help button home button Endocrine Society Molecular Endocrinology ENDO 08 Sessions Library
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0102
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Catalano, S.
Right arrow Articles by Andò, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Catalano, S.
Right arrow Articles by Andò, S.
Molecular Endocrinology 17 (5): 923-934
Copyright © 2003 by The Endocrine Society

Triiodothyronine Decreases the Activity of the Proximal Promoter (PII) of the Aromatase Gene in the Mouse Sertoli Cell Line, TM4

Stefania Catalano1, Vincenzo Pezzi1, Adele Chimento, Cinzia Giordano, Amalia Carpino, Maureen Young, Michael J. McPhaul and Sebastiano Andò

Departments of Pharmaco-Biology (V.P., A.C., C.G.) and Cell Biology (A.C., S.A.), Centro Sanitario Faculty of Pharmacy (S.C.), University of Calabria 87030 Arcavacata di Rende (CS), Italy; and Department of Internal Medicine (M.Y., M.J.M.), University of Texas Southwestern Medical Center, Dallas, Texas 75235-8857

Address all correspondence and requests for reprints to: Professor Sebastiano Andò, Department of Cell Biology, University of Calabria, Arcavacata di Rende (CS) 87030, Italy. E-mail: sebastiano.ando{at}unical.it)


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Estrogens and thyroid hormones play a significant role in regulating functions and development of the testis. The synthesis of estrogens from androgens is catalyzed by the enzyme complex termed aromatase, which in the testis displays an age-related cellular compartmentalization, primarily in Sertoli cells in immature animals, whereas in adults it is expressed in Leydig and germ cells. T3 induces a precocious terminal differentiation of prepubertal Sertoli cells together with a dramatic decrease of their aromatase activity. In the present work, we have examined the mechanism by which T3 exerts this inhibitory action on aromatase expression.

As an experimental model, we used the mouse Sertoli cell line TM4, which conserves a large spectrum of functional features present in immature Sertoli cells. For instance, after revealing the presence of aromatase by immunocytochemistry and measuring its enzymatic activity, we confirmed in this cell line the functional events previously characterized in primary cultures of immature rat Sertoli cells: 1) a strong stimulation of aromatase activity by dibutyryl-cAMP [(Bu)2cAMP] (simulating FSH action); and 2) the inhibition of aromatase activity by incubation with T3 under basal condition and after (Bu)2cAMP stimulation.

After identifying promoter II as the regulatory region located immediately upstream of the transcriptional initiation site in the TM4 cell line by rapid amplification of cDNA ends analysis, we conducted experiments to examine the molecular mechanism by which thyroid hormones modulate aromatase gene expression in this cell line. TM4 cells were transfected with plasmids containing different segments of the rat promoter II sequence ligated to a luciferase reporter gene. Analysis of the activities of these promoter fusions demonstrated that T3 inhibits basal and (Bu)2cAMP-stimulated activity of the aromatase promoter. This effect was not revealed in T3-treated cells transfected with construct in which the steroidogenic factor-1 (SF-1) response element was mutated. These results indicate that the inhibitory effect of T3 requires the integrity of the SF-1 response element and are further supported in the EMSA. The EMSA experiments demonstrated that thyroid hormone/thyroid receptor {alpha}1 complex (TH/TR{alpha}1) is able to compete with SF-1 in binding to oligonucleotides containing an SF-1 motif, an element essential for the activity of the PII aromatase promoter. The findings suggest that the binding of the thyroid hormone/thyroid receptor {alpha}1 complex to the SF-1 motif is the molecular mechanism by which T3 exerts an inhibitory effect on aromatase gene expression in the TM4 cell line.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE CAPACITY OF the testis to synthesize estrogens from androgens has been well established (1, 2, 3). This biosynthesis is catalyzed by the enzyme complex termed aromatase, which is composed of two polypeptides, an ubiquitous, nonspecific flavoprotein, NADPH-cytochrome P450 reductase and a specific form of cytochrome P450 (P450arom encoded by the CYP19 gene) (4) expressed in several tissues such as placenta (5, 6), adipose tissue (7), skin (8), brain (9), and gonads (10, 11, 12, 13). In rat testis an age-related change has been observed in the cellular localization of the aromatization site, primarily in Sertoli cells in immature animals, but located in Leydig and germ cells (pachytene spermatocytes and spermatids) in adults (14, 15, 16, 17).

Further observations have demonstrated that estrogens play a significant role in regulating testicular functions. The importance of estrogens in regulating spermatogenesis has been supported by the progressive atrophy of seminiferous epithelium observed in estrogen receptor {alpha} knockout mice as a consequence of the alteration of fluid luminal resorption (18, 19, 20). Moreover, in primates, the long-term use of aromatase inhibitors determined defects in spermiogenesis (21). The same features have been supported by data from the characterization of mice in which the aromatase gene has been disrupted (22, 23).

Aromatase expression appears to be regulated by tissue-specific promoters (24, 25, 26, 27). A promoter proximal to the translation start site, called promoter II (PII) (28, 29), regulates the expression of P450arom in ovaries of several species, in fetal gonads (30), and in two rat Leydig tumor cells (R2C and H540) (31, 32). We have demonstrated recently that PII is the principal promoter that is active in rat Sertoli, Leydig, and germ cells (33).

Aromatase activity and estrogen receptor content were dramatically enhanced in immature Sertoli cells prepared from hypothyroid rats (34). Hormone replacement with T3 shortened Sertoli cell replication markedly (35) and reduced both aromatase activity (36) and estrogen receptor content dramatically (37). On the basis of the latter data, it was reasonable to postulate that T3 regulates negatively a short autocrine loop by which estradiol production in situ sustains the mitogenic activity of prepubertal Sertoli cells (38).

Our recent findings have defined at least two mechanisms involved in the down-regulatory effect of T3 on aromatase activity expressed in prepubertal Sertoli cells: the first one represented by the induction of altered transcripts coding for truncated and inactive aromatase proteins; the second one linked to a direct modulator role of T3 in regulating aromatase gene transcription (39, 40).

In the present study, we have shown in the mouse Sertoli cell line, TM4, the molecular mechanism by which thyroid hormone modulates the activity of PII of the rat aromatase gene. Functional studies and EMSA indicate that thyroid hormone/thyroid receptor {alpha}1 competes with steroidogenic factor 1 (SF-1) binding to the AGGTCA motif that is necessary for the activity of the PII aromatase promoter. The binding of TH/TR {alpha}1 to the SF-1 response element (SF-1 RE) is the molecular mechanism by which T3 produces an inhibitory effect on aromatase gene expression in TM4 Sertoli cells.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Immunolocalization of P450arom in TM4 Cells
A strong P450arom immunoreactivity was detected in the cytoplasm of TM4 cells as well as in the perinuclear region. No reaction was detected in the nuclei (Fig. 1AGo). Immunostaining was not observed in the cells processed without primary antibody (Fig. 1BGo) or with the antiaromatase antibody competed with an excess of purified P450arom protein (data not shown).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 1. Aromatase Immunostaining and Effects of T3 on Aromatase Activity in Cultured TM4 Cells

A, Strong P450arom immunoreactivity is observed in the cell cytoplasm and none is detected in the nucleus. B, No staining is present in control samples in which the primary antibody was replaced by the homologous nonimmune serum. Calibration bar, 5 µm. C, TM4 cells were cultured for 48 h in DMEM-F12 in the absence or in the presence of T3 (100 nM), or (Bu)2cAMP (0.5 mM), or T3 (100 nM) combined with (Bu)2cAMP (0.5 mM). Aromatase activity was evaluated by measuring the tritiated water released by TM4 cell cultures after incubation with 0.5 µM [1 ß-3H]androst-4-ene-3,17-dione at 37 C for 5 h. The results obtained were expressed as fentomoles [3H]H2O released per hour and were normalized for mg protein (fmol/h/mg protein). Values represent the means ± SEM of three different experiments, each performed with triplicate samples. *, P < 0.05 with respect to the control; **, P < 0.01 with respect to the (Bu)2cAMP-stimulated samples.

 
Aromatase Activity in TM4 Cells Is Down-Regulated by T3
To verify the presence of functional aromatase activity in TM4 cultured cells, we have measured aromatase activity by the tritiated water assay. The mean value of aromatase activity was 26.7 ± 1.96 fmol/h/mg protein in basal condition. R2C cells used as a positive control confirm the previous basal values reported in the literature (130 ± 4.5 fmol/h per mg protein) (31). A dose-response analysis of the effects of (Bu)2cAMP (simulating FSH action) on TM4 aromatase activity revealed that the maximal stimulatory effect was achieved at the concentration of 0.5 mM (data not shown). Aromatase activity in TM4 cells was partially inhibited after incubation of T3 for 48 h [control = 26.7 ± 1.96; T3 (100 nM) = 11.06 ± 5.9 fmol/h/mg protein; P < 0.05 respect to the control]. Exposure to T3 for 48 h combined with (Bu)2cAMP inhibited drastically the stimulatory effects induced by the cyclic nucleotide [(Bu)2cAMP (0.5 mM) = 345.5 ± 28.1; (Bu)2cAMP (0.5 mM) + T3 (100 nM) = 1.39 ± 0.41 fmol/h/mg protein; P < 0.01 with respect to the (Bu)2cAMP-stimulated samples]. (Fig. 1CGo).

Identification of Aromatase Gene Promoter in TM4 Cells
To investigate the mechanism of action of T3 on aromatase expression, we have focused our attention on the structure of the aromatase gene promoter in TM4. Recently, we demonstrated that the promoter located immediately upstream of the site of transcriptional initiation (PII) directs the expression of aromatase mRNA in prepubertal rat Sertoli cells (33). Using rapid amplification of cDNA ends (RACE) analysis, we amplified the 5'-ends of the aromatase mRNA expressed in TM4 cells to identify the structure of aromatase gene promoter in this cell line. As a positive control, we used the R2C rat Leydig tumor cell line, in which initiation of transcription of aromatase mRNA occurs approximately 100 nucleotides upstream of the initiator methionine (31). RACE analysis of R2C RNA identified a single predominant band approximately 250 nucleotides in length. Using the same method of analysis, a band of similar size was identified in TM4 cells. Southern analysis, performed with the aromatase-specific probe AS3, and subsequent sequence analysis of the fragment confirmed that in TM4 the transcript identified was derived from the promoter immediately upstream of the site of translational initiation (PII) (data not shown).

TR{alpha}1 is the Functional TR Isoform Expressed in TM4 Cells
Before exploring more closely the possible binding of the TH/TR complex to SF-1 RE and the role of this binding in modulating PII activity, we set out to determine which functional TR(s) isoform was present in TM4 cells. By Western blot analysis we demonstrated the presence of TR{alpha}1 protein, in the nuclear extracts of TM4 cells, using a specific antibody against a recombinant protein corresponding to the full-length TR{alpha}1 of chicken origin. We detected a band of 48 kDa that comigrated with transcribed and translated in vitro TR{alpha}1 protein used as positive control (Fig. 2AGo). No band was detected using TRß1 antibody (Fig. 2BGo). The same experiment was carried out for confirming expression of SF-1 protein using a specific antibody against a recombinant protein SF-1 of mouse. We detected a band of 53 kDa that comigrated with transcribed and translated in vitro SF-1 protein used as positive control (Fig. 2CGo).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Western Immunoblotting of TR{alpha}1 and SF-1 in Cultured TM4 Cells

A, TR{alpha}1 Western analysis of TM4 nuclear extract (lane 3) and transcribed and translated in vitro TR{alpha}1 protein (lane 2) used as positive control. B, TRß1 Western analysis of TM4 nuclear extract (lane 3) and transcribed and translated in vitro TRß1 protein (lane 2) used as positive control. C, SF-1 Western analysis of TM4 nuclear extract (lane 3) and transcribed and translated SF-1 protein used as positive control (lane 2). In all panels lane 1 prestained high-range molecular mass markers (Inalco, Milan, Italy). The marker sizes are shown in the left margin. Twenty micrograms of TM4 nuclear extract protein were analyzed for each specimen.

 
Effects of T3 and Exogenous TR{alpha} on Expression of Rat P450arom PII/Luciferase Reporter Gene Constructs in TM4 Cells
To identify genomic elements involved in the T3 regulation of P450arom PII, we used plasmids containing different segments of the rat PII sequence ligated upstream of a luciferase reporter gene in the promoterless pGL2 basic vector [p-183: -183/+94 (including one CRE and one SF-1 RE); p-688: -688/+94 (three CREs and one SF-1 RE); p-1037: -1037/+94 (three CREs and one SF-1 RE); p-688 m: -688/+94 (three CREs and mutated SF-1 RE)] (Fig. 3AGo). The P450arom PII constructs were transfected into TM4 cells.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Effects of T3 on Expression of Rat P450arom PII/Luciferase Reporter Gene Constructs in TM4 Cells

A, Schematic map of the P450arom proximal promoter fragments used in this study. Three putative CRE motifs (5'-CRE at -335; 3'-CRE at -231; XCRE at -169) are indicated as solid circles. The AGGTCA site (SF-1 RE and TRE half-site at -90) is indicated as rectangle. A mutated SF-1 binding site (SF-1 mut) is present in p-688 m (black rectangle). All of the promoter constructs contain the same 3'-boundary (+94). The 5'-boundaries of the promoter fragments varied from -183 to -1037. Each of the fragments was subcloned into the pGL2 vector. B, Transcriptional activity of TM4 with promoter constructs are shown. Cells were treated in DMEM-F-12 in the absence (control) or in the presence of T3 (100 nM) [T3], or (Bu)2cAMP (0.5 mM) [(Bu)2cAMP], or T3 (100 nM) + (Bu)2cAMP (0.5 mM) [(Bu)2cAMP + T3] for 48 h. C, Transcriptional activity of TM4 cells cotransfected with P645 vector alone and with CMV SF-1 plasmid are shown. After 24 h recovery the cells were treated as shown above. These results represent the means ± SEM of three different experiments. In each experiment, the activities of the transfected plasmids were assayed in triplicate transfections. pGL2: basal activity measured in cells transfected with pGL2 basal vector. *, P < 0.05 with respect to the control; **, P < 0.01 with respect to the (Bu)2cAMP-treated samples. {blacksquare}, P < 0.01 with respect to the control of p-688; {blacksquare}{blacksquare}, P < 0.01 with respect to the (Bu)2cAMP-treated p-688 samples. RLU, Relative light units.

 
Transfected cells were either not treated or treated with 0.5 mM (Bu)2cAMP and/or 100 nM T3 for 48 h. p-1037 plasmid tended to show a higher basal and (Bu)2cAMP-stimulated activity when compared with the two plasmids containing deletions within the promoter (p-688, p-183) (Fig. 3BGo).

T3 exerts a partial inhibition of the basal promoter activity (P < 0.05) as well as upon (Bu)2cAMP stimulation (P < 0.01) in samples transfected with p-1037, p-688, and p-183 plasmids. It is worth noting that construct p-688m bearing SF-1 mutated site displays significantly lower basal activity compared with the p-688 plasmid (p-688 = 0.09 ± 0.01; p-688 m = 0.04 ± 0.01 relative light units), and the responsiveness to (Bu)2cAMP stimulation is abolished (p-688 = 0.18 ± 0.01; p-688 m = 0.06 ± 0.01 relative light units). No inhibitory effects were observed in T3-treated cells transfected with p-688m promoter fusion (Fig. 3BGo). These results confirm the importance of the SF-1 binding site in the regulation of aromatase expression in the TM4 cell line and suggest that the inhibitory effect of T3 requires AGGTCA sequence motif.

This inference is further strengthened by the observation that the expression of additional SF-1 in TM4 cells reversed the down-regulatory effect of T3 on the activity of the p-688 aromatase promoter fusion (Fig. 3CGo).

Moreover, cotransfection with TR{alpha} determined a significant decrease of aromatase promoter activity in all conditions tested (Fig. 4Go).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 4. Effect of Exogenous TR{alpha} on Expression of Rat P450arom PII/Luciferase Reporter Gene Construct in TM4 Cells

Transcriptional activity of TM4 cells cotransfected with p-688 vector alone and with RSV TR{alpha} plasmid are shown. After 24 h recovery, the cells were treated in DMEM-F-12 in the absence (control) or in the presence of T3 (100 nM) [T3], or (Bu)2cAMP (0.5 mM) [(Bu)2cAMP], or T3 (100 nM) + (Bu)2cAMP (0.5 mM) [(Bu)2cAMP + T3] for 48 h. These results represent the means ± SEM of three different experiments. In each experiment, the activities of the transfected plasmids were assayed in triplicate transfections. pGL2: basal activity measured in cells transfected with pGL2 basal vector. *, P < 0.05 with respect to the cells transfected with p-688 alone. {square}, P < 0.05 with respect to the control. {square}{square}, P < 0.05 with respect to the (Bu)2cAMP-treated samples. RLU, Relative light units.

 
These observations raise the possibility that the binding of TH/TR complex to this sequence might lead to a competitive interference with PII activity.

TR{alpha}1 Protein Binds to SF-1 RE
On the basis of the evidence that the inhibitory effect of T3 on aromatase requires the crucial presence of SF-1 RE, EMSAs were performed using the SF-1 motif as probe. In the EMSA shown in Fig. 5Go we focused our attention on two complexes (see arrows) obtained using nuclear extracts prepared from TM4 cells. Competition binding studies demonstrated that a 100-fold molar excess of unlabeled probe inhibited the formation of these complexes. This inhibition was not observed when a mutated SF-1 oligonucleotide was used as competitor (Fig. 5Go, lane 4). Using nuclear extracts from TM4 cells pretreated with T3 does not change this pattern substantially (Fig. 5Go, lane 5). The inclusion of an anti-Ad4BP (Ad4BP is the bovine homolog of SF-1) and TR{alpha}1 antibodies in the reactions attenuated drastically the specific bands drastically and resulted in the formation of supershifted complexes (Fig. 5Go, lanes 6–9).



View larger version (69K):
[in this window]
[in a new window]
 
Figure 5. Gel Mobility Shift Assay on TM4 Nuclear Extract and SF-1 and TR{alpha}1-Transcribed and Translated in Vitro Protein Using the SF-1 Motif as Probe

The results of incubating control TM4 nuclear extracts with probe are shown in lane 2. Competition experiments were performed adding as competitor a 100-fold (lane 3) molar excess of unlabeled probe or a 100-fold molar excess of unlabeled oligonucleotide containing a mutated SF-1 RE (lane 4). Lane 5, Nuclear extracts from T3-treated TM4 cells. Anti-Ad4BP antibody (lanes 6 and 8) or anti-TR{alpha}1 antibody (lanes 7 and 9) were incubated with control (lanes 6 and 7) or T3-treated (lanes 8 and 9) TM4 nuclear extracts. In vitro translated proteins were obtained as described in Materials and Methods. Two microliters of translated SF-1 (lane 10) and 2 µl of TR{alpha}1 (lane 12) proteins were incubated with the SF-1 RE as probe. In lane 11 the translated SF-1 protein was incubated with an anti-Ad4BP antibody. TR{alpha}1-translated protein was incubated with anti-TR{alpha}1 antibody (lane 13). Lane 1 contains probe alone.

 
Using transcribed and translated in vitro SF-1 protein, we obtained a single band at the same level of the faster band revealed in TM4 nuclear extracts (Fig. 5Go, lane 10), whereas incubation with in vitro translated TR{alpha}1 protein determined the presence of two bands, one comigrating at the same level of SF-1 and another one slower, probably due to a dimerization of TR{alpha}1 protein complex (Fig. 5Go, lane 12). Competition binding studies revealed that both transcribed and translated SF-1 and TR{alpha}1 DNA binding complex were abrogated by 100-fold molar excess of unlabeled probe (data not shown). Finally the specificity of these bands was proved by the formation of supershifted complexes in the presence of anti-Ad4BP and TR{alpha}1 antibodies (Fig. 5Go, lanes 11 and 13). The faster migrating bands, which appear when anti-Ad4BP or anti-TR{alpha}1 antibodies are added, were considered not specific, being still present after incubation with oligonucleotide probe containing mutated SF-1 RE (data not shown).

In the EMSA depicted in Fig. 6Go, we investigated the hypothesis that TR{alpha} could compete with SF-1 for binding to the same DNA responsive element. We observed that in the presence of equal amounts (1 µl) of both transcribed and translated SF-1 and TR{alpha}1 proteins, the faster band was attenuated (Fig. 6Go, lane 3) compared with in vitro translated SF-1 alone (Fig. 6Go lane 2). When progressively increasing amounts (3 and 5 µl) of in vitro translated TR{alpha} protein were added, the slower band became considerably more evident (Fig. 6Go, lanes 4 and 5). At the highest amount, the addition of anti-Ad4BP antibody resulted in the supershift of the faster migrating band. By contrast, the addition of anti-TR{alpha}1 antibody resulted in a supershift and a decrease in the intensity of both bands (Fig. 6Go, lanes 6 and 7).



View larger version (57K):
[in this window]
[in a new window]
 
Figure 6. EMSA Revealed Competition Between TR{alpha}1 and SF-1 for the Same Binding Site

Translated SF-1 protein (lanes 2–7) were incubated in the absence or in the presence of different amounts (1, 3, and 5 µl) of translated TR{alpha}1 protein. Anti-Ad4BP and anti-TR{alpha}1 antibodies were added in the reaction (lanes 6 and 7). TR{alpha}1 protein (2 µl; lane 8) was incubated with the SF-1 RE as probe. Lane 1 contains probe alone; lane 9 contains 2 µl of unprogrammed rabbit reticulocyte lysate incubated with the SF-1 RE.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In previous studies, it has been documented that postnatal exposure of rats to high levels of T3 induces a precocious terminal differentiation of prepubertal Sertoli cells that is coincident with a dramatic decrease of aromatase activity (34, 35). TM4 cells exhibit a spectrum of features in common with native Sertoli cells. In the present study we have documented that the pattern aromatase activity in the TM4 cell line is similar to that described previously in immature Sertoli cells: 1) a strong dose-dependent stimulation of aromatase activity by (Bu)2cAMP (simulating FSH action) (39, 40); and 2) the inhibition of aromatase activity by incubation with T3 under basal conditions and after (Bu)2cAMP stimulation (39, 40).

Recently we have observed that T3 at 100 nM resulted in a significant decrease of endogenous mRNA levels in prepubertal rat Sertoli cells. This was suggested by the authors as a possible mechanism through which T3 contributes to the down-regulatory effect on aromatase expression. In addition, an induction of aromatase mRNA encoding inactive aromatase proteins has been observed after prolonged treatment with T3, providing an additional mechanism through which T3 may act to inhibit aromatase activity (39, 40). The current study presents data regarding the molecular basis by which T3 leads to the inhibition of aromatase gene expression.

Distinctive promoters are employed to direct the expression of aromatase mRNA deriving from a single aromatase gene in different tissues. We have recently established that the promoter located immediately upstream of the transcriptional initiation site (PII) directs the expression of aromatase mRNA in Sertoli cells, Leydig cells, and in rat germ cells (33). Using the same experimental approach, in the present work we have demonstrated that PII of the rat aromatase gene directs aromatase expression in TM4 Sertoli cell line as well.

A number of functional motifs have been identified in the PII aromatase promoter. Two motifs resembling cAMP response elements (termed the 5'-CRE and 3'-CRE) have been identified at positions -335 and -231. Another CRE-like sequence is present at -169, but contains an extra nucleotide inserted between the second and third nucleotide (XCRE) (32). In the present study, we have demonstrated an enhanced activation of all of the aromatase promoter fusions containing the 3'- and 5'-CREs after (Bu)2cAMP stimulation, demonstrating that these regions contain elements that mediate the effects of the cAMP transduction pathway that potentiate aromatase expression and activity.

An SF-1 binding site is present in this promoter as well (at -90 relative to the start of transcription). We demonstrated by Western analysis that in TM4 cells, SF-1 is conspicuously expressed and that, in functional studies, it appears to be an important regulator of P450 aromatase. Indeed, mutagenesis or deletion of the SF-1 binding site results in a marked lowering of PII activity in basal conditions as well as after (Bu)2cAMP stimulation. These data fit with the paradigm that the SF-1 binding site plays a crucial role in controlling transcription of cytochrome P450 genes in cells of both gonadal and adrenal origin (41).

After treatment with T3, promoter fusions of the rat aromatase PII promoter display decreased activity for each of the three 5'-deleted region examined in transfected TM4 cells. In addition, the overexpression of TR{alpha} produces a significant reduction of promoter activity in basal conditions as well as upon (Bu)2cAMP stimulation. Finally, the observed inhibitory effect of T3 was abrogated when a promoter fusion containing a mutated SF-1 element was employed. These results clearly suggest that the integrity of SF-1 sequence is a prerequisite for the effect of T3 in negatively regulating aromatase promoter activity. These findings raise the possibility that TRs and SF-1 are competing for binding to a common site within this regulatory region. This inference is further supported by the observation that the inhibitory effects of thyroid hormone on the activity of the aromatase promoter fusions are not observed when SF-1 levels are increased by transfection of TM4 cells.

TRs are members of steroid/thyroid hormone receptor superfamily and are encoded by two different genes, TR{alpha} and TRß. Alternate splicing leads to the production of several peptide isoforms, five of which have been described: TR{alpha}1, TR{alpha}2, TR{alpha}3, TRß1, and TRß2 (42). It has been demonstrated that TR{alpha}1 is the only TR{alpha} isoform that is able to bind T3, and it is this isoform that is expressed in the Sertoli cells of fetal and prepubertal rats (43). The detection of only the TR{alpha} isoform in TM4 cells further reinforces the functional similarity between the two cell types. TRs can bind as monomers to the half-site consensus sequence AGGTCA or, more frequently, as dimer (44) to a TRE configured as two half-sites arranged in three different ways: 1) direct repeats separated by four nucleotides; 2) unspaced palindromes; and 3) inverted palindromes usually spaced by six nucleotides (45). Natural hormone response elements (HREs) rarely contain two perfect consensus half-sites. It has been reported that half-site sequence of HREs can deviate quite considerably from the consensus sequences, especially for dimeric HREs in which a single conserved half-site is usually sufficient to confer high-affinity binding to the homo- or heterodimer complexes (46).

Location of an AGGTCA sequence at the -90 position supports a possible binding of TR to this promoter region, which we verified by EMSA experiments. In the presence of anti-Ad4BP and anti-TR{alpha}1 antibodies, we observed supershifts of DNA binding complexes (Fig. 5Go, lanes 6–9) demonstrating that both SF-1 and TR{alpha}1 proteins are able to bind the AGGTCA sequence located in PII.

SF-1 and TR{alpha}1 transcribed and translated in a cell-free system were used, in EMSA experiments, to better investigate the competition of these molecules for the same DNA binding site. We observed that SF-1 protein synthesized in vitro forms a single complex, which migrates at the same position as the faster migrating band observed in EMSA performed using TM4 nuclear extracts. By contrast, TR{alpha}1 protein forms two distinct complexes, one comigrating with the SF-1 complex and another displaying slightly slower mobility (Fig. 5Go, lanes 10 and 12).

When we incubated similar amounts of TR{alpha} and SF-1 translated in vitro, the band corresponding to the SF-1 complexes decreased and was further attenuated as higher quantities of TR{alpha}1 were added. For instance, in the presence of an amount of TR{alpha} 5-fold greater than the amount of included SF-1, the top complex was markedly increased compared with the more rapidly migrating species (Fig. 6Go, lane 5). We interpret these findings to indicate that, under these conditions, the binding of TR{alpha} and SF-1 as monomeric complex (bottom complex) is somehow prevented and the binding of TR{alpha} in its dimeric form (top complex) predominates. These findings agree with a previous report (44) demonstrating that homodimerization is favored at higher TR concentrations. Consistent with this hypothesis, at higher TR{alpha} concentrations, when anti-Ad4BP antibody is added, we observed a supershift with a predominant attenuation of the faster-migrating band (Fig. 6Go lane 6). When anti-TR{alpha}1 antibody is added instead, an attenuation of both bands was observed (Fig. 6Go, lane 7). These data reinforce the inference that the faster band represents SF-1 and TR{alpha} binding as monomers, while the slower-migrating band represents TR{alpha} in a dimeric complex.

The mechanism by which the binding of TR to SF-1 RE results in a down-regulation of aromatase gene expression remains to be elucidated. However, in all the cases studied to date in which T3 affects a negative regulation of gene expression [e.g. down-regulation of the genes encoding the {alpha}- and ß-subunits of TSH (47, 48)], the thyroid response elements (TREs) are found to be localized close to the transcription start site. This is the circumstance in the PII aromatase promoter, where the binding of TR{alpha} to SF-1 binding site located adjacent to the transcription start site is implicated in the negative regulation of PII aromatase promoter activity. The functional role of SF-1 in controlling the activity of PII in the TM4 cell line is demonstrated by the fact that the promoter with a mutated SF-1 response exhibits an activity that is markedly inhibited under basal conditions, as well as after (Bu)2cAMP stimulation. In the intact promoter, the activity measured after treatment with thyroid hormone alone is similar to that observed in the promoter with mutated SF-1 RE. This suggests the possibility that the major inhibitory effect induced by thyroid hormone on the activity of the aromatase PII promoter is due principally to the occupancy of the SF-1 binding site by thyroid receptor, as suggested by our EMSA.

In conclusion, our findings, stemming from functional analysis and from mobility shift assays, suggest that thyroid hormone/thyroid receptor complex is able to compete with SF-1 in binding to a common sequence within the PII promoter of the rat aromatase gene. The binding of thyroid hormone/thyroid receptor complex to this sequence impairs the binding of SF-1 and serves to interfere negatively in the activity of aromatase promoter.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Cell Cultures
The TM4 cell line, derived from the testis of immature BALB/c mice, was originally characterized based on its morphology, hormone responsiveness, and metabolism of steroids (49). This cell line was obtained from the American Type Culture Collection (Manassas, VA) and cultured in DMEM (Sigma, St. Louis, MO) containing 2.5% fetal calf serum, 5% horse serum, and 1 mg/ml penicillin-streptomycin (Eurobio, Les Ulis, France). The R2C cell line was obtained from the American Type Culture Collection and cultured in Ham’s F-12 medium supplemented with 15% horse serum, 2.5% fetal calf serum, and 1 mg/ml penicillin-streptomycin (Eurobio).

Immunocytochemical Staining
TM4 cells were cultured for 48 h on chamber slides in DMEM supplemented with bovine serum (2.5%), horse serum (5%), and antibiotics under air-CO2 (5%) atmosphere at 37 C. TM4 cells were fixed for 30 min in freshly prepared paraformaldehyde (2%). After paraformaldehyde removal, the cells were treated with hydrogen peroxide (3% in methanol) for 30 min to inhibit endogenous peroxidase activity. Cells were then incubated for a further 30 min with 15% normal goat serum to block the nonspecific binding sites. Immunocytochemical staining was performed by using a rabbit polyclonal antiserum generated against the human placental P450 aromatase (1:100, overnight at 4 C) as primary antibody (Hauptman-Woodward Medical Research Institute, Buffalo, NY), while a biotinylated goat-antirabbit IgG (1:1200 for 60 min at room temperature) was applied as secondary antibody (Vector Laboratories, Inc., Burlingame, CA). Avidin-biotin-horseradish peroxidase complex amplification was then carried out (Vector Laboratories, Inc.) for 30 min at room temperature and 3,3'-diaminobenzidine tetrachloride dihydrate (Vector Laboratories, Inc.) was used as a detection system. Cultured cells were rinsed with Tris-buffered saline (0.05 M Tris-HCl plus 0.15 M NaCl; pH 7.6) containing 0.05% Triton X-100 after each step. Control slides were assessed treating cells with the same procedure but replacing the primary antibody by normal rabbit serum at the same concentration. An absorption control was also performed by using a primary antibody preabsorbed (48 h at 4 C) with an excess (5 nmol/ml) of antigen (P450arom purified from human placenta by immunoaffinity chromatography) obtained by Hauptman-Woodward Medical Research Institute.

Aromatase Activity Assay
The aromatase activity in subconfluent TM4 cells culture medium was measured by the tritiated water release assay using 0.5 µM [1ß-3H]androst-4-ene-3,17-dione (Perkin-Elmer, Foster City, CA) as substrate (50). Incubations were performed at 37 C for 5 h under an air-CO2 (5%) atmosphere. The results obtained were expressed as fentomoles per hour and normalized to mg of protein (fmol/h/mg protein).

RNA Isolation
Total cellular RNA was extracted from TM4 and R2C cells using the Total RNA Isolation System kit (Promega Corp., Madison, WI). The purity and integrity of the RNA were checked spectroscopically and by gel electrophoresis before the analytical procedures were performed.

RACE and Southern Blot Analysis
RACE was performed to amplify 5'-ends of mRNAs extracted from TM4 and R2C cell line used as positive control, using Marathon cDNA Amplification kit (CLONTECH Laboratories, Inc., Palo Alto, CA). For the first amplification, antisense primer AS1 (5'-AGCCAGGACCTGGTATTGAAGACGAGCTCT-3', located in the exon II) was used in combination with the adapter primer. For the second, nested amplification, antisense primer, AS2 (5'-AATCAGGAGAAGGAGGCCCATGATCAGCA-3', located in the exon II) was combined with the adapter primer. The amplified products were run on 1.2% agarose gel and blotted on ZetaProbe Blotting Membranes (Bio-Rad Laboratories, Inc., Hercules, CA). The membrane was hybridized with a specific antisense oligonucleotide, AS3 (5'-ATGGCACTGACAGTCACAGTT-3') for Exon II. The oligonucleotide was labeled with [{gamma}32P]ATP using polynucleotide kinase.

Extraction from Agarose Gel and Sequencing of the P450arom RT-PCR Fragments
The RT-PCR products were extracted and purified from agarose gel by QIAquick Gel Extraction kit (Promega Corp.), subcloned into PCR 2.1 vector (TA Cloning kit, Invitrogen), and sequenced using radioactive dideoxy-chain termination method (Sequenase kit, Amersham Pharmacia Biotech, Buckinghamshire, UK).

Transfection Assay
Transient transfection experiments were performed using vectors containing different segments of the rat aromatase PII sequence ligated to a luciferase reporter gene. Progressive deletions of aromatase promoter -1037/+94 (p-1037), -688/+94 (p-688), and -183/+94 (p-183) were generated by the PCR and subcloned into the pGL2-Basic vector (Promega Corp.) as was previously described (32). Fugene 6 (Roche, Indianapolis, IN) was used as directed by the manufacturer to cotransfect cells plated in a 3.5-cm2 well with the pGL2-promoter constructs (0.5 µg/well) or cytomegalovirus (CMV) constitutively active luciferase reporter gene (0.5 µg/well). A set of experiments was performed cotransfecting p-688 vector (0.5 µg/well) and CMV SF-1 plasmid (0.5 µg/well; obtained from Dr. W. E. Rainey, University of Texas Southwestern Medical Center, Dallas, TX) or Rous sarcoma virus (RSV) TR{alpha} plasmid (0.5 µg/well) (obtained from Dr. E. A. Jannini, University of Aquila, Aquila, Italy). Empty vectors were used to ensure that DNA concentrations were constant in each transfection. TK renilla luciferase plasmid (25 ng/well) (Promega Corp.) was used to normalize the efficiency of the transfection. Empty PGL2-Basic vector was used as a control vector to measure basal activity. Twenty-four hours after transfection, the medium was changed and the cells were treated in DMEM-F12 in the presence or absence of T3 (100 nM), (Bu)2cAMP (0.5 mM), 0.5 mM (Bu)2cAMP +T3 (100 nM) for 48 h. At the end of this period, firefly and renilla luciferase activities were measured using Dual Luciferase kit (Promega Corp.). The firefly luciferase data of each sample were normalized on the basis of transfection efficiency measured by renilla luciferase activity.

Western Blot Analysis
Nuclear extracts were prepared from TM4 as previously described (51). Briefly, TM4 cells plated into 60-mm2 dishes were scraped into 1.5 ml of cold PBS. Cells were pelleted for 10 sec and resuspended in 400 µl cold buffer A (10 mM HEPES-KOH, pH 7.9, at 4 C, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonylfluoride) by flicking the tube. The cells were allowed to swell on ice for 10 min and then vortexed for 10 sec. Samples are centrifuged for 10 sec and the supernatant fraction discarded. The pellet was resuspended in 50 µl of cold Buffer C (20 mM HEPES-KOH, pH 7.9; 25% glycerol; 1.5 mM MgCl2; 420 mM NaCl; 0.2 mM EDTA; 0.5 mM dithiothreitol; 0.2 mM phenylmethylsulfonylfluoride) and incubated on ice for 20 min for high-salt extraction. Cellular debris was removed by centrifugation for 2 min at 4 C, and the supernatant fraction (containing DNA-binding proteins) was stored at -70 C. The yield was determined by the Bradford method (52). The proteins were separated on sodium dodecyl sulfate-polyacrylamide (11%) gel and then electroblotted onto a nitrocellulose membrane. The blots were incubated overnight at 4 C with 1) anti-TR{alpha}1 antibody, raised against a recombinant protein corresponding to the full-length TR{alpha}1 of chicken origin (1:1000) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), 2) anti-TRß1 antibody against the carboxyl-terminal region of the TRß1 of human origin (1:1000) (Santa Cruz Biotechnology, Inc.), 3) rabbit polyclonal antiserum against a recombinant protein SF-1 of mouse origin (1:500; Upstate Biotechnology, Inc., Lake Placid, NY). The antigen-antibody complexes were detected by incubation of the membranes at room temperature with goat antirabbit IgG coupled to peroxidase, developed using the ECL Plus Western blotting detection system (Amersham Pharmacia Biotech). In vitro transcribed and translated TR{alpha}1, TRß1, and SF-1 proteins were synthesized using T7 polymerase in the rabbit reticulocyte lysate system as directed by the manufacturer (Promega Corp.). These proteins were used as positive controls in the immunoblot and EMSA experiments. As template we used the SF-1 plasmid (obtained from Dr. W. E. Rainey), the TR{alpha}1 plasmid (from the American Type Culture Collection), and the TRß1 plasmid (from the American Type Culture Collection).

Gel Mobility Shift Assay
Nuclear extracts were prepared from TM4 as previously described (51). The probe was generated by annealing single-stranded oligonucleotides and labeled with [{gamma}32P] ATP and T4 polynucleotide kinase, and then purified using Sephadex G50 spin columns (Amersham Pharmacia Biotech). The DNA sequences used as probe or as cold competitors are the following (the nucleotide motifs of interest are underlined, mutations are shown as lower case letters): SF-1, CAGGACCTGAGTCTCCCAAGGTCATCCTTGTTTGACTTGTA; mutated SF-1, TCTCCCAAtaTCATCCTTGT. Oligonucleotides were synthesized by Sigma Genosys (Cambridge, UK). The protein binding reactions were carried out in 20 µl of buffer (20 mM HEPES, pH 8; 1 mM EDTA; 50 mM KCl; 10 mM dithiothreitol; 10% glycerol; 1 mg/ml BSA) with 50,000 cpm of labeled probe, 6 µg of TM4 nuclear protein, or 2 µl of transcribed and translated in vitro SF-1 protein or TR{alpha}1 protein and 5 µg poly (dI-dC) (Roche). The above-mentioned mixture was incubated at room temperature for 20 min in the presence or absence of unlabeled competitor oligonucleotides or transcribed and translated in vitro TR{alpha}1 protein and in the presence or absence of rabbit antiserum to Ad4BP/SF-1 (Ad4BP is the bovine homolog of SF-1) (kindly provided from Dr. K. Morohashi, National Institute for Basic Biology, myodaiji-cho, Okazaki, Japan). For experiments involving TR{alpha}1 antibody, obtained against a peptide corresponds to amino acid residues 403–410 from human TR{alpha}1 (Affinity BioReagents, Inc., Golden, CO); the reaction mixture was incubated with this antibody at 4 C for 30 min after addition of labeled probe. Under the conditions employed, cross-reactivity of the TR{alpha} and SF-1 antibodies was not observed in EMSA supershift assays (data not shown). The entire reaction mixture was electrophoresed through a 6% polyacrylamide gel in 0.25x Tris borate-EDTA for 3 h at 150 V. Gels were dried and subjected to autoradiography at -70 C.

Statistical Analysis
Each data point represents the mean ± SEM of three experiments. Data were analyzed by ANOVA using the STATPAC computer program.


    ACKNOWLEDGMENTS
 
We thank Dr. William E. Rainey and Dr. E. A. Jannini for providing us with the SF-1 plasmid and RSV TR{alpha} plasmid, respectively, and Dr. K. Morohashi for providing us the antibody Ad4BP.


    FOOTNOTES
 
1 These authors contributed equally to this work. Back

This work was supported by Cofin Ministero dell’Università e della Ricerca Scientifica e Tecnologica 2001 Grant prot. N 2001063981.

Abbreviations: (Bu)2cAMP, Dibutyryl-cAMP; CMV, cytomegalovirus; CRE, cAMP response element; HRE, hormone response element; PII, promoter II; RACE, rapid amplification of cDNA ends; RSV, rous sarcoma virus; SF-1, steroidogenic factor-1; SF-1 RE, SF-1 response element; TH, thyroid hormone; TR{alpha}1, TH receptor {alpha}1; TRE, thyroid response element.

Received for publication March 8, 2002. Accepted for publication January 28, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Armstrong DT, Dorrington JH 1977 Estrogen biosynthesis in the ovaries and testes. Adv Sex Horm Res 3:217–258[Medline]
  2. Van der Molen HJ, Brinkmann AO, de Jong FH, Rommerts FF 1981 Testicular oestrogens. J Endocrinol 89:33P–46P
  3. Payne AH, Perkins LM, Georgiou M, Quinn PG 1987 Intratesticular site of aromatase activity and possible function of testicular estradiol. Steroids 550:435–448
  4. Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood MM, Graham-Lorence S, Amarneh B, Ito Y, Fisher CR, Mendelson CR, Bulun SE 1994 Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr Rev 15:342–355[Abstract/Free Full Text]
  5. Kellis JT, Vickery LE 1987 Purification and characterization of human placental aromatase P450. J Biol Chem 262:4413–4420[Abstract/Free Full Text]
  6. Kilgore MW, Means GD, Mendelson CR, Simpson ER 1992 Alternative promotion of aromatase cytochrome P450 expression in human fetal tissues. Mol Cell Endocrinol 83:R9–R16
  7. Mahendroo MS, Mendelson CR, Simpson ER 1993 Tissue-specific and hormonally controlled alternative promoters regulate aromatase cytochrome P450 gene expression in human adipose tissue. J Biol Chem 268:19463–19470[Abstract/Free Full Text]
  8. Harada N 1992 A unique aromatase (P-450 AROM) mRNA formed by alternative use of tissue-specific exons 1 in human skin fibroblasts. Biochem Biophys Res Commun 189:1001–1007[CrossRef][Medline]
  9. Lephart ED 1997 Molecular aspects of brain aromatase cytochrome P450. J Steroid Biochem Mol Biol 61:375–380[CrossRef][Medline]
  10. McNatty KP, Baird DT, Bolten A, Chambers P, Corker CS, McLean H 1976 Concentrations of oestrogens and androgens in human ovarian venous plasma and follicular fluid throughout the menstrual cycle. J Endocrinol 71:77–85[Abstract/Free Full Text]
  11. Brodie A, Inkster S 1993 Aromatase in the human testis. J Steroid Biochem Mol Biol 44:549–555[CrossRef][Medline]
  12. Foucalt P, Carreau S, Kuczynski W, Guillaumin JM, Bardos P, Drosdowsky MA 1992 The human Sertoli cells in vitro: lactate, estradiol-17ß and transferrin production. J Androl 13:361–367[Abstract/Free Full Text]
  13. Papadopoulos V, Carreau S, Szerman-Joly E, Drosdowsky MA, Dehennin L, Scholler R 1986 Rat testis 17-estradiol: identification by gas chromatography-mass spectrometry and age related cellular distribution. J Steroid Biochem 24:1211–1216[CrossRef][Medline]
  14. Rommerts FFG, De Jong FH, Brinkmann AO, van der Molen HJ 1982 Development and cellular localization of rat testicular aromatase activity. J Reprod Fertil 65:281–288[Abstract/Free Full Text]
  15. Tsai-Morris CH, Aquilano DR, Dufau ML 1985 Cellular localization of rat testicular aromatase activity during development. Endocrinology 116:38–46[Abstract/Free Full Text]
  16. Hess RA, Bunick D, Bahr JM 1995 Sperm, a source of estrogen. Environ Health Perspect 103:59–62
  17. Levallet J, Bilinska B, Mittre H, Genissel C, Fresnel J, Carreau S 1998 Expression and immunolocalization of functional cytochrome P450 aromatase in mature rat testicular cells. Biol Reprod 58:919–926[Abstract/Free Full Text]
  18. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1991 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 90:11162–11166
  19. Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC, Lubahn DB, Korach KS 1996 Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology 137:4796–4805[Abstract]
  20. Hess RA, Bunick D, Lee KH, Bahr J, Taylor JA, Korach KS, Lubahn DB 1997 A role for estrogens in the male reproductive system. Nature 390:509–512[CrossRef][Medline]
  21. Shetty G, Krishnamurty H, Krishnamurty HM, Bhatnagar AS, Moudgal NR 1998 Effect of long-term treatment with aromatase inhibitor on testicular function of adult male bonnet monkeys (M radiata). Steroids 63:414–420[CrossRef][Medline]
  22. Fisher CR, Graves KH, Parlow AF, Simpson ER 1998 Characterization of mice deficient in aromatase (ArKO) because of targeted disruption of the cyp 19 gene. Proc Natl Acad Sci USA 95:6965–6970[Abstract/Free Full Text]
  23. Robertson KM, Oldonnel L, Jones ME, Meachem SJ, Boon WC, Fisher CR, Graves KH, McLachlan RI, Simpson ER 1999 Impairment of spermatogenesis in mice lacking a functional aromatase (CYP19)gene. Proc Natl Acad Sci USA 96:7986–7991[Abstract/Free Full Text]
  24. Cho I, Simmen RC, Simmen FA 1996 Molecular cloning of cytochrome P450 aromatase complementary deoxyribonucleic acid from periimplantation porcine and equine blastocysts identifies multiple novel 5'-untranslated exons expressed in embryos, endometrium, and placenta. Endocrinology 137:1457–1467[Abstract]
  25. Lephart ED, Herbst MA, McPhaul MJ 1995 Characterization of aromatase cytochrome P450 mRNA in rat perinatal brain, ovary, and a Leydig tumor cell line: evidence for the existence of brain specific aromatase transcripts. Endocrine 3:25–31
  26. Bulun SE, Simpson ER 1994 Regulation of aromatase expression in human tissues. Breast Cancer Res Treat 30:19–29[CrossRef][Medline]
  27. Hinshelwood MM, Corbin CJ, Tsang PCW, Simpson ER 1993 Isolation and characterization of a complementary deoxyribonucleotide acid insert encoding bovine aromatase cytochrome P450. Endocrinology 133:1971–1977[Abstract/Free Full Text]
  28. Hickey GJ, Krasnow JS, Beattie WG, Richards JS 1990 Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 3',5'-monophosphate-dependent and independent regulation. Cloning and sequencing of rat aromatase cDNA and 5'genomic DNA. Mol Endocrinol 4:1–12
  29. Means GD, Kilgore MW, Mahendroo MS, Mendelson CR, Simpson ER 1991 Tissue-specific promoters regulate aromatase cytochrome P450 gene expression in human ovary and fetal tissues. Mol Endocrinol 5:2005–2013[Abstract/Free Full Text]
  30. Bulun SE, Rosenthal IM, Brodie AMH, Inkster SE, Zeller WP, Di-George AM, Frasier SD, Kilgore MW, Simpson ER 1993 Use of tissue-specific promoters in the regulation of aromatase cytochrome P450 gene expression in human testicular and ovarian sex cord tumors, as well as in normal fetal and adult gonads. J Clin Endocrinol Metab 77:1616–1621[Abstract]
  31. Young M, Lephart ED, McPhaul MJ 1997 Expression of aromatase cytochrome P450 in rat H540 Leydig tumor cells. J Steroid Biochem Mol Biol 63:37–44[CrossRef][Medline]
  32. Young M, McPhaul MJ 1998 A steroidogenic factor-1-binding site and cyclic adenosine 3',5'-monophosphate response element-like elements are required for the activity of the rat aromatase promoter in rat Leydig tumor cell lines. Endocrinology 139:5082–5093[Abstract/Free Full Text]
  33. Lanzino M, Catalano S, Genissel C, Andò S, Carreau S, Hamra K, McPhaul MJ 2001 Aromatase messenger RNA is derived from the proximal promoter of the aromatase gene in Leydig, Sertoli, and germ cells of the rat testis. Biol Reprod 64:1439–1443[Abstract/Free Full Text]
  34. Panno ML, Beraldi E, Pezzi V, Salerno M, De Luca G, Lanzino M, Le Pera M, Sisci D, Prati M, Palmero S, Bolla E, Fugassa E, Andò S 1994 Influence of thyroid hormone on androgen metabolism in peripubertal rat Sertoli cells. J Endocrinol 140:349–355[Abstract/Free Full Text]
  35. van Hasteer LH, de Jong FH, Docter R, de Rooij DG 1993 High neonatal triidothyronine levels reduce the period of Sertoli cell proliferation and accelerate tubular lumen formation in the rat testis, and increase serum inhibin levels. Endocrinology 133:755–760[Abstract/Free Full Text]
  36. Panno ML, Sisci D, Salerno M, Lanzino M, Pezzi V, Morrone EG, Pezzi V, Palmero S, Fugassa E, Andò S 1996 Thyroid hormone modulates androgen and oestrogen receptor content in the Sertoli cells of peripubertal rats. J Endocrinol 148:43–50[Abstract/Free Full Text]
  37. Panno Ml, Sisci D, Salerno M, Lanzino M, Mauro L, Morrone EG, Palmero S, Fugassa E, Andò S 1996 Effect of triidothyronine administration on estrogen receptor contents in peripubertal Sertoli cells. Eur J Endocrinol 134:633–638[Abstract/Free Full Text]
  38. Sisci D, Panno Ml, Salerno M, Maggiolini, Pezzi V, Morrone EG, Mauro L, Aquila S, Marsico S, Lanzino M, Andò S 1997 A time course study on the "in vitro" effects of T3 and testosterone on androgen and estrogen receptors in peripubertal primary Sertoli cells. Exp Clin Endocrinol Diabetes 105:218–224[Medline]
  39. Pezzi V, Panno ML, Sirianni R, Forastieri P, Casaburi I, Lanzino M, Rago V, Giordano F, Giordano C, Carpino A, Andò S 2001 Effects of tri-iodothyronine on alternative splicing events in the coding region of cytochrome P450 aromatase in immature rat Sertoli cells. J Endocrinol 170:381–393[Abstract]
  40. Andò S, Sirianni R, Forastieri P, Casaburi I, Lanzino M, Rago V, Giordano F, Giordano C, Carpino A, Pezzi V 2001 Aromatase expression in prepubertal Sertoli cells: effect of thyroid hormone. Mol Cell Endocrinol 178:11–21[CrossRef][Medline]
  41. Parker KL, Shimmer BP 1997 Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr Rev 18:361–377[Abstract/Free Full Text]
  42. Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184–193[Abstract/Free Full Text]
  43. Jannini EA, Ulisse S, D’Armiento M 1995 Thyroid hormone and male gonadal function. Endocr Rev 16:443–459[Abstract/Free Full Text]
  44. Lazar Ma, Berrobin TJ, Harding HP 1991 Differential DNA binding by monomeric, homodimeric, and potentially heteromeric forms of the thyroid hormone receptor. Mol Cell Biol 11:5005–5015[Abstract/Free Full Text]
  45. Aprilettio Wj, Ribeiro RCJ, Wagner RL, Feng W, Webb P, Kushner PJ, West BL, Nilsson S, Scanlan TS, Fletterick RJ, Baxter JD 1998 Molecular and structural biology of thyroid hormone receptors. Clin Exp Pharmacol Physiol 25:S2–S11
  46. Giguere V 1999 Orphan nuclear receptors: from gene to function. Endocr Rev 20:689–725[Abstract/Free Full Text]
  47. Chatterjee VKK, Lee J-K, Rentoumis A, Jameson JL 1989 Negative regulation of the thyroid stimulating hormone {alpha} gene by thyroid hormone:receptor interaction adjacent to the TATA box. Proc Natl Acad Sci USA 86:9114–9118[Abstract/Free Full Text]
  48. Wondisford FE, Farr EA, Radovick S, Steinfelder HJ, Moates JM, McClaskey JH, Weintraub BD 1989 Thyroid hormone inhibition of human thyrotropin ß-subunit gene expression is mediated by a cis-acting element located in the first exon. J Biol Chem 264:14601–14604[Abstract/Free Full Text]
  49. Mather J 1980 Establishment and characterization of two distinct mouse testicular epithelial cell lines. Biol Reprod 23:243–252[Abstract]
  50. Lephart ED and Simpson ER 1991 Assay of aromatase activity. Methods Enzymol 206:477–483[Medline]
  51. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2499[Free Full Text]
  52. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   TRα  |  TRβ  |  SF-1
Ligands:   Thyroid hormone



This article has been cited by other articles:


Home page
J EndocrinolHome page
M. S. Wagner, S. M. Wajner, and A. L. Maia
The role of thyroid hormone in testicular development and function
J. Endocrinol., December 1, 2008; 199(3): 351 - 365.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
D. Silandre, C. Delalande, P. Durand, and S. Carreau
Three promoters PII, PI.f, and PI.tr direct the expression of aromatase (cyp19) gene in male rat germ cells
J. Mol. Endocrinol., August 1, 2007; 39(2): 169 - 181.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Zhou, T. Suzuki, A. Kovacic, R. Saito, Y. Miki, T. Ishida, T. Moriya, E. R. Simpson, H. Sasano, and C. D. Clyne
Interactions between Prostaglandin E2, Liver Receptor Homologue-1, and Aromatase in Breast Cancer
Cancer Res., January 15, 2005; 65(2): 657 - 663.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Pezzi, R. Sirianni, A. Chimento, M. Maggiolini, S. Bourguiba, C. Delalande, S. Carreau, S. Ando, E. R. Simpson, and C. D. Clyne
Differential Expression of Steroidogenic Factor-1/Adrenal 4 Binding Protein and Liver Receptor Homolog-1 (LRH-1)/Fetoprotein Transcription Factor in the Rat Testis: LRH-1 as a Potential Regulator of Testicular Aromatase Expression
Endocrinology, May 1, 2004; 145(5): 2186 - 2196.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Catalano, S.
Right arrow Articles by Andò, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Catalano, S.
Right arrow Articles by Andò, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals