG, deoxyglucose; EEA1, early endosomal antigen 1; EGFP, enhanced GFP; FYVE, Fab1p/YOTB Vac1p/EEA1; GFP, green fluorescent protein; GLUT4, glucose transporter 4; KRP, Krebs Ringer phosphate; MOI, multiplicity of infection; MTM1, myotubular myopathy-1; MTMR, MTM-related; PI3K, phosphatidylinositol 3-kinase; PKB, protein kinase B; PtdIns(3)P, phosphatidylinositol 3-phosphate; wt, wild-type.

Received for publication July 3, 2003. Accepted for publication September 8, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Wallgren-Pettersson C, Clarke A, Samson F, Fardeau M, Dubowitz V, Moser H, Grimm T, Barohn RJ, Barth PG 1995 The myotubular myopathies: differential diagnosis of the X linked recessive, autosomal dominant, and autosomal recessive forms and present state of DNA studies. J Med Genet 32:673–679[Abstract/Free Full Text]
  2. Laporte J, Hu LJ, Kretz C, Mandel JL, Kioschis P, Coy JF, Klauck SM, Poustka A, Dahl N 1996 A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nat Genet 13:175–182[CrossRef][Medline]
  3. Laporte J, Biancalana V, Tanner SM, Kress W, Schneider V, Wallgren-Pettersson C, Herger F, Buj-Bello A, Blondeau F, Liechti-Gallati S, Mandel JL 2000 MTM1 mutations in X-linked myotubular myopathy. Hum Mutat 15:393–409[CrossRef][Medline]
  4. Laporte J, Blondeau F, Buj-Bello A, Mandel JL 2001 The myotubularin family: from genetic disease to phosphoinositide metabolism. Trends Genet 17:221–228[CrossRef][Medline]
  5. Buj-Bello A, Laugel V, Messaddeq N, Zahreddine H, Laporte J, Pellissier JF, Mandel JL 2002 The lipid phosphatase myotubularin is essential for skeletal muscle maintenance but not for myogenesis in mice. Proc Natl Acad Sci USA 99:15060–15065[Abstract/Free Full Text]
  6. Wishart MJ, Taylor GS, Slama JT, Dixon JE 2001 PTEN and myotubularin phosphoinositide phosphatases: bringing bioinformatics to the lab bench. Curr Opin Cell Biol 13:172–181[CrossRef][Medline]
  7. Taylor GS, Maehama T, Dixon JE 2000 Inaugural article: myotubularin, a protein tyrosine phosphatase mutated in myotubular myopathy, dephosphorylates the lipid second messenger, phosphatidylinositol 3-phosphate. Proc Natl Acad Sci USA 97:8910–8915[Abstract/Free Full Text]
  8. Blondeau F, Laporte J, Bodin S, Superti-Furga G, Payrastre B, Mandel JL 2000 Myotubularin, a phosphatase deficient in myotubular myopathy, acts on phosphatidylinositol 3-kinase and phosphatidylinositol 3-phosphate pathway. Hum Mol Genet 9:2223–2229[Abstract/Free Full Text]
  9. Schu PV, Takegawa K, Fry MJ, Stack JH, Waterfield MD, Emr SD 1993 Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science 260:88–91[Abstract/Free Full Text]
  10. Cui X, De Vivo I, Slany R, Miyamoto A, Firestein R, Cleary ML 1998 Association of SET domain and myotubularin-related proteins modulates growth control. Nat Genet 18:331–337[CrossRef][Medline]
  11. Hunter T 1998 Anti-phosphatases take the stage. Nat Genet 18:303–305[CrossRef][Medline]
  12. Kim SA, Vacratsis PO, Firestein R, Cleary ML, Dixon JE 2003 Regulation of myotubularin-related (MTMR)2 phosphatidylinositol phosphatase by MTMR5, a catalytically inactive phosphatase. Proc Natl Acad Sci USA 100:4492–4497[Abstract/Free Full Text]
  13. Buj-Bello A, Furling D, Tronchere H, Laporte J, Lerouge T, Butler-Browne GS, Mandel JL 2002 Muscle-specific alternative splicing of myotubularin-related 1 gene is impaired in DM1 muscle cells. Hum Mol Genet 11:2297–2307[Abstract/Free Full Text]
  14. Bolino A, Muglia M, Conforti FL, LeGuern E, Salih MA, Georgiou DM, Christodoulou K, Hausmanowa-Petrusewicz I, Mandich P, Schenone A, Gambardella A, Bono F, Quattrone A, Devoto M, Monaco AP 2000 Charcot-Marie-Tooth type 4B is caused by mutations in the gene encoding myotubularin-related protein-2. Nat Genet 25:17–19[CrossRef][Medline]
  15. Azzedine H, Bolino A, Taieb T, Birouk N, Di Duca M, Bouhouche A, Benamou S, Mrabet A, Hammadouche T, Chkili T, Gouider R, Ravazzolo R, Brice A, Laporte J, LeGuern E 2003 Mutations in MTMR13, a new pseudophosphatase homologue of MTMR2 and Sbf1, in two families with an autosomal recessive demyelinating form of Charcot-Marie-Tooth disease associated with early-onset glaucoma. Am J Hum Genet 72:1141–1153[CrossRef][Medline]
  16. Senderek J, Bergmann C, Weber S, Ketelsen UP, Schorle H, Rudnik-Schoneborn S, Buttner R, Buchheim E, Zerres K 2003 Mutation of the SBF2 gene, encoding a novel member of the myotubularin family, in Charcot-Marie-Tooth neuropathy type 4B2/11p15. Hum Mol Genet 12:349–356[Abstract/Free Full Text]
  17. Saltiel AR, Kahn CR 2001 Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414:799–806[CrossRef][Medline]
  18. Bryant NJ, Govers R, James DE 2002 Regulated transport of the glucose transporter GLUT4. Nat Rev Mol Cell Biol 3:267–277[CrossRef][Medline]
  19. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B 1998 A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95:2509–2514[Abstract/Free Full Text]
  20. Chartier C, Degryse E, Gantzer M, Dieterle A, Pavirani A, Mehtali M 1996 Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J Virol 70:4805–4810[Abstract]
  21. Crouzet J, Naudin L, Orsini C, Vigne E, Ferrero L, Le Roux A, Benoit P, Latta M, Torrent C, Branellec D, Denefle P, Mayaux JF, Perricaudet M, Yeh P 1997 Recombinational construction in Escherichia coli of infectious adenoviral genomes. Proc Natl Acad Sci USA 94:1414–1419[Abstract/Free Full Text]
  22. Simonsen A, Wurmser AE, Emr SD, Stenmark H 2001 The role of phosphoinositides in membrane transport. Curr Opin Cell Biol 13:485–492[CrossRef][Medline]
  23. Stenmark H, Aasland R, Driscoll PC 2002 The phosphatidylinositol 3-phosphate-binding FYVE finger. FEBS Lett 513:77–84[CrossRef][Medline]
  24. Gillooly DJ, Morrow IC, Lindsay M, Gould R, Bryant NJ, Gaullier JM, Parton RG, Stenmark H 2000 Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells. EMBO J 19:4577–4588[CrossRef][Medline]
  25. Laporte J, Blondeau F, Gansmuller A, Lutz Y, Vonesch JL, Mandel JL 2002 The PtdIns3P phosphatase myotubularin is a cytoplasmic protein that also localizes to Rac1-inducible plasma membrane ruffles. J Cell Sci 115:3105–3117[Abstract/Free Full Text]
  26. Khan AH, Pessin JE 2002 Insulin regulation of glucose uptake: a complex interplay of intracellular signalling pathways. Diabetologia 45:1475–1483[CrossRef][Medline]
  27. Taha C, Mitsumoto Y, Liu S, Klip A 1995 The insulin-dependent biosynthesis of GLUT1 and GLUT3 glucose transporters in L6 muscle cells is mediated by distinct pathways. Roles of p21ras and pp70 S6 kinase. J Biol Chem 270:24678–24681[Abstract/Free Full Text]
  28. Schaletzky J, Dove SK, Short B, Lorenzo O, Clague MJ, Barr FA 2003 Phosphatidylinositol-5-phosphate activation and conserved substrate specificity of the myotubularin phosphatidylinositol 3-phosphatases. Curr Biol 13:504–509[CrossRef][Medline]
  29. Walker DM, Urbe S, Dove SK, Tenza D, Raposo G, Clague MJ 2001 Characterization of MTMR3, an inositol lipid 3-phosphatase with novel substrate specificity. Curr Biol 11:1600–1605[CrossRef][Medline]
  30. Berger P, Bonneick S, Willi S, Wymann M, Suter U 2002 Loss of phosphatase activity in myotubularin-related protein 2 is associated with Charcot-Marie-Tooth disease type 4B1. Hum Mol Genet 11:1569–1579[Abstract/Free Full Text]
  31. Kim SA, Taylor GS, Torgersen KM, Dixon JE 2002 Myotubularin and MTMR2, phosphatidylinositol 3-phosphatases mutated in myotubular myopathy and type 4B Charcot-Marie-Tooth disease. J Biol Chem 277:4526–4531[Abstract/Free Full Text]
  32. Xue Y, Fares H, Grant B, Li Z, Rose AM, Clark SG, Skolnik EY 2003 Genetic analysis of the myotubularin family of phosphatases in Caenorhabditis elegans. J Biol Chem 278:34380–34386[Abstract/Free Full Text]
  33. Tronchère H, Buj-Bello A, Mandel JL, Payrastre B, Implication of phosphoinositide phosphatases in genetic diseases: the case of myotubularin. Cell Mol Life Sci, in press
  34. Laporte J, Liaubet L, Blondeau F, Tronchere H, Mandel JL, Payrastre B 2002 Functional redundancy in the myotubularin family. Biochem Biophys Res Commun 291:305–312[CrossRef][Medline]
  35. Dorchies OM, Laporte J, Wagner S, Hindelang C, Warter JM, Mandel JL, Poindron P 2001 Normal innervation and differentiation of X-linked myotubular myopathy muscle cells in a nerve-muscle coculture system. Neuromuscul Disord 11:736–746[CrossRef][Medline]
  36. Mora S, Pessin JE 2002 An adipocentric view of signaling and intracellular trafficking. Diabetes Metab Res Rev 18:345–356[CrossRef][Medline]
  37. Siddhanta U, McIlroy J, Shah A, Zhang Y, Backer JM 1998 Distinct roles for the p110alpha and hVPS34 phosphatidylinositol 3'-kinases in vesicular trafficking, regulation of the actin cytoskeleton, and mitogenesis. J Cell Biol 143:1647–1659[Abstract/Free Full Text]
  38. Laporte J, Kress W, Mandel JL 2001 Diagnosis of X-linked myotubular myopathy by detection of myotubularin. Ann Neurol 50:42–46[CrossRef][Medline]
  39. Pfaffly JR, Engle M, Backer JM, Pirola L, Van Obberghen E, Pessin JE, GLUT4 targeting to insulin-responsive compartment in 3T3L1 adipocytes is inhibited by the lipid phosphatase myotubularin. Proc American Diabetes Association 62nd Scientific Sessions, San Francisco, CA, 2002 (Abstract 1877-P)
  40. Orlicky DJ, DeGregori J, Schaack J 2001 Construction of stable coxsackievirus and adenovirus receptor-expressing 3T3–L1 cells. J Lipid Res 42:910–915[Abstract/Free Full Text]
  41. Flint AJ, Tiganis T, Barford D, Tonks NK 1997 Development of "substrate-trapping" mutants to identify physiological substrates of protein tyrosine phosphatases. Proc Natl Acad Sci USA 94:1680–1685[Abstract/Free Full Text]
  42. Thurmond DC, Ceresa BP, Okada S, Elmendorf JS, Coker K, Pessin JE 1998 Regulation of insulin-stimulated GLUT4 translocation by Munc18c in 3T3L1 adipocytes. J Biol Chem 273:33876–33883[Abstract/Free Full Text]
  43. Haj-Ahmad Y, Graham FL 1986 Characterization of an adenovirus type 5 mutant carrying embedded inverted terminal repeats. Virology 153:22–34[CrossRef][Medline]
  44. Lathe R, Vilotte JL, Clark AJ 1987 Plasmid and bacteriophage vectors for excision of intact inserts. Gene 57:193–201[CrossRef][Medline]
  45. Gratacap MP, Payrastre B, Viala C, Mauco G, Plantavid M, Chap H 1998 Phosphatidylinositol 3,4,5-trisphosphate-dependent stimulation of phospholipase C-{gamma}2 is an early key event in Fc{gamma}RIIA-mediated activation of human platelets. J Biol Chem 273:24314–24321[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Shisheva
Phosphoinositides in insulin action on GLUT4 dynamics: not just PtdIns(3,4,5)P3
Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E536 - E544.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Cao, J. M. Backer, J. Laporte, E. J. Bedrick, and A. Wandinger-Ness
Sequential Actions of Myotubularin Lipid Phosphatases Regulate Endosomal PI(3)P and Growth Factor Receptor Trafficking
Mol. Biol. Cell, August 1, 2008; 19(8): 3334 - 3346.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. Rome, V. Lecomte, E. Meugnier, J. Rieusset, C. Debard, V. Euthine, H. Vidal, and E. Lefai
Microarray analyses of SREBP-1a and SREBP-1c target genes identify new regulatory pathways in muscle
Physiol Genomics, August 1, 2008; 34(3): 327 - 337.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Buj-Bello, F. Fougerousse, Y. Schwab, N. Messaddeq, D. Spehner, C. R. Pierson, M. Durand, C. Kretz, O. Danos, A.-M. Douar, et al.
AAV-mediated intramuscular delivery of myotubularin corrects the myotubular myopathy phenotype in targeted murine muscle and suggests a function in plasma membrane homeostasis
Hum. Mol. Genet., July 15, 2008; 17(14): 2132 - 2143.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
I. J. Lodhi, D. Bridges, S.-H. Chiang, Y. Zhang, A. Cheng, L. M. Geletka, L. S. Weisman, and A. R. Saltiel
Insulin Stimulates Phosphatidylinositol 3-Phosphate Production via the Activation of Rab5
Mol. Biol. Cell, July 1, 2008; 19(7): 2718 - 2728.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Falasca, W. E. Hughes, V. Dominguez, G. Sala, F. Fostira, M. Q. Fang, R. Cazzolli, P. R. Shepherd, D. E. James, and T. Maffucci
The Role of Phosphoinositide 3-Kinase C2{alpha} in Insulin Signaling
J. Biol. Chem., September 21, 2007; 282(38): 28226 - 28236.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E. Hirsch, C. Costa, and E. Ciraolo
Phosphoinositide 3-kinases as a common platform for multi-hormone signaling
J. Endocrinol., August 1, 2007; 194(2): 243 - 256.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Naimi, N. Gautier, C. Chaussade, A. M. Valverde, D. Accili, and E. Van Obberghen
Nuclear Forkhead Box O1 Controls and Integrates Key Signaling Pathways in Hepatocytes
Endocrinology, May 1, 2007; 148(5): 2424 - 2434.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
V. Tosch, H. M. Rohde, H. Tronchere, E. Zanoteli, N. Monroy, C. Kretz, N. Dondaine, B. Payrastre, J.-L. Mandel, and J. Laporte
A novel PtdIns3P and PtdIns(3,5)P2 phosphatase with an inactivating variant in centronuclear myopathy
Hum. Mol. Genet., November 1, 2006; 15(21): 3098 - 3106.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Robert, C. Gaggioli, O. Bailet, C. Chavey, P. Abbe, E. Aberdam, E. Sabatie, A. Cano, A. Garcia de Herreros, R. Ballotti, et al.
SPARC Represses E-Cadherin and Induces Mesenchymal Transition during Melanoma Development.
Cancer Res., August 1, 2006; 66(15): 7516 - 7523.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
O. Lorenzo, S. Urbe, and M. J. Clague
Systematic analysis of myotubularins: heteromeric interactions, subcellular localisation and endosomerelated functions
J. Cell Sci., July 15, 2006; 119(14): 2953 - 2959.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Yamamoto, M. L. Cremona, and J. E. Rothman
Autophagy-mediated clearance of huntingtin aggregates triggered by the insulin-signaling pathway
J. Cell Biol., February 27, 2006; 172(5): 719 - 731.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. L. Robinson and J. E. Dixon
The Phosphoinositide-3-phosphatase MTMR2 Associates with MTMR13, a Membrane-associated Pseudophosphatase Also Mutated in Type 4B Charcot-Marie-Tooth Disease
J. Biol. Chem., September 9, 2005; 280(36): 31699 - 31707.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ishiki, V. K. Randhawa, V. Poon, L. JeBailey, and A. Klip
Insulin Regulates the Membrane Arrival, Fusion, and C-terminal Unmasking of Glucose Transporter-4 via Distinct Phosphoinositides
J. Biol. Chem., August 5, 2005; 280(31): 28792 - 28802.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Tang, A. M. Powelka, N. A. Soriano, M. P. Czech, and A. Guilherme
PTEN, but Not SHIP2, Suppresses Insulin Signaling through the Phosphatidylinositol 3-Kinase/Akt Pathway in 3T3-L1 Adipocytes
J. Biol. Chem., June 10, 2005; 280(23): 22523 - 22529.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
T. Maffucci, F. T. Cooke, F. M. Foster, C. J. Traer, M. J. Fry, and M. Falasca
Class II phosphoinositide 3-kinase defines a novel signaling pathway in cell migration
J. Cell Biol., June 6, 2005; 169(5): 789 - 799.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
O. Lorenzo, S. Urbe, and M. J. Clague
Analysis of phosphoinositide binding domain properties within the myotubularin-related protein MTMR3
J. Cell Sci., May 1, 2005; 118(9): 2005 - 2012.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Tronchere, J. Laporte, C. Pendaries, C. Chaussade, L. Liaubet, L. Pirola, J.-L. Mandel, and B. Payrastre
Production of Phosphatidylinositol 5-Phosphate by the Phosphoinositide 3-Phosphatase Myotubularin in Mammalian Cells
J. Biol. Chem., February 20, 2004; 279(8): 7304 - 7312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chaussade, C.
Right arrow Articles by Van Obberghen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chaussade, C.
Right arrow Articles by Van Obberghen, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals