| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Pharmaco-Biology (V.P., A.C., C.G.) and Cell Biology (A.C., S.A.), Centro Sanitario Faculty of Pharmacy (S.C.), University of Calabria 87030 Arcavacata di Rende (CS), Italy; and Department of Internal Medicine (M.Y., M.J.M.), University of Texas Southwestern Medical Center, Dallas, Texas 75235-8857
Address all correspondence and requests for reprints to: Professor Sebastiano Andò, Department of Cell Biology, University of Calabria, Arcavacata di Rende (CS) 87030, Italy. E-mail: sebastiano.ando{at}unical.it)
| ABSTRACT |
|---|
|
|
|---|
As an experimental model, we used the mouse Sertoli cell line TM4, which conserves a large spectrum of functional features present in immature Sertoli cells. For instance, after revealing the presence of aromatase by immunocytochemistry and measuring its enzymatic activity, we confirmed in this cell line the functional events previously characterized in primary cultures of immature rat Sertoli cells: 1) a strong stimulation of aromatase activity by dibutyryl-cAMP [(Bu)2cAMP] (simulating FSH action); and 2) the inhibition of aromatase activity by incubation with T3 under basal condition and after (Bu)2cAMP stimulation.
After identifying promoter II as the regulatory region located immediately upstream of the transcriptional initiation site in the TM4 cell line by rapid amplification of cDNA ends analysis, we conducted experiments to examine the molecular mechanism by which thyroid hormones modulate aromatase gene expression in this cell line. TM4 cells were transfected with plasmids containing different segments of the rat promoter II sequence ligated to a luciferase reporter gene. Analysis of the activities of these promoter fusions demonstrated that T3 inhibits basal and (Bu)2cAMP-stimulated activity of the aromatase promoter. This effect was not revealed in T3-treated cells transfected with construct in which the steroidogenic factor-1 (SF-1) response element was mutated. These results indicate that the inhibitory effect of T3 requires the integrity of the SF-1 response element and are further supported in the EMSA. The EMSA experiments demonstrated that thyroid hormone/thyroid receptor
1 complex (TH/TR
1) is able to compete with SF-1 in binding to oligonucleotides containing an SF-1 motif, an element essential for the activity of the PII aromatase promoter. The findings suggest that the binding of the thyroid hormone/thyroid receptor
1 complex to the SF-1 motif is the molecular mechanism by which T3 exerts an inhibitory effect on aromatase gene expression in the TM4 cell line.
| INTRODUCTION |
|---|
|
|
|---|
Further observations have demonstrated that estrogens play a significant role in regulating testicular functions. The importance of estrogens in regulating spermatogenesis has been supported by the progressive atrophy of seminiferous epithelium observed in estrogen receptor
knockout mice as a consequence of the alteration of fluid luminal resorption (18, 19, 20). Moreover, in primates, the long-term use of aromatase inhibitors determined defects in spermiogenesis (21). The same features have been supported by data from the characterization of mice in which the aromatase gene has been disrupted (22, 23).
Aromatase expression appears to be regulated by tissue-specific promoters (24, 25, 26, 27). A promoter proximal to the translation start site, called promoter II (PII) (28, 29), regulates the expression of P450arom in ovaries of several species, in fetal gonads (30), and in two rat Leydig tumor cells (R2C and H540) (31, 32). We have demonstrated recently that PII is the principal promoter that is active in rat Sertoli, Leydig, and germ cells (33).
Aromatase activity and estrogen receptor content were dramatically enhanced in immature Sertoli cells prepared from hypothyroid rats (34). Hormone replacement with T3 shortened Sertoli cell replication markedly (35) and reduced both aromatase activity (36) and estrogen receptor content dramatically (37). On the basis of the latter data, it was reasonable to postulate that T3 regulates negatively a short autocrine loop by which estradiol production in situ sustains the mitogenic activity of prepubertal Sertoli cells (38).
Our recent findings have defined at least two mechanisms involved in the down-regulatory effect of T3 on aromatase activity expressed in prepubertal Sertoli cells: the first one represented by the induction of altered transcripts coding for truncated and inactive aromatase proteins; the second one linked to a direct modulator role of T3 in regulating aromatase gene transcription (39, 40).
In the present study, we have shown in the mouse Sertoli cell line, TM4, the molecular mechanism by which thyroid hormone modulates the activity of PII of the rat aromatase gene. Functional studies and EMSA indicate that thyroid hormone/thyroid receptor
1 competes with steroidogenic factor 1 (SF-1) binding to the AGGTCA motif that is necessary for the activity of the PII aromatase promoter. The binding of TH/TR
1 to the SF-1 response element (SF-1 RE) is the molecular mechanism by which T3 produces an inhibitory effect on aromatase gene expression in TM4 Sertoli cells.
| RESULTS |
|---|
|
|
|---|
|
Identification of Aromatase Gene Promoter in TM4 Cells
To investigate the mechanism of action of T3 on aromatase expression, we have focused our attention on the structure of the aromatase gene promoter in TM4. Recently, we demonstrated that the promoter located immediately upstream of the site of transcriptional initiation (PII) directs the expression of aromatase mRNA in prepubertal rat Sertoli cells (33). Using rapid amplification of cDNA ends (RACE) analysis, we amplified the 5'-ends of the aromatase mRNA expressed in TM4 cells to identify the structure of aromatase gene promoter in this cell line. As a positive control, we used the R2C rat Leydig tumor cell line, in which initiation of transcription of aromatase mRNA occurs approximately 100 nucleotides upstream of the initiator methionine (31). RACE analysis of R2C RNA identified a single predominant band approximately 250 nucleotides in length. Using the same method of analysis, a band of similar size was identified in TM4 cells. Southern analysis, performed with the aromatase-specific probe AS3, and subsequent sequence analysis of the fragment confirmed that in TM4 the transcript identified was derived from the promoter immediately upstream of the site of translational initiation (PII) (data not shown).
TR
1 is the Functional TR Isoform Expressed in TM4 Cells
Before exploring more closely the possible binding of the TH/TR complex to SF-1 RE and the role of this binding in modulating PII activity, we set out to determine which functional TR(s) isoform was present in TM4 cells. By Western blot analysis we demonstrated the presence of TR
1 protein, in the nuclear extracts of TM4 cells, using a specific antibody against a recombinant protein corresponding to the full-length TR
1 of chicken origin. We detected a band of 48 kDa that comigrated with transcribed and translated in vitro TR
1 protein used as positive control (Fig. 2A
). No band was detected using TRß1 antibody (Fig. 2B
). The same experiment was carried out for confirming expression of SF-1 protein using a specific antibody against a recombinant protein SF-1 of mouse. We detected a band of 53 kDa that comigrated with transcribed and translated in vitro SF-1 protein used as positive control (Fig. 2C
).
|
on Expression of Rat P450arom PII/Luciferase Reporter Gene Constructs in TM4 Cells
|
T3 exerts a partial inhibition of the basal promoter activity (P < 0.05) as well as upon (Bu)2cAMP stimulation (P < 0.01) in samples transfected with p-1037, p-688, and p-183 plasmids. It is worth noting that construct p-688m bearing SF-1 mutated site displays significantly lower basal activity compared with the p-688 plasmid (p-688 = 0.09 ± 0.01; p-688 m = 0.04 ± 0.01 relative light units), and the responsiveness to (Bu)2cAMP stimulation is abolished (p-688 = 0.18 ± 0.01; p-688 m = 0.06 ± 0.01 relative light units). No inhibitory effects were observed in T3-treated cells transfected with p-688m promoter fusion (Fig. 3B
). These results confirm the importance of the SF-1 binding site in the regulation of aromatase expression in the TM4 cell line and suggest that the inhibitory effect of T3 requires AGGTCA sequence motif.
This inference is further strengthened by the observation that the expression of additional SF-1 in TM4 cells reversed the down-regulatory effect of T3 on the activity of the p-688 aromatase promoter fusion (Fig. 3C
).
Moreover, cotransfection with TR
determined a significant decrease of aromatase promoter activity in all conditions tested (Fig. 4
).
|
TR
1 Protein Binds to SF-1 RE
On the basis of the evidence that the inhibitory effect of T3 on aromatase requires the crucial presence of SF-1 RE, EMSAs were performed using the SF-1 motif as probe. In the EMSA shown in Fig. 5
we focused our attention on two complexes (see arrows) obtained using nuclear extracts prepared from TM4 cells. Competition binding studies demonstrated that a 100-fold molar excess of unlabeled probe inhibited the formation of these complexes. This inhibition was not observed when a mutated SF-1 oligonucleotide was used as competitor (Fig. 5
, lane 4). Using nuclear extracts from TM4 cells pretreated with T3 does not change this pattern substantially (Fig. 5
, lane 5). The inclusion of an anti-Ad4BP (Ad4BP is the bovine homolog of SF-1) and TR
1 antibodies in the reactions attenuated drastically the specific bands drastically and resulted in the formation of supershifted complexes (Fig. 5
, lanes 69).
|
1 protein determined the presence of two bands, one comigrating at the same level of SF-1 and another one slower, probably due to a dimerization of TR
1 protein complex (Fig. 5
1 DNA binding complex were abrogated by 100-fold molar excess of unlabeled probe (data not shown). Finally the specificity of these bands was proved by the formation of supershifted complexes in the presence of anti-Ad4BP and TR
1 antibodies (Fig. 5
1 antibodies are added, were considered not specific, being still present after incubation with oligonucleotide probe containing mutated SF-1 RE (data not shown).
In the EMSA depicted in Fig. 6
, we investigated the hypothesis that TR
could compete with SF-1 for binding to the same DNA responsive element. We observed that in the presence of equal amounts (1 µl) of both transcribed and translated SF-1 and TR
1 proteins, the faster band was attenuated (Fig. 6
, lane 3) compared with in vitro translated SF-1 alone (Fig. 6
lane 2). When progressively increasing amounts (3 and 5 µl) of in vitro translated TR
protein were added, the slower band became considerably more evident (Fig. 6
, lanes 4 and 5). At the highest amount, the addition of anti-Ad4BP antibody resulted in the supershift of the faster migrating band. By contrast, the addition of anti-TR
1 antibody resulted in a supershift and a decrease in the intensity of both bands (Fig. 6
, lanes 6 and 7).
|
| DISCUSSION |
|---|
|
|
|---|
Recently we have observed that T3 at 100 nM resulted in a significant decrease of endogenous mRNA levels in prepubertal rat Sertoli cells. This was suggested by the authors as a possible mechanism through which T3 contributes to the down-regulatory effect on aromatase expression. In addition, an induction of aromatase mRNA encoding inactive aromatase proteins has been observed after prolonged treatment with T3, providing an additional mechanism through which T3 may act to inhibit aromatase activity (39, 40). The current study presents data regarding the molecular basis by which T3 leads to the inhibition of aromatase gene expression.
Distinctive promoters are employed to direct the expression of aromatase mRNA deriving from a single aromatase gene in different tissues. We have recently established that the promoter located immediately upstream of the transcriptional initiation site (PII) directs the expression of aromatase mRNA in Sertoli cells, Leydig cells, and in rat germ cells (33). Using the same experimental approach, in the present work we have demonstrated that PII of the rat aromatase gene directs aromatase expression in TM4 Sertoli cell line as well.
A number of functional motifs have been identified in the PII aromatase promoter. Two motifs resembling cAMP response elements (termed the 5'-CRE and 3'-CRE) have been identified at positions -335 and -231. Another CRE-like sequence is present at -169, but contains an extra nucleotide inserted between the second and third nucleotide (XCRE) (32). In the present study, we have demonstrated an enhanced activation of all of the aromatase promoter fusions containing the 3'- and 5'-CREs after (Bu)2cAMP stimulation, demonstrating that these regions contain elements that mediate the effects of the cAMP transduction pathway that potentiate aromatase expression and activity.
An SF-1 binding site is present in this promoter as well (at -90 relative to the start of transcription). We demonstrated by Western analysis that in TM4 cells, SF-1 is conspicuously expressed and that, in functional studies, it appears to be an important regulator of P450 aromatase. Indeed, mutagenesis or deletion of the SF-1 binding site results in a marked lowering of PII activity in basal conditions as well as after (Bu)2cAMP stimulation. These data fit with the paradigm that the SF-1 binding site plays a crucial role in controlling transcription of cytochrome P450 genes in cells of both gonadal and adrenal origin (41).
After treatment with T3, promoter fusions of the rat aromatase PII promoter display decreased activity for each of the three 5'-deleted region examined in transfected TM4 cells. In addition, the overexpression of TR
produces a significant reduction of promoter activity in basal conditions as well as upon (Bu)2cAMP stimulation. Finally, the observed inhibitory effect of T3 was abrogated when a promoter fusion containing a mutated SF-1 element was employed. These results clearly suggest that the integrity of SF-1 sequence is a prerequisite for the effect of T3 in negatively regulating aromatase promoter activity. These findings raise the possibility that TRs and SF-1 are competing for binding to a common site within this regulatory region. This inference is further supported by the observation that the inhibitory effects of thyroid hormone on the activity of the aromatase promoter fusions are not observed when SF-1 levels are increased by transfection of TM4 cells.
TRs are members of steroid/thyroid hormone receptor superfamily and are encoded by two different genes, TR
and TRß. Alternate splicing leads to the production of several peptide isoforms, five of which have been described: TR
1, TR
2, TR
3, TRß1, and TRß2 (42). It has been demonstrated that TR
1 is the only TR
isoform that is able to bind T3, and it is this isoform that is expressed in the Sertoli cells of fetal and prepubertal rats (43). The detection of only the TR
isoform in TM4 cells further reinforces the functional similarity between the two cell types. TRs can bind as monomers to the half-site consensus sequence AGGTCA or, more frequently, as dimer (44) to a TRE configured as two half-sites arranged in three different ways: 1) direct repeats separated by four nucleotides; 2) unspaced palindromes; and 3) inverted palindromes usually spaced by six nucleotides (45). Natural hormone response elements (HREs) rarely contain two perfect consensus half-sites. It has been reported that half-site sequence of HREs can deviate quite considerably from the consensus sequences, especially for dimeric HREs in which a single conserved half-site is usually sufficient to confer high-affinity binding to the homo- or heterodimer complexes (46).
Location of an AGGTCA sequence at the -90 position supports a possible binding of TR to this promoter region, which we verified by EMSA experiments. In the presence of anti-Ad4BP and anti-TR
1 antibodies, we observed supershifts of DNA binding complexes (Fig. 5
, lanes 69) demonstrating that both SF-1 and TR
1 proteins are able to bind the AGGTCA sequence located in PII.
SF-1 and TR
1 transcribed and translated in a cell-free system were used, in EMSA experiments, to better investigate the competition of these molecules for the same DNA binding site. We observed that SF-1 protein synthesized in vitro forms a single complex, which migrates at the same position as the faster migrating band observed in EMSA performed using TM4 nuclear extracts. By contrast, TR
1 protein forms two distinct complexes, one comigrating with the SF-1 complex and another displaying slightly slower mobility (Fig. 5
, lanes 10 and 12).
When we incubated similar amounts of TR
and SF-1 translated in vitro, the band corresponding to the SF-1 complexes decreased and was further attenuated as higher quantities of TR
1 were added. For instance, in the presence of an amount of TR
5-fold greater than the amount of included SF-1, the top complex was markedly increased compared with the more rapidly migrating species (Fig. 6
, lane 5). We interpret these findings to indicate that, under these conditions, the binding of TR
and SF-1 as monomeric complex (bottom complex) is somehow prevented and the binding of TR
in its dimeric form (top complex) predominates. These findings agree with a previous report (44) demonstrating that homodimerization is favored at higher TR concentrations. Consistent with this hypothesis, at higher TR
concentrations, when anti-Ad4BP antibody is added, we observed a supershift with a predominant attenuation of the faster-migrating band (Fig. 6
lane 6). When anti-TR
1 antibody is added instead, an attenuation of both bands was observed (Fig. 6
, lane 7). These data reinforce the inference that the faster band represents SF-1 and TR
binding as monomers, while the slower-migrating band represents TR
in a dimeric complex.
The mechanism by which the binding of TR to SF-1 RE results in a down-regulation of aromatase gene expression remains to be elucidated. However, in all the cases studied to date in which T3 affects a negative regulation of gene expression [e.g. down-regulation of the genes encoding the
- and ß-subunits of TSH (47, 48)], the thyroid response elements (TREs) are found to be localized close to the transcription start site. This is the circumstance in the PII aromatase promoter, where the binding of TR
to SF-1 binding site located adjacent to the transcription start site is implicated in the negative regulation of PII aromatase promoter activity. The functional role of SF-1 in controlling the activity of PII in the TM4 cell line is demonstrated by the fact that the promoter with a mutated SF-1 response exhibits an activity that is markedly inhibited under basal conditions, as well as after (Bu)2cAMP stimulation. In the intact promoter, the activity measured after treatment with thyroid hormone alone is similar to that observed in the promoter with mutated SF-1 RE. This suggests the possibility that the major inhibitory effect induced by thyroid hormone on the activity of the aromatase PII promoter is due principally to the occupancy of the SF-1 binding site by thyroid receptor, as suggested by our EMSA.
In conclusion, our findings, stemming from functional analysis and from mobility shift assays, suggest that thyroid hormone/thyroid receptor complex is able to compete with SF-1 in binding to a common sequence within the PII promoter of the rat aromatase gene. The binding of thyroid hormone/thyroid receptor complex to this sequence impairs the binding of SF-1 and serves to interfere negatively in the activity of aromatase promoter.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunocytochemical Staining
TM4 cells were cultured for 48 h on chamber slides in DMEM supplemented with bovine serum (2.5%), horse serum (5%), and antibiotics under air-CO2 (5%) atmosphere at 37 C. TM4 cells were fixed for 30 min in freshly prepared paraformaldehyde (2%). After paraformaldehyde removal, the cells were treated with hydrogen peroxide (3% in methanol) for 30 min to inhibit endogenous peroxidase activity. Cells were then incubated for a further 30 min with 15% normal goat serum to block the nonspecific binding sites. Immunocytochemical staining was performed by using a rabbit polyclonal antiserum generated against the human placental P450 aromatase (1:100, overnight at 4 C) as primary antibody (Hauptman-Woodward Medical Research Institute, Buffalo, NY), while a biotinylated goat-antirabbit IgG (1:1200 for 60 min at room temperature) was applied as secondary antibody (Vector Laboratories, Inc., Burlingame, CA). Avidin-biotin-horseradish peroxidase complex amplification was then carried out (Vector Laboratories, Inc.) for 30 min at room temperature and 3,3'-diaminobenzidine tetrachloride dihydrate (Vector Laboratories, Inc.) was used as a detection system. Cultured cells were rinsed with Tris-buffered saline (0.05 M Tris-HCl plus 0.15 M NaCl; pH 7.6) containing 0.05% Triton X-100 after each step. Control slides were assessed treating cells with the same procedure but replacing the primary antibody by normal rabbit serum at the same concentration. An absorption control was also performed by using a primary antibody preabsorbed (48 h at 4 C) with an excess (5 nmol/ml) of antigen (P450arom purified from human placenta by immunoaffinity chromatography) obtained by Hauptman-Woodward Medical Research Institute.
Aromatase Activity Assay
The aromatase activity in subconfluent TM4 cells culture medium was measured by the tritiated water release assay using 0.5 µM [1ß-3H]androst-4-ene-3,17-dione (Perkin-Elmer, Foster City, CA) as substrate (50). Incubations were performed at 37 C for 5 h under an air-CO2 (5%) atmosphere. The results obtained were expressed as fentomoles per hour and normalized to mg of protein (fmol/h/mg protein).
RNA Isolation
Total cellular RNA was extracted from TM4 and R2C cells using the Total RNA Isolation System kit (Promega Corp., Madison, WI). The purity and integrity of the RNA were checked spectroscopically and by gel electrophoresis before the analytical procedures were performed.
RACE and Southern Blot Analysis
RACE was performed to amplify 5'-ends of mRNAs extracted from TM4 and R2C cell line used as positive control, using Marathon cDNA Amplification kit (CLONTECH Laboratories, Inc., Palo Alto, CA). For the first amplification, antisense primer AS1 (5'-AGCCAGGACCTGGTATTGAAGACGAGCTCT-3', located in the exon II) was used in combination with the adapter primer. For the second, nested amplification, antisense primer, AS2 (5'-AATCAGGAGAAGGAGGCCCATGATCAGCA-3', located in the exon II) was combined with the adapter primer. The amplified products were run on 1.2% agarose gel and blotted on ZetaProbe Blotting Membranes (Bio-Rad Laboratories, Inc., Hercules, CA). The membrane was hybridized with a specific antisense oligonucleotide, AS3 (5'-ATGGCACTGACAGTCACAGTT-3') for Exon II. The oligonucleotide was labeled with [
32P]ATP using polynucleotide kinase.
Extraction from Agarose Gel and Sequencing of the P450arom RT-PCR Fragments
The RT-PCR products were extracted and purified from agarose gel by QIAquick Gel Extraction kit (Promega Corp.), subcloned into PCR 2.1 vector (TA Cloning kit, Invitrogen), and sequenced using radioactive dideoxy-chain termination method (Sequenase kit, Amersham Pharmacia Biotech, Buckinghamshire, UK).
Transfection Assay
Transient transfection experiments were performed using vectors containing different segments of the rat aromatase PII sequence ligated to a luciferase reporter gene. Progressive deletions of aromatase promoter -1037/+94 (p-1037), -688/+94 (p-688), and -183/+94 (p-183) were generated by the PCR and subcloned into the pGL2-Basic vector (Promega Corp.) as was previously described (32). Fugene 6 (Roche, Indianapolis, IN) was used as directed by the manufacturer to cotransfect cells plated in a 3.5-cm2 well with the pGL2-promoter constructs (0.5 µg/well) or cytomegalovirus (CMV) constitutively active luciferase reporter gene (0.5 µg/well). A set of experiments was performed cotransfecting p-688 vector (0.5 µg/well) and CMV SF-1 plasmid (0.5 µg/well; obtained from Dr. W. E. Rainey, University of Texas Southwestern Medical Center, Dallas, TX) or Rous sarcoma virus (RSV) TR
plasmid (0.5 µg/well) (obtained from Dr. E. A. Jannini, University of Aquila, Aquila, Italy). Empty vectors were used to ensure that DNA concentrations were constant in each transfection. TK renilla luciferase plasmid (25 ng/well) (Promega Corp.) was used to normalize the efficiency of the transfection. Empty PGL2-Basic vector was used as a control vector to measure basal activity. Twenty-four hours after transfection, the medium was changed and the cells were treated in DMEM-F12 in the presence or absence of T3 (100 nM), (Bu)2cAMP (0.5 mM), 0.5 mM (Bu)2cAMP +T3 (100 nM) for 48 h. At the end of this period, firefly and renilla luciferase activities were measured using Dual Luciferase kit (Promega Corp.). The firefly luciferase data of each sample were normalized on the basis of transfection efficiency measured by renilla luciferase activity.
Western Blot Analysis
Nuclear extracts were prepared from TM4 as previously described (51). Briefly, TM4 cells plated into 60-mm2 dishes were scraped into 1.5 ml of cold PBS. Cells were pelleted for 10 sec and resuspended in 400 µl cold buffer A (10 mM HEPES-KOH, pH 7.9, at 4 C, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonylfluoride) by flicking the tube. The cells were allowed to swell on ice for 10 min and then vortexed for 10 sec. Samples are centrifuged for 10 sec and the supernatant fraction discarded. The pellet was resuspended in 50 µl of cold Buffer C (20 mM HEPES-KOH, pH 7.9; 25% glycerol; 1.5 mM MgCl2; 420 mM NaCl; 0.2 mM EDTA; 0.5 mM dithiothreitol; 0.2 mM phenylmethylsulfonylfluoride) and incubated on ice for 20 min for high-salt extraction. Cellular debris was removed by centrifugation for 2 min at 4 C, and the supernatant fraction (containing DNA-binding proteins) was stored at -70 C. The yield was determined by the Bradford method (52). The proteins were separated on sodium dodecyl sulfate-polyacrylamide (11%) gel and then electroblotted onto a nitrocellulose membrane. The blots were incubated overnight at 4 C with 1) anti-TR
1 antibody, raised against a recombinant protein corresponding to the full-length TR
1 of chicken origin (1:1000) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), 2) anti-TRß1 antibody against the carboxyl-terminal region of the TRß1 of human origin (1:1000) (Santa Cruz Biotechnology, Inc.), 3) rabbit polyclonal antiserum against a recombinant protein SF-1 of mouse origin (1:500; Upstate Biotechnology, Inc., Lake Placid, NY). The antigen-antibody complexes were detected by incubation of the membranes at room temperature with goat antirabbit IgG coupled to peroxidase, developed using the ECL Plus Western blotting detection system (Amersham Pharmacia Biotech). In vitro transcribed and translated TR
1, TRß1, and SF-1 proteins were synthesized using T7 polymerase in the rabbit reticulocyte lysate system as directed by the manufacturer (Promega Corp.). These proteins were used as positive controls in the immunoblot and EMSA experiments. As template we used the SF-1 plasmid (obtained from Dr. W. E. Rainey), the TR
1 plasmid (from the American Type Culture Collection), and the TRß1 plasmid (from the American Type Culture Collection).
Gel Mobility Shift Assay
Nuclear extracts were prepared from TM4 as previously described (51). The probe was generated by annealing single-stranded oligonucleotides and labeled with [
32P] ATP and T4 polynucleotide kinase, and then purified using Sephadex G50 spin columns (Amersham Pharmacia Biotech). The DNA sequences used as probe or as cold competitors are the following (the nucleotide motifs of interest are underlined, mutations are shown as lower case letters): SF-1, CAGGACCTGAGTCTCCCAAGGTCATCCTTGTTTGACTTGTA; mutated SF-1, TCTCCCAAtaTCATCCTTGT. Oligonucleotides were synthesized by Sigma Genosys (Cambridge, UK). The protein binding reactions were carried out in 20 µl of buffer (20 mM HEPES, pH 8; 1 mM EDTA; 50 mM KCl; 10 mM dithiothreitol; 10% glycerol; 1 mg/ml BSA) with 50,000 cpm of labeled probe, 6 µg of TM4 nuclear protein, or 2 µl of transcribed and translated in vitro SF-1 protein or TR
1 protein and 5 µg poly (dI-dC) (Roche). The above-mentioned mixture was incubated at room temperature for 20 min in the presence or absence of unlabeled competitor oligonucleotides or transcribed and translated in vitro TR
1 protein and in the presence or absence of rabbit antiserum to Ad4BP/SF-1 (Ad4BP is the bovine homolog of SF-1) (kindly provided from Dr. K. Morohashi, National Institute for Basic Biology, myodaiji-cho, Okazaki, Japan). For experiments involving TR
1 antibody, obtained against a peptide corresponds to amino acid residues 403410 from human TR
1 (Affinity BioReagents, Inc., Golden, CO); the reaction mixture was incubated with this antibody at 4 C for 30 min after addition of labeled probe. Under the conditions employed, cross-reactivity of the TR
and SF-1 antibodies was not observed in EMSA supershift assays (data not shown). The entire reaction mixture was electrophoresed through a 6% polyacrylamide gel in 0.25x Tris borate-EDTA for 3 h at 150 V. Gels were dried and subjected to autoradiography at -70 C.
Statistical Analysis
Each data point represents the mean ± SEM of three experiments. Data were analyzed by ANOVA using the STATPAC computer program.
| ACKNOWLEDGMENTS |
|---|
plasmid, respectively, and Dr. K. Morohashi for providing us the antibody Ad4BP. | FOOTNOTES |
|---|
This work was supported by Cofin Ministero dellUniversità e della Ricerca Scientifica e Tecnologica 2001 Grant prot. N 2001063981.
Abbreviations: (Bu)2cAMP, Dibutyryl-cAMP; CMV, cytomegalovirus; CRE, cAMP response element; HRE, hormone response element; PII, promoter II; RACE, rapid amplification of cDNA ends; RSV, rous sarcoma virus; SF-1, steroidogenic factor-1; SF-1 RE, SF-1 response element; TH, thyroid hormone; TR
1, TH receptor
1; TRE, thyroid response element.
Received for publication March 8, 2002. Accepted for publication January 28, 2003.
| REFERENCES |
|---|
|
|
|---|
gene by thyroid hormone:receptor interaction adjacent to the TATA box. Proc Natl Acad Sci USA 86:91149118NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
D. Silandre, C. Delalande, P. Durand, and S. Carreau Three promoters PII, PI.f, and PI.tr direct the expression of aromatase (cyp19) gene in male rat germ cells J. Mol. Endocrinol., August 1, 2007; 39(2): 169 - 181. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhou, T. Suzuki, A. Kovacic, R. Saito, Y. Miki, T. Ishida, T. Moriya, E. R. Simpson, H. Sasano, and C. D. Clyne Interactions between Prostaglandin E2, Liver Receptor Homologue-1, and Aromatase in Breast Cancer Cancer Res., January 15, 2005; 65(2): 657 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pezzi, R. Sirianni, A. Chimento, M. Maggiolini, S. Bourguiba, C. Delalande, S. Carreau, S. Ando, E. R. Simpson, and C. D. Clyne Differential Expression of Steroidogenic Factor-1/Adrenal 4 Binding Protein and Liver Receptor Homolog-1 (LRH-1)/Fetoprotein Transcription Factor in the Rat Testis: LRH-1 as a Potential Regulator of Testicular Aromatase Expression Endocrinology, May 1, 2004; 145(5): 2186 - 2196. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||