| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Mammary Biology and Tumorigenesis Laboratory (R.C.H., B.K.V.), National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892-1402; Cancer Research Program (J.H., C.J.O.), Garvan Institute of Medical Research, Darlinghurst, Sydney, New South Wales, Australia 2010; and United States Department of Agriculture/Agricultural Research Service Childrens Nutrition Research Center (D.L.H.), Department of Pediatrics, and The Breast Center (A.V.L.), Baylor College of Medicine, Houston, Texas 77030
Address all correspondence and requests for reprints to: Russell C. Hovey, Lactation and Mammary Gland Biology Group, Department of Animal Science, University of Vermont, Room 121, Terrill Hall, Burlington, Vermont 05405. E-mail: rhovey{at}zoo.uvm.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
It is well established that this course of development is coordinately regulated by key endocrine hormones and locally derived growth factors. Of the endocrine hormones, the pituitary-derived hormone prolactin (PRL) is a primary regulator of alveolar development (2, 3, 4, 5) through its stimulation of mammary epithelial cell (MEC) proliferation, as demonstrated in vivo (6) and in vitro (7). In parallel, PRL may have antiapoptotic effects that lead to increased MEC survival (8). These functions of PRL are in addition to its well recognized effects on milk protein synthesis (9). Recently, we demonstrated that the expression of PRL receptor (PRLR) mRNA is up-regulated and heterogeneously distributed in the mammary ducts of mature, nulliparous female mice (6). Furthermore, PRL-stimulated proliferation of MEC is accompanied by proliferation of adjacent stromal cells that also express various isoforms of PRLR mRNA in a development-specific fashion (6). Combined, these data suggest that PRL acts upon a subpopulation of MEC and stromal cells to promote alveolar development through an as yet undefined autocrine/paracrine mechanism(s).
IGF-II is a member of the insulin/IGF family that is mitogenic for normal (10, 11, 12) and neoplastic (13) MEC. IGF-II is generally implicated as a locally derived growth factor that functions in embryonic tissues (14). However, several lines of evidence support a role for IGF-II during normal postnatal mammary gland development. IGF-II mRNA is heterogeneously expressed by MEC in the ductal epithelium of nulliparous mice (15). Similarly, IGF-II mRNA is expressed within the parenchyma and stroma of the ovine mammary gland during allometric growth and is regulated by ovarian function (16). Furthermore, IGF-II is expressed by both breast cancer cells (17) and stromal cells adjacent to breast tumors (18, 19). Transgenic overexpression of IGF-II in the mammary glands of mice from the ovine ß-lactoglobulin promoter results in epithelial hyperplasia (20), whereas overexpression of IGF-II from the Moloney murine leukemia virus promoter results in delayed involution and apoptosis of MEC and the sustained expression of Akt (21).
Considerable debate has surrounded the question of how IGF-II acts on target cells. Although the mannose-6-phosphate receptor represents an exclusive receptor for IGF-II, it targets IGF-II for lysosomal degradation without evoking a cellular response (22). In addition, the IGF-I receptor (IGF-IR) has generally been considered the main pathway for IGF-II action because IGF-II displays a low affinity for the insulin receptor (IR; Ref. 14). Indeed, IGF-IR is expressed in the normal mouse mammary gland during development (15). However, several disparate results arising from mouse genetic models for IR, IGF-IR, and IGF-II have continued to imply a role for the IR in IGF-II action. This paradox can now be explained by the demonstration of two IR isoforms, IR-A and IR-B (23). IR-A, but not IR-B, is a high-affinity receptor for IGF-II that is expressed in several tissues including breast tumors (24). Binding of IGF-II to IR-A subsequently activates signaling pathways downstream of IR-A that include IR autophosphorylation, tyrosine phosphorylation of IR substrates (IRS) and Shc, and activation of Akt, leading to the specific induction of mitosis in target cells (23, 25).
On the basis of the recognized actions of PRL and the known functions of IGF-II, we hypothesized that IGF-II functions as an autocrine/paracrine effector of PRL action in the normal mouse mammary gland. Here, we demonstrate that PRL induces transcription of IGF-II in MEC via a PRLR-dependent pathway that leads to the stimulation of alveolar development. We also find that PRL induces IRS-1 and IRS-2 in the mouse mammary gland, indicating a role for IGF-II as a local effector of PRL action during mammary gland development.
| RESULTS |
|---|
|
|
|---|
|
On d 2 of pregnancy, the expression of IGF-II mRNA in PRLR-/- transplants was 75% of that in WT tissue (Fig. 2
). On d 4, the level of IGF-II mRNA in PRLR-/- transplants was 7-fold higher than in transplants bearing WT MEC. This difference reflected increased expression of IGF-II in the Rag1-/- cleared fat pad (CFP) relative to both the intact Rag1-/- mammary glands and the Rag1-/- CFP bearing WT epithelial transplants. In keeping with observations for CFP vs. intact tissues during puberty (Fig. 1
), these data indicate a mechanism for epithelial suppression of stromal IGF-II expression that is mediated by epithelial PRLR. By d 6 of pregnancy, transplants bearing WT MEC had 5-fold higher expression of IGF-II mRNA, compared with transplants of PRLR-/- MEC into Rag1-/- CFP, and a level of expression comparable to that in the intact Rag1-/- mammary gland. Comparable levels of gene expression in Rag1-/- CFP and PRLR-/- transplants indicates that epithelial expression of IGF-II expression could not be activated in the absence of epithelial PRLR.
|
These data suggestive of PRL-regulated IGF-II expression during pregnancy were confirmed using defined conditions in vitro. Explants of mammary glands from 18-d pregnant mice were cultured in hormone-free medium in the presence of various concentrations of ovine (o)PRL, then harvested 3 d later to determine IGF-II mRNA levels by semiquantitative RT-PCR. Although a low concentration of 50 ng/ml oPRL was without effect, potentially due to refractoriness to elevated serum PRL at this stage of pregnancy, 100-1000 ng/ml stimulated increased IGF-II mRNA expression compared with unsupplemented cultures (Fig. 3
).
|
|
|
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The present data indicate that IGF-II is an autocrine effector of PRL action and induces IRS-1 and IRS-2 concurrent with ductal branching and alveolar development in the mouse mammary gland. These findings concur with several parallel functions for PRL and IGF-II in normal and neoplastic MEC. During development of the mammary glands in nulliparous and pregnant mice, both PRLR (6) and IGF-II (15) are heterogeneously distributed in MEC of the ducts. Overexpression of IGF-II in the mammary glands results in alveolar hyperplasia (20), and IGF-II is overexpressed in pregnancy-associated mammary tumors (13). Similarly, PRL is also known to be a major stimulant of alveolar development in vivo during pregnancy (5) and in vitro (4). In addition, both PRL (8) and IGF-II (21) suppress apoptosis in MEC during involution, and both PRL and IGF-II activate signaling intermediates such as Akt (21, 25, 33). In human breast cancer, the autocrine/paracrine synthesis of both PRL (34) and IGF-II (19) is increased, and both are autocrine/paracrine mitogens for breast cancer cells in vitro (24, 35). Furthermore, both PRL and IGF-II are recognized mitogens for normal mouse MEC in vitro. Taken together, these similarities between PRL and IGF-II implicate them in a combined role toward MEC proliferation during normal mammary development and in breast cancer.
The present data also indicate that the effects of GH and PRL on the developing mammary gland may be distinguished by their ability to differentially induce the expression of IGF-I and IGF-II, respectively. Several reports have shown that GH, in concert with E, induces ductal elongation through the local stromal synthesis of IGF-I (31). By contrast, PRL does not induce the local synthesis of IGF-I (31) or ductal elongation, but instead can induce IGF-II so as to promote alveolar development (present study). This outcome is most clearly indicated in PRLR-/- mice that fail to undergo alveolar development (2, 3) in association with reduced expression of IGF-II.
Divergence between the effects of GH and PRL on local IGF expression may be critical in demarcating the roles of these hormones during the course of normal mammary gland development. Our current data also suggest that GH can induce the expression of IGF-II in MEC, consistent with the knowledge that GH and PRL cooperate during lobuloalveolar development, potentially through the combined induction of IGF-I and IGF-II. Although it is possible that PRL may exert its observed effects through the GH receptor, our results for promoter transfection studies and analyses using PRLR-/- mice would suggest that this is not the case. Furthermore, it is likely that PRL and GH induce IGF-II through common shared and recognized signaling pathways (36, 37, 38). In the ovine mammary gland, IGF-II mRNA was most abundant in the mammary parenchyma during a period of allometric growth (16). This abundant local synthesis of IGF-II may account for the extensive tertiary branching of mammary ducts in ruminants during this period compared with those in the mouse (39). Although IGF-II mRNA was also abundant in the mouse mammary fat pad of neonates, this expression declined precipitously in the weaning/prepubertal period. Such marked down-regulation of IGF-II gene expression during this period has also been reported in other tissues of various species (40, 41, 42). This decline probably represents either the maturation of fetal mammary mesenchyme (that expresses a high level of IGF-II) into white adipose tissue, or changing systemic control by hormones such as thyroid hormone (43). In parallel, it is tempting to speculate that high local expression of IGF-II in this period contributes to branching of the mammary ductal rudiment in neonates. It was also intriguing that proliferative epithelium within the intact mammary gland suppressed IGF-II mRNA levels relative to those in the CFP during prepuberty and puberty, and also in the presence of WT but not PRL receptor knockout epithelium during early pregnancy. This may represent a local means to down-regulate stromal IGF-II expression and associated alveolar development during a period of primarily ductal elongation. Similar evidence for the regulation of IGF expression by epithelial-stromal interactions has been identified in the normal mammary gland (16) and in breast tumors (18), although it is not clear what mechanism underlies this phenomenon. On the basis of this evidence, however, the increased expression of stromal IGF-II in the vicinity of breast tumors may reflect a loss of this suppressive ability in tumors rather than the alternate acquisition of the ability to induce stromal IGF-II.
Our findings combined with those from other studies collectively indicate that PRL contributes toward regulation of the mammary IGF system. For example, PRL induced the synthesis of an undefined IGFBP in explants of pregnant mammary tissue in vitro (44). Likewise, declining PRL during involution is implicated in the increased expression of IGFBP-5 by MEC (8). The repertoire of the actions of PRL can now be extended to it being an effector of IGF-II synthesis and MEC proliferation in sexually mature and pregnant females. Clearly, the various IGFBPs and IGF-IR/IR subtypes, including IR-A, also possess a significant capacity to regulate these local signals. In the present study, we also identified that PRL treatment further led to the significant induction of IRS protein levels concordant with its ability to induce IGF-II expression in the mammary gland. Previously, it has been shown that both IRS-1 and IRS-2 are phosphorylated in response to IGF-II action via the IR-A (23). Hence, these data afford a mechanism for MEC proliferation and alveolar development that involves the parallel induction of IGF-II and IRS molecules by PRL, then subsequent phosphorylation of elevated IRS proteins by autocrine/paracrine IGF-II acting through IR-A. Further studies are presently underway to demonstrate this IRS phosphorylation in situ.
What remains to be established is whether PRL cooperates with other hormones such as P to regulate IGF-II. Recently, we showed that PRL synergized with P to induce MEC proliferation and ductal branching in sexually mature female mice that coincided with the heterogeneous colocalization of PRLR and PR in ductal MEC. Interestingly, IGF-II mRNA is also heterogeneously distributed in ductal MEC (15), as was IRS-1 and IRS-2 in the present study, where IRS-1 and IRS-2 were most markedly induced by P plus PRL. Furthermore, cells that express P receptor (PR) are frequently E receptor (ER)-positive, and these cells are frequently adjacent to ER/PR-negative cells that are division-competent. Hence, it is conceivable that, through a presently unclear association, MEC positive for ER, PR, and PRLR are activated to express IGF-II that in turn provides paracrine mitogenic stimulation for adjacent hormone receptor-negative MEC that proliferate as alveolar progenitor cells.
In conclusion, these data indicate a previously unidentified role for IGF-II as a local effector of PRL action in the mammary gland. This mode of PRL action via IGF-II likely complements other hormone-induced local growth factors to facilitate the full course of mammary development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
To study developmental changes in IGF-II mRNA levels, mice were euthanized at different ages to provide mammary tissues. To address hormonal variations during the estrous cycle, pubertal and sexually mature mice were killed at diestrus as determined by vaginal appearance (45) and confirmed by vaginal lavage (46). Mice euthanized during gestation were mated at 10 wk of age, and the presence of a vaginal plug was considered d 0 of gestation.
To study changes within the mammary fat pad, endogenous mammary epithelium was surgically removed to leave a cleared mammary fat pad (47) as described previously (6). Mice were subsequently euthanized at various stages of nulliparous and gestational development. Epithelium-free mammary fat pad tissue was obtained from females at 3 wk of age and earlier by collecting the fat pad tissue dorsal to the supramammary lymph node. All tissues were snap-frozen in liquid nitrogen and stored at -80 C.
Mammary epithelium from WT and PRLR-/- mice was analyzed after transplantation to Rag1-/- immunocompromized hosts. After the no. 4 mammary fat pads of Rag1-/- female mice were cleared of endogenous epithelium, PRLR-/- and WT epithelium was transplanted into contralateral mammary fat pads. The animals were aged for 12 wk to allow the epithelium to develop within the fat pad. After this period, the animals were mated, and d 0 of pregnancy was designated after observance of a vaginal plug. Mammary tissues were collected at 2, 4, and 6 d of pregnancy when there was no detectable difference in alveolar development between genotypes (n = 46 for each time point) and were snap-frozen in liquid nitrogen before storage at -80 C.
To determine hormonal effects on IRS expression, nulliparous female BALB/c were bilaterally ovariectomized at 9 wk of age. One week later, mice were injected for 5 d with twice-daily injections (sc) of oPRL (1 µg/g body weight·d) with or without P (1 mg/d) in 0.9% saline. Harvested mammary tissues were fixed in 4% paraformaldehyde, then embedded in paraffin for sectioning at 4 µm.
Cell Culture
HC11 normal mouse MECs were routinely maintained in growth medium comprising RPMI 1640 supplemented with 10% FBS (Life Technologies, Inc., Gaithersburg, MD), EGF (10 ng/ml; Collaborative Research, Waltham, MA), insulin (5 µg/ml, Life Technologies, Inc.), HEPES (4.7 g/liter), sodium bicarbonate (2.2 g/liter), glutamine, penicillin (100 U/ml), and streptomycin (100 µg/ml). For gene expression experiments, cells were plated into six-well plates at 1.5 x 105 cells per well in growth medium and were grown for 23 d to confluence. Cells were subsequently changed to maintenance medium [RPMI with 8% FBS, HEPES, sodium bicarbonate, penicillin/streptomycin, and insulin (5 µg/ml)] either alone or supplemented with Dex (1 µM) with or without various concentrations of oPRL, for an additional 3 d.
CHO cells were routinely grown in
-MEM supplemented with 10% FBS and penicillin/streptomycin.
Promoter Analysis
Luciferase reporter constructs containing promoter regions for the murine IGF-II gene (P1, P2, and P3) that have been described elsewhere (48) were kindly provided by Dr. Peter Rotwein (Oregon Health Sciences University, Portland, OR). A cDNA encoding the hPRLR long form (kindly provided by Paul A. Kelly, Institut National de la Santé et de la Recherche Médicale, Paris, France) was subcloned into the pEF6C mammalian expression vector that uses the elongation factor-1
promoter (Invitrogen, Carlsbad, CA). CHO cells were plated into six-well plates in growth medium at 2.4 x 105 cells per well 24 h prior to transfection. Cells were then transfected for 36 h in the same medium with a total of 2 µg plasmid DNA. After transfection, cells were changed to serum-free medium (
-MEM supplemented with ITS+1; BD Biosciences, Bedford, MA) and cultured for 24 h longer in the presence or absence of oPRL (1 µg/ml) and/or Dex (1 µM). Cells were then scraped into 1x cell lysis buffer and assayed for luminescence using the luciferase assay system (Promega Corp., Madison, WI) on a Lumat LB9507 luminometer. Transfection efficiency was normalized for expression from a pSV40 ß- galactosidase construct (Promega Corp.) as measured using a 96-well colorimetric assay (ß-Galactosidase Enzyme Assay System, Promega Corp.) on an ELx800UV microtiter plate reader (Bio-Tek Instruments, Inc., Winooski, VT). Transfection experiments were conducted in triplicate on three occasions.
Whole Organ and Explant Culture
Whole organ culture of mouse mammary glands was conducted essentially as described (26). Briefly, BALB/c mice were primed for 9 d with E and P contained within cholesterol pellets implanted sc. Mammary glands were then floated on siliconized lens paper and cultured in Waymouths medium (Life Technologies, Inc.) supplemented with 1% BSA, HEPES, sodium bicarbonate, penicillin/streptomycin, aldosterone, hydrocortisone and oPRL for 6 d, with medium changed on the third day. Media was further supplemented with rhIGF-II (Becton Dickinson and Co., Bedford, MA) or rhdel(16)IGF-II (Upstate Biotechnology, Inc., Lake Placid, NY) at either 10 or 200 ng/ml. Mammary glands were then spread on microscope slides, fixed, and prepared as whole mounts stained with alum carmine. Mammary gland alveolar development (AD) was blindly scored on the basis of a previously described approach (26) using a subjective linear scale of 110 (where 1 is no AD, and 10 is AD equivalent to that in mid pregnancy). For each treatment, five or six mammary glands were analyzed.
In a separate experiment, explants of mammary tissue (approximately 8 mm3) from BALB/c mice on d 18 of pregnancy were floated on siliconized lens paper and cultured in Waymouths medium with insulin (50 ng/ml), or supplemented with various doses of oPRL for 3 d. After the culture period, explants were snap-frozen in liquid nitrogen before RNA extraction.
Quantitative and Semiquantitative RT-PCR
Total RNA was extracted from tissues or cell monolayers using Trizol before treatment with DNAse I (10 U/µg RNA; Life Technologies, Inc.). RNA (1 µg) was reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) primed by oligo deoxythymidine and random hexamers in a final volume of 25 µl. Negative controls for reverse transcription (RT) were generated in the absence of RT enzyme, whereas PCR-negative controls were performed in the absence of RT product.
Quantitative competitive RT-PCR using the PCR mimic construction kit (CLONTECH Laboratories, Inc.) was used to determine changes in IGF-II mRNA levels during mammary gland development in pooled tissue samples. Briefly, a competitor mimic cDNA with primer-specific 5' and 3' ends was synthesized to be of similar size to the specific IGF-II PCR product. This DNA fragment was then quantified and diluted before being added to individual PCRs at different levels to provide a competitive internal standard in the presence of 0.2 µM each primer and PCR master mix (Roche Molecular Biochemicals, Indianapolis, IN). Reaction products were resolved by agarose gel electrophoresis, stained with ethidium bromide, and quantified by image analysis using NIH Image. The log ratio of IGF-II product to IGF-II mimic product was then plotted against the log number of mimic molecules added to the PCR. The amount of IGF-II cDNA was calculated by determining the X intercept where the ratio of target to mimic concentration equaled 1. Levels of IGF-II mRNA were expressed relative to the level of GAPDH mRNA that was similarly determined using a GAPDH mimic in competitive PCR.
In subsequent experiments, semiquantitative RT-PCR analysis of gene expression for IGF-II, GAPDH, and ß-casein mRNA was performed using a previously validated method (6) and optimized conditions for each gene. Gene expression levels were determined from products resolved on ethidium bromide-stained agarose gels, and corrected to the corresponding level of GAPDH mRNA. Triplicate samples were analyzed in each case.
For RT-PCR analysis of IGF-II mRNA expression in PRLR-/- and corresponding WT samples, real-time monitoring of PCR amplification dynamics was achieved using a LightCycler (Roche Diagnostic Systems, Inc.). Additional real-time RT-PCR analysis of HC11 mRNA levels was performed using an ABI Prism 7700 sequence detection system (PE Applied Biosystems, Foster City, CA). Reverse-transcribed RNA was amplified using the FastStart PCR kit (Roche Molecular Biochemicals) or JumpStart kit (Sigma, St. Louis, MO) in the presence of SybrGreen, and cycle amplification differences were used to determine approximate differences in mRNA copy number between samples according to the manufacturers instructions.
The following primers were used for RT-PCR analyses of IGF-II mRNA (49) to yield a single, sequence-verified product: 5', GAGCTTGTTGACACGCTTCAGTTTGTC; and 3', ACGTTTGGCCTCTCTGAACTCTTTGAG, using a 60 C annealing step. Gene expression levels were normalized to the corresponding level of GAPDH mRNA determined using primers from CLONTECH Laboratories, Inc.
Immunohistochemistry
Immunohistochemistry for IRS-1 and IRS-2 was conducted on paraffin-embedded sections of mammary tissue using rabbit antihuman IRS-1 or IRS-2 antibodies (Upstate Biotechnology, Inc.). All incubations were performed at room temperature, and all washing was performed with TBST [0.15 M NaCl, 0.01 M Tris-HCl (pH 7.4), 0.05% Tween 20] unless otherwise stated. Slides were cut at 34 µm, baked overnight at 58 C, and deparaffinized using a Shandon-Lipshaw Varistain. Heat-induced antigen retrieval was performed in 0.1 M Tris-HCl (pH 9.0) for 5 min using a pressure cooker. Endogenous peroxidase activity was blocked by incubation in 3% hydrogen peroxide solution for 5 min. Avidin/biotin blocking was performed with a blocking kit from (Vector Laboratories, Inc. Burlingame, CA). Slides were then incubated in IRS-1 antibody (1:400 dilution in Tris-buffered saline + 1% BSA) or IRS-2 antibody (1:200 dilution in TBS + 1% BSA) for 1 h, biotin-labeled secondary antibody (1:200) for 30 min, and then horseradish peroxidase-labeled avidin (1:200) for 30 min. For a negative control, slides were incubated with purified rabbit Ig (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Detection was then performed by incubation with diaminobenzidine (DAKO Corp., Carpinteria, CA) for 15 min, followed by enhancement with 0.2% osmium tetroxide for 30 sec. Slides were counterstained with 0.05% methyl green for 30 sec, dehydrated, and mounted using cytoseal. Quantification of immunostaining results was performed as a subjective intensity score or by determining the percentage of cells that were immunostained positive in two individual mice. This immunopositivity index was determined as the number of positive cells among at least 500 epithelial cells counted over 10 or more fields.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: AD, Alveolar development; CFP, cleared fat pad(s); CHO, Chinese hamster ovary; Dex, dexamethasone; E, estrogen; EGF, epidermal growth factor; ER, E receptor; FBS, fetal bovine serum; h, human; GAPDH, glyceraldehyde-3-phosphate; IGFBP, IGF binding protein; IGF-IR, IGF-I receptor; IR, insulin receptor; IRS, IR substrate; MEC, mammary epithelial cell; o, ovine; P, progesterone; PR, P receptor; PRL, prolactin; PRLR, PRL receptor; r, recombinant; RT, reverse transcription.
Received for publication June 13, 2002. Accepted for publication December 16, 2002.
| REFERENCES |
|---|
|
|
|---|
(TGF
) in differentiated rat mammary tumors: estrogen induction of TGF
production. Mol Endocrinol 1:683692This article has been cited by other articles:
![]() |
C. Berlato and W. Doppler Selective Response to Insulin Versus Insulin-Like Growth Factor-I and -II and Up-Regulation of Insulin Receptor Splice Variant B in the Differentiated Mouse Mammary Epithelium Endocrinology, June 1, 2009; 150(6): 2924 - 2933. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Kleinberg, T. L. Wood, P. A. Furth, and A. V. Lee Growth Hormone and Insulin-Like Growth Factor-I in the Transition from Normal Mammary Development to Preneoplastic Mammary Lesions Endocr. Rev., February 1, 2009; 30(1): 51 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Murphy, J. Baptista, J. Holly, A. M. Umpleby, S. Ellard, L. W. Harries, J. Crolla, T. Cundy, and A. T. Hattersley Severe Intrauterine Growth Retardation and Atypical Diabetes Associated with a Translocation Breakpoint Disrupting Regulation of the Insulin-Like Growth Factor 2 Gene J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4373 - 4380. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B Renfree, E. I Ager, G. Shaw, and A. J Pask Genomic imprinting in marsupial placentation Reproduction, November 1, 2008; 136(5): 523 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E Morabito, J. F Trott, D. M Korz, H. E Fairfield, S. H Buck, and R. C Hovey A 5' distal palindrome within the mouse mammary tumor virus-long terminal repeat recruits a mammary gland-specific complex and is required for a synergistic response to progesterone plus prolactin J. Mol. Endocrinol., August 1, 2008; 41(2): 75 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Wang, Y. Yin, H. Yuan, T. Sakamaki, H. Okano, and R. I. Glazer Musashi1 Modulates Mammary Progenitor Cell Expansion through Proliferin-Mediated Activation of the Wnt and Notch Pathways Mol. Cell. Biol., June 1, 2008; 28(11): 3589 - 3599. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Carver and L. A. Schuler Prolactin Does Not Require Insulin-Like Growth Factor Intermediates but Synergizes with Insulin-Like Growth Factor I in Human Breast Cancer Cells Mol. Cancer Res., April 1, 2008; 6(4): 634 - 643. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bachelot and N. Binart Reproductive role of prolactin Reproduction, February 1, 2007; 133(2): 361 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lukanova, P. Toniolo, A. Zeleniuch-Jacquotte, K. Grankvist, M. Wulff, A. A. Arslan, Y. Afanasyeva, R. Johansson, P. Lenner, G. Hallmans, et al. Insulin-like Growth Factor I in Pregnancy and Maternal Risk of Breast Cancer Cancer Epidemiol. Biomarkers Prev., December 1, 2006; 15(12): 2489 - 2493. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Wall, H. M. Crawford, S. E. Ellis, G. E. Dahl, and T. B. McFadden Mammary Response to Exogenous Prolactin or Frequent Milking During Early Lactation in Dairy Cows J Dairy Sci, December 1, 2006; 89(12): 4640 - 4648. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Theil, K. Sejrsen, W. L. Hurley, R. Labouriau, B. Thomsen, and M. T. Sorensen Role of suckling in regulating cell turnover and onset and maintenance of lactation in individual mammary glands of sows J Anim Sci, July 1, 2006; 84(7): 1691 - 1698. [Abstract] [Full Text] [PDF] |
||||
![]() |
D J Flint, M Boutinaud, C B A Whitelaw, G J Allan, and A F Kolb Prolactin inhibits cell loss and decreases matrix metalloproteinase expression in the involuting mouse mammary gland but fails to prevent cell loss in the mammary glands of mice expressing IGFBP-5 as a mammary transgene. J. Mol. Endocrinol., June 1, 2006; 36(3): 435 - 448. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Y. Ma, G. M. Anderson, T. D. Gunn, V. Goffin, D. R. Grattan, and S. J. Bunn Prolactin Specifically Activates Signal Transducer and Activator of Transcription 5b in Neuroendocrine Dopaminergic Neurons Endocrinology, December 1, 2005; 146(12): 5112 - 5119. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Wall, T. L. Auchtung, G. E. Dahl, S. E. Ellis, and T. B. McFadden Exposure to Short Day Photoperiod During the Dry Period Enhances Mammary Growth in Dairy Cows J Dairy Sci, June 1, 2005; 88(6): 1994 - 2003. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Allar and T. L. Wood Expression of the Insulin-Like Growth Factor Binding Proteins during Postnatal Development of the Murine Mammary Gland Endocrinology, May 1, 2004; 145(5): 2467 - 2477. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Srivastava, M. Matsuda, Z. Hou, J. P. Bailey, R. Kitazawa, M. P. Herbst, and N. D. Horseman Receptor Activator of NF-{kappa}B Ligand Induction via Jak2 and Stat5a in Mammary Epithelial Cells J. Biol. Chem., November 14, 2003; 278(46): 46171 - 46178. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Carpenter, C. A. Gray, T. M. Bryan, T. H. Welsh Jr., and T. E. Spencer Estrogen and Antiestrogen Effects on Neonatal Ovine Uterine Development Biol Reprod, August 1, 2003; 69(2): 708 - 717. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Lee, P. Zhang, M. Ivanova, S. Bonnette, S. Oesterreich, J. M. Rosen, S. Grimm, R. C. Hovey, B. K. Vonderhaar, C. R. Kahn, et al. Developmental and Hormonal Signals Dramatically Alter the Localization and Abundance of Insulin Receptor Substrate Proteins in the Mammary Gland Endocrinology, June 1, 2003; 144(6): 2683 - 2694. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |