Molecular Endocrinology, doi:10.1210/me.2002-0369
Molecular Endocrinology 17 (4): 692-703
Copyright © 2003 by The Endocrine Society
Short-Term Plasticity of Cyclic Adenosine 3',5'-Monophosphate Signaling in Anterior Pituitary Corticotrope Cells: The Role of Adenylyl Cyclase Isotypes
Ferenc A. Antoni,
Alexander A. Sosunov1,
Anders Haunsø2,
Janice M. Paterson3 and
James Simpson
Department of Neuroscience, University of Edinburgh, Edinburgh EH8 9JZ, Scotland, United Kingdom
Address all correspondence and requests for reprints to: F. Antoni, Department of Neuroscience, University of Edinburgh, Edinburgh EH8 9JZ, Scotland, United Kingdom. E-mail: ferenc.antoni{at}ed.ac.uk.
 |
ABSTRACT
|
|---|
Anterior pituitary corticotropes show a wide repertory of responses to hypothalamic neuropeptides and adrenal corticosteroids. The hypothesis that plasticity of the cAMP signaling system underlies this adaptive versatility was investigated. In dispersed rat anterior pituitary cells, depletion of intracellular Ca2+ stores with thapsigargin combined with ryanodine or caffeine enhanced the corticotropin releasing-factor (CRF)-evoked cAMP response by 4-fold, whereas reduction of Ca2+ entry alone had no effect. CRF-induced cAMP was amplified 15-fold by arginine-vasopressin (AVP) or phorbol-dibutyrate ester. In the presence of inhibitors of cyclic nucleotide phosphodiesterases and phorbol-dibutyrate ester, the depletion of Ca2+ stores had no further effect on CRF-induced cAMP accumulation. Adenohypophysial expression of mRNAs for the Ca2+-inhibited adenylyl cyclases (ACs) VI and IX, and the protein kinase C-stimulated ACs II and VII was demonstrated. ACIX was detected in corticotropes by immunocytochemistry, whereas ACII and ACVI were not present. The data show negative feedback regulation of CRF-induced cAMP levels by Ca2+ derived from ryanodine receptor-operated intracellular stores. Stimulation of protein kinase C by AVP enhances Ca2+-independent cAMP synthesis, thus changing the characteristics of intracellular Ca2+ feedback. It is proposed that the modulation of intracellular Ca2+ feedback in corticotropes by AVP is an important element of physiological control.
 |
INTRODUCTION
|
|---|
FORTY-ONE AMINO ACID residue corticotropin-releasing factor (CRF) and arginine vasopressin (AVP) are the main hypothalamic mediators of the stress response (1) that stimulate the secretion of ACTH by adenohypophysial corticotrope cells. Adrenal corticosteroids are mobilized in response to ACTH and provide a negative feedback signal in the brain and the anterior pituitary gland to prevent an overshoot of the stress response (2, 3). Additional hypothalamic inhibitory factors also contribute to the regulation of corticotropes (1, 4). Corticotrope cells show remarkable functional plasticity, e.g. glucocorticoid inhibition of pituitary ACTH secretion is diminished in autoimmune disease models (5, 6), while it is very pronounced in psychological stress (7).
The currently identified receptors for CRF all activate adenylyl cyclase (AC) through the stimulatory G protein Gs (8). In corticotropes, activation of CRF1
receptors enhances cAMP levels, which leads to increased firing of action potentials and oscillations of intracellular free Ca2+ ([Ca2+]i) (1, 9). In contrast to CRF, AVP activates V1ß receptors coupled to phospholipase Cß through Gq in corticotrope cells (10). When given alone at physiological concentrations (
2 nM), AVP has little or no effect on ACTH secretion. However, it markedly augments ACTH release induced by CRF (11) by amplifying the CRF-evoked cAMP response (12, 13). These effects are mediated by protein kinase C (14).
Studies in the AtT20 corticotrope tumor cell line have shown that CRF-induced cAMP accumulation as well as membrane depolarization are under feedback inhibition by [Ca2+]i (15, 16). Disruption of the Ca2+ negative feedback in AtT20 cells leads to enhanced cAMP levels and a marked reduction of glucocorticoid inhibition of stimulated ACTH release (17). Previous work in cultured rat anterior pituitary cells (18) suggested that intracellular Ca2+ is an obligatory cofactor for CRF-induced cAMP production. This contradicts the findings in AtT20 cells (15) and the more generalized Ca2+-feedback hypothesis of glucocorticoid action (17, 19).
Therefore, the aim of the present study was to analyze the effects of Ca2+ on cAMP levels in corticotrope cells exposed to CRF and AVP. The results demonstrate Ca2+ negative feedback control of CRF-induced cAMP levels in rat pituitary corticotropes by [Ca2+]i derived from a ryanodine receptor (RyR)-operated intracellular source. AVP markedly enhanced the cAMP response to CRF and amplified by 10-fold the dynamic range of the modulation of cAMP levels by [Ca2+]i. This change was in part due to the enhancement of Ca2+-independent cAMP synthesis. Analysis of AC expression indicated that ACIX and ACVII are likely to mediate the actions of CRF and AVP in corticotrope cells. It is proposed that the reduction of Ca2+ feedback inhibition of cAMP synthesis underlies the ability of AVP to reduce glucocorticoid feedback inhibition of ACTH release.
 |
RESULTS
|
|---|
Ca2+ Feedback Inhibition of CRF-Induced cAMP Synthesis
The time course of the cAMP response to a high physiological concentration of CRF (0.3 nM) is shown in Fig. 1A
. Levels of cAMP peaked at 2 min, declined sharply by 5 min, and returned to baseline at 20 min. As CRF is highly specific to corticotropes and because corticotrope cells represent, at best, 10% of the total number of cells in this preparation, 2- to 3-fold increases of total cAMP may correspond to approximately 20- to 30-fold increases of intracellular cAMP in corticotropes.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 1. Time Course of cAMP Accumulation in Isolated Rat Anterior Pituitary Cells [Vehicle (Basal) and 0.3 nM CRF-Treated (CRF) Cells]
A, Incubations in medium containing 2 mM Ca2+. B, Incubations in low Ca2+ medium containing 30 µM ryanodine and 2 µM thapsigargin. Data are means ± SEM of triplicates, from a representative of two separate experiments.
|
|
Depletion of Ca2+ pools by means of 2 mM EGTA, 30 µM ryanodine, and 2 µM thapsigargin before the application of CRF increased the basal levels of cAMP in the cell suspension. The amplitude of the cAMP response to CRF was similar to that observed in medium containing 2 mM Ca2+ (Fig. 1B
); however, it was sustained: steady state was reached within 5 min and maintained up to 20 min.
The decline of cAMP levels after 2 min in 2 mM Ca2+ medium indicated the involvement of cyclic nucleotide phosphodiesterases (PDEs), while the steady state seen in Ca2+-depleted cells suggested regulation by Ca2+ of PDE and/or AC. Indeed, the combination of the PDE inhibitors 3-isobutyl-1-methylxanthine (IBMX) and rolipram markedly enhanced the cAMP response to 0.3 nM CRF without the involvement of adenosine receptors (20). In the presence of 1 mM IBMX and 0.1 mM rolipram (PDE-I), application of 3 µM nifedipine or 2 mM CoCl2 or acute depletion of extracellular Ca2+ by resuspension of the cells in low Ca2+ medium failed to alter the cAMP response to 0.3 nM CRF (not shown). Thus, reduction of Ca2+ entry mechanisms had no apparent effect on the cAMP response to CRF. Attempts to use intracellular chelators of Ca2+ failed to yield useful data because of the apparently nonspecific effects of all acetoxy-methyl esters tested [1-[2-(5-carboxyoxazol-2-yl)-6-aminobenzofuran-5-oxy]-2-(2'-amino-5'-methylphenoxy)-ethane-N,N,N'N'-tetraacetic acid pentaacetoxymethyl ester (FURA2/AM), 1, 2-bis-(o-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid tetra-(acetoxymethyl)-ester (BAPTA/AM) as well as 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein acetoxymethyl ester (BCECF/AM)] to enhance cAMP accumulation in this system (data not shown). Therefore, drugs that deplete or block intracellular Ca2+ stores were used. Application of 10 mM caffeine significantly increased basal cAMP levels, but failed to enhance the response to 0.3 nM CRF (Table 1
). Thapsigargin at 2 µM had no effect; however, in combination with caffeine it produced a significant enhancement of basal as well as CRF-induced cAMP formation (Table 1
). Preincubation in low Ca2+ medium containing 2 mM EGTA for 30 min augmented basal and CRF-induced cAMP (Fig. 2A
). The application of 2 mM EGTA with 10 mM caffeine and 2 µM thapsigargin gave the highest response to CRF (Fig. 2A
).
View this table:
[in this window]
[in a new window]
|
Table 1. Effect of Depletion of Intracellular Ca2+ Pools on 0.3 nM CRF-Induced cAMP Accumulation in the Presence of 1 mM IBMX and 0.1 mM Rolipram
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Figure 2. Analysis of the Effects of Ca2+ on cAMP Synthesis Induced by CRF in Isolated Rat Anterior Pituitary Cells
A, Depletion of intracellular Ca2+ pools leads to enhanced synthesis of cAMP in the presence of PDE blockers (1 mM IBMX, 0.1 mM rolipram). Cells were preincubated in 2 mM Ca2+ (Ca2+), or various combinations of 2 mM EGTA (E), 2 µM thapsigargin (T), and 10 mM caffeine (C). Data are means ± SEM of quadruplicates from a representative of four experiments. Note marked increases in basal (hatched columns) cAMP levels; however, these were not proportional to the enhancement of the response to CRF: two-way ANOVA gave a significant interaction (P < 0.05) between the effects of Ca2+ depletion and CRF. The increments of cAMP (empty portion of columns) were analyzed by one-way ANOVA and Newman-Keuls test. *, P < 0.05 when compared with the increment of cAMP in 2 mM Ca2+ group; +, P < 0.05 when compared with the increment of the EGTA group. B, Time course of 0.3 nM CRF-stimulated cAMP accumulation in the presence of blockers of PDE in control cells (2 mM Ca2+) and in Ca2+-depleted cells in 2 mM EGTA, 10 mM caffeine, and 2 µM thapsigargin (ECT). Increments above basal cAMP levels are shown; the basal level of cAMP in 2 mM Ca2+ was 0.11 ± 0.014 pmol/well. Data are means ± SEM of quadruplicates from a representative of two experiments.
|
|
The time course of the CRF-induced increment of cAMP in Ca2+-depleted cells treated with PDE-I is shown in Fig. 2B
. Note that the rate of cAMP accumulation was close to linear up to 8 min, with a marked reduction afterward. In medium containing 2 mM Ca2+ the response reached steady state as early as 5 min. At 8 min, the cAMP increment in Ca2+-depleted cells was 4.0 ± 0.22-fold higher (mean ± SEM, n = 5, each in quadruplicate) than in 2 mM Ca2+. Taken together, these data indicated that CRF-induced cAMP synthesis was inhibited by Ca2+ derived from RyR-operated Ca2+ stores.
Concentration-response curves to CRF in the absence (Fig. 3A
) or the presence of PDE-I (Fig. 3B
) revealed that the Ca2+-regulated component of cAMP synthesis, i.e. the difference between the CRF-induced increments in Ca2+-depleted conditions and in 2 mM Ca2+, approached maximum between 0.3 and 1 nM CRF [Fig. 3
, A and B (inset)], which is the upper limit of the physiological range. Importantly, cellular cAMP continued to rise in response to concentrations of CRF up to 100-fold above this level (Fig. 3
, A and B).

View larger version (20K):
[in this window]
[in a new window]
|
Figure 3. Enhancement of the CRF-Induced cAMP Response by Ca2+ Depletion in Isolated Rat Anterior Pituitary Cells
A, Cells in medium containing 2 mM Ca2+ or low Ca2+ medium with 30 µM ryanodine and 2 µM thapsigargin (ERT); the inset shows the difference between the CRF-induced increments of cAMP in the ERT and 2 mM Ca2+ groups for each concentration of CRF. B, Cells treated with 1 mM IBMX and 0.1 mM rolipram, incubated in medium containing 2 mM Ca2+ or low Ca2+ medium with 10 mM caffeine and 2 µM thapsigargin (ECT); means ± SEM of quadruplicates representative of two experiments. The inset is as in panel A.
|
|
Activation of Protein Kinase C Reduces the Ca2+-Inhibited Component of cAMP Synthesis
Physiological concentrations of AVP (0.3 and 2 nM) strongly enhanced the cAMP response to 0.3 nM CRF (Fig. 4A
), whereas there was no detectable change in cAMP levels in the presence of up to 100 nM AVP alone (not shown). Pretreatment with the protein kinase inhibitor bis-indolyl maleimide I (1 µM) blocked approximately 90% of the effect of 2 nM AVP, suggesting its mediation by protein kinase C (data not shown). Combination of 0.3 nM CRF with 2 nM AVP (CRF/AVP) augmented the cAMP response to 14.5 ± 2- and 15.9 ± 2.3-fold (mean ± SEM; n = 3, each carried out in quadruplicate) of the responses to 0.3 nM CRF in 2 mM Ca2+ and 0.3 nM CRF in 2 mM EGTA, 30 µM ryanodine, and 2 µM thapsigargin, respectively. Thus, the effect of AVP was largely independent of Ca2+ status and, as a result, the dynamic range of Ca2+ control, i.e. the difference in the cAMP response in 2 mM Ca2+ vs. ERT-medium, increased almost 10-fold. The cAMP response to CRF/AVP was not maximal as application of supraphysiological concentrations of AVP revealed the ability of the system to produce greater than 100-fold increases of cAMP (Fig. 4A
).

View larger version (12K):
[in this window]
[in a new window]
|
Figure 4. Interaction of Protein Kinase C Activation and Ca2+ Depletion on cAMP Accumulation Evoked by 0.3 nM CRF
A, Cells in medium containing 2 mM Ca2+ or low Ca2+ medium with 30 µM ryanodine and 2 µM thapsigargin (ERT). The basal level of cAMP in 2 mM Ca2+ was 0.04 ± 0.006 pmol/well. B and C, Cells treated with 1 mM IBMX and 0.1 mM rolipram, incubated in medium containing 2 mM Ca2+ or low Ca2+ medium with 10 mM caffeine and 2 µM thapsigargin (ECT). Data are means ± SEM of quadruplicates representative of three separate experiments. The basal level of cAMP in 2 mM Ca2+ was 0.10 ± 0.02 in panel B and 0.12 ± 0.02 pmol/well in panel C.
|
|
In the presence of PDE-I, AVP produced significant, concentration-dependent potentiation of the cAMP response to 0.3 nM CRF (Fig. 4B
). At 2 nM AVP the amplification was 3.5 ± 0.7-fold (mean ± SEM; n = 5, each carried out in quadruplicate) of the control CRF response, which was substantially less than the 15-fold increase in the absence of PDE-I. Furthermore, Ca2+-depletion had a significantly smaller effect on the cAMP response to CRF/AVP in the presence of PDE inhibitors [Vehicle (4.1 ± 0.7) vs. PDE-I (2.2 ± 0.4)-fold increase of the response in 2 mM Ca2+ medium, mean ± SEM, n = 3 and n = 5, respectively, each in quadruplicate, P < 0.05 compared by Students t test]. At a high, supraphysiological AVP concentration (50 nM), no enhancement of the cAMP response was observed upon Ca2+ depletion (Fig. 4B
). Similarly, increasing concentrations of the protein kinase C activator PdBu (phorbol-dibutyrate ester) progressively diminished the Ca2+ modulation of CRF-induced cAMP production (Fig. 4C
).
In sum, both AVP-induced protein kinase C activation and the depletion of Ca2+ pools enhanced the cAMP response to CRF in the presence as well as the absence of PDE-I. In the absence of PDE-I there was clear synergy between the effects of AVP and Ca2+ depletion, whereas in the presence of PDE-I the effects were additive and much smaller in amplitude. In the presence of PDE-I, intensive stimulation of the protein kinase C pathway eventually enhanced the cAMP response to levels at which the effects of Ca2+ depletion were not discernible.
Specificity of Ca2+ Inhibition of Stimulus-Induced cAMP
Introduction of Ca/EGTA into the medium suppressed the CRF-induced increment of cAMP levels to that seen in cells incubated with 2 mM Ca2+ throughout in the presence (Fig. 5A
) as well as in the absence of PDE-I (not shown). This was also the case for cells stimulated with CRF/AVP (Fig. 5A
); moreover, inclusion of 1 µM of the Ca2+ ionophore ionomycin which supports Ca2+-dependent ACTH secretion in this system (21) failed to augment the inhibitory effect of 2 mM extracellular Ca2+ on CRF- or CRF/AVP-induced cAMP responses (data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 5. Introduction of Ca2+ into the Extracellular Fluid Suppresses cAMP Responses to CRF or CRF and AVP in Combination
Experiments carried out in the presence of PDE blockers, 0.1 mM rolipram and 1 mM IBMX. A, Increments of cAMP above respective basals; data are means ± SEM from quadruplicates representative of four experiments. *, P < 0.05 when compared with 0 Ca2+ group, but not different from response of cells incubated in 2 mM Ca2+ throughout (dashed line, CRF 0.3 nM/AVP 2 nM; dotted line, CRF 0.3 nM); one-way ANOVA, Newman-Keuls test. B, Specificity of the inhibitory effect of Ca2+ on CRF-induced cAMP synthesis. Cells incubated in 2 mM Ca2+ throughout, or depleted of Ca2+ with 0.2 EGTA, 10 mM caffeine, 2 µM thapsigargin (ECT) before the addition of 0.3 nM CRF in medium containing Ca2+, Co2+, and Ba2+ to reach 2 mM final concentration. Data are means ± SEM from quadruplicates representative of two experiments. *, P < 0.05 when compared with the increment of cAMP above the respective basal in the 2 mM Ca2+ group, one-way ANOVA followed by Dunnetts test.
|
|
Specificity of the action of Ca2+ was analyzed in cells incubated in 0.2 mM EGTA, 10 mM caffeine, and 2 µM thapsigargin to avoid displacement of significant amounts of Ca2+ by Co2+ and Ba2+ which have much higher affinities for EGTA. In the presence of PDE-I the inhibitory effect of Ca2+ was mimicked by Co2+ but not by Ba2+ (Fig. 5B
).
AC Isotype Expression and Localization in Rat Adenohypophysis
The data presented so far indicated the involvement of Ca2+-inhibited and protein kinase C-stimulated ACs in the response to CRF and AVP. RT-PCR with primers that amplify ACV and ACVI yielded the expected 1095-bp product, which was cleaved by restriction enzymes in a pattern that indicated the presence of ACVI but not of ACV in rat adenohypophysis (Fig. 6
). The expression of ACVII was also observed with RT-PCR (Fig. 6
; GenBank accession no. AF542508).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 6. Analysis of AC mRNA Expression in Rat Adenohypophysis by RT-PCR
A, RT-PCRs with common primers for ACV and ACVI and restriction digests of the PCR products were carried out as described by Premont et al. (55 ). Agarose gel chromatogram of PCR/restriction digest products from rat adenohypophysis (lanes 1, 3, 5, and 7) and brain (lanes 2, 4, 6, and 8). PCR products were digested with XhoI (lanes 1 and 2), SacI (lanes 5 and 6), or both enzymes (lanes 3 and 4). Undigested PCR products are shown in lanes 7 and 8. The positions of standards (bp) are shown in the extreme left and right lanes (m). Upper arrow indicates 1095-bp product derived from ACV mRNA digested by SacI to yield fragments of 220 bp and 875 bp (middle arrow); 1095-bp ACVI product remains undigested. Digestion with XhoI yields fragments of 300 bp and 795 bp (lower arrow) from the ACVI-derived PCR product but does not cut that derived from ACV. B, Agarose gel chromatogram of the PCR product for ACVII using unique sequence-specific primers; the amplified segment was subcloned, sequenced, and verified as ACVII.
|
|
In situ hybridization revealed diffuse positive labeling for ACII (Fig. 7
), as well as ACIX (Fig. 7
), in the adenohypophysis. Ribonuclease (RNase) protection assays showed a strong signal for both ACII and ACIX (Fig. 7
). Immunohistochemical staining showed that ACIX was widely expressed in the adenohypophysis and was found in all ACTH-immunopositive cells (Fig. 8
). In contrast, ACII (Fig. 8
), as well as ACVI, were completely segregated from ACTH. No discernible positive signal could be obtained with the antibody against ACVII in pituitary or brain tissue (data not shown).

View larger version (101K):
[in this window]
[in a new window]
|
Figure 7. Expression of ACII and ACIX mRNAs in Rat Adenohypophysis
In situ hybridization with 35S-labeled antisense (A) and sense (B) riboprobes for ACII indicating specific mRNA labeling in the anterior lobe. C, RNase protection assay with 32P-labeled ACII probe (330 bp). Lanes 1 and 2, skeletal muscle; lanes 3 and 4, adenohypophysis; lanes 5 and 6, hypothalamus. D, In situ hybridization with 35F-labeled antisense and (E) sense riboprobes for ACIX indicating specific mRNA labeling in the anterior lobe. F, RNase protection assay with 32P-labeled AC9 probe (356 bp) and a 220-bp ß-actin probe in both lanes. Each probe produced a single protected radiolabeled band.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 8. Localization of AC Expression In Corticotrope Cells by Indirect Immunofluorescence
Affinity-purified antibodies against ACII, V/VI, and IX were reacted with free-floating sections of rat adenohypohysis. The reaction for ACs was detected with secondary antibodies conjugated to Alexa 488 dye, ACTH was visualized with Alexa 546 conjugates. The bar represents 20 µm. Note widespread expression of ACIX and its colocalization with ACTH. No colocalization with ACTH was apparent for ACII or ACV/VI.
|
|
 |
DISCUSSION
|
|---|
These data show that in rat anterior pituitary corticotropes the CRF-induced cAMP response is under feedback inhibition by intracellular free Ca2+ primarily derived from intracellular stores sensitive to ryanodine and caffeine. AVP, the physiologically relevant cohormone of CRF, modulates Ca2+ feedback by shifting cAMP synthesis toward a Ca2+-independent pathway, thereby markedly enhancing the cAMP response.
Nature of the Ca2+ Feedback Signal
CRF triggers an increase of [Ca2+]i through cAMP in corticotropes (1, 9). Hence, the inhibition of cAMP accumulation by [Ca2+]i constitutes a negative feedback effect. In contrast, previous work carried out in cultured rat anterior pituitary cells suggested that Ca2+ is a necessary cofactor for CRF-induced cAMP synthesis (18). However, this conclusion was derived from cells extensively treated with the ionophore A23187, which may lead to mitochondrial Ca2+ leakage and thus impairment of oxidative metabolism (e.g. see Ref.22).
Acute reduction of extracellular Ca2+ entry produced no change in CRF-induced cAMP responses, while treatment with 2 mM EGTA, caffeine, and thapsigargin had marked effects. Previously, Abou-Samra et al. (18) reported that intracellular Ca2+ stores contributed to the secretagogue action of CRF, but at the time these pools were not identified. An inositol-1,3,5-triphosphate receptor-operated intracellular Ca2+ store is functional in pituitary corticotropes (reviewed in Refs.1 and10). A RyR-operated store has not been previously reported, although caffeine is a well established stimulus for ACTH release (23). Moreover, mRNAs for RyR type 2 and type 3 are abundant in rat adenohypophysis (24). In smooth muscle cells, the RyR system is known to play a prominent role in the regulation of Ca2+-activated membrane proteins such as ion channels (25), while the control of RyR stores in nonmuscle cells is not well characterized. All RyR isotypes are capable of Ca2+-induced Ca2+ release. Furthermore, the type 2 receptor is sensitized to Ca2+ by cAMP-dependent phosphorylation (reviewed in Ref.26). The present data suggest that the stimulation of protein kinase A by CRF may be sufficient to activate the RyR-operated store, e.g. by amplification of spontaneous Ca2+ sparks (25). Another possibility, that of activation of RyR through dihydropyridine-sensitive channels (26), seems unlikely as nifedipine had no significant effect on cAMP production evoked by CRF.
The Ca2+ control of CRF-induced cAMP appeared redundant: upon the depletion of intracellular Ca2+ stores, CRF- as well as CRF/AVP-induced cAMP was effectively suppressed by Ca2+ added to the extracellular fluid. The mode of entry of Ca2+ that controls cAMP synthesis was not addressed in detail, as this was beyond the power of resolution of the experimental system. Previous work suggests that voltage-regulated (15, 27, 28) as well as capacitative Ca2+ entry (29, 30), i.e. that evoked by the depletion of intracellular Ca2+ stores, may control cAMP synthesis in a variety of systems.
The action of Ca2+ to inhibit cAMP synthesis appeared specific. Co2+, which is known to be taken up by cells via capacitative Ca2+ entry mechanisms (31), and to mimic some of the biological actions of Ca2+ (32, 33) suppressed CRF-induced cAMP synthesis. In contrast, Ba2+ was ineffective, which is consistent with the general view that Ba2+ does not readily replace Ca2+ as an effector in biological systems, including the inhibition of ACs (34).
In sum, the primary source of Ca2+ for the regulation of cAMP levels appears to be a RyR-operated intracellular Ca2+ pool. If this pool is depleted, Ca2+ entry mechanisms may also provide a negative feedback signal to secretagogue-induced cAMP synthesis.
Targets of Ca2+ Feedback in Cells Exposed to Physiological Concentrations of CRF
The effects of Ca2+ on CRF-induced cAMP accumulation were prominent in the presence of PDE blockers, indicating that Ca2+ inhibits CRF-activated AC in corticotrope cells. Currently, there are no examples of Ca2+ inhibition of CRF-Gs-AC coupling, whereas inhibition of ACs by Ca2+ is well established (29, 35). Here we have demonstrated the expression of mRNAs for the Ca2+-inhibited ACs, ACVI and ACIX in the rat anterior pituitary gland, also reported in sheep (36). Furthermore, immunocytochemical analysis indicated the presence of ACIX but not ACVI in corticotropes. Others (37) have reported that the activity of AC in rat anterior pituitary membranes is strongly inhibited by submicromolar Ca2+. Both ACVI (29) and ACIX (38) are inhibited by 0.11 µM Ca2+ and [Ca2+]i levels in CRF-stimulated corticotropes are within this range (39, 40).
A further possible mode of Ca2+ negative feedback action on cAMP is the stimulation of cAMP hydrolysis. Approximately 70% of the total PDE activity in the adenohypophysis is Ca2+/calmodulin activated (20, 41) and consists of both low Km (
1.5 µM) and high Km (
50 µM) species. Based on studies with various inhibitors of PDE (20), it would appear that high Km, Ca2+-activated PDE is active only during stimulation by CRF and AVP. Work in GH3 pituitary tumor cells indicates that low Km Ca2+-activated PDEs (PDE1C) may be important for basal cAMP levels (42). These enzymes are expressed in the rat adenohypophysis (20); however, there is no compelling evidence for a major involvement of Ca2+-activated PDEs in the response to physiological levels of CRF.
Taken together, the main target of Ca2+ feedback inhibition upon activation by physiological concentrations of CRF appears to be ACIX (Fig. 9A
).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 9. Schematic Summary of the Effects of AVP and Ca2+ on CRF-Induced cAMP Responses in Adenohypophysial Corticotrope Cells
A, CRF signaling at physiological concentrations of the neurohormone. Note that the main mode of Ca2+ feedback (in thick line) is the inhibition of AC. Whether this is a direct action of Ca2+ on the enzyme or is mediated by other factors remains to be investigated. B, Switch of Ca2+ feedback by AVP. Note functionally coordinated effects of AVP to activate ACVII and to suppress the Ca2+-inhibited AC as well as the Ca2+-activated PDE. As a result, the rate of cAMP synthesis is increased, and the main avenue of Ca2+ feedback is through Ca2+-activated PDE (PDE1A). CRF1 R, CRF1 type receptor; AVP1ßR,V1ß receptor; PLCß, Phopholipase Cß3b; P*ACVII, phosphorylated adenylyl cyclase VII; IP3, inositol 1,3,5 trisphosphate; ACIX, adenylyl cyclase IX; PDE1, type 1, Ca2+/calmodulin-activated cyclic nucleotide phosphodiesterase; PDE4, type 4, cAMP-specific cyclic nucleotide phosphodiesterase; IP3R, IP3 receptor; Kinase A, cAMP-dependent protein kinase; Kinase C, Ca2+-independent, phorbol-ester activated protein kinase C; CiCr, Ca2+-induced Ca2+ release from intracellular stores.
|
|
Modulation of Ca2+ Feedback Inhibition of cAMP Synthesis by AVP
AVP augmented CRF-induced cAMP accumulation in the presence of PDE blockers and had no detectable effects on basal cAMP in the presence or absence of PDE blockers. This confirms previous reports (12, 14) showing that, in corticotrope cells, AC is a coincidence detector for the simultaneous activation of Gs
and protein kinase C by CRF and AVP, respectively. Indeed, mRNA for both ACII and ACVII, ACs that are stimulated by protein kinase C in the context of activation by Gs
, is expressed in rat adenohypophysis (Refs.36 and43 and present study). The potentiation of the cAMP response by AVP and PdBu was prominent in Ca2+-depleted cells, suggesting the involvement of a Ca2+-independent and phorbol ester-activated form of protein kinase C, such as
or
, which are prominently expressed in rat adenohypophysis (44, 45). Human erythroid progenitor cells, which express predominantly ACVII, show a similar potentiation of cAMP synthesis by Ca2+-independent, phorbol ester-activated protein kinase C (46). As ACII protein was not found in corticotrope cells, it is reasonable to suggest that ACVII is the AC activated by the combination of physiological concentrations CRF and AVP, and by supraphysiological (>1 nM) concentrations of CRF.
The reduction of the effect of AVP on CRF-induced cAMP formation in the presence of PDE blockers observed in the present study is consistent with the inhibition of high Km PDE activity by AVP observed previously (12). The cAMP concentration in corticotrope cells exposed to high physiological levels of CRF/AVP was approximately 100200 µM, which is in the range of high Km, high-capacity, Ca2+-activated PDEs (47). Indeed, this type of PDE constitutes close to 70% of cAMP-hydrolyzing activity in the adenohypophysis (41) and is likely to be PDE1A or a closely related enzyme (20). In the presence of PDE blockers, Ca2+ control of cAMP was blocked by PdBu activation of protein kinase C or supraphysiological AVP concentrations. In the absence of PDE inhibitors, Ca2+ depletion still markedly enhanced the cAMP response at all AVP concentrations tested. Hence, the data indicate that the predominant mode of operation of Ca2+ feedback is switched by AVP from the inhibition of ACIX to the activation of high Km PDE (Fig. 9
, A and B). Intriguingly, AVP also appears to suppress the activity of the same PDE, leading to a functionally concerted and highly effective augmentation of intracellular cAMP levels. Whether or not there are intracellular gradients of cAMP (48, 49) in corticotropes, and what the physiological target(s) of 100 µM cAMP may be, remains to be investigated.
Implications for Physiological Control
The present data conform to a model incorporating Ca2+-inhibited ACIX, protein kinase C-activated ACVII, and high-Km, high-capacity PDE (Fig. 9
, A and B). The Ca2+-inhibited component of the CRF-induced cAMP response appeared to saturate between 0.3 nM and 1 nM CRF. Thus, it is reasonable to hypothesize that at physiological concentrations (i.e.
0.3 nM) of CRF, ACIX is predominant and ACVII is only weakly activated (Fig. 9A
). Under these conditions, PDE4 is important for cAMP hydrolysis and no evidence for the involvement of high-Km, Ca2+-activated PDE was apparent (20). Activation of protein kinase C stimulates ACVII; thus, in the presence of AVP, ACVII would emerge as the dominant AC (Fig. 9B
). A further mechanism that would facilitate the switch to Ca2+-independent cAMP synthesis through ACVII is that activation of protein kinase C inhibits the activation of ACIX by Gs-coupled receptors (50).
The concentrations of CRF (0.3 nM) and AVP (0.32 nM) used in the present study approximate the physiological levels in the hypophysial portal blood of animals subjected to various forms of stress (reviewed in Refs.1 and51). The intracellular cAMP response is a major determinant of the efficiency of glucocorticoid inhibition at the pituitary gland (52), which is the main site of action of the synthetic glucocorticoid dexamethasone (53) and is also significant for physiological control by endogenous corticosteroids. The present study shows that functionally concerted actions of AVP through protein kinase C produce a rapid switch in the cAMP biosynthetic pathway. An escape of cAMP biosynthesis from Ca2+-negative feedback inhibition ensues, which is made possible by the molecular diversity of cAMP signaling proteins expressed in corticotrope cells. The main physiological consequence is the resistance of ACTH release to glucocorticoid feedback inhibition (52).
 |
MATERIALS AND METHODS
|
|---|
Reagents
Unless stated otherwise, all reagents were of the highest analytical grade available. Rat/hCRF and AVP were from Bachem (Saffron Walden, UK); bis-indolyl maleimide I, PdBu, thapsigargin, and ryanodine (technical grade 96+%) were supplied by LC Laboratories, Alexis Corp., Nottingham, UK); IBMX and caffeine were from Sigma-Aldrich Corp. (Poole, Dorset, UK); and rolipram was provided courtesy of Schering AG (Berlin, Germany). BAPTA/AM, BCECF/AM, and FURA2/AM were from Calbiochem-Novabiochem (Nottingham, UK).
Rat Anterior Pituitary Cells
Isolated cells were prepared by tryptic digestion from the anterior pituitary glands of male Wistar rats (150200 g body weight) and preconditioned for 23 h in Hanks balanced salt solution (HBSS) without Mg2+ and Ca2 (HBSS+, Life Technologies, Inc., Paisley, UK) supplemented with HEPES (pH 7.4), 2 mM CaCl2, and 1 mM MgSO4 0.25% BSA as previously described (20). Subsequently the cells were sedimented by centrifugation, resuspended, counted in a hematocytometer, and diluted 10-fold or greater with low Ca2+ medium [HBSS with 2 mM EGTA, 1 mM MgSO4, 25 mM HEPES (pH 7.4), 0.25% wt/vol BSA] or the same medium containing 4 mM CaCl2 as required by the experiment. Aliquots (50 µl) of the cell suspension (0.61 x 106 cells/ml) were distributed into conical polypropylene RIA microvials (Sarstedt, Leicester, UK) in 96-well format and incubated in a water bath at 37 C.
Ca2+ Depletion Protocols and the Measurement of cAMP in Intact Cells
Depletors/blockers of intracellular Ca2+ stores or acetoxymethyl-esters (BAPTA-AM, FURA2-AM, and BCECF-AM) were added in 50 µl at the start of preincubation, as indicated in the text and figure legends. The drugs used to modify intracellular Ca2+ handling were caffeine, an activator of RyR, ryanodine, a blocker of RyRs, and thapsigargin, an inhibitor of intracellular Ca2+-ATPases that refill RyR and inositol-1,3,5-triphosphate receptor-operated Ca2+ stores. The two latter drugs were dissolved in ethanol; hence, vehicle controls were used as appropriate (0.10.3% vol/vol ethanol). Caffeine, because it has PDE inhibitor activity, was applied only in the presence of blockers of cyclic nucleotide PDEs. Overall, when combined with 2 mM EGTA and 2 µM thapsigargin in the presence of PDE blockers, caffeine or ryanodine produced similar changes of cAMP levels.
Aliquoted cells were preincubated in 100 µl of medium for 30 min. Unless indicated otherwise, blockers of PDE (1 mM IBMX and 0.1 mM rolipram) were introduced after 20 min of preincubation in a volume of 10 µl. The only exception to this pattern was when the effects of acutely applied modified low Ca2+ medium containing 0.2 instead of 2 mM EGTA were assessed, in which case the cells received PDE blockers immediately upon resuspension in the incubation medium.
After 30 min of preincubation, agonists dissolved in 2 mM or low Ca2+ medium were added in 50 µl volume. The pH of this solution was 7.65 to minimize the change of pH upon mixing with 2 mM EGTA; a pH shift from 7.407.29 occurred upon achieving a free Ca2+ concentration of 2 mM. This protocol was modified when the effects of Ba2+ and Co2+ were compared with those of Ca2+, as these divalent cations potently displace Ca2+ from EGTA. Hence, cells were incubated for 20 min under Ca2+-depleting conditions and subsequently pelleted by centrifugation at 200 x g for 5 min. Resuspension and all other additions were in modified low Ca2+ medium with 30 µM ryanodine and 2 µM thapsigargin. Ca2+ and other divalent cations were added assuming that 0.2 mM EGTA was present.
Incubation with agonists continued for 8 min unless indicated otherwise. An equal volume (160 µl) of 0.2 M HCl was added to terminate the reaction. Total cAMP levels were measured by RIA upon freeze-thawing and acetylation (15). More than 90% of the cAMP content was associated with the cells under these conditions, both in the presence and the absence of PDE blockers.
RNAse Protection Assay
Total tissue RNA was prepared using Trizol reagent (Life Technologies, Inc., Paisley, UK) according to the manufacturers instructions. The general solution hybridization method and reagents were as provided in kit form by Ambion, Inc. (Austin, TX). ACIX mRNA was detected using a probe transcribed from rat ACIX cDNA (Paterson, J. M., unpublished) corresponding to nucleotides 11071450 of the mouse ACIX cDNA (GenBank accession no. Z50190) and subcloned into pcDNA3. The riboprobe for ACII was transcribed from cDNA corresponding to nucleotides 17552106 of the rat ACII cDNA (GenBank M80550, courtesy of Dr. R. R. Reed, John Hopkins University, Baltimore, MD), which was subcloned into pcDNA3 (Invitrogen, San Diego, CA) by standard procedures (54). 32P-labeled sense and antisense riboprobes were synthesized using the requisite RNA polymerases. 32P-labeled ß-actin (220 bp) cRNA probe was also prepared and used as control for sample loading according to the manufacturers instructions.
In Situ Hybridization
Plasmids described above for RNase protection assay were transcribed with the requisite RNA polymerases to generate 35S-UTP-labeled sense and antisense strand riboprobes according to standard procedures (54). The radiolabeled riboprobes were used for in situ hybridization histochemistry on 15-µm sections of rat pituitary gland as previously described (38). The sections were autoradiographed on Kodak x-ray film (Eastman Kodak Co., Rochester, NY) for 518 d at -70 C.
RT-PCR
Total RNA was prepared from brains and pituitary glands of male Wistar rats and reverse transcribed as previously reported (15). The PCR reaction and restriction enzyme analysis of the products for ACV and ACVI were as described by Premont et al. (55). Primers for rat ACVII were: forward, GAAGAAGTTCAAGAAGGAGC; and reverse, AATCACTCCAGCAATCACAGGC. PCR was carried out as previously reported (15) and the product was subcloned into pGEM-T and sequenced in an automated DNA sequencer (Microsynth A.G., Balgach, Switzerland).
Immunocytochemistry
Male Wistar rats (200300 g body weight) were perfused transcardially with 4% freshly depolymerized paraformaldehyde in 0.1 M sodium phosphate, pH 7.4. The pituitary gland was removed from the skull and postfixed overnight at 4 C. Subsequently the tissue was placed in 15% and then 30% sucrose in PBS for cryoprotection. Transverse, 60- to 90-µm- thick sections were cut on a cryostat, collected, and processed for immunocytochemistry as free floating sections (56). Primary antisera were as follows: chicken antibodies directed against the C terminus of ACIX (38) were purified from egg-yolk extracts on antigen peptide coupled to Sepharose 4B by differential desorption (57) and used at 1:200 to 1:500 dilution. Affinity-purified rabbit antibodies against rat ACII (lots J105 and L227, used at 1:300), human ACVII (lot K070 used up to 1:50), and rat ACV/VI (lot I 110, 1:400) and their respective antigen peptides were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). C-terminally directed mouse anti-ACTH monoclonal antibody (clone CBL56) was purchased from Cymbus Biotech (Chandlers Fords, Hants, UK) and used at 1:1000. Affinity-purified secondary antibodies raised against rabbit or mouse IgG in goat, and coupled to Alexa 488 and 598 fluorescent dyes, respectively, were from Molecular Probes, Inc. (Eugene, OR) and used at 1:300-fold dilution. Sections were mounted on glass slides coated with polylysine (Merck & Co., Inc.), covered with Permafluor (Beckman Coulter, Inc., High Wycombe, Buckinghamshire, UK) and viewed in a E600FM Eclipse microscope (Nikon, Melville, NY) equipped with a Radiance 2000 confocal headstage (Bio-Rad Laboratories, Inc., Hercules, CA) at 10x and 40x (oil immersion) magnifications. Image acquisition was adjusted by the Lasersharp software (Bio-Rad Laboratories, Inc.), so that no cross-talk between the green and red detection channels was apparent. The specificity of each of the primary sera was verified by preabsorption with the respective peptide antigens at 5 µM for commercial antibodies and 10 µM for chick anti-ACIX for 16 h at 4 C before application to the sections; secondary antibody specificities were also verified in reactions where one or both of the primary antibodies were omitted.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. K. J. Catt and A. Baukal (National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD) for cAMP antiserum; Dr. R. R. Reed (Baltimore, MD) for the AC-II cDNA; Dr. H. Wachtel (Berlin, Germany) for the gift of rolipram; Mrs. Susan S. Smith and Mr. O. C. Grace for technical assistance; and Mr. A. Thomson (Medical Research Council Cooperative Group on Synaptic Plasticity, Edinburgh) for support with confocal microscopy.
 |
FOOTNOTES
|
|---|
This work was supported by the Medical Research Council.
1 Present address: Department of Neurology, Columbia University, New York, New York. 
2 Present address: Organon Ltd., Newhouse, Scotland, United Kingdom. 
3 Present address: Laboratory of Molecular Physiology, University of Edinburgh, Edinburgh, Scotland, United Kingdom. 
Abbreviations: AC, Adenylyl cyclase; AVP, arginine vasopressin; BAPTA-AM, 1,2-bis-(o-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid tetra-(acetoxymethyl)-ester; BCECF-AM, 2',7'-bis-(carboxymethyl)-5(6'-carboxyfluorescein acetoxymethyl ester; [Ca2+]i, intracellular free Ca2+; CRF, corticotropin-releasing factor; FURA2-AM, 1-[2-(5-carboxyoxazole-2-yl)-6-aminobenzofuran-5-oxy]-2-(2'-amino-5'methylphenoxy)-ethane-N,N,N'N'-tetraacetic acid pentaacetoxymethyl ester; HBSS, Hanks balanced salt solution; IBMX, 3-isobutyl-1-methylxanthine; PdBu, phorbol-dibutyrate ester; PDE, phosphodiesterase; RNase, ribonuclease; RyR, ryanodine receptor.
Received for publication November 6, 2002.
Accepted for publication January 6, 2003.
 |
REFERENCES
|
|---|
- Antoni FA 1993 Vasopressinergic control of anterior pituitary adrenocorticotropin secretion comes of age. Front Neuroendocrinol 14:76122[CrossRef][Medline]
- Dallman MF, Akana SF, Scribner KA, Bradbury MJ, Walker CD, Strack AM, Cascio CS 1992 Stress, feedback and facilitation on the hypothalamo-pituitary-adrenal axis. J Neuroendocrinol 4:517526[CrossRef]
- Sapolsky RM, Romero LM, Munck AU 2000 How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocr Rev 21:5589[Abstract/Free Full Text]
- Engler D, Redei E, Kola I 1999 The corticotropin-release inhibitory factor hypothesis: a review of the evidence for the existence of inhibitory as well as stimulatory hypophysiotropic regulation of adrenocorticotropin secretion and biosynthesis. Endocr Rev 20:460500[Abstract/Free Full Text]
- Sarlis NJ, Chowdrey HS, Stephanou A, Lightman SL 1992 Chronic activation of the hypothalamo-pituitary-adrenal axis and loss of circadian rhythm during adjuvant-induced arthritis in the rat. Endocrinology 130:17751779[Abstract/Free Full Text]
- MacPhee IAM, Antoni FA, Mason DW 1989 Spontaneous recovery of rats from experimental allergic encephalomyelitis is dependent on regulation of the immune system by endogenous adrenal corticosteroids. J Exp Med 169:431445[Abstract/Free Full Text]
- Thrivikraman KV, Nemeroff CB, Plotsky PM 2000 Sensitivity to glucocorticoid-mediated fast-feedback regulation of the hypothalamic-pituitary-adrenal axis is dependent upon stressor specific neurocircuitry. Brain Res 870:87101[CrossRef][Medline]
- DeSouza EB 1995 Corticotropin-releasing factor receptorsphysiology, pharmacology, biochemistry and role in central-nervous-system and immune disorders. Psychoneuroendocrinology 20:789819[CrossRef][Medline]
- Ritchie AK, Kuryshev YA, Childs GV 1996 Corticotropin-releasing hormone and calcium signaling in corticotropes. Trends Endocrinol Metab 7:365369[CrossRef][Medline]
- Aguilera G, Rabadan-Diehl C 2000 Vasopressinergic regulation of the hypothalamic-pituitary-adrenal axis: implications for stress adaptation. Regul Pept 96:2329[CrossRef][Medline]
- Gillies GE, Linton EA, Lowry PJ 1982 Corticotropin releasing activity of the new CRF is potentiated several times by vasopressin. Nature 299:355357[CrossRef][Medline]
- Abou-Samra A-B, Harwood JP, Manganiello VC, Catt KJ, Aguilera G 1987 Phorbol 12-myristate 13-acetate and vasopressin potentiate the effect of corticotropin-releasing factor on cyclic AMP production in rat anterior pituitary cells. J Biol Chem 262:11291136[Abstract/Free Full Text]
- Giguère V, Labrie F 1982 Vasopressin potentiates cyclic AMP accumulation and ACTH release induced by corticotropin-releasing factor (CRF) in rat anterior pituitary cells. Endocrinology 111:17521754[Abstract/Free Full Text]
- Carvallo P, Aguilera G 1989 Protein kinase C mediates the effect of vasopressin in pituitary corticotrophs. Mol Endocrinol 3:19351943[Abstract/Free Full Text]
- Antoni FA, Barnard RJO, Shipston MJ, Smith SM, Simpson J, Paterson JM 1995 Calcineurin feedback inhibition of agonist-evoked cAMP formation. J Biol Chem 270:2805528061[Abstract/Free Full Text]
- Shipston MJ, Kelly JS, Antoni FA 1996 Glucocorticoids block protein kinase A inhibition of calcium-activated potassium channels. J Biol Chem 271:9197200[Abstract/Free Full Text]
- Antoni FA 1996 Calcium checks cyclic AMPmechanism of corticosteroid feedback in adenohypophysial corticotrophs. J Neuroendocrinol 8:659672[CrossRef][Medline]
- Abou-Samra A-B, Catt KJ, Aguilera G 1987 Calcium-dependent control of corticotropin release in rat anterior pituitary cell cultures. Endocrinology 121:965971[Abstract/Free Full Text]
- Landfield PW, Eldridge JC 1994 Evolving aspects of the glucocorticoid hypothesis of brain aging: hormonal modulation of neuronal calcium homeostasis. Neurobiol Aging 15:579588[CrossRef][Medline]
- Ang KL, Antoni FA 2002 Functional plasticity of cyclic AMP hydrolysis in rat adenohypophysial corticotroph cells. Cell Signal 14:445452[CrossRef][Medline]
- Antoni FA, Dayanithi G 1990 Evidence for distinct glucocorticoid and guanine 3',5' monophosphate effected inhibition of secretagogue stimulated ACTH release in vitro. Endocrinology 126:13551360[Abstract/Free Full Text]
- Kristal BS, Dubinsky JM 1997 Mitochondrial permeability transition in the central nervous system: induction by calcium cycling-dependent and -independent pathways. J Neurochem 69:524538[Medline]
- Marzouk HF, Zuyderwijk J, Uitterlinden P, van Koetsveld P, Blijd JJ, Abou-Hashim EM, el-Kannishy MH, de Jong FH, Lamberts SW 1991 Caffeine enhances the speed of the recovery of the hypothalamo-pituitary-adrenocortical axis after chronic prednisolone administration in the rat. Neuroendocrinology 54:439446[Medline]
- Sundaresan S, Weiss J, Bauer-Dantoin AC, Jameson JL 1997 Expression of ryanodine receptors in the pituitary gland: evidence for a role in gonadotropin-releasing hormone signaling. Endocrinology 138:20562065[Abstract/Free Full Text]
- Nelson MT, Cheng H, Rubart M, Santana LF, Bonev AD, Knot HJ, Lederer WJ 1995 Relaxation of arterial smooth-muscle by calcium sparks. Science 270:633637[Abstract/Free Full Text]
- Zucchi R, Ronca-Testoni S 1997 The sarcoplasmic reticulum Ca2+ channel/ryanodine receptor: modulation by endogenous effectors, drugs and disease states. Pharmacol Rev 49:151[Abstract/Free Full Text]
- Yu HJ, Ma H, Green RD 1993 Calcium entry via L-type calcium channels acts as a negative regulator of adenylyl cyclase activity and cyclic AMP levels in cardiac myocytes. Mol Pharmacol 44:689693[Abstract]
- Fagan KA, Graf RA, Tolman S, Schaack J, Cooper DM 2000 Regulation of a Ca2+-sensitive adenylyl cyclase in an excitable cell. Role of voltage-gated vs. capacitative Ca2+ entry. J Biol Chem 275:4018740194[Abstract/Free Full Text]
- Cooper DMF, Karpen JW, Fagan JW, Mons NE 1998 Ca2+-sensitive adenylyl cyclases. Adv Second Messenger Phosphoprotein Res 32:2352[Medline]
- Watson EL, Wu ZL, Jacobson KL, Storm DR, Singh JC, Ott SM 1998 Capacitative Ca2+ entry is involved in cAMP synthesis in mouse parotid acini. Am J Physiol 274:C557C565
- Nagy I, Pabla R, Matesz C, Dray A, Woolf CJ, Urban L 1993 Cobalt uptake enables identification of capsaicin- and bradykinin-sensitive subpopulations of rat dorsal root ganglion cells in vitro. Neuroscience 56:241246[CrossRef][Medline]
- Li HC, Chan WW 1984 Activation of brain calcineurin towards proteins containing Thr(P) and Ser(P) by Ca2+, calmodulin, Mg2+ and transition metal ions. Eur J Biochem 144:447452[Medline]
- Leinders T, Vankleef R, Vijverberg HPM 1992 Divalent-cations activate small-conductance (SK) and large-conductance (BK) channels in mouse neuroblastoma-cellsselective activation of SK channels by cadmium. Pfluegers Arch 422:217222[CrossRef][Medline]
- Fagan KA, Mons N, Cooper DM 1998 Dependence of the Ca2+-inhibitable adenylyl cyclase of C62B glioma cells on capacitative Ca2+ entry. J Biol Chem 273:92979305[Abstract/Free Full Text]
- Antoni FA 1997 Calcium regulation of adenylyl cyclaserelevance for endocrine control. Trends Endocrinol Metab 8:713
- Barrett P, Choi WS, Morris M, Morgan P 2000 A role for tyrosine phosphorylation in the regulation and sensitization of adenylate cyclase by melatonin. FASEB J 14:16191628[Abstract/Free Full Text]
- Giannattasio G, Bianchi R, Spada A, Vallar L 1987 Effect of calcium on adenylate cyclase of rat anterior pituitary gland. Endocrinology 120:26112619[Abstract/Free Full Text]
- Antoni FA, Palkovits M, Simpson J, Smith SM, Leitch AL, Rosie R, Fink G, Paterson JM 1998 Ca2+/calcineurin-inhibited adenylyl cyclase highly abundant in forebrain regions important for learning and memory. J Neurosci 18:96509661[Abstract/Free Full Text]
- Guérineau N, Corcuff J-B, Tabarin A, Mollard P 1991 Spontaneous and corticotropin-releasing factor-induced cytosolic calcium transients in corticotrophs. Endocrinology 129:409420[Abstract/Free Full Text]
- Kuryshev YA, Childs GV, Ritchie AK 1996 Corticotropin-releasing hormone stimulates Ca2+ entry through L-type and P-type Ca2+ channels in rat corticotropes. Endocrinology 137:22692277[Abstract]
- Nagasaka A, Ohkubo S, Hidaka H 1983 3'-5'-Cyclic-nucleotide phosphodiesterase in the bovine pituitary-gland. Biochim Biophys Acta 755:481487[Medline]
- Rich TC, Tse TE, Rohan JG, Schaack J, Karpen JW 2001 In vivo assessment of local phosphodiesterase activity using tailored cyclic nucleotide-gated channels as cAMP sensors. J Gen Physiol 118:6378[Abstract/Free Full Text]
- Morrill AC, Wolfgang D, Levine MA, Wand GS 1993 Stress alters adenylyl cyclase activity in the pituitary and frontal cortex of the rat. Life Sci 53:17191727[CrossRef][Medline]
- Garcia-Navarro S, Kalina M, Naor Z 1991 Immunocytochemical localization of protein kinase-C subtypes in anterior pituitary cells: colocalization in hormone-containing cells reveals heterogeneity. Endocrinology 129:27802786[Abstract/Free Full Text]
- Korytko A, Fields A, Allshouse L, Cuttler L 1998 Pituitary expression of protein kinase C isotypes during early development. J Neuroendocrinol 10:569576[CrossRef][Medline]
- Haslauer M, Baltensperger K, Porzig H 1998 Thrombin and phorbol esters potentiate Gs-mediated cAMP formation in intact human erythroid progenitors via two synergistic signaling pathways converging on adenylyl cyclase type VII. Mol Pharmacol 53:837845[Abstract/Free Full Text]
- Beavo JA 1995 Cyclic-nucleotide phosphodiesterasesfunctional implications of multiple isoforms. Physiol Rev 75:725748[Abstract/Free Full Text]
- Hempel CM, Vincent P, Adams SR, Tsien RY, Selverston AI 1996 Spatio-temporal dynamics of cyclic AMP signals in an intact neural circuit. Nature 384:166169[CrossRef][Medline]
- Jurevicius J, Fischmeister R 1996 cAMP compartmentation is responsible for a focal activation of cardiac Ca2+ channels by ß-adrenergic agonists. Proc Natl Acad Sci USA 93:295299[Abstract/Free Full Text]
- Cumbay MG, Vortherms TA, Watts VJ, Activation of PKC inhibits adenylate cyclase type IX activity. Abstracts of the 31st Annual Meeting of the Society for Neuroscience, San Diego, CA, 2001, 42.10
- Plotsky PM 1991 Pathways to the secretion of adrenocorticotropin: a view from the portal. J Neuroendocrinol 3:19
- Lim MC, Shipston MJ, Antoni FA 2002 Post-translational modulation of glucocorticoid inhibition at the pituitary level. Endocrinology 143:37963801[Abstract/Free Full Text]
- Meijer OC, de Lange EC, Breimer DD, de Boer AG, Workel JO, de Kloet ER 1998 Penetration of dexamethasone into brain glucocorticoid targets is enhanced in mdr1A P-glycoprotein knockout mice. Endocrinology 139:17891793[Abstract/Free Full Text]
- Sambrook J, Frisch EF, Maniatis T 1989 Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
- Premont RT, Chen J, Ma HW, Ponnapalli M, Iyengar R 1992 Two members of a widely expressed subfamily of hormone-stimulated adenylyl cyclases. Proc Natl Acad Sci USA 89:98099813[Abstract/Free Full Text]
- Antoni FA, Linton EA 1989 Immunocytochemical detection of corticotropin releasing-factor: multiple cross-reactions of a widely used carboxy-terminally directed CRF antiserum (rC70) in rat hypothalamus. Neuroscience 29:167174[CrossRef][Medline]
- Tsang VC, Wilkins PP 1991 Optimum dissociating condition for immunoaffinity and preferential isolation of antibodies with high specific activity. J Immunol Methods 138:291299[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. Kucka, K. Kretschmannova, T. Murano, C.-P. Wu, H. Zemkova, S. V. Ambudkar, and S. S. Stojilkovic
Dependence of Multidrug Resistance Protein-Mediated Cyclic Nucleotide Efflux on the Background Sodium Conductance
Mol. Pharmacol.,
February 1, 2010;
77(2):
270 - 279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kidd, I. M. Modlin, B. I. Gustafsson, I. Drozdov, O. Hauso, and R. Pfragner
Luminal regulation of normal and neoplastic human EC cell serotonin release is mediated by bile salts, amines, tastants, and olfactants
Am J Physiol Gastrointest Liver Physiol,
August 1, 2008;
295(2):
G260 - G272.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Hines, P. L. Hoffman, S. Bhave, L. Saba, A. Kaiser, L. Snell, I. Goncharov, L. LeGault, M. Dongier, B. Grant, et al.
A Sex-Specific Role of Type VII Adenylyl Cyclase in Depression
J. Neurosci.,
November 29, 2006;
26(48):
12609 - 12619.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Andric, T. S. Kostic, and S. S. Stojilkovic
Contribution of Multidrug Resistance Protein MRP5 in Control of Cyclic Guanosine 5'-Monophosphate Intracellular Signaling in Anterior Pituitary Cells
Endocrinology,
July 1, 2006;
147(7):
3435 - 3445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Seino and T. Shibasaki
PKA-Dependent and PKA-Independent Pathways for cAMP-Regulated Exocytosis
Physiol Rev,
October 1, 2005;
85(4):
1303 - 1342.
[Abstract]
[Full Text]
[PDF]
|
 |
|