help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0139
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shang, C. A.
Right arrow Articles by Waters, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shang, C. A.
Right arrow Articles by Waters, M. J.
Molecular Endocrinology 17 (12): 2494-2508
Copyright © 2003 by The Endocrine Society

Constitutively Active Signal Transducer and Activator of Transcription 5 Can Replace the Requirement for Growth Hormone in Adipogenesis of 3T3-F442A Preadipocytes

Catherine A. Shang and Michael J. Waters

School of Biomedical Sciences and the Institute for Molecular Bioscience, The University of Queensland, Queensland 4072 Brisbane, Australia

Address all correspondence and requests for reprints to: Michael J. Waters, School of Biomedical Sciences and the Institute for Molecular Bioscience, The University of Queensland, Queensland 4072 Brisbane, Australia. E-mail: m.waters{at}mailbox.uq.edu.au.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Although it is the best characterized in vitro model of GH action, the mechanisms used by GH to induce differentiation of murine 3T3-F442A preadipocytes remain unclear. Here we have examined the role of three transcriptional regulators in adipogenesis. These regulators are either rapidly induced in response to GH [Stra13, signal transducer and activator of transcription (Stat)3] or of central importance to GH signaling (Stat5). Retroviral transfection of 3T3-F442A preadipocytes was used to increase expression of Stra13, Stat3, and Stat5a. Only Stat5a transfection increased the expression of adipogenic markers peroxisome proliferator-activated receptor {gamma}, CCAAT enhancer binding protein (C/EBP){alpha}, and adipose protein 2/fatty acid-binding protein in response to GH, as determined by quantitative RT-PCR. Transfection with constitutively active Stat3 and Stat5a revealed that constitutively active Stat5a but not Stat3 was able to replace the GH requirement for adipogenesis. Constitutively active Stat5a but not Stat3 was able to increase the formation of lipid droplets and expression of {alpha}-glycerol phosphate dehydrogenase toward levels seen in mature adipocytes. Constitutively active Stat5a was also able to increase the expression of transcripts for C/EBP{alpha} to similar levels as GH, and of C/EBPß, peroxisome proliferator-activated receptor {gamma}, and adipose protein 2/fatty acid-binding protein transcripts to a lesser extent. An in vivo role for GH in murine adipogenesis is supported by significantly decreased epididymal fat depot size in young GH receptor-deleted mice, before manifestation of the lipolytic actions of GH. We conclude that Stat5 is a critical factor in GH-induced, and potentially prolactin-induced, murine adipogenesis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DIFFERENTIATION OF ADIPOCYTES is under hormonal and growth factor control. Under growth arrest conditions, several cell lines derived from embryonic fibroblasts have been shown to convert to adipocytes in response to serum and to form fully developed fat pads in vivo at the site of injection (1, 2). GH has been identified as a major adipogenic factor in serum responsible for this conversion (3, 4). Further studies with one of these lines, the 3T3-F442A preadipocyte, showed that GH is required to prime these cells for terminal differentiation (5, 6), but little is known of the molecular mechanism involved in this priming event.

Differentiation of preadipocyte cells lines such as 3T3-L1 and 3T3-F442A in response to adipogenic hormonal cocktails containing insulin, glucocorticoids, cAMP, and fetal calf serum (FCS) is mediated in part by the initial expression of CCAAT enhancer binding proteins (C/EBP)ß and C/EBP{delta}. Early expression of these transcription factors results in low-level expression of peroxisome proliferator-activated receptor (PPAR){gamma}, which in turn activates expression of C/EBP{alpha}. PPAR{gamma} and C/EBP{alpha} then positively regulate the transcription of each other, enabling high expression of both proteins for the duration of terminal differentiation (7, 8). The expression of PPAR{gamma} is both necessary and sufficient for adipocyte differentiation in vitro and in vivo (9, 10), whereas the primary role for C/EBP{alpha} is for the maintenance of PPAR{gamma} expression during adipogenesis and for insulin sensitivity (11). In addition to the early activation of C/EBPß and C/EBP{delta}, other transcription factors are likely to be involved in regulating the expression of PPAR{gamma} and C/EBP{alpha} in response to hormonal stimuli, as double knockout (KO) C/EBPß-C/EBP{delta} mice, while displaying reduced mass of brown adipose tissue and white adipose tissue, do have normal levels of PPAR{gamma} and C/EBP{alpha} (12).

We have used the specific requirement for GH in the initiation of 3T3-F442A adipogenesis as a cell model in which to study the molecular mechanisms by which GH regulates cellular differentiation. Using a serum-free chemically defined differentiation media (DDM) composed of GH, IGF-I, epidermal growth factor (EGF), insulin, transferrin, and fetuin, it is possible to study direct GH effects upon 3T3-F442A differentiation (6). Previous studies using a two-phase protocol that allows the GH-priming event to be separated from terminal differentiation established that the major mediator of GH signaling (Janus kinase 2) is essential for GH priming of these cells (13). Furthermore, depletion of the transcription factor, signal transducer and activator of transcription (Stat)5 by antisense oligonucleotide abolished the ability of GH to promote adipogenesis, implicating Stat5 as a mediator in GH-dependent differentiation of 3T3-F442A preadipocytes (13). However, it is unclear whether Stat5 is indeed required for GH priming or for terminal differentiation that can be mediated by other factors in the chemically defined adipogenic medium (6). Recent studies in other cell models have also supported a role for Stat5 in adipogenesis. These have shown that, during adipogenesis, Stat5 protein levels are rapidly induced in response to adipogenic hormone stimulus (14, 15). Furthermore, ectopic expression of Stat5a promoted adipogenesis in several nonadipogenic fibroblast cell lines (16), whereas expression of a dominant-negative Stat5a mutant protein in 3T3-L1 cells attenuated this process (15).

As a means of understanding how GH regulates the program of gene expression necessary for adipogenesis, genes rapidly induced by GH in 3T3-F442A preadipocytes have been identified by our laboratory and others. Several of these genes include the immediate early genes c-fos, c-jun (17), Egr-1 (18), C/EBP{delta}, and C/EBPß (19). Using a subtractive hybridization approach, we have recently reported Stat2, Stat3, thrombospondin-1, oncostatin M receptor ß-chain, a DEAD box RNA helicase, and muscleblind, a developmental transcription factor (20), to be rapidly transcriptionally regulated by GH. We report here that the basic helix-loop-helix transcription factor Stra13/DEC1/Sharp2, a member of the Drosophila hairy/Enhancer of split transcription repressor family, is also rapidly induced in 3T3-F442A preadipocytes in response to GH. Nothing is known concerning the role of Stra13 in GH action, but Stra13 is reported to be the first transcription factor that can promote chondrogenic differentiation at both early and terminal stages (21). A retinoid-inducible gene, Stra13 is also able to induce differentiation of PC12 cells into neurons, rather than to mesoderm/endoderm (22). It is proposed that Stra13 may play a key role in signaling pathways that lead to growth arrest and terminal differentiation by repression of target genes via histone deacetylase-dependent and histone deacetylase-independent mechanisms (23).

In this study we have investigated the functional role of the transcription factors Stat3, Stat5, Stra13, and constitutively active mutants of Stat3 and Stat5 in GH-induced priming of 3T3-F442A preadipocytes. We report that the ectopic expression of a constitutively active mutant of Stat5, but not of a constitutively active Stat3, or of Stra13, is sufficient to prime differentiation of 3T3-F442A preadipocytes independent of GH. This provides further support for the critical involvement of Stat5 in early adipogenic events.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Genes Potentially Involved in GH-Dependent Adipogenesis—Stra13
The subtractive hybridization approach (suppression subtractive hybridization with PCR-Select) was used to identify rapidly induced genes that may be involved in GH-induced priming of 3T3-F442A preadipocytes (20). We report here that Stra13 was identified in this manner, and Northern blot analysis was used to verify that it is induced by GH within 1 h (Fig. 1Go).



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 1. Northern Blot Analysis of Stra13 in GH-Stimulated 3T3-F442A Preadipocytes

Gels were run with 10 µg of total RNA isolated from 3T3-F442A preadipocytes that had been treated with vehicle or with 2 nM GH for the stated times. Blots were probed with a random prime labeled probe for Stra13. Results shown are representative of replicate experiments. An 18S ribosomal probe was used to control for loading variations in all experiments.

 
Ectopic Expression of Stat3, Stat5, and Stra13 in 3T3-F442A Preadipocytes by Retroviral Transfection
To investigate whether Stat3, Stat5, and Stra13 are involved in GH-mediated differentiation of 3T3-F442A preadipocytes, stable cell lines overexpressing these transcription factors were established (24). The pBabe-Vector, pBabe-Stat5a, pBabe-Stat3, and pBabe-Stra13 stable cell lines were grown to confluence in cat serum and then induced to differentiate in the presence and absence of GH in defined differentiation medium. All cell lines grew normally to confluence and showed no morphological changes in phenotype. The effect of ectopic expression of Stat5, Stat3, and Stra13 on GH-induced adipogenesis was determined after 10 d of differentiation by qualitative assessment of appearance of Oil Red O-stained lipid droplets and by quantification of {alpha}-glycerol phosphate dehydrogenase (GPDH) activity. Cell lines cultured in the absence of GH had very little lipid accumulation in comparison with cell lines with GH and did not differ from vector-transfected control cells, as shown in Fig. 2Go, panel 1. The presence of ectopic Stat3 or Stra13 did not influence the extent of lipid accumulation in response to GH, although some increase in Stat5a-transfected cells was evident (Fig. 2Go, panel 1). Immunofluorescence was used to verify expression of the transduced gene in each cell line 24 h after infection and before puromycin selection. As shown in Fig. 2Go, panel 2, the stable lines all express protein that is detectable using the appropriate antibody to the relevant tag. This was confirmed by EMSA in the case of Stat5a (Fig. 2Go, panel 3), which shows substantial overexpression of Stat5a using this retroviral system. From these experiments, it appears that overexpression of wild-type (wt) Stra13, Stat3, or Stat5 is not sufficient to allow GH-independent priming of cells for adipogenesis.



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 2. Ectopic Expression of Stat5a, Stat3, and Stra13 Does Not Stimulate GH-Independent Adipogenesis of 3T3-F442A Preadipocytes

Panel 1, Stable 3T3-F442A-Vector (A and B), 3T3-F442A-Stat5 (C and D), 3T3-F442-Stat3 (E and F), and 3T3-F442A-Stra13 (G and H) cell lines were cultured after confluence in DMM in the absence (A, C, E, and F) or presence of 2 nM GH (B, D, F, and H). After 12 d, the cells were stained with Oil Red O and observed by light microscopy. Original magnification, x100. Panel 2, Ectopic expression of Stat5a, Stat3, and Stra13 protein in 3T3-F442A cells. The fusion proteins STAT5a-FLAG, STAT3-HA, and STRA13-HA were expressed in 3T3-F442A preadipocytes using retroviral-mediated gene transfer. The infected cells were grown for 24–48 h on coverslips, fixed, and the expression of Stat5-FLAG (A), Stat3-HA (C), and STRA 13-HA (E) proteins was observed by immunofluorescence staining. Original magnification was x600. The right panel (B, D, and F) shows the corresponding DAPI staining of the infected cells. Panel 3, Level of ectopic expression of Stat5a is substantially increased in Stat5-expressing cell lines, by EMSA. This was performed using nuclear extracts prepared from 3T3-F442A-Vector and 3T3-F442A-Stat5 cell lines serum starved for 3 h and then either untreated (-) or treated with 100 ng/ml of hGH for 15 min (+). Mobility shift assays were performed using a 32P-labeled oligonucleotide probe containing a Stat5 consensus binding site, as described in Materials and Methods. Identification of endogenous Stat5 and ectopically expressed Stat5Flag was performed by preincubating extracts with polyclonal antibody to Stat5 or monoclonal FLAG antibody. The supershifted complexes (SS), the Stat5-DNA complex, and the Stat5Flag-DNA complex are indicated with an arrow. Protein concentration of nuclear extracts was determined by bicinchoninic acid and 4 µg of nuclear extract was loaded per lane.

 
Ectopic Expression of Stat5a1*6 Induces GH-Independent Differentiation of 3T3-F442A Preadipocytes
It appeared likely that the lack of effect on differentiation of 3T3-F442A preadipocytes by ectopic expression of Stat3 and Stat5 in the absence of GH was due to insufficient activation of these factors under the conditions used in the experiment. To resolve this issue we repeated the previous experiment using characterized, constitutively active Stat5 and Stat3 mutants. After 10 d the adipogenic ability of cells stably expressing constitutively active Stat3 and Stat5a was determined phenotypically by Oil Red O staining and quantitatively by measurement of GPDH enzyme activity. The 3T3-F442A-Stat3-C cell line had a fibroblastic appearance in the absence of GH and only a few cells displayed lipid accumulation, whereas in the presence of GH the majority of cells were rounded and contained large lipid droplets (Fig. 3Go, panel 1). The Stat5a1*6 cell lines were also able to undergo differentiation in response to GH. However, the Stat5a1*6 cell line differentiated into lipid-containing cells that morphologically resembled adipocytes without GH stimulation (Fig. 3Go, panel 1). The 3T3-F442A-Stat3-C cell lines grew at a similar rate to control 3T3-F442A-Vector cell lines, whereas the 3T3-F442A-Stat5a1*6 cell lines routinely required a longer period of time in culture to reach confluence. The 3T3-F442A-Stat51*6 line also accumulated lipid more rapidly than the control cell line in the presence of GH. Mutant Stat5a1*6 was FLAG tagged and mutant Stat3-C was hemagglutinin (HA) tagged to enable demonstration of their expression. Immunofluorescence using either anti-HA or anti-FLAG antibodies was used to verify Stat5a1*6 and Stat3-C cell lines were expressing the transduced gene (Fig. 3Go, panel 2), although not at the high level seen with Stat5a (above).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3. Ectopic Expression of Constitutively Active Stat5a, But Not Stat3, Mutant Is Sufficient to Induce GH-Independent Adipogenesis in 3T3-F442A Preadipocytes

Panel 1, Stable 3T3-F442-Vector (A and B), 3T3-F442A-Stat5a 1*6 (C and D), and 3T3-F442A-Stat3-C (E and F) cell lines were cultured after confluence in DDM in the absence (A, C, and E) or presence of 2 nM GH (B, D, and F). After 12 d, the cells were stained with Oil Red O and observed under light microscopy. Magnification, x100. Panel 2, Ectopic expression of constitutively active mutants of Stat5a and Stat3. The fusion proteins of Stat5A-1*6-FLAG and Stat3-C-HA were expressed in 3T3-F442A preadipocytes using retroviral-mediated gene transfer. The infected cells were grown for 24–48 h on coverslips, fixed, and the expression of Stat5a1*6-FLAG (A) and Stat3-C-HA (B) proteins was observed by immunofluorescence staining. Original magnification was x600. The right panel (B and D) shows the corresponding DAPI staining of the infected cells.

 
Biochemical Demonstration of Constitutive Binding Activity of Stat5a1*6 and Stat3-C in 3T3-F442A Preadipocytes
To demonstrate the constitutive activity of these mutant proteins under the conditions of these experiments, nuclear extracts were prepared from 3T3-F442A-Vector, 3T3-F442A-Stat5a1*6, and 3T3-F442A-Stat3-C cell lines, untreated or treated with 50 ng/ml human GH (hGH). These were assayed for binding to high-affinity Stat5 and Stat3 binding sites by EMSA. Without activation by GH there was no binding of endogenous wt Stat5 or Stat3, but there was constitutive binding of Stat5a1*6 (Fig. 4AGo) and Stat3-C to DNA (Fig. 4BGo). The expected identity of the protein interacting with the high-affinity binding site oligonucleotide probe was confirmed using antibodies specific for the appropriate epitope tag. Incubation of the protein-DNA complexes with HA or FLAG antibody resulted in these complexes being supershifted (Fig. 4Go, A and B).



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. The Mutant Stat5a1*6-FLAG Protein Can Bind DNA in the Absence of GH Stimulation

EMSA was performed using nuclear extracts prepared from the 3T3-F442A-Vector and 3T3-F442A-Stat5a-1*6-FLAG cell lines serum starved for 3 h and then either left untreated (-) or treated with 100 ng/ml of hGH for 15 min (+). Mobility shift assays were performed using a 32P-labeled oligonucleotide probe containing a Stat5 consensus binding site. Identification of endogenous Stat5 and ectopically expressed Stat5a–1*6-FLAG was facilitated by preincubating extracts with polyclonal antibody to Stat5a or monoclonal FLAG antibody (Sigma). The supershifted complexes (SS), the Stat5-DNA complex, and the Stat5a-1*6-DNA complex are indicated with an arrow. FP, Free probe. B, The mutant Stat3-C-HA protein can bind DNA in the absence of GH-stimulation. EMSA was performed using nuclear extracts prepared from the 3T3-F442A-Vector and 3T3-F442A-Stat3-C cell lines serum starved for 3 h and then either untreated (-) or treated with 100 ng/ml of hGH for 15 min (+). Mobility shift assays were performed using 32P-labeled oligonucleotide probe containing a Stat3 consensus binding site. Identification of endogenous Stat3 and ectopically expressed Stat3-C was facilitated by preincubating extracts with polyclonal antibody to Stat3 or monoclonal HA antibody (Sigma). The supershifted complexes (SS), the Stat3-DNA complex,and the Stat3-C-DNA complex are indicated with an arrow.

 
Quantitative Measurement of Differentiation by GPDH Assay
In addition to macroscopic observation of adipogenic differentiation by Oil Red O staining, the extent of differentiation was assessed by measurement of the activity of the lipogenic enzyme GPDH. In the control, Stat3, Stat5, and Stra13 cell lines in which GH was omitted from the defined medium, the GPDH activity was at almost undetectable levels, as would be expected in preadipocytes (Fig. 5Go). GPDH activity increased to more than 100 U/mg protein when stimulated with GH; there was no significant increase in the presence of wt Stat3, Stat5a, or Stra13, although the level with Stat5a almost reached significance. In comparison, the Stat5a1*6 cell lines displayed greater than 100 U/mg of GPDH activity without GH treatment, whereas the Stat3-C displayed a small but significant increase in activity in the absence of GH (Fig. 5Go).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Effect of GH on Adipogenesis of 3T3-F442A Preadipocytes {alpha}-GPDH Activity

Stable 3T3-F442A-vector (A), 3T3-F442A-STRA13 (B), 3T3-F442A-Stat5a (C), 3T3-F442A-Stat3 (D), 3T3-F442A-Stat5a 1*6 (E), and 3T3-F442A-Stat3-C (F) cell lines were cultured post confluence in DDM (see Materials and Methods) in the absence or presence of 2 nM GH. After 10 d the cells were harvested, and GPDH activity was measured as described in Materials and Methods. Data represent the means ± SEM from three independent experiments.

 
The 3T3-F442A Adipogenic Program in Response to Ectopic Stat5a Expression
To characterize the effect of ectopic expression of Stat5a on GH-dependent differentiation of 3T3-F442A cells, quantitative RT-PCR was used to examine the expression of a subset of key genes during adipogenesis. For this, the 3T3-F442A-Vector and 3T3-F442A-Stat5a cell lines were grown to 100% confluence and induced to differentiate in DMM in the presence of 2 nM GH. Total RNA was isolated from each cell line at 100% confluence (d 0) (preadipocyte), and after d 1, 2, 4, 6, and 8 of differentiation. Analysis of gene expression of the pBabe-Vector cell lines showed that, in response to DDM, an increase in C/EBPß expression occurred within 1 d and preceded expression of C/EBP{alpha} and adipose protein 2/fatty acid-binding protein (aP2) (Fig. 6Go). The expression of C/EBPß increased from d 2 and was maintained throughout the 8 d of differentiation studied. Similarly, an increase of PPAR{gamma} expression was first observed after 1 d of differentiation and the expression levels increased during differentiation to reach maximum levels at d 8. Expression of C/EBP{alpha} increased after d 2, after the PPAR{gamma}. The downstream adipogenic gene aP2 was induced later, at d 4 of adipogenesis, and steadily increased in expression to reach a maximum level at d 8. In the pBabe-Stat5a cell line, the expression pattern and level of C/EBPß mRNA were similar to that of the control pBabe-vector cell lines. However, whereas ectopic expression of Stat5a resulted in a similar pattern of gene expression of PPAR{gamma}, C/EBP{alpha}, and aP2, the level of gene expression was significantly greater for pBabe-Stat5a than for the pBabe-vector control cell line (Fig. 6Go).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. Increase in Expression of Adipogenic Genes by Ectopic Expression of Stat5a during GH-Dependent Differentiation of 3T3-F442A Preadipocytes

Cells were grown to 100% confluence in DMEM containing 5% cat serum and then induced to undergo the differentiation process with DDM containing 2 nM hGH. At the indicated times after induction the cells were harvested and RNA prepared from the samples. This was analyzed using quantitative real-time PCR for expression of C/EBPß, PPAR{gamma}, C/EBP{alpha}, and aP2. The levels of mRNA for these genes are expressed relative to the amount of mRNA present in 100% confluent preadipocytes not exposed to DDM (d 0). All real-time PCR data were normalized to ARP expression to correct for differences in the amount and quality of total RNA. The data are shown as the mean ± SD of three determinations. Data are representative of three independent experiments.

 
The 3T3-F442A Adipogenic Program in Response to Ectopic Constitutively Active Stat5 Expression
To investigate how constitutively active Stat5a1*6 can induce GH-independent differentiation of 3T3-F442A preadipocytes, we next examined the pattern of adipogenic gene expression in pBabe-Stat5a1*6 cells. 3T3-F442A preadipocytes ectopically expressing pBabe-Stat5a1*6 were grown to 100% confluence in DMEM containing 5% cat serum. The cells were then induced to differentiate in DDM in the absence of hGH. Total RNA was isolated at 100% confluence (d 0) (preadipocyte), and at d 1, 2, 4, 6, and 8 of differentiation. A similar pattern of gene expression for the constitutively active mutant was seen as with the pBabe-control and pBabe-Stat5a cell lines responding to GH (Figs. 6Go and 7Go). Expression of C/EBPß was modestly induced by d 1 and this level of expression was maintained throughout the 8 d of differentiation studied. Expression of PPAR{gamma} was induced early in differentiation at d 1 and this expression increased to reach a maximum level at d 8. However, the level of PPAR{gamma} expression was reduced relative to that seen in pBabe-Vector cell lines in response to GH (Figs. 6Go and 7Go). Expression of C/EBP{alpha} was observed later in differentiation at d 2 and increased to maximum levels by d 8. Interestingly, whereas expression of aP2 was induced during adipogenesis, its level of expression was dramatically reduced, indicating that GH-activated factors other than Stat5 are required for full aP2 expression.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 7. Effect of Constitutively Active Stat5a1*6 on Expression of Adipogenic Genes during GH-Independent Differentiation of 3T3-F442A Preadipocytes

Cells were infected with retrovirus vectors encoding Stat5a1*6. Infected cells were grown to 100% confluence in DMEM containing 5% cat serum and then induced to undergo the differentiation process with DDM in the absence of hGH. At the indicated times after induction the cells were harvested and RNA prepared from the samples and analyzed using quantitative real-time PCR for expression of C/EBPß, PPAR{gamma}, C/EBP{alpha}, and aP2. The levels of mRNA for these genes are expressed relative to the amount of mRNA present in 100% confluent preadipocytes not exposed to DDM (d 0). All real-time PCR data were normalized to ARP expression to correct for differences in the amount and quality of total RNA. The data are shown as the mean ± SD of three determinations. Data are representative of three independent experiments.

 
Murine Adipogenesis Is Dependent on GH Receptor (GHR) Signaling in Vivo
To assess the importance of GH as an adipogenic factor in the mouse, epididymal fat pad weight was determined in 42-d-old male mice with GHR gene deletion (25). As shown in Fig. 8Go, fat pad weight is reduced to 25% of wt littermate controls in the absence of GHR signaling. The decrease in epididymal fat pad weight is greater than allometric (wt fat pad is 0.99% of body weight, GHR null is 0.67% of body weight), P < 0.001.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 8. Fat Pad Weight Is GH Dependent

A, Total epididymal fat pad weight from 42-d-old male mice (n =5), either GHR null mice or C57Bl/6 control animals. Mean ± SEM; **, P < 0.001, against wt mice, unpaired t test. B, Fat pad weight as a percentage of body weight. Mean ± SEM; **, P < 0.001 against wt mice.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
This study has investigated the functional role of Stat3, Stat5a, and Stra13 in mediating GH-dependent adipogenesis of 3T3-F442A preadipocytes. We have previously identified Stat3 to be rapidly transcriptionally up-regulated by GH in this cell line (20), and both Stat3 and Stat5 are known to be induced during human adipogenesis (26). Stat5 has been implicated as important in GH-dependent differentiation of 3T3-F442A, but whether it plays a role in terminal differentiation or in GH-dependent priming is not established (13). A third transcription factor, Stra13, known to be involved in cellular differentiation and reported here to be rapidly up-regulated by GH in 3T3-F442A preadipocytes, was also investigated. Stra13 has been reported to be induced in 3T3-L1 cells during adipogenesis by a protein kinase C/MAPK/phosphatidylinositol 3 kinase-independent pathway, potentially involving Stat5 (27). It acts to induce cell cycle arrest (23) and promotes chondrocyte (21) and neuronal differentiation (22), indicating that it could be involved in the control of differentiation of several cell lineages during mouse development. However, we found no effect of Stra13 overexpression on adipogenesis of 3T3-F442A cells, either in the presence or in the absence of GH. Stra13 has recently been reported to be important in mediating inhibition of adipocyte differentiation in response to hypoxia in 3T3-L1 preadipocytes (28), but in 3T3-F442A cells we found no inhibition of GH induced differentiation with ectopic expression of Stra13. However, our study was carried out in serum-free medium and the defined factors used to induce differentiation of the 3T3-F442A line may not have been sufficient to activate other members of the basic helix-loop-helix family of transcription factors with which Stra13 is predicted to interact to regulate transcription (22).

3T3-F442A cell lines ectopically expressing Stat5a, Stat3, or Stra13 showed no marked differences in phenotype detected macroscopically by visualization of lipid accumulation by Oil Red O staining (Fig. 2Go). Similarly, quantitative evaluation of differentiation by measurement of GPDH activity revealed no significant differences, although the cell lines overexpressing Stat5a did have a greater GH-dependent adipogenic response compared with control cells. This supports the view that Stat5 is mediating GH-dependent adipogenesis.

To determine whether the lack of altered phenotype in preadipocytes overexpressing Stat3 and Stat5 in the absence of GH was due to insufficient activation of these transcription factors, stable cell lines expressing constitutively active mutants of Stat3 and Stat5a were established. Ectopic expression of constitutively active Stat3 had only a minor effect on the differentiation of 3T3-F442A in the absence of GH, with a small extent of GH-independent differentiation being detected in the GPDH assay. This lack of involvement of Stat3 in adipocyte differentiation is in agreement with another study in which Stat3 was shown to critical for proliferation of preconfluent 3T3-L1 preadipocytes but was not involved in differentiation of these cells (29). Thus, although Stat3 protein expression is increased upon conversion of preadipocytes to adipocytes (14, 20), it appears to play no physiological role in adipocyte differentiation.

We did find that ectopic expression of constitutively active Stat5a was sufficient to induce GH-independent adipogenesis in 3T3-F442A preadipocytes. This Stat5a mutant has been previously well characterized and is constitutively phosphorylated on tyrosine residues, localized to the nucleus and transcriptionally active (30). The results presented here support the view that the earliest event driving GH-dependent initiation of adipogenesis (priming) is the activation of Stat5, and the results are congruent with the finding that overexpression of antisense Stat5a can block GH-induced adipogenesis in 3T3-F442A preadipocytes (13).

The expression of Stat5a and Stat5b proteins has been observed to be increased during differentiation of 3T3-L1 cells, and the expression strongly correlated with the degree of differentiation (14, 31, 32, 33). Recently, several studies have supported a role for Stat5a in adipogenesis. Floyd and Stephens (16) and others have shown that overexpression of Stat5a strongly promotes adipogenesis in nonprecursor cells in response to a strong adipogenic cocktail of FCS, 1-methyl-1-isobutylxanthine (MIX), dexamethasone (DEX), and insulin. Interestingly, overexpression of Stat5b was unable to mimic this effect but its expression enhanced the adipogenic potential of Stat5a-expressing cells (16). In addition, 3T3-L1 cells expressing a dominant-negative Stat5a mutant resulted in reduced number of cells undergoing adipogenesis (32). In this study, it was postulated that the inhibition of differentiation observed was due to down-regulation of PPAR{gamma} and C/EBP{alpha} expression by dominant negative Stat5a, which would concur with our finding of increased expression of these in response to constitutively active Stat5a expression.

Using real-time PCR analysis we have examined the gene expression pattern of adipogenic markers during GH-induced adipogenesis in 3T3-F442A in lines expressing vector alone or Stat5a to clarify the mechanism involved in GH-dependent adipogenesis. We found that ectopic expression of Stat5a resulted in enhanced expression of PPAR{gamma} and C/EBP{alpha} but only marginally increases that of C/EBPß. A similar gene expression pattern was reported in 3T3-L1 cells overexpressing Stat5a and induced to differentiate in response to FCS, DEX, MIX, and insulin (31). Hence, this study and that of others provide evidence that Stat5a is acting to stimulate adipogenesis by its ability to activate the expression of PPAR{gamma}, but it remains to be determined whether this occurring by a direct or an indirect mechanism.

Based on our current understanding of adipocyte differentiation, and our RT-PCR findings with adipogenic markers, the ability of constitutively active Stat5a1*6 to induce GH-independent adipogenesis would most likely be a result of induction of PPAR{gamma} expression. Although the expression of PPAR{gamma} in response to GH-independent differentiation is lower than that observed in pBabe-vector control cell lines during GH-dependent differentiation, it is of sufficient level to induce the program of differentiation. It is not yet clear whether constitutively active Stat5a is able to directly activate expression of PPAR{gamma}, or whether it is acting via C/EBP{alpha}, by increased C/EBPß, or a combination of these mechanisms.

The lower levels of C/EBPß, aP2, and, to a lesser extent, PPAR{gamma} seen with constitutive Stat5a activation do indicate that, in addition to the activation of Stat5a, other factors regulated by GH are required for maximum expression of these adipocyte-specific genes. Recently, the transcription factor cAMP response element binding protein (CREB) has been shown to be necessary for adipogenesis in 3T3-L1 cells (33). GH is known to induce the phosphorylation of CREB in 3T3-F442A (34), and it is possible that this factor may be involved in the regulation of adipocyte-specific genes in response to GH, particularly because CREB has been shown to be able to bind to elements in the C/EBPß and aP2 promoter and to regulate transcription of the full-length aP2 promoter linked to the luciferase reporter gene (33). Moreover, GH is able to activate the ERK/MAPK pathway in 3T3-F442A preadipocytes, and ERK activation is required for CREB-dependent up-regulation of C/EBPß and -{delta} expression (35). It remains to be determined whether CREB and Stat5 are working synergistically to mediate GH-dependent differentiation of 3T3-F442A preadipocytes.

Although it is well established that GH can act as an adipogenic agent in a number of clonal murine lines (3T3-F442A, Ob1771, 3T3-L1, and Ob17UT; Ref. 36 and references therein), GH inhibits adipogenesis in adipose stromal cells from a number of species (37, 38, 39). Hansen et al. (36) have proposed that this is a result of the ability of GH to induce the expression of Pref-1, a potent inhibitor of adipogenesis, evidently via increased expression of Foxa-2 (40). It is notable that protocols demonstrating inhibition of adipogenesis by GH generally use high concentrations of GH (10 times physiological) and low concentrations of IGF-I or insulin (36, 39). Given that IGF-I or insulin at high levels is able to prevent Pref-1 inhibition of adipogenesis (41), this contradiction may be a consequence of suppressed Pref-1 action at the higher insulin concentrations used in the serum-free adipogenic protocols for murine clonal preadipocyte lines such as 3T3-F442A (5). Alternatively, Richter et al. (42) reported that GH could inhibit expression of aP2 through a Stat5-mediated mechanism that did not involve its transactivation domain.

To determine whether GH does indeed have a role in adipogenesis, as opposed to other Stat5-activating hormones, we have determined the weight of the main discrete adipose depot (epididymal fat) in young male GHR-deleted mice (25). Epididymal fat is reported to have the highest adipose expression of GHR in rodents (44), so it could be expected to demonstrate any role for GH in adipogenesis in vivo. At 42 d of age, the adiposity resulting from absence of the lipolytic actions of GH in these GHR KO mice has not manifested (45), and we found that the epididymal depot was significantly smaller than wt animals, both in absolute amount, and as a percentage of body weight (Fig. 8Go). In 70-d-old GHR KO mice, epididymal fat weight is still less than wt, but, when expressed as a percentage of body weight, no longer reaches significance (45). Although this is consistent with a role for GH in murine adipogenesis in vivo, our finding cannot discriminate between a direct requirement for GH in adipogenesis and indirect actions resulting from markedly decreased plasma IGF-I and insulin in these GHR KO animals (46). Nevertheless, the core observation in this study, the importance of Stat5 for adipogenesis, is supported by several lines of evidence in vivo, including Stat5a/b double KO mice that have an epididymal fat pad only one fifth the size of wt (47), and the finding that transgenic mice specifically expressing dominant-negative Stat5a in fat show a significant reduction in white adipose tissue (31). Moreover, we have found that in vivo truncation of the GHR at 569, together with substitution of tyrosine 539 and 545 to phenylalanine, results in a decrease in Stat5 response to GH to 25–30% of wt levels (as measured by EMSA in hepatic nuclear extracts) (48, 49), and at 42 d of age these mice have epididymal adipose depots reduced to a similar extent as the young GHR KO mice reported here (i.e. 0.684 ± 0.024% body weight; mean ± SEM, n = 8, P < 0.001 against wt C57bl/6 value of 0.99 ± 0.025%).

In mice, adipogenesis occurs after birth and is essential for maintaining the energy requirements between feedings (50). Our results are consistent with the view that GH is involved in adipocyte differentiation very early postnatally, and, as the mice mature, the lipolytic actions of GH become predominant. This view is supported by the finding of Flint and Gardner (51) that chronic treatment of neonatal rats with a GH-neutralizing antibody caused a profound reduction (80%) in the number of differentiated adipocytes in two internal fat depots, whereas the sc depot was only moderately affected (20%). It is also consistent with the clinical finding that GH-deficient children have a reduced adipocyte number, although adipocyte volume is increased, potentially because of the absence of the lipolytic actions of GH (52). Although there is a certain teleological sense in the view that GH contributes to the creation of the adipose reserves that it will subsequently regulate, other Stat5-activating hormones present during fetal and postnatal development are also likely to be involved. It is plausible that prolactin (PRL) and placental lactogen contribute to the residual adipose tissue in GHR null mice because PRL activates Stat5a and is able to induce PPAR{gamma} and to induce adipose conversion of NIH-3T3 cells (53). Furthermore, PRL receptor KO mice are reported to have decreased abdominal fat depot (54).

In conclusion, GH-induced adipogenesis can be mediated by activation of Stat5a and, potentially, Stat5b. The exact mechanism of Stat5a-induced differentiation remains to be determined but, based on the 3T3-F442A cell model, includes induction of the key adipogenic regulators PPAR{gamma} and C/EBPß and C/EBP{alpha}. In vivo, Stat5 is necessary for normal adipogenesis, and, in the mouse, Stat5 activation may be driven by a combination of GH, PRL, and placental lactogens acting through the GH and PRL receptors.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
Recombinant hGH was a gift from Genentech Inc. (San Francisco, CA). Early passage 3T3-F442A preadipocytes were kindly provided by Dr. Howard Green (Harvard University, Boston, MA). EGF, fetuin, transferrin, and insulin were purchased from Sigma (St. Louis, MO). All other reagents were of analytical reagent grade.

Animals
GHR KO mice with a neo cassette insertion in exon 4 of the extracellular domain (25) were a generous gift of J. J. Kopchick and K. Coschigano (Edison Biotechnology Institute, Ohio University, Athens, OH). Experiments were carried out according to National Health and Medical Research Council (Australia) guidelines with the authorization of the University of Queensland Animal Ethics Committee.

Plasmids
The pBabe viral expression vector was a gift from Warren Pear (Institute of Medicine and Engineering, University of Pennsylvania Health System, Philadelphia, PA). The mammalian expression vector pSG5Stra13 containing full-length murine Stra13 cDNA was kindly provided by Professor Pierre Chambon (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Illkirch, France). The pBabeStra13HA viral expression vector was constructed by removing the internal BamH1 within the Stra13 cDNA by site-directed mutagenesis (Stratagene, La Jolla, CA). The oligonucleotides used for the site-directed mutagenesis were as follows: forward primer, 5'-CGCCGCATCATGGAACGCA TCCC CAGCGCGCAAC-3'; and reverse primer, 5'-GTTGCGCGCT GGGGATGCGT TCCATGATGC GGCG-3' with the silent mutation underlined. The full-length Stra13 cDNA was PCR amplified from pSG5Stra13mBamH1 using a 5' primer Stra13UTRBamH1 containing a BamH1 overhang and a 3' primer Stra13HA-EcoRI primer that contained a HA tag and a EcoR1 3' overhang. The PCR product was digested with EcoR1 and BamH1 and ligated into the EcoR1/BamH1 sites of multiple cloning site of the pBabe-Puro vector. The sequence of the primers 5'Stra13UTRBamH1 and Stra13HA-EcoRI were, respectively, GC CGCTGCTCCT GGCATCCCAG CGCATTGC and CCCTCCTTTA AACTTAGAAA CCAAAGACTA CCCTTATGACGTCCCCGATTACGCCTAGAATT CCGG (the HA tag sequence is underlined).

The pBabe-Stat5a-Flag and pBabe-Stat5a1*6-Flag retroviral expression constructs were created by directionally cloning the full-length Stat5a and Stat5a1*6 cDNA excised by restriction digestion with EcoR1-Sal1 from pMXStat5aWT and pMXStat5a1*6 constructs, respectively, into the EcoR1-Sal1 sites of the pBabe-Puro plasmid. The Stat5a constructs were kindly provided by Professor Toshio Kitamura (Institute of Medical Science, The University of Tokyo, Tokyo, Japan) (55). The pBabe-Stat3 plasmid was constructed by subcloning the full-length HA-tagged Stat3 from the plasmid pEFBOS-HA-Stat3 that were generously provided by Dr. Masahiko Hibi (Biomedical Research Center, Osaka University Graduate School of Medicine, Osaka, Japan). This construct was then used to generate a constitutively active Stat3 designated pBabeStat3-C by substitution of two cysteine residues within the C-terminal loop of the Src homology 2 domain of Stat3 as described in Bromberg et al. (56). All plasmid constructs were verified by autosequencing at the Australian Genome Research Facility (Brisbane, Australia).

Transfections and Infections
Retroviral constructs were chosen for these studies because they introduce a single copy of a gene into most mammalian cell types at efficiencies approaching 100% and avoid clonal artifacts. Full-length cDNA encoding Stat5a, Stat3, Stra13, Stat5a1*6, and Stat5-C were inserted into the Moloney murine leukemia virus-derived expression vector pBabe-puro (23). This vector contains a puromycin resistance gene under the control of the simian virus 40 promoter. pBabe-Stat3, pBabe-Stra13, and pBabe-Stat3-C contained a HA epitope tag, and pBabe-Stat5a and pBabe-Stat5a1*6 contained a FLAG epitope tag to facilitate identification of the expressed proteins.

To produce high-titer retrovirus, these constructs and the parental vector pBabe-puro were transiently transfected into the high-efficiency viral packaging cell line Bosc 23 (57). The Bosc 23 producer cell line was a gift from Professor David Baltimore (Center for Cancer Research and Department of Biology, Massachusetts Institute of Technology, Boston, MA), and were grown in DMEM (Life Technologies, Rockville, MD) containing 10% (vol/vol) FCS (Trace Scientific, Melbourne, Australia).

Routinely the transient transfections were carried out using 60-mm dishes containing 3 x 106 Bosc 23 cells plated in 4 ml of 10% FCS the night before transfection. To enhance transfection efficiency, chloroquine was added to media to a final concentration of 25 µM immediately before transfection. DNA constructs were introduced into cells via calcium phosphate-mediated transfection. Briefly, 20 µg of plasmid was made up to 500 µl in 2 M CaCl2, an equal volume of HEPES-buffered saline solution (pH 7.05) was added to the DNA/CaCl2 solution by bubbling, and the mixture was immediately added to the cells in a dropwise manner. The cells were quickly returned to the 37 C incubator (5% CO2). After 10 h of incubation, the media were replaced with 4 ml 10%FCS/DMEM to remove the chloroquine. The media were changed again after 24 h of incubation to 3 ml of 10%/DMEM, and the cells were incubated for an additional 24 h before the virus containing medium was removed and centrifuged at 500 x g for 5 min in a JA20 Beckman (Fullerton, CA) centrifuge. If not used immediately, the viral supernatants were aliquoted and snap frozen using a dry ice bath and stored at -70 C.

For retroviral infection of 3T3-F442A preadipocytes, cells were plated in six-well plates the day before viral infection at a density of 0.2 x 105 cells per well. The day after, the medium was aspirated and 0.5 ml of viral supernatant together with 0.5 ml of 10% newborn bovine serum (NBS)/DMEM supplemented with 8 µg/µl polybrene was added to the cells. The cells were centrifuged immediately at 1800 rpm for 45 min at 22 C in a Sorvall centrifuge with six-well plate carriers. After the spin infection, the cells were returned to the incubator for 24 h. Following this, the media were aspirated and replaced with 2 ml 10%NBS/DMEM and infected cells were selected with 2 µg/µl of puromycin. After 48 h, remaining cells were split 1:4 and allowed to attach in 10% NBS/DMEM. After approximately 3 h, cells were given two PBS washes and the media were changed to 5% cat serum/DMEM. Selection in 2 µg/ml of puromycin was then continued until cells reached 100% confluence. Once the infected 3T3-F442A preadipocytes cells had reached confluence, generally after 4–5 d, they were induced to differentiate (see below). The infection efficiencies of the 3T3-F442A cells were 70–80%, as assessed by simultaneous experiments before puromycin selection and immunofluorescence analysis for tagged protein.

Differentiation of 3T3-F442A Preadipocytes
To investigate the role of Stat5 and the GH-regulated transcription factors Stra13 and Stat3 in mediating GH-induced differentiation of 3T3-F442A preadipocytes, we used a DDM composed of GH, IGF-I, EGF, insulin, transferrin, and fetuin (5). Because serum derived from bovine sources contains sufficient GH to prime the cells, to grow the cells before initiating serum-free differentiation, cells were plated at low density and grown to 100% confluency in 5% cat serum, which has low GH levels (2). Differentiation of the confluent 3T3-F442A preadipocytes in defined differentiation media in response to 2 nM GH occurred over a period of 10–12 d.

3T3-F442A cell stocks were routinely passaged in DMEM supplemented with 10% NBS (Trace Biosciences, Melbourne, Australia). For differentiation experiments, 3T3-F442A preadipocytes were disaggregated with 0.05% (wt/vol) trypsin and 0.02% (wt/vol) EDTA and replated at a density of approximately 500 cells/ml in 10% NBS/DMEM. Once the cells had attached (3–4 h), the medium was changed to DMEM supplemented with 5% cat serum. The cells were then grown to confluence, generally requiring between 4 and 5 d of culture. At confluence (designated d 0), the medium was changed to a DDM for serum-independent differentiation. The DDM consisted of F-12/DME (2:1, vol/vol) supplemented with insulin (10 µg/ml), transferrin (10 µg/ml), fetuin (50 µg/ml), T3 (100 pg/ml), and EGF (50 ng/ml) (5). This medium was changed every 3 d until differentiation was complete, generally by d 12. Serum-free differentiation of 3T3-F442A fibroblasts was studied in the presence or absence of 2 nM hGH in the DDM.

Oil Red O Staining
Cells were washed with PBS and then fixed for 1 h in 10% formalin/PBS. After fixing, the cells were rinsed twice with PBS and the lipids were stained with a freshly prepared 60% Oil Red O solution from an Oil Red O stock solution (0.5 g in 99% isopropanol). The cells were stained for 15 min and then washed twice in H2O for 30 min. Cells were visualized with an inverted Olympus IX70 microscope using a Spot 2.20 trifilter digital camera.

Immunofluorescence Microscopy
Cells grown on 1% collagen coated coverslips were washed with PBS, then fixed and permeabilized with 4% paraformaldehyde (ProSciTech, Melbourne, Australia)/0.1% Triton X-100 in PBS (30 mM sodium phosphate, 150 mM sodium chloride, pH 7.4) for 30 min at 37 C. After fixation, the cells were washed five times with PBS and blocked with 1% goat serum in PBS for 1 h at room temperature or overnight at 4 C. Cells were then incubated for 1 h at room temperature with primary antibodies, either anti-FLAG M2 monoclonal antibody (Sigma) or anti-HA monoclonal antibody [BabCO (Berkeley, CA) via Chemicon Australia Pty. Ltd.], at dilutions of 1:500 and 1:200, respectively. After rinsing five times with PBS, bound primary antibody was visualized with goat antimouse IgG conjugated with tetramethylrhodamine isothiocyanate (Sigma) diluted in PBS. After washing, the coverslips were mounted on glass slides using Vectashield mounting medium containing 4',6' diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA). The slides were viewed with an Olympus AX70 fluorescence microscope and images taken using a Dage-MT1 camera (Dage Inc., Michigan City, MI) and analyzed using Scion Image software (Scion Corp., Frederick, MD).

Assay of Adipose Conversion by GPDH Activity
After 10 d of adipogenesis the 3T3-F442A cells were harvested and washed with cold PBS (pH 7.4). The cells then were resuspended in 25 mM Tris/1 mM EDTA (pH 7.4) and lysed by sonication using a Vibra-Cell sonicator (Sonics and Materials Inc., Danbury, CT) for 10 sec at 40 W. The suspension was cleared by centrifugation in a bench top centrifuge at full speed for 20 min at 4 C and supernatants were stored at -80 C. The assay for activity of GPDH was carried out by measuring the oxidation of nicotinamide adenine dinucleotide phosphate (NADH) at 340 nm (58). The reaction mixture contained 100 mM triethanolamine-HCl, 2.5 mM EDTA, 0.12 mM NADH, 0.2 mM dihydroxyacetone phosphate, 0.1 mM ß-mercaptoethanol (pH 7.5), and 50 µl of cell supernatant, all in a final volume of 300 µl. The change in absorbance was followed in a SpectroMax 250 spectrophotometer (Molecular Devices, Sunnyvale, CA) at 25 C using MaxPro Version 2.2.1 software (Molecular Devices). One unit of enzyme activity corresponded to the oxidation of 1 µmol of NADH per minute. Total cell protein was determined by the bicinchoninic acid protein determination method (Pierce, Rockford, IL) according to the manufacturer’s instructions.

EMSA
Cells were serum starved for 3 h before treatment with 100 ng/ml of hGH for 15 min and then nuclear extracts were prepared as previously described (17). Ten micrograms of nuclear extract were used for binding assays. The nuclear extract was incubated in binding buffer containing 40 mM HEPES, 40% glycerol, 200 mM KCl, 0.4 mM EDTA, 3 mM MgCl, 2 µg BSA, and 1 µg of poly(deoxyinosine-deoxycytidine) at room temperature for 15 min. The oligonucleotides used for gel shift analysis contained the following sequences: Stat5 consensus, 5'-AGA TTTCTAGGAATTCAATCC-3'; Stat3 consensus (M67 SIE) probe, 5'-TCATTTCCCGTAAATCCCTAAGCT-3'. Oligonucleotides were annealed and end-labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). For supershift experiments, the probe and nuclear extracts were incubated at room temperature for 15 min and then incubated with 1 µl of {alpha}-Flag (Sigma) or 1 µl of {alpha}-HA antibody (BabCO via Chemicon Australia Pty. Ltd.) or Stat3 (sc 482X) or Stat5a (sc 835X) antibody (Santa Cruz Biotechnology, Santa Cruz, CA) on ice for an additional 30 min. Samples were resolved on a 5% polyacrylamide gel containing 1x Tris-borate EDTA buffer for approximately 2 h at 200 V.

RNA Extraction and cDNA Synthesis for Real-Time PCR Analysis
Total RNA was isolated from 100-mm dishes of confluent 3T3-F442A cells, puromycin selected for expression of pBabe-Stat5a, pBabe-Stat5a1*6, and pBabe-vector. The cells were harvested at d 0, 1, 2, 4, 6, and 8 after transfer to DDM media using Trizol Reagent (Invitrogen, Carlsbad, CA) for RNA extraction according to the manufacturer’s protocol. Residual DNA was removed by treatment with deoxyribonuclease using a DNA-free kit (Ambion, Austin, TX) per the manufacturer’s instructions. The integrity and quality of isolated RNA was examined by electrophoresis and ethidium bromide staining. For synthesis of first-strand cDNA for RT-PCR, 4 µg of total RNA was incubated with 500 ng of oligo(deoxythymidine)15 primer (Promega, Madison, WI) at 65 C for 5 min to allow the primer to anneal to the RNA. The cDNA was then synthesized by addition of 200 U SuperScript II ribonuclease reverse transcriptase (Invitrogen) and incubation at 42 C for 50 min in a final volume of 20 µl, after which the reaction was heat inactivated at 70 C for 15 min. cDNA was diluted 50-fold before PCR amplification.

Quantitative Real-Time PCR
Real-time PCR was performed using a 7700 Sequence Detector System (Perkin Elmer/Applied Biosystems Inc., Rowville, Australia). PCRs were carried out using SYBR Green PCR master mix (Applied Biosystems) containing 200 nM forward and reverse primers for amplification of C/EBPß, C/EBP{alpha}, and aP2 or containing 100 nM forward and reverse primers for amplification of PPAR{gamma} and 5 µl of 1:50 dilution of the cDNA template in a final volume of 25 µl. The primers used in the study (Table 1Go) were designed using Primer Express software (Perkin Elmer/Applied Biosystems Inc.) and synthesized by Genset Oligos (Genset, Paris, France). All real-time PCRs were carried out using MicroAmp optical 96-well reaction plates and MicroAmp optical caps (Applied Biosystems). LightCycler conditions were as follows: 95 C for 10 min for 1 cycle, 95 C for 15 sec, 60 C for 1 min repeated for 45 cycles, and hold at 25 C. A single fluorescence measurement was taken during the extension period of the PCR cycle. Analysis of the real-time PCR data was performed using the ABI PRISM Sequence Detection System (using version 1.7 software). Relative quantitation of gene expression data was performed as per ABI PRISM Sequence Detection System User Bulletin 2. Briefly, relative standard curves were generated for the target gene and internal control, acidic ribosomal phosphoprotein PO by plotting cycle threshold values against the log cDNA dilution. From these standard curves, the amount of target and internal control in the unknown samples was determined. Subsequently, the amount of target gene was divided by the amount of the internal control to obtain the normalized value.


View this table:
[in this window]
[in a new window]
 
Table 1. Oligonucleotide Primer Sequences Used in Real-Time Quantitative PCR Using SYBR Green I Dye

 
Statistical Analysis
Pairwise comparisons were carried out by Student’s t test. Where multiple comparisons were undertaken, they were with ANOVA, using Tukey’s post hoc test for pairwise comparisons.


    ACKNOWLEDGMENTS
 
We thank Jennifer Rowland and Linda Kerr for genotyping of mouse lines, Annette Shewan for expert advice on retrovirus generation, and David Gordon for assistance with immunofluorescence studies.


    FOOTNOTES
 
This work was supported by National Health & Medical Research Council (Australia) grant to M.J.W.

Abbreviations: aP2, Adipose protein 2/fatty acid-binding protein; C/EBP, CCAAT enhancer binding protein; CREB, cAMP response element binding protein; DAPI, 4',6' diamidino-2-phenylindole; DDM, serum-free chemically defined differentiation media; DEX, dexamethasone; EGF, epidermal growth factor; FCS, fetal calf serum; GHR, GH receptor; GPDH, {alpha}-glycerol phosphate dehydrogenase; HA, hemagglutinin; hGH, human GH; KO, knockout; MIX, 1-methyl-1-isobutylxanthine; NADH, nicotinamide adenine dinucleotide phosphate; NBS, newborn bovine serum; PPAR, peroxisome proliferator-activated receptor; PRL, prolactin; Stat, signal transducer and activator of transcription; wt, wild-type.

Received for publication April 16, 2003. Accepted for publication September 4, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Kuri-Harcuch W, Green H 1978 Adipose conversion of 3T3 cells depends on a serum factor. Proc Natl Acad Sci USA 75:6107–6109[Abstract/Free Full Text]
  2. Nam SY, Lobie PE 2000 The mechanism of effect of GH on preadipocyte and adipocyte function. Obes Rev 1:73–86[CrossRef][Medline]
  3. Nixon T, Green H 1984 Contribution of growth hormone to the adipogenic activity of serum. Endocrinology 114:527–532[Abstract/Free Full Text]
  4. Morikawa M, Green H, Lewis UJ 1984 Activity of human growth hormone and related polypeptides on the adipose conversion of 3T3 cells. Mol Cell Biol 4:228–231[Abstract/Free Full Text]
  5. Zezulak KM, Green H 1986 The generation of insulin-like growth factor-1 sensitive cells by growth hormone action. Science 233:551–553[Abstract/Free Full Text]
  6. Guller S, Sonenberg M, Wu KY, Szabo P, Corin RE 1989 Growth hormone-dependent events in the adipose differentiation of 3T3-F442A fibroblasts: modulation of macromolecular synthesis. Endocrinology 125:2360–2367[Abstract/Free Full Text]
  7. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM 2000 Transcriptional regulation of adipogenesis. Genes Dev 14:1293–307[Free Full Text]
  8. Wu Z, Rosen ED, Brun R, Hauser S, Adelmant G, Troy AE, McKeon C, Darlington GJ, Spiegelman BM 1999 Cross-regulation of C/EBP{alpha} and PPAR{gamma} controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell 3:151–158[CrossRef][Medline]
  9. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  10. Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortensen RM 1999 PPAR{gamma} is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 4:611–617[CrossRef][Medline]
  11. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, Spiegelman BM 2002 C/EBP{alpha} induces adipogenesis through PPAR{gamma}: a unified pathway. Genes Dev 16:22–26[Abstract/Free Full Text]
  12. Tanaka T, Yoshida N, Kishimoto T, Akira S 1997 Defective adipocyte differentiation in mice lacking the C/EBPß and/or C/EBP{delta} gene. EMBO J 16:7432–7443[CrossRef][Medline]
  13. Yarwood SJ, Sale EM, Sale GJ, Houslay MD, Kilgour E, Anderson NG 1999 Growth hormone-dependent differentiation of 3T3-F442A preadipocytes requires Janus kinase/signal transducer and activator of transcription but not mitogen-activated protein kinase or p70 S6 kinase signaling. J Biol Chem 274:8662–8668[Abstract/Free Full Text]
  14. Stephens JM, Morrison RF, Pilch PF 1996 The expression and regulation of STATs during 3T3-L1 adipocyte differentiation. J Biol Chem 271:10441–10444[Abstract/Free Full Text]
  15. Nanbu-Wakao R, Morikawa Y, Matsumura I, Masuho Y, Muramatsu MA, Senba E, Wakao H 2002 Stimulation of 3T3-L1 adipogenesis by signal transducer and activator of transcription 5. Mol Endocrinol 16:1565–1576[Abstract/Free Full Text]
  16. Floyd ZE, Stephens JM. 2003 STAT5A promotes adipogenesis in nonprecursor cells and associates with the glucocorticoid receptor during adipocyte differentiation. Diabetes 52:308–314[Abstract/Free Full Text]
  17. Gurland G, Ashcom G, Cochran BH, Schwartz J 1990 Rapid events in growth hormone action. Induction of c-fos and c-jun transcription in 3T3-F442A preadipocytes. Endocrinology 127:3187–3195[Abstract/Free Full Text]
  18. Clarkson RW, Shang CA, Levitt LK, Howard T, Waters MJ 1999 Ternary complex factors Elk-1 and Sap-1a mediate growth hormone-induced transcription of egr-1 (early growth response factor-1) in 3T3-F442A preadipocytes. Mol Endocrinol 13:619–631[Abstract/Free Full Text]
  19. Clarkson RW, Chen CM, Harrison S, Wells C, Muscat GE, Waters MJ 1995 Early responses of trans-activating factors to growth hormone in preadipocytes: differential regulation of CCAAT enhancer-binding protein-ß (C/EBPß) and C/EBP{delta}. Mol Endocrinol 9:108–120[Abstract/Free Full Text]
  20. Shang CA, Thompson BJ, Teasdale R, Brown RJ, Waters MJ 2002 Genes induced by growth hormone in a model of adipogenic differentiation. Mol Cell Endocrinol 189:213–219[CrossRef][Medline]
  21. Shen M, Yoshida E, Yan W, Kawamoto T, Suardita K, Koyano Y, Fujimoto K, Noshiro M, Kato Y 2002 Basic helix-loop-helix protein DEC1 promotes chondrocyte differentiation at the early and terminal stages. J Biol Chem 277:50112–50120[Abstract/Free Full Text]
  22. Boudjelal M, Taneja R, Matsubara S, Bouillet P, Dolle P, Chambon P 1997 Overexpression of Stra13, a novel retinoic acid-inducible gene of the basic helix-loop-helix family, inhibits mesodermal and promotes neuronal differentiation of P19 cells. Genes Dev 11:2052–2065[Abstract/Free Full Text]
  23. Sun H, Taneja R 2000 Stra13 expression is associated with growth arrest and represses transcription through histone deacetylase (HDAC)-dependent and HDAC-independent mechanisms. Proc Natl Acad Sci USA 97:4058–4063[Abstract/Free Full Text]
  24. Morgenstern JP, Land H 1990 Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 18:3587–3596[Abstract/Free Full Text]
  25. Zhou Y, Xu BC, Maheshwari HG, He L, Reed M, Lozykowski M, Okada S, Cataldo L, Coschigano K, Wagner TE, Baumann G, Kopchick JJ 1997 A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci USA 94:13215–13220[Abstract/Free Full Text]
  26. Harp JB, Franklin D, Vanderpuije AA and Gimble JM 2001 Differential expression of signal transducers and activators of transcription during human adipogenesis. Biochem Biophys Res Commun 281:907–912[CrossRef][Medline]
  27. Inuzuka H, Nanbu-Wakao R, Masuho Y, Muramatsu M, Tojo H, Wakao H 1999 Differential regulation of immediate early gene expression in preadipocyte cells through multiple signaling pathways. Biochem Biophys Res Commun 265:664–668[CrossRef][Medline]
  28. Yun Z, Maecker HL, Johnson RS, Giaccia AJ 2002 Inhibition of PPAR gamma 2 gene expression by the HIF-1-regulated gene DEC1/Stra13: a mechanism for regulation of adipogenesis by hypoxia. Dev Cell 2:331–341[CrossRef][Medline]
  29. Deng J, Hua K, Lesser SS, Harp JB 2000 Activation of signal transducer and activator of transcription-3 during proliferative phases of 3T3-L1 adipogenesis. Endocrinology 141:2370–2376[Abstract/Free Full Text]
  30. Onishi M, Nosaka T, Misawa K, Mui AL, Gorman D, McMahon M, Miyajima A, Kitamura T 1998 Identification and characterization of a constitutively active STAT5 mutant that promotes cell proliferation. Mol Cell Biol 18:3871–3879[Abstract/Free Full Text]
  31. Stewart WC, Morrison RF, Young SL, Stephens JM 1999 Regulation of signal transducers and activators of transcription (STATs) by effectors of adipogenesis: coordinate regulation of STATs 1, 5A, and 5B with peroxisome proliferator-activated receptor-{gamma} and C/AAAT enhancer binding protein-{alpha}. Biochim Biophys Acta 1452:188–196[Medline]
  32. Balhoff JP, Stephens JM 1998 Highly specific and quantitative activation of STATs in 3T3-L1 adipocytes. Biochem Biophys Res Commun 247:894–900[CrossRef][Medline]
  33. Reusch JE, Colton LA, Klemm DJ 2000 CREB activation induces adipogenesis in 3T3-L1 cells. Mol Cell Biol 20:1008–1020[Abstract/Free Full Text]
  34. Yarwood SJ, Kilgour E, Anderson NG 1998 Cyclic AMP potentiates growth hormone-dependent differentiation of 3T3-F442A preadipocytes: possible involvement of the transcription factor CREB. Mol Cell Endocrinol 138:41–50[CrossRef][Medline]
  35. Belmonte N, Phillips BW, Massiera F, Villageois P, Wdziekonski B, Saint-Marc P, Nichols J, Aubert J, Saeki K, Yuo A, Narumiya S, Ailhaud G, Dani C 2001 Activation of extracellular signal-regulated kinases and CREB/ATF-1 mediate the expression of CCAAT/enhancer binding proteins beta and -{delta} in preadipocytes. Mol Endocrinol 15:2037–2049[Abstract/Free Full Text]
  36. Hansen LH, Madsen B, Teisner B, Nielsen JH, Billestrup N 1998 Characterization of the inhibitory effect of growth hormone on primary preadipocyte differentiation. Mol Endocrinol 12:1140–1149[Abstract/Free Full Text]
  37. Vassaux G, Negrel R, Ailhaud G, Gaillard D 1994 Proliferation and differentiation of rat adipose precursor cells in chemically defined medium: differential action of anti-adipogenic agents. J Cell Physiol 161:249–256[CrossRef][Medline]
  38. Wabitsch M, Braun S, Hauner H, Heinze E, Ilondo MM, Shymko R, De Meyts P, Teller WM 1996 Mitogenic and antiadipogenic properties of hGH in differentiating human adipocyte precursor cells in primary culture. Pediatr Res 40:450–456[Medline]
  39. Hausman GJ, Martin RJ 1989 The influence of hGH on preadipocyte development in serum supplemented and serum free cultures of stromal-vascular cells from pig adipose tissue. Domest Anim Endocrinol 6:331–337[CrossRef][Medline]
  40. Wolfrum C, Shih DQ, Kuwajima S, Norris AW, Kahn CR, Stoffel M 2003 Role of Foxa-2 in adipocyte metabolism and differentiation. J Clin Invest 112:345–356[CrossRef][Medline]
  41. Zhang H, Nohr J, Jensen CH, Petersen RK, Bachmann E, Teisner B, Larsen LK, Mandrup S, Kristiansen K 2003 Insulin-like growth factor-1/insulin bypasses Pref-1/FA1-mediated inhibition of adipocyte differentiation. J Biol Chem 278:20906–20914[Abstract/Free Full Text]
  42. Richter HE, Albrektsen T, Billestrup N 2003 J Mol Endocrinol. The role of signal transducer and activator of transcription 5 in the inhibitory effects of GH on adipocyte differentiation. J Mol Endocrinol 30:139–150[Abstract]
  43. Deleted in proof
  44. LaFranchi S, Hanna CE, Torresani T, Schoenle E, Illig R 1985 Comparison of growth hormone binding and metabolic response in rat adipocytes of epididymal, subcutaneous, and retroperitoneal origin. Acta Endocrinol (Copenh) 110:50–55[Abstract/Free Full Text]
  45. Li Y, Knapp JR, Kopchick JJ 2003 Enlargement of interscapular brown adipose tissue in growth hormone antagonist transgenic and in growth hormone receptor gene-disrupted dwarf mice. Exp Biol Med (Maywood) 228:207–215[Abstract/Free Full Text]
  46. Hauck SJ, Hunter WS, Danilovich N, Kopchick JJ, Bartke A 2001 Reduced levels of thyroid hormones, insulin, and glucose, and lower body core temperature in the growth hormone receptor/binding protein knockout mouse. Exp Biol Med (Maywood) 226:552–558[Abstract/Free Full Text]
  47. Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, Ihle JN 1998 Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93:841–850[CrossRef][Medline]
  48. Rowland JE, White M, Brown R, Noakes PG, Waters MJ, In vivo role of cytoplasmic signalling domains in growth hormone receptor function. Program of the 85th Annual Meeting of The Endocrine Society, Philadelphia, PA, 2003 (Abstract P3-334)
  49. Rowland JE 2003 PhD thesis. Analysis of GH receptor signalling in vivo—transgenic models. Queensland, Australia: University of Queensland Press
  50. Ailhaud G, Grimaldi P, Negrel R 1992 Cellular and molecular aspects of adipose tissue development. Annu Rev Nutr 12:207–233[CrossRef][Medline]
  51. Flint DJ, Gardner MJ 1993 Influence of growth hormone deficiency on growth and body composition in rats: site-specific effects upon adipose tissue development. J Endocrinol 137:203–211[Abstract/Free Full Text]
  52. Bonnet FP, Vanderscheuren-Lodeweyckx M, Eeckels R, Malvaux P 1974 Subcutaneous adipose tissue and lipids in blood in GH deficiency before and after treatment with GH. Pediatr Res 8:800–805
  53. Nanbu-Wakao R, Fujitani Y, Masuho Y, Muramatu M, Wakao H 2000 Prolactin enhances CCAAT enhancer-binding protein-ß (C/EBPß) and peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) messenger RNA expression and stimulates adipogenic conversion of NIH-3T3 cells. Mol Endocrinol 14:307–316[Abstract/Free Full Text]
  54. Freemark M, Fleenor D, Driscoll P, Binart N, Kelly P 2001 Body weight and fat in prolactin receptor-deficient mice. Endocrinology 142:532–537[Abstract/Free Full Text]
  55. Nosaka T, Kawashima T, Misawa K, Ikuta K, Mui AL, Kitamura T 1999 STAT5 as a molecular regulator of proliferation, differentiation and apoptosis in hematopoietic cells. EMBO J 18:4754–4765[CrossRef][Medline]
  56. Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C, Darnell Jr JE 1999 Stat3 as an oncogene. Cell 98:295–303[CrossRef][Medline]
  57. Pear WS, Nolan GP, Scott ML, Baltimore D 1993 Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci USA 90:8392–8396[Abstract/Free Full Text]
  58. Wise LS, Green H 1979 Participation of one isozyme of cytosolic glycerophosphate dehydrogenase in the adipose conversion of 3T3 cells. J Biol Chem 254:273–275[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
Y. Chen, G. Lin, J. S. Huo, D. Barney, Z. Wang, T. Livshiz, D. J. States, Z. S. Qin, and J. Schwartz
Computational and Functional Analysis of Growth Hormone (GH)-Regulated Genes Identifies the Transcriptional Repressor B-Cell Lymphoma 6 (Bc16) as a Participant in GH-Regulated Transcription
Endocrinology, August 1, 2009; 150(8): 3645 - 3654.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
U. A. White, A. A. Coulter, T. K. Miles, and J. M. Stephens
The STAT5A-Mediated Induction of Pyruvate Dehydrogenase Kinase 4 Expression by Prolactin or Growth Hormone in Adipocytes
Diabetes, June 1, 2007; 56(6): 1623 - 1629.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. S. Davies, E. F. Gevers, A. E. Stevenson, K. T. Coschigano, M. M. El-Kasti, M. J. Bull, C. Elford, B. A. J. Evans, J. J. Kopchick, and T. Wells
Adiposity profile in the dwarf rat: an unusually lean model of profound growth hormone deficiency
Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1483 - E1494.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Z. E. Floyd, B. M. Segura, F. He, and J. M. Stephens
Degradation of STAT5 proteins in 3T3-L1 adipocytes is induced by TNF-{alpha} and cycloheximide in a manner independent of STAT5A activation
Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E461 - E468.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
M. Kawai, N. Namba, S. Mushiake, Y. Etani, R. Nishimura, M. Makishima, and K. Ozono
Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPAR{gamma} pathway
J. Mol. Endocrinol., January 1, 2007; 38(1): 19 - 34.
[Abstract] [Full Text] [PDF]


Home page
Poult. Sci.Home page
H. Zhou, N. Deeb, C. M. Evock-Clover, C. M. Ashwell, and S. J. Lamont
Genome-Wide Linkage Analysis to Identify Chromosomal Regions Affecting Phenotypic Traits in the Chicken. II. Body Composition.
Poult. Sci., October 1, 2006; 85(10): 1712 - 1721.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. C. Hogan and J. M. Stephens
The Regulation of Fatty Acid Synthase by STAT5A
Diabetes, July 1, 2005; 54(7): 1968 - 1975.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Fleenor, J. Oden, P. A. Kelly, S. Mohan, S. Alliouachene, M. Pende, S. Wentz, J. Kerr, and M. Freemark
Roles of the Lactogens and Somatogens in Perinatal and Postnatal Metabolism and Growth: Studies of a Novel Mouse Model Combining Lactogen Resistance and Growth Hormone Deficiency
Endocrinology, January 1, 2005; 146(1): 103 - 112.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shang, C. A.
Right arrow Articles by Waters, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shang, C. A.
Right arrow Articles by Waters, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals