Molecular Endocrinology, doi:10.1210/me.2002-0313
Molecular Endocrinology 17 (4): 562-574
Copyright © 2003 by The Endocrine Society
Estradiol Stabilizes Estrogen Receptor Messenger Ribonucleic Acid in Sheep Endometrium via Discrete Sequence Elements in Its 3'-Untranslated Region
Dianne C. Mitchell and
Nancy H. Ing
Department of Animal Science, Department of Veterinary Anatomy and Public Health, Faculty of Genetics, Texas A&M University, College Station, Texas 77843-2471
Address all correspondence and requests for reprints to: Dr. Nancy Ing, Department of Animal Science, Texas A&M University, College Station, Texas 77843-2471. E-mail: ning{at}cvm.tamu.edu.
 |
ABSTRACT
|
|---|
The preovulatory surge of estrogen up-regulates estrogen receptor-
(ER) gene expression in the uterus during the estrous/menstrual cycles of female mammals. Previously, we demonstrated that the 5-fold increase in ER mRNA levels in endometrium of ovariectomized ewes treated with a physiological dose of estradiol (E2) is entirely due to an increase in ER mRNA stability. Our current work confirms that the E2 effect is specific to ER mRNA. The sequence of ER mRNA, cloned from sheep endometrium, shows a high degree of conservation with those of other species, even in the 5'- and the very long 3'-untranslated regions. In a cell-free assay, ER mRNA demonstrates greater stability with endometrial extracts from E2-treated ewes compared with those from untreated ovariectomized ewes. The E2-enhanced stability of ER mRNA was ablated by prior treatment of the extracts with proteinase K, 70 C heat, and oxidizing and alkylating reagents, indicating that a protein is responsible for stabilization of the message. The 3'-untranslated region of ER mRNA contains discrete sequences required for E2-enhanced stability, four of which were identified by extensive deletion mutant analyses. Transfer of two of the four minimal E2-modulated stability sequences conferred E2-enhanced stability to a heterologous RNA. These minimal E2-modulated stability sequences contain a common 10-base, uridine-rich sequence that is predicted to reside in a loop structure. Throughout our studies, estrogen stabilization of ER mRNA in sheep endometrium resembled that of vitellogenin mRNA in frog liver, indicating conservation of this ancient mechanism for enhancing gene expression in response to estrogen.
 |
INTRODUCTION
|
|---|
IN ANIMAL SPECIES ranging from fish to man, estrogens regulate reproductive functions by affecting expression of specific genes. Endometrium, the innermost layer of the mammalian uterus, is exquisitely sensitive to estrogens and provides the secretions that completely support the embryo(s) before formation of the placenta. The fluctuating ovarian production of estrogen and progesterone during the estrous/menstrual cycles of the female programs the endometrial secretions continuously, so that gene expression changes in synchrony with the needs of the developing embryo (1). The preovulatory surge of estrogen is the period of highest estrogen influence. It up-regulates expression of estrogen receptor (ER) and progesterone receptor (PR) genes in endometrium of all mammalian species examined (2). Without the preovulatory surge of estrogen, even synchronous embryos fail to survive (1, 3). Estrogen actions are brought about by two ER proteins: ER
and ERß. Of the two ER genes, expression levels of ER
are much higher than those of ERß in the uterus. In addition, ER
knock-out mice demonstrate complete uterine dysfunction and resistance to estrogen while ERß knock-out mice do not (4, 5). Interestingly, only ER
is regulated by E2 in the uterus (6). Therefore, our studies focus on ER
(subsequently referred to as ER) and its up-regulation by estrogen in the sheep uterus.
The effects of estrogen on expression of the ER gene are complex. Consistent with other hormone-receptor interactions, estrogen acutely down-regulates ER protein levels via the ubiquitin-proteasome pathway (7). In uteri of ovariectomized ewes, concentrations of ER protein drop to undetectable levels, but then recover and surpass initial levels within 24 h, after increased ER mRNA levels (8, 9). The direction of E2 regulation of ER gene expression is tissue specific: the up-regulation in endometrium, myometrium, and pituitary contrasts with the down-regulation of ER protein and mRNA levels in mammalian liver, hypothalamus, and mammary gland (9, 10, 11, 12, 13). In MCF-7 cells, a breast cancer cell line used widely for ER studies, E2 down-regulates ER mRNA levels by both transcriptional repression and mRNA destabilization (14, 15). Another important variable is the dose of estrogen: large, pharmacological doses down-regulate ER mRNA levels, even in the uterus (16). The autoregulation of androgen receptor gene expression is similar to that of ER in its bidirectionality, with a combination of transcriptional and posttranscriptional effects that depend upon the tissue, cell line, and dose of androgen (17, 18, 19). Elucidation of the molecular mechanisms that tightly regulate the expression of these steroid hormone receptor genes could provide new therapeutic targets for reproductive problems as well as hormone-responsive cancers.
The molecular mechanism by which estrogen regulates gene expression is well known: estrogen binds ER protein, which changes conformation, dimerizes, binds to estrogen-responsive genes, and interacts with coactivators and/or corepressors to alter rates of transcription (20). For example, estrogen enhances transcription from the two estrogen-responsive promoters of the PR gene (21). In ovariectomized ewes, a single, physiological dose of estradiol (E2) increases endometrial PR mRNA concentrations 75% in 24 h and subsequently increases levels of PR protein (8, 22). Concurrently, ER mRNA (and protein) levels increase more robustly, to 500% of the levels in endometrium of control ewes. While runoff analyses with endometrial nuclei detected increased transcription of the PR gene, the rate of ER gene transcription remained unchanged. ER mRNA stabilization by E2 was demonstrated by both in vivo pulse-labeling and ex vivo transcription inhibitor studies (22). Ishikawa cells, a line from a human endometrial adenocarcinoma, also up-regulate ER gene expression in response to E2 treatment by enhancing ER mRNA stability (23). Thus, E2 acts posttranscriptionally to rapidly and powerfully up-regulate ER gene expression in sheep endometrium.
Estrogens are the hormones best characterized for their roles in regulating the stabilities of specific mRNAs (24). As in sheep endometrium, estrogen stabilizes ER mRNA in fish liver, implying that this molecular mechanism for increasing ER gene expression is conserved from fish to mammals (25). In frog and chicken livers, E2 specifically stabilizes vitellogenin and apolipoprotein II mRNAs and destabilizes albumin mRNA (24). The vitellogenin mRNA contains a tandem ACUGAU element in the 3'-untranslated region (UTR), which is bound by vigilin, a protein induced by estrogen treatment (26, 27, 28). The related APyUGA sequences in apolipoprotein II and albumin mRNAs are cleaved by polysomal ribonuclease 1 (PMR1) in an estrogen-dependent manner (29, 30). Based on these data, we hypothesized that E2 specifically up-regulates ER gene expression in endometrium by stabilizing ER mRNA via discrete RNA sequence elements. The following describes the development of a cell-free mRNA stability assay and identification of ER mRNA sequences responsible for E2-enhanced stability.
 |
RESULTS
|
|---|
Untranslated Sequences of ER mRNA Are Conserved Across Species
To determine the sequence of the entire sheep ER mRNA (6351 bases in length), we cloned the 5'- and 3'-UTR sequences of ER mRNA using the available sequences of the coding region (8, 31). From sheep endometrium of an E2-treated ewe, we cloned six independent cDNAs containing the 5'-UTR of ER mRNA (209 bases). All six sequences were identical and indicated that transcription initiated at the promoter 2265 bases upstream of the translation start site on genomic DNA. Our sheep ER 5'-UTR sequence matched one from the sheep pituitary (31), extended it 5' by 70 bases, thus completing it according to the major transcription start site in the human and mouse uterus (32, 33). The 5'-UTR sequence of sheep ER mRNA was remarkably well conserved: 96, 87, 84, and 82% identical to ER mRNA sequences of the pig, horse, human, and mouse. Similar levels of sequence identity existed in the coding region of ER mRNA (1788 bases in length): 93, 90, 88, 84, and 63% of the residues of pig, horse, human, mouse, and blue tilapia fish coding sequences, respectively, were identical to that of the sheep ER mRNA.
The 3'-UTR of ER mRNA (4354 bases in length) composed the majority of the message in all species (34). Overall percentages of identical nucleotides between the sheep ER 3'-UTR sequence and those of other species were lower than in the 5'-UTR and coding sequences in every case: 77, 73, 75, 64, and 56% for pig, horse, human, mouse, and blue tilapia fish, respectively. Upon closer inspection, highly conserved regions were present in the 3'-UTR, but were interspersed with ones of lower homology, including many gaps and insertions. This is evident in the graph of the percent identities of 90-base windows of sheep ER mRNA sequences with the aligned sequences from human, pig, and horse (Fig. 1
). Note that the species show similar patterns of sequence homologies: high in 5'-UTRs and coding regions, but variable in the 3'-UTRs. Note that in the 3' half of the 3'-UTR of ER mRNA, for which only sheep and human ER mRNA sequences are known, there is a long (500 base) region that is 94% identical in the two messages. The high degree of conservation of 3'-UTR sequences of ER mRNAs across species implies that these have important biological functions.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1. Sequence Conservation of ER mRNAs in Large Mammals
Sequences of the human, pig, and horse ER mRNAs were aligned with that of the sheep, and percentages of identical nucleotides to the sheep ER mRNA sequence were calculated for 90-base windows. These values are graphed relative to their position in the sheep ER mRNA (numbered on the x-axis) for human (filled diamonds and solid line), pig (open squares and dashed line), and horse ER mRNAs (filled circles and dotted line). Also indicated on the x-axis are the positions of the coding region (filled box), AU-rich instability elements (arrows), APyUGA sites for PMR1 cleavage (asterisks), and sequences homologous to the estrogen-stabilizing sequences of vitellogenin mRNA (open boxes).
|
|
Sequence Elements in the 3'-UTR of ER mRNA
ER mRNA sequences were scanned for motifs known to regulate stabilities of other mRNAs. Most prevalent in the literature are the adenine- and uridine-rich instability elements [androgen response elements (AREs); e.g. AUUUA and AUUUUA (35, 36)]. Sheep and human ER mRNAs carried 10 and 14 AREs, respectively, and these were found only in the 3'-UTRs (positions indicated by arrows on the x-axis in Fig. 1
). Also in the 3'-UTRs of ER mRNAs were two sequences similar to the sequence element that stabilizes vitellogenin mRNA in response to estrogen [positions indicated by squares on the x-axis of Fig. 1
(27)]. Figure 2
shows the alignment of two sheep and one human ER mRNA sequence with that of the vitellogenin mRNA element. Of the two ACUGAU sequences, the first is perfectly conserved in the ER mRNAs. The second ACUGAU had one or two different residues, and the spacing of the ACUGAU sequences varied slightly in the ER mRNAs from the eight bases in vitellogenin mRNA. Similar to the vitellogenin mRNA element, the homologs in ER mRNA were associated with instability elements (underlined in Fig. 2
). The ACUGAU sequences contain the PMR1 cleavage site consensus APyUGA (30). In the sheep and human ER mRNAs there are 12 and 14 APyUGA sequences, respectively, and all but one are within the 3'-UTRs (Fig. 1
, asterisks on x-axis). It is likely that the AREs confer instability to the ER mRNA, making it more sensitive to posttranscriptional regulation, while the ACUGAU and/or APyUGA elements are involved in enhanced stability and rapid up-regulation in response to estrogen.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. Sheep and Human ER mRNAs Contain Sequences Homologous to the Estrogen-Modulated Sequences of Frog Vitellogenin mRNA
Within the 3'-UTR of ER mRNAs are sequences that may be homologous to those responsible for estrogen stabilization of vitellogenin mRNA, shown in the alignment. The sheep ER mRNA contains two homologs, whereas the human ER mRNA contains only the first. The two ACUGAU sequences of vitellogenin mRNA (at bottom) that are important for estrogen-enhanced stability are boxed along with homologs in the ER mRNAs. Neighboring instability elements are underlined: AUUUA in the mammalian mRNAs and GAUGAU in the frog mRNA. Positions of the homologs in the entire 3'-UTR of ER mRNA are shown in Fig. 1 .
|
|
E2 Does Not Affect Global mRNA Stability in Endometrium
To determine whether E2 treatment causes a general stabilization of total cellular RNA and mRNA in endometrium, RNA synthesized in explant cultures from E2-treated and control ewes was labeled with a pulse of 3H-uridine before inhibiting transcription with DRB. 3H-labeling of total cellular and polyA+ RNA was assessed in samples taken at different times. Half-lives (times to 50% of initial RNA levels) for both total cellular and polyA+ RNA pools were 9 h, regardless of whether the RNA was from endometrium of E2-treated or control ewes (n = 3 ewes in each treatment group). Thus, E2 treatment did not alter global RNA or mRNA stability in endometrium of sheep.
E2 Specifically Stabilizes ER mRNA in Vitro
The stability of radiolabeled ER mRNA was assessed in incubations with high-speed cytosolic extracts prepared from endometrium of E2-treated and control ewes. The left panel of Fig. 3
shows a representative autoradiograph from a gel separating the remaining intact probe (indicated by the arrow) from the degradation products that migrate further down the gel. Results are shown for reactions stopped at intervals spanning 60 min for extracts from one E2-treated and one control ewe. The 3'-UTR probe was longer lived in the endometrial extract from the E2-treated ewe compared with its rapid disappearance and accumulation of degradation products in the control ewe extract. The average percentages of the remaining intact probe from assays with endometrial extracts from all E2-treated and control ewes were plotted against time in the right panel of Fig. 3
. E2 treatment significantly extended the half-life of ER RNA from 721 min. Subsequent assays were performed with an incubation time of 15 min, intermediate to these half-lives. The stabilities of glyceraldehyde-3-phosphate dehydrogenase and ß-globin mRNA, 28S and 18S rRNA, and plasmid vector transcripts were not different between E2-treated and control ewe extracts (Fig. 4
, Ref. 9 , and data not shown), indicating the specificity of the E2 effect for ER mRNA.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 3. ER mRNA Is More Stable in Endometrial Extracts from E2-Treated Ewes Compared with Those of Control Ewes
Radiolabeled sheep ER mRNA was incubated with endometrial extract proteins from E2-treated or control ewes for 0, 7.5, 15, 30, or 60 min. The left panel shows the RNA after incubation with extract proteins from one E2-treated and one control ewe in an autoradiograph after RNA electrophoresis on a denaturing 5% polyacrylamide gel. The intact ER RNA probe (arrow) disappears over time (in minutes), whereas shorter degradation products accumulate. The percent RNA remaining (means and SEs) for endometrial extracts from all E2-treated (closed circles, solid lines) and control (open circles, dashed lines) ewes are graphed over time in the right panel. E2 treatment increased the half-life (time to 50% of initial RNA level) of ER mRNA from 721 min.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4. The 3'-UTR of ER mRNA Contains Sequences Responsible for E2-Modulated Stability
The 5'-UTR, coding (CDS), and 3'-UTR sequences of ER mRNA were tested for stability in vitro. The percentages of RNA remaining after incubation with endometrial extracts from control and E2-treated ewes are shown in hatched and filled bars, respectively, in the left half of the graph. Only the ER 3'-UTR demonstrated E2-modulated stability (indicated by the asterisk). Stability tests of ß-globin (GL) mRNA and ß-globin mRNA with its 3'-UTR replaced by that of ER mRNA indicated that the 3'-UTR of ER mRNA conferred E2enhanced stability to ß-globin mRNA.
|
|
E2 Stabilizes ER mRNA via Sequences within Its 3'-UTR
The cell-free assay was used to localize the ER mRNA sequences important to its E2-enhanced stability. Radiolabeled 5'-UTR, coding sequence, and 3'-UTR of ER mRNA were incubated with endometrial extracts from control and E2-treated ewes. Quantitation of the percent intact RNA remaining indicated that the 3'-UTR is inherently less stable than the other ER mRNA regions and ß-globin mRNA (Fig. 4
). Also, the 3'-UTR was the only region of ER mRNA that demonstrated greater stability in the extracts from E2-treated ewes [although the coding sequence of the ER mRNA demonstrated a trend toward stabilization by E2 treatment (P = 0.06)]. When the 3'-UTR of ß-globin mRNA was replaced by that of ER mRNA, it conferred E2-enhanced stability to the ß-globin RNA. These experiments indicated that the 3'-UTR of ER mRNA contained the sequences required for E2 modulation of mRNA stability.
A Uterine Protein Is Responsible for the E2-Enhanced Stability of ER mRNA
The initial characterization of the factor responsible for the E2-enhanced stability of the 3'-UTR of ER mRNA in E2-treated ewes also employed the cell-free assay. The tissue specificity of the E2 effect was tested in three estrogen-responsive tissues: endometrium, myometrium, and liver (10). The stability of the 3'-UTR of ER mRNA was much greater in endometrial and myometrial extracts of E2-treated ewes compared with those from control ewes (Fig. 5
). In liver extracts from all ewes, however, the RNA was efficiently degraded and there was no effect of treatment. These data imply that uterine (but not liver) tissues responded to E2 by expressing a factor that enhanced stability of ER mRNA.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 5. E2 Enhances ER mRNA Stability in Uterine Tissues, But Not in Liver
Tissues were collected from three E2-treated and three control ewes. ER RNA was more stable in extracts from endometrium and myometrium of E2-treated ewes. However, ER RNA stability was low in liver extracts from control and E2-treated ewes, indicating a lack of E2 effect in this tissue.
|
|
To determine whether the factor that makes ER mRNA more stable in endometrial extracts from E2-treated ewes is proteinaceous, the extracts were subjected to treatments that challenge protein function. After repeated freezing and thawing, ER RNA retained its E2-enhanced stability (Fig. 6
). However, prior digestion of proteins in extracts with proteinase K or heating to 70 C greatly decreased ER RNA stability and ablated its E2-enhanced stability. Heat treatment at 95 C was unique in making the ER RNA probe very stable in endometrial extracts from both control and E2-treated ewes, probably due to general denaturation of all proteins, including the relatively heat-stable ribonucleases (RNases). These data suggest that E2 induces a protein that stabilizes ER mRNA in uterine tissues.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 6. An Endometrial Protein Stabilizes ER mRNA
Endometrial extracts were pretreated with proteinase K (PK, 0.4 mg/ml for 15 min at 37 C) and five cycles of freeze-thaw treatment (5XF-T) at 70 C or 95 C heat for 15 min. The percents of the 3'-UTR of ER mRNA remaining after incubation with extracts from control and E2-treated ewes are reported as least squares means and SEs in hatched and filled bars, respectively. Asterisks indicate a significant effect of E2 treatment on RNA stability.
|
|
Polyadenylation Does Not Alter E2-Enhanced ER RNA Stability
The 5'-cap structure and 3'-polyadenylated tail of mammalian mRNAs stabilize the message from degradation by exonucleases (37, 38, 39). To determine whether these structures affect E2 modulation of ER RNA stability, ER transcripts were synthesized with and without capping and polyadenylation. The overall and E2-modulated stabilities of the 3'-UTR of ER mRNA and several long and short fragments of it were unaffected by the end structures. Poly-A-binding protein, as well as poly-C- and poly-U-binding proteins, regulate stabilities of some mRNAs in mammalian cells (37, 38, 39, 40, 41, 42, 43). Therefore, we tested ribonucleotide A, C, and U homopolymers, as well as double-stranded DNA polymers of dG*dC and dI*dC, for their ability to alter ER RNA stability in vitro by binding and sequestering proteins. All of the polymers except dI*dC increased the percent of ER RNA remaining by an average of 15%. However, the magnitude of enhanced ER RNA stability in extracts from E2-treated ewes remained constant. Together, these data indicate that the E2-enhanced stability of ER mRNA is not due to nuclease activities at the 5'- and 3'-ends of ER mRNA, but is likely to be due to regulated activity of an endonuclease. The endonuclease and/or RNA-binding proteins involved in its E2-regulated activity do not appear to be proteins previously characterized that bind poly-A, poly-C, or poly-U RNA with high affinity (37, 38, 39, 40, 41, 42, 43).
E2-Enhanced ER RNA Stability Requires Reducing Conditions and Mg2+
Many RNA-protein interactions, including those on estrogen-regulated mRNAs, are sensitive to reducing, oxidizing, and alkylating reagents, as well as Mg2+ concentrations (44, 45, 46). Therefore, the effects of these reagents on the E2-modulated stability of the 3'-UTR of ER mRNA were examined in our cell-free assay. Oxidizing (diamide) and alkylating [N-ethylmaleimide (NEM)] reagents decreased the stability of the ER probe to near zero in extracts from both control and E2-treated ewes (Fig. 7
). Concurrent treatment with excess reducing agent dithiothreitol (DTT) abolished the diamide effect. The stability of ER RNA was lower and the E2 effect was compromised in assays lacking Mg2+. Higher concentrations of DTT and Mg2+ than those in the standard RNA stability assay (2 mM each) appeared to enhance the stability of the ER RNA probe equally in extracts from control and E2-treated ewes without altering its differential nature. In conclusion, the E2-enhanced protein that stabilized ER mRNA required Mg2+ and reducing conditions and was inhibited by alkylating reagents.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Reducing Conditions and Mg2+ Are Required for Maximal and E2-Enhanced Stability of ER mRNA
Endometrial extracts were pretreated for 15 min with reagents that reduce (DTT), oxidize (diamide), or alkylate [N-ethylmaleimide (NEM)] thiol groups (values indicate concentrations of reagents in mM). In addition, assays were performed in the 0, 2 (standard), or 10 mM Mg2+. The percentages of the 3'-UTR of ER mRNA remaining after the incubation with endometrial extracts from control (hatched bars) and E2-treated (filled bars) ewes are reported as least squares means and SEs. Asterisks indicate that E2 treatment had a significant effect on RNA stability.
|
|
Discrete Regions of ER mRNA Are Sufficient for Its E2-Enhanced Stability
To identify the ER mRNA sequences involved in its E2-enhanced stability, sets of 5'- and 3'-deletion mutants of the 3'-UTR of the sheep ER mRNA were tested in the cell-free RNA stability assay (Fig. 8
, top half). Preferential stability in endometrial extracts from E2-treated ewes was maintained by all but two of the RNAs (indicated by solid lines). When the deletions of the two central regions were extended, the fragment of ER mRNA recovered E2-enhanced stability. Surprisingly, even the short (
500 bases long) 5'- and 3'-end fragments maintained E2-enhanced stability. These data indicate that multiple ER mRNA sequences are involved in the E2-modulated stability of the message.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 8. 5'- and 3'-Deletion Mutants and Fragments Indicate Regions of the 3'-UTR of ER mRNA that Are Important for E2-Modulated mRNA Stability
The 3'-UTR of the ER mRNA of the sheep is shown in cartoon form at the top, from the 5'-end of the 3'-UTR (base number 1) to the 3'-poly A tail (An; beginning at base no. 4337). Positions of sheep ER mRNA sequences homologous to the estrogen-stabilized vitellogenin element, APyUGA elements, and AREs are indicated by open boxes, asterisks, and arrows, respectively. Lines below the cartoon indicate the RNA deletion mutants tested for E2-modulated stability. Results are shown for sets of 5'- and 3'-deletion mutants in the top half of the figure and for selected internal fragments, from large to small, in the bottom half. RNAs indicated by solid lines demonstrated E2-enhanced stabilities (P < 0.05), whereas ones depicted by stippled or hatched lines did not (0.10 < P < 0.05 and P > 0.10, respectively). Numbers at the right of the lines indicate the average percentages of the RNA remaining after incubation with extracts from E2-treated ewes and control ewes (values separated by a slash). SEs ranged from 36, depending on the RNA probe. The four MEMSS (MEMSS-A to -D; RNAs < 90 bases in length that have enhanced stability in E2-treated ewe extracts) are labeled and boxed at the bottom.
|
|
Further analyses for E2-stabilizing sequences in the 3'-UTR of ER mRNA began with large RNA fragments and then narrowed to focus on regions of interest (Fig. 8
, lower half). These included the 5'- and 3'-ends which maintained E2-modulated stability; the two internal regions, which compromised E2-modulated stability in the deletion mutants (described above); and the regions around the two vitellogenin mRNA homologs. In general, the ER mRNA fragments demonstrated a wide range of stabilities, consistent with data from human ER mRNA (47). The range of RNA stabilities was dependent upon ewe treatment: between 20% and 89% RNA remaining in E2-treated ewe extracts compared with 985% RNA remaining in control ewe extracts. Larger fragments were generally less stable, whereas smaller fragments had stabilities that varied over the entire range. RNA stability loosely correlated to the absence of AREs. The ratio of RNA stability in E2-treated vs. control ewe extracts was unrelated to overall stability and varied from 1 (no difference) to 3 (three times more RNA remaining after incubation with extracts from E2-treated ewes compared with that with control ewes).
To identify discrete sequences (<90 bases) that contained sequences sufficient for E2-enhanced stability, shorter and shorter ER mRNA fragments were analyzed. RNAs from two regions of interest lost E2 modulation upon reduction, perhaps the result of disruption of either RNA structure or cooperative action of multiple sequence elements. However, the analyses successfully identified four independent minimal E2-modulated stability sequences (MEMSS), designated A, B, C, and D (boxed at the bottom of Fig. 8
). The MEMSS-A to -D were 134, 387, 2672, and 4022 bases downstream from the stop codon. Over their 86-, 68-, 82-, and 82-base lengths, the MEMSS-A to -D sequences were well conserved, with 86%, 84%, 76%, and 89% identical residues between the aligned sheep and human ER mRNA sequences, respectively. The 5'-end of MEMSS-C was notable because it contained the 5'-sheep ER mRNA homolog of the estrogen-modulated element of vitellogenin mRNA. Deletion of MEMSS-A, -B, -C, or -D, individually or in combinations (AB, AD, ABC, ABD, and ABCD), did not ablate E2-enhanced stability (Fig. 8
and data not shown). Therefore, the four identified MEMSS appear to act alongside additional sequences within the 3'-UTR to confer E2-enhanced stability to ER mRNA.
Transfer of the MEMSS-C and -D Confers E2-Enhanced Stability to a Heterologous RNA
To determine whether the MEMSS sequences could confer E2-modulated stability to a heterologous RNA, MEMSS-A to D sequences were cloned 3' to 18S rRNA, and the chimeric RNAs were transcribed in vitro. As shown in Fig. 9
, the stabilities of 18S-MEMSS-A and 18S-MEMSS-B were similar to that of 18S rRNA in not demonstrating preferential stability in endometrial extracts from E2-treated ewes compared with those from control ewes. However, transfer of MEMSS-C and -D sequences did confer enhanced stability to those chimeric RNAs in extracts from E2-treated ewes. Thus, whereas all four of the MEMSS contained sequences sufficient for E2-modulated stability, the function of the MEMSS-C and -D sequences was transferable. These MEMSS-C and -D sequences also shared a 10-base sequence (UGUAUUCUUC) that is uridine rich (60%). The predicted RNA structures of MEMSS-C and -D show these UGUAUUCUUC sequences on single-stranded loop regions, along with multiple APyUGA-related sequences in double-stranded structures (Fig. 10
).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 9. E2-Modulated Stability Is Conferred by MEMSS Sequences
The MEMSS-A to -D sequences were cloned 3' to 18S RNA. Percents of chimeric RNAs remaining after the incubation with endometrial extracts from control and E2-treated ewes are reported as least squares means and SEs. The 18S RNA showed no differential stability between ewe treatments, nor did chimeric RNAs containing 18S-MEMSS-A and 18S-MEMSS-B sequences (18S-A and 18S-B). However, transfer of MEMSS-C and MEMSS-D sequences to 18S RNA (18S-C and 18S-D) did confer enhanced stability in endometrial extracts from E2-treated ewes compared with those from control ewes (asterisks).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 10. Proposed Structures for MEMSS-C and -D
Structures were predicted for the MEMSS-C and -D sequences by the Minimal Energy FOLDing (MFOLD) program. The calculated free energies are -22 and -13 kcal/mol, making the structures likely to occur in vivo. Numerical base positions are indicated on the 82-base-long MEMSS RNAs. Sequences related to APyUGAU are highlighted and the 10-base sequence shared by the two MEMSS is boxed. The 5'-homolog of the estrogen-stabilized element of vitellogenin mRNA in the sheep ER mRNA is at the 5'-end of MEMSS-C.
|
|
The E2-Induced Stabilizing Factor for ER mRNA Is Not Vigilin
Since the E2 stabilization of ER mRNA in sheep endometrium was similar in sequences and required conditions similar to that of vitellogenin in frog liver, we tested whether vigilin protein was responsible for the former as it is for the latter (28). Endometrial extract proteins were electrophoresed and blotted alongside proteins from a similar kidney extract (used as a positive control). The Western blot was developed with antibodies that have been shown to bind human vigilin (48). A band of 119 kDa was detected in all lanes (Fig. 11
). However, E2 treatment did not affect the level of vigilin in the endometrial samples. Thus, vigilin does not appear to be responsible for the greater stability of ER mRNA in the endometrial extracts from E2-treated ewes.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 11. Vigilin Levels in Endometrial Extracts Are Not Up-Regulated by E2
Endometrial protein samples (60 µg) from control (Con) and E2-treated (E2) ewes were analyzed for vigilin on a Western blot. Chemiluminescent immunodetection revealed protein bands of 119 kDa (arrowhead) in each lane, and their intensities were not affected by E2 treatment of the ewes. A similar band was detected in the kidney extract (+), used as a positive control.
|
|
 |
DISCUSSION
|
|---|
This study extends our understanding of the mechanism by which estrogens naturally up-regulate ER mRNA in uterine tissues during reproductive cycles (8). We detected no changes in global RNA metabolism in endometrium with E2 treatment, contrary to conflicting reports in the literature that describe E2 increasing or decreasing the ratio of general RNase or RNAse inhibitor activities in genital tracts of female rats (49, 50, 51). As determined previously in vivo (23, 24), the E2 stabilization in the cell-free assay was specific to ER mRNA, indicating that its RNA sequences are required for the hormonal effect.
The ER mRNA sequences required for its E2enhanced stability were systematically identified in the 6359-base-long message. First, the 5'- and 3'-UTR sequences of ER mRNA in sheep endometrium were described, so that the sheep ER mRNA joins that of the human in having complete sequence information. The first exon sequences of the 5'-UTR of ER mRNAs vary due to differential usage of six promoters on the ER gene, which are spliced into a single site 89 bases upstream of the translation initiation site (52, 53). Tissue-specific splicing also creates 5'-heterogeneity for glucocorticoid mRNA (54). Interestingly, all eight independent cDNA clones of ER mRNA from sheep endometrium were transcribed from the promoter 2265 bases upstream of the translation initiation site. This promoter was predominant in the human and mouse uterus, as well (34, 45, 53, 55). Because the 5'-UTR sequences were not sufficient for E2-enhanced stability, the functional role(s) of the 5'-UTR of ER mRNA may be more involved with regulation of translation.
The 3'-UTR of ER mRNA is extensive (>4000 bases long) and composes the majority of the sequence in all species examined, a feature common to PR and androgen receptor mRNAs as well (21, 34). In contrast, the 3'-UTR sequences of very stable mRNAs, such as those of ß-globin and glyceraldehyde 3-phosphate dehydrogenase, are short (
200 bases long). Long 3'-UTR sequences increase the number of potential sites for RNA-binding proteins, including endonucleases. Because cleavage within the 3'-UTR separates the polyA tail from the rest of the mRNA, which then rapidly decays, mRNAs with long 3'-UTR sequences are inherently unstable as has been shown for ER mRNA (34, 37, 38, 39). The evolutionary conservation of 3'-UTR sequences of ER mRNA imply that they have important functions; we are the first to report that these functions include enhanced stability in response to E2 treatment.
In addition to remarkable overall sequence conservation, the 3'-UTR sequence of sheep ER mRNA revealed the presence of sequence motifs important to stabilities of other mRNAs. The 10 or more ARE elements in the 3'-UTR of sheep and human ER mRNAs were probably responsible for the instability conferred by the 3'-UTR when it was transferred to heterologous genes (Ref. 34 and data not shown). Loss or absence of AREs in the ER mRNA fragments analyzed appeared to stabilize RNAs in the cell-free assay. The inherent instability of ER mRNA and protein (56) makes its levels rapidly responsive to changes in transcription and mRNA stability, as is the case with oncogene products such as c-fos and c-myc. Thus, sequence elements within the 3'-UTR of ER mRNA appear to be critical to the biology of ER gene expression.
The cell-free RNA stability assay developed here was based on similar ones used to define the RNA sequences and binding proteins involved in regulated mRNA stabilities (24, 26, 27, 28, 29, 30, 35, 36, 40, 41, 42, 43, 44, 45, 46, 57, 58, 59). The cell-free assay data recreated the 3-fold enhanced stability with E2 treatment that was specific to ER mRNA in vivo. However, the absolute values of mRNA half-lives in vitro were shorter than those measured in vivo, perhaps due to the disruption of subcellular architecture that compartmentalizes RNAs apart from RNases. In addition, the high-speed centrifugation of the extracts may have reduced levels of polysomal proteins that stabilize mRNAs, such as cap- and polyA-binding proteins, since those features did not affect RNA stability in our assay. The tissue specificity of E2 up-regulation of ER mRNA in vivo [in endometrium and myometrium but not liver (10)] was also consistent with the E2-enhanced stability of ER mRNA in the cell-free assay in extracts from endometrium and myometrium, but not liver.
With the in vitro stability assay, we defined four MEMSS sequences of less than 90 bases within the greater-than-4000-base-long 3'-UTR that were sufficient for E2-enhanced stability. In addition, MEMSS-C and -D conferred stability to a heterologous RNA. The MEMSS-C and -D shared a 10-base-long, U-rich sequence and multiple sequences related to APyUGA (Fig. 10
). One of the APyUGA of MEMSS-C was identified as a homolog of the estrogen-stabilizing element of vitellogenin mRNA from our original ER mRNA sequence data. The endonuclease and stabilizing factors that regulate cleavage of APyUGA sites in vitellogenin, albumin, and apolipoprotein II mRNAs in an estrogen-dependent manner in frog and chicken liver are similar to the endometrial protein that stabilizes ER mRNA in their inhibition by 70 C heat and alkylation, and dependence on Mg2+ and reducing conditions (30, 44, 59). These similarities suggest that vigilin, the E2-induced protein that stabilizes vitellogenin mRNA in frog liver, may be acting similarly in sheep endometrium. Western blot analyses of extract proteins identified vigilin as a 119-kDa band (Fig. 11
), similar to its size in bovine tissues (60). However, vigilin protein levels were not affected by E2 treatment. Northern blot analyses of endometrial tissue for vigilin mRNA also failed to detect increased vigilin gene expression in the E2-treated ewes (data not shown). Others have demonstrated that vigilin does not bind human ER mRNA (61). It appears, therefore, that vigilin is not responsible for the greater stability of ER mRNA in endometrium of E2-treated ewes.
Our current working model postulates that sites such as APyUGA on the 3'-UTR of ER mRNA are sensitive to cleavage by an endonuclease in endometrium of ewes. However, E2 treatment induces a protein (other than vigilin) to bind neighboring sequences, such as the UGUAUUCUUC, which protects the ER mRNA from degradation. Future experiments will further define the ER mRNA sequences/structures and their binding proteins that are critical to this novel mechanism of gene regulation by estrogen in a mammalian tissue.
 |
MATERIALS AND METHODS
|
|---|
Animal Treatment, Tissue Collection, and Extract Preparation
Adult cross-bred ewes (Ovis aries) with normal estrous cycles were ovariectomized in the breeding season at least 4 wk before the beginning of the experiment. Four ewes received 50 µg E2 in 0.5 ml charcoal-stripped corn oil as an im injection, whereas four others received only the corn oil vehicle. Eighteen hours later, endometrium, myometrium, and liver tissues were collected surgically. All animal procedures were approved by the Texas A&M University Laboratory Animal Care and Use Committee. High-speed cytosolic extracts were prepared at 4 C in the presence of protease inhibitors. Briefly, 2 g of fresh endometrium were homogenized in 15 ml of hypotonic buffer (57, 59). After clearing of nuclei and cell debris, extracts were centrifuged 100,000 x g for 60 min. Dialysis in 20 mM HEPES (pH 7.9) 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, and 5 µg/ml each leupeptin and aprotinin. Unless otherwise specified, reagents were of molecular biology grade from Sigma (St. Louis, MO). Radionucleotides were purchased from New England Nuclear Life Science Products (Boston, MA).
Cloning and Sequencing ER 5'- and 3'-UTRs
The 5'- and 3'-UTRs of sheep ER mRNA were cloned by rapid amplification of cDNA ends (RACE), the former with dC-tailing (54), or the Marathon kit (CLONTECH Laboratories, Inc., Palo Alto, CA), respectively. The gene-specific primers used for 5'-RACE were: (5')GGTCTCCTTGGCAGATTCCATGGCCATGC and (nested) (5')TGCCGGACGCTTTGGTGTGTAGGG, and for 3'-RACE: (5')TTGCCAGTACCAGTGACAAGG. At least three clones of each were sequenced using PE Applied Biosystems (Foster City, CA) terminator mix for cycle sequencing and their automated DNA sequencer at the Gene Technologies core facility of Texas A&M University. 5'- and 3'- Sheep ER mRNA sequences were assembled with the FRAGMENT ASSEMBLY programs of the Genetics Computer Group package (Madison, WI) and submitted to GenBank (accession nos. AY059388 and AY033393). The CLUSTAL-W program (62) was used to align the sheep ER mRNA sequences (including GenBank accession nos. Z49257 and AF159145) to those of other species: pig (AF034972), horse (AF124093), human (X03635, X62462), mouse (M38651, AJ276597), and blue tilapia fish (X93561). The Multiple Expectation Maximization for Motif Elicitation (MEME) and Minimal Energy FOLDing (MFOLD) algorithms were used to identify structures and similar sequences in the MEMSS (63, 64).
Synthesis of RNAs Analyzed in the Cell-Free Stability Assays
Templates for in vitro transcription of sense ER 3'-UTR cRNAs were generated by PCR from plasmids containing cDNAs for the 5'-UTR, coding sequence (31), and 3'-UTR of ovine ER mRNA. The PCR used gene-specific 5'- and 3'-primers, with the former carrying the T7 RNA promoter sequence. For polyadenylated transcripts, the 3'-primer carried 50 T residues at its 5'-end. Unrelated control cRNAs were transcribed in vitro from pTRI RNA 18S (Ambion, Inc., Austin, TX) and plasmids containing globin-coding sequences with or without the 3'-UTR. The latter were generated by PCR with primers spanning bases 497716 or 497-1399 of the globin sequence (GenBank accession no. V00882) from the pBBB (65) and cloned into pcDNA3.1 (Invitrogen; Carlsbad, CA). Chimeric constructs of 18S rRNA or ß-globin sequences with ER 3'-UTR sequences cloned into 3'-positions were also used as templates for in vitro transcription. Transcripts were uniformly labeled with 32P-UTP during in vitro transcription with T7 RNA polymerase (Maxiscript kit, Ambion, Inc.). Capping was performed by adding the cap analog m7G(5') ppp(5')G and reducing levels of GTP in the transcription reaction (Promega Corp., Madison, WI). Radiolabeled RNAs were gel purified on 5% polyacrylamide/8 M urea gels. After elution from the gel in 500 mM ammonium acetate, 0.2% (wt/vol) sodium dodecyl sulfate, 1 mM EDTA at 45 C on a rocking platform overnight, probes were precipitated and redissolved in 0.5 mg/ml yeast tRNA in 1 mM sodium citrate, pH 6.5.
Explant Cultures for Global RNA Stability Determination
For 3 h, RNAs synthesized in endometrial explant cultures from three E2-treated and three control ovariectomized ewes were labeled with 3H-uridine as previously described (23). Explants from E2-treated ewes were cultured with 10-9 M E2, while control ewe explants received the vehicle only. Transcription was inhibited immediately after pulse labeling (time = 0 h) by adding 75 µg/ml 5,6-dichloro-1-ß-D-ribofuranosylbenzimidazole, previously shown to block 95% of transcription in this culture system (23). Explant samples were taken at that time and subsequently at 6-h intervals. Total cellular and polyA+ RNA samples were prepared and analyzed in duplicate for RNA concentration and incorporated radioactivity.
In Vitro Stability Assay
The stability of each RNA (0.1 ng, 1000 cpm) was tested with 6 µg cytosolic extract protein from each ewe in duplicate (66). The 10-µl stability reactions were incubated for 15 min (or the indicated time in Fig. 3
) at 37 C, and RNA was purified and separated electrophoretically on a 5% polyacrylamide/8 M urea gel alongside the input RNA. Radioactivity of full-length probe was measured directly from the dried gels with an InstantImager (Packard Instruments, Meriden, CT). Fragments of the 3'-UTR of ER mRNA were assayed alongside the full-length 3'-UTR, which generated very consistent percentages of the probe remaining after the incubation. Quantitative data were analyzed by least-squares ANOVA using the General Linear Model procedures of SAS (SAS version 6.12 from the SAS Institute, Inc., Cary, NC). All assays were repeated three times. Data are reported as least squares means and SEs for the ewe treatment groups. The level of significance was P < 0.05 unless otherwise noted. Pretreatment of extracts with proteinase K (Ambion, Inc.; 0.4 mg/ml) was 15 min at 37 C. Homopolymer nucleic acids (Pharmacia Biotech, Piscataway, NJ) were preincubated with the extracts for 15 min at 37 C at 2000-fold molar excess. In assays of fragments of the 3'-UTR of ER mRNA, the full-length 3'-UTR was tested alongside and generated very consistent percentages of the probe remaining after the incubation.
Western Blot Analysis of Vigilin Levels
Protein samples (60 µg), one from each endometrial extract and one from a similar extract from bovine kidney, were electrophoresed on a 7.5% polyacrylamide minigel containing sodium dodecyl sulfate. The separated proteins were electroblotted to nitrocellulose. The blot was developed with vigilin antibodies (48), antirabbit IgG conjugated to horseradish peroxidase, and SuperSignal West Pico chemiluminescent substrate (Pierce Chemical Co., Rockford, IL). The chemiluminescence was imaged on a Fluorscan 8800 (Alpha Innotech, San Leandro, CA).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Yuhua Farnell, Dr. Laurie Jaeger, Ms. Cindy Balog, and Ms. Margaret Schell for their expertise and assistance in performing the experiments reported here and gratefully acknowledge the gift of the pBBB plasmid from Dr. Ann-Bin Shyu and the vigilin antibodies from Dr. Peter K. Mueller.
 |
FOOTNOTES
|
|---|
This work was supported by National Science Foundation Grant IBN-9514038.
Abbreviations: ARE, Androgen response element; DTT, dithiothreitol; E2, estradiol; ER, estrogen receptor; MEMSS, minimal E2-modulated stability sequence; PMR1, polysomal ribonuclease 1; PR, progesterone receptor; RACE, rapid amplification of cDNA ends; RNase, ribonuclease; UTR, untranslated region.
Received for publication September 5, 2002.
Accepted for publication January 7, 2003.
 |
REFERENCES
|
|---|
- Moore NW, Miller BG, Trappl MN 1983 Transport and development of embryos transferred to the oviducts of entire and ovariectomized ewes. J Reprod Fertil 68:129135[CrossRef][Medline]
- Ing NH, Robertson JA 1999 Regulation of hormone receptor gene expression. In: Carson D, ed. Embryo implantation: molecular, cellular, and clinical aspects. New York: Springer-Verlag; 287298
- Dao B, Vanage G, Marshall A, Bardin CW, Koide SS 1996 Anti-implantation activity of antiestrogens and mifepristone. Contraception 54:253258[CrossRef][Medline]
- Pettersson K, Gustafsson JA 2001 Role of estrogen receptor ß in estrogen action. Annu Rev Physiol 63:165192[CrossRef][Medline]
- Curtis Hewitt S, Couse JF, Korach KS 2000 Estrogen receptor knock out mice: what their phenotypes reveal about mechanisms of estrogen action. Breast Cancer Res 2:345352[CrossRef][Medline]
- Wang H, Masironi B, Eriksson H, Sahlin L 1999 A comparative study of estrogen receptors
and ß in the rat uterus. Biol Reprod 61:955964[Abstract/Free Full Text]
- Dennis AP, Haq RU, Nawaz Z 2001 Importance of the regulation of nuclear receptor degradation. Front Biosci 6:954959
- Ing NH, Spencer TE, Bazer FW 1996 Estrogen enhances expression of the estrogen receptor gene in endometrium by a posttranscriptional mechanism. Biol Reprod 54:591599[Abstract]
- Ing NH, Tornesi BT 1997 E2 up-regulates estrogen receptor and progesterone receptor gene expression in specific uterine cells. Biol Reprod 56:12051215[Abstract]
- Zou K, Ing NH 1998 Oestradiol up-regulates oestrogen receptor and cyclophilin mRNA concentrations in endometrium, but has opposite effects in liver. J Steroid Biochem Mol Biol 64:231237[CrossRef][Medline]
- Boyd MT, Hildebrandt RH, Bartow SA 1996 Expression of the estrogen receptor gene in developing and adult human breast. Breast Cancer Res Treat 37:243251[CrossRef][Medline]
- Simerly RB, Young BJ 1991 Regulation of estrogen receptor messenger ribonucleic acid in rat hypothalamus by sex steroid hormones. Mol Endocrinol 5:424432[Abstract]
- Friend KE, Resnick EM, Ang LW, Shupnik MA 1997 Specific modulation of estrogen receptor mRNA isoforms in rat pituitary throughout the estrous cycle and in response to steroid hormones. Mol Cell Endocrinol 131:147155[CrossRef][Medline]
- Kaneko KJ, Furlow JD, Gorski J 1993 Involvement of the coding sequence for the estrogen receptor gene in autologous ligand-dependent down-regulation. Mol Endocrinol 7:879888[Abstract]
- Saceda M, Lindsey, RK, Solomon H, Angeloni SV, Martin MB 1998 Estradiol regulates estrogen receptor mRNA stability. J Steroid Biochem Mol Biol 66:113120[CrossRef][Medline]
- Bergman MD, Schachter BS, Karelus K, Combatsiaris EP, Garcia T Nelson JF 1992 Upregulation of the uterine estrogen receptor and its messenger ribonucleic acid during the mouse estrous cycle: the role of estradiol. Endocrinology 130:19231930[Abstract]
- Quarmby VE, Yarbrough WG, Lubahn DB, French FS, Wilson EM 1990 Autologous down-regulation of androgen receptor messenger ribonucleic acid. Mol Endocrinol 4:2228[Abstract]
- Grad JM, Dai JL, Wu S, Burnstein KL 1999 Multiple androgen response elements and a myc consensus site in the androgen receptor (AR) coding region are involved in androgen-mediated up-regulation of AR messenger RNA. Mol Endocrinol 13:18961911[Abstract/Free Full Text]
- Yeap BB, Kruger RG, Leedman PJ 1999 Differential posttranscriptional regulation of androgen receptor gene expression by androgen in prostate and breast cancer cells. Endocrinology 140:32833291
- Tsai M-J, Clark JH, Schrader WT, OMalley BW 1998 Mechanisms of action of hormones that act as transcription-regulatory factors. In: Williams textbook of endocrinology. 9th ed. Philadelphia: WB Saunders Co.; 5594
- Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:16031614[Medline]
- Ing NH, Ott TL 1999 Estradiol up-regulates estrogen receptor-
messenger ribonucleic acid in sheep endometrium by increasing its stability. Biol Reprod 60:134139[Abstract/Free Full Text]
- Robertson JA, Farnell Y, Lindahl LS, Ing NH 2002 Estradiol up-regulates estrogen receptor messenger ribonucleic acid in endometrial carcinoma (Ishikawa) cells by stabilizing the message. J Mol Endocrinol 29:125135[Abstract]
- Shapiro DJ, Barton MC, McKearin DM, Chang T-C, Lew D, Blume J, Nielsen DA, Gould L 1989 Estrogen regulation of gene transcription and mRNA stability. Recent Prog Horm Res 45:2964
- Flouriot G, Pakdel F, Valotaire Y 1996 Transcriptional and post-transcriptional regulation of rainbow trout estrogen receptor and vitellogenin gene expression. Mol Cell Endocrinol 124:173183[CrossRef][Medline]
- Dodson RE, Shapiro DJ 1994 An estrogen-inducible protein binds specifically to a sequence in the 3' untranslated region of estrogen-stabilized vitellogenin mRNA. Mol Cell Biol 14:31303138[Abstract/Free Full Text]
- Dodson RE, Shapiro DJ 1997 Vigilin, a ubiquitous protein with 14 K homology domains, is the estrogen-inducible vitellogenin mRNA 3'-untranslated region-binding protein. J Biol Chem 272:1224912252[Abstract/Free Full Text]
- Cunningham KS, Dodson RE, Nagel MA, Shapiro DJ, Schoenberg DR 2000 Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3'-untranslated region by the mRNA endonuclease polysomal ribonuclease 1. Proc Natl Acad Sci USA 97:1249812502[Abstract/Free Full Text]
- Margot JB, Williams DL 1996 Estrogen induces the assembly of a multiprotein messenger ribonucleoprotein complex on the 3'-untranslated region of chicken apolipoprotein II mRNA. J Biol Chem 271:44524460[Abstract/Free Full Text]
- Chernokalskaya E, Dompenciel R, Schoenberg DR 1997 Cleavage properties of an estrogen-regulated polysomal ribonuclease involved in the destabilization of albumin mRNA. Nucleic Acids Res 25:735742[Abstract/Free Full Text]
- Madigou T, Tiffoche C, Lazennec G, Pelletier J, Thieulant ML 1996 The sheep estrogen receptor: cloning and regulation of expression in the hypothalamo-pituitary axis. Mol Cell Endocrinol 121:153163[CrossRef][Medline]
- Grandien K 1996 Determination of transcription start sites in the human estrogen receptor gene and identification of a novel, tissue-specific, estrogen receptor-mRNA isoform. Mol Cell Endocrinol 116:207212[CrossRef][Medline]
- Kos M, OBrien S, Fluoriot G, Gannon F 2000 Tissue-specific expression of multiple mRNA variants of the mouse estrogen receptor
gene. FEBS Lett 477:1520[CrossRef][Medline]
- Kenealy MR, Fluoriot G, Sonntag-Buck V, Dandekar T, Brand H, Gannon F 2000 The 3'-untranslated region of the human estrogen receptor
gene mediates rapid messenger ribonucleic acid turnover. Endocrinology 141:28052813[Abstract/Free Full Text]
- Balmer LA, Beveridge DJ, Jazayeri JA, Thomson AM, Walker CE, Leedman PJ 2001 Identification of a novel AU-Rich element in the 3' untranslated region of epidermal growth factor receptor mRNA that is the target for regulated RNA-binding proteins. Mol Cell Biol 21:20702084[Abstract/Free Full Text]
- Nabors LB, Gillespie GY, Harkins K, King PH 2001 HuR, a RNA stability factor, is expressed in malignant brain tumors and binds to adenine- and uridine-rich elements within the 3' untranslated regions of cytokine and angiogenic factor mRNAs. Cancer Res 61:21542161[Abstract/Free Full Text]
- Guhaniyogi J, Brewer G 2001 Regulation of mRNA stability in mammalian cells. Gene 265:1123[CrossRef][Medline]
- Gao M, Fritz DT, Ford LP, Wilusz J 2000 Interaction between a poly(A)-specific ribonuclease and the 5'cap influences mRNA deadenylation rates in vitro. Mol Cell 5:479488[CrossRef][Medline]
- Wang Z, Kiledjian M 2001 Functional link between the mammalian exosome and RNA decapping. Cell 107:751762[CrossRef][Medline]
- Kash JC, Menon KMJ 1999 Sequence-specific binding of a hormonally regulated mRNA binding protein to cytidine-rich sequences in the lutropin receptor open reading frame. Biochemistry 38:1688916897[CrossRef][Medline]
- Czyzyk-Krzeska MF, Bendixen AC 1999 Identification of the polyC binding protein in the complex associated with the 3' untranslated region of erythropietin messenger RNA. Blood 93:21112120[Abstract/Free Full Text]
- Erondu NE, Nwankwo J, Zhong Y, Boes M, Dake B, Bar RS 1999 Transcriptional and posttranscriptional regulation of insulin-like growth factor binding protein-3 by cyclic adenosine 3',5'-monophosphate: messenger RNA stabilization is accompanied by decreased binding of a 42-kDa protein to a uridine-rich domain in the 3'-untranslated region. Mol Endocrinol 13:495504[Abstract/Free Full Text]
- Lee WY, Loflin P, Clancey CL, Peng H, Lever JE 2000 Cyclic nucleotide regulation of Na+/glucose cotransporter (SGLT1) mRNA stability. J Biol Chem 275:3399834008[Abstract/Free Full Text]
- Dompenciel RE, Garnepudi VR, Schoenberg DR 1995 Purification and characterization of an estrogen-regulated Xenopus liver polysomal nuclease involved in the selective destabilization of albumin mRNA. J Biol Chem 270:61086118[Abstract/Free Full Text]
- Xiao X, Tang Y-S, Mackins JY, Sun X-L, Jayaram HN, Hansen DK, Antony AC 2001 Isolation and characterization of a folate receptor mRNA-binding trans-factor from human placenta. J Biol Chem 276:4151041517[Abstract/Free Full Text]
- Hamilton BJ, Burns CM, Nichols RC, Rigby WFC 1997 Modulation of AUUUA response element binding by heterogeneous nuclear ribonucleoprotein A1 in human T lymphocytes. J Biol Chem 272:2873228741[Abstract/Free Full Text]
- Dandekar T, Beyer K, Bork P, Kenealy M-R, Pantopoulos K, Hentze M, Sonntag-Buck V, Flouriot G, Gannon F, Keller W, Schreiber S 1998 Systematic genomic screening and analysis of mRNA in untranslated regions and mRNA precursors: combining experimental and computational approaches. Bioinformatics 14:271278[Abstract/Free Full Text]
- Kuegler S, Gruenweller A, Probst C, Klinger M, Mueller PK, Kruse C 1996 Vigilin contains a functional nuclear localisation sequence and is present in both the cytoplasm and the nucleus. FEBS Lett 382:330334[CrossRef][Medline]
- Rao KS, Sirdeshmukh R, Gupta PD 1994 Modulation of cytosolic RNase activity by endogenous RNase inhibitor in rat vaginal epithelial cells on estradiol administration. FEBS Lett 343:1114[CrossRef][Medline]
- Schauer RC 1991 Effects of estradiol and progesterone on rat uterine ribonuclease inhibitor activity. Horm Metab Res 23:162165[Medline]
- Brockdorff NA, Knowler JT 1986 Oestrogen-induced changes in the relative concentrations of ribonuclease and ribonuclease inhibitor in rat uterus. Mol Cell Endocrinol 44:117124[CrossRef][Medline]
- Flouriot G, Griffin C, Kenealy M, Sonntag-Buck, V, Gannon F 1998 Differentially expressed messenger RNA isoforms of the human estrogen receptor-
gene are generated by alternative splicing and promoter usage. Mol Endocrinol 12:19391954[Abstract/Free Full Text]
- Fasco MJ 1998 Estrogen receptor mRNA splice variants produced from the distal and proximal promoter transcripts. Mol Cell Endocrinol 138:5159[CrossRef][Medline]
- McCormick JA, Lyons V, Jacobson MD, Diorio NJ, Nyirenda M, Weaver S, Ester W, Yau JLW, Meaney MJ, Seckl JR, Chapmn KE 2000 5'-Heterogeniety of glucocorticoid receptor messenger RNA is tissue specific: differential regulation of variant transcripts by early-life events. Mol Endocrinol 14:506517[Abstract/Free Full Text]
- Donaghue C, Westley BR, May FEB 1999 Selective promoter usage of the human estrogen receptor-
gene and its regulation by estrogen. Mol Endocrinol 13:19341950[Abstract/Free Full Text]
- Nardulli AM, Katzenellenbogen B 1986 Dynamics of estrogen receptor turnover in uterine cells in vitro and in uteri in vivo. Endocrinology 119:20382046[Abstract]
- Ratnasabapathy R, Hwang S-PL, Williams DL 1990 The 3'-untranslated region of apolipoprotein II mRNA contains two independent domains that bind distinct cytosolic factors. J Biol Chem 265:1405014055[Abstract/Free Full Text]
- Ford LP, Wilusz J 1999 An in vitro system using HeLa cytoplasmic extracts that reproduces regulated mRNA stability. Methods 17:2127[CrossRef][Medline]
- Ratnasabapathy R 1995 In vitro characterization of an estrogen-regulated mRNA stabilizing activity in the avian liver. Cell Mol Biol Res 41:583594[Medline]
- McKnight GL, Reasoner J, Gilbert T, Sundquist KO, Hokland B, McKernan PA, Champagne J, Johnson CJ, Bailey MC, Holly R, OHara PJ, Oram JF 1992 Cloning and expression of a cellular high density lipoprotein-binding protein that is up-regulated by cholesterol loading of cells. J Biol Chem 267:1213112141[Abstract/Free Full Text]
- Kanamori H, Dodson RE, Shapiro DJ 1998 In vitro genetic analysis of the RNA binding site of vigilin, a multi-KH-domain protein. Mol Cell Biol 18:39914003[Abstract/Free Full Text]
- Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:46734680[Abstract/Free Full Text]
- Jacobson AB, Zuker, M 1993 Structural analysis by energy dot plot of a large mRNA. J Mol Biol 233:261269[CrossRef][Medline]
- Bailey TL, Elkan C 1994 Fitting a mixture model by expectation maximization to discover motifs in biopolymers. In: Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology. Menlo Park, CA: AAAI Press; 2836
- Chen C-YA, Chen T-M, Shyu A-B 1994 Interplay of two functionally and structurally distinct domains of the c-fos AU-rich element specifies its mRNA-destabilizing function. Mol Cell Biol 14:416426[Abstract/Free Full Text]
- Bernstein PL, Herrick DJ, Prokipcak RD, Ross J 1992 Control of c-myc mRNA half-life in vitro by a protein capable of binding to a coding region stability determinant. Genes Dev 6:642654[Abstract/Free Full Text]
NURSA Molecule Pages Link:
- Nuclear Receptors:
ERα
|
ERβ
|
PR
- Ligands:
17β-Estradiol
This article has been cited by other articles:

|
 |

|
 |
 
H. W. Huang, W. Bi, G. N. Jenkins, and J. L. Alcorn
Glucocorticoid Regulation of Human Pulmonary Surfactant Protein-B mRNA Stability Involves the 3'-Untranslated Region
Am. J. Respir. Cell Mol. Biol.,
April 1, 2008;
38(4):
473 - 482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Manikkam, R. C. Thompson, C. Herkimer, K. B. Welch, J. Flak, F. J. Karsch, and V. Padmanabhan
Developmental Programming: Impact of Prenatal Testosterone Excess on Pre- and Postnatal Gonadotropin Regulation in Sheep
Biol Reprod,
April 1, 2008;
78(4):
648 - 660.
[Abstract]
[Full Text]
[PDF]
|
 |
|