help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0391
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/5/935    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, M.
Right arrow Articles by Posner, B. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, M.
Right arrow Articles by Posner, B. I.
Molecular Endocrinology 17 (5): 935-944
Copyright © 2003 by The Endocrine Society

Gab2 Tyrosine Phosphorylation by a Pleckstrin Homology Domain-Independent Mechanism: Role in Epidermal Growth Factor-Induced Mitogenesis

Mei Kong, Catherine Mounier, Alejandro Balbis, Gerry Baquiran and Barry I. Posner

Polypeptide Hormone Laboratory, Faculty of Medicine, McGill University, Montréal, Québec, Canada H3A 2B2

Address all correspondence and requests for reprints to: Barry I. Posner, Polypeptide Hormone Laboratory, Strathcona Anatomy Building, 3640 University Street, Montréal, Québec, Canada H3A 2B2. E-mail: barry.posner{at}staff.mcgill.ca.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In primary rat hepatocyte cultures, activation of phosphatidylinositol 3-kinase is both necessary and sufficient to account for epidermal growth factor (EGF)-induced DNA synthesis. In these cells, three major p85-containing complexes were formed after EGF treatment: ErbB3-p85, Shc-p85, and a multimeric Gab2-Grb2-SHP2-p85, which accounted for more than 80% of total EGF-induced PI3K activity (Kong, M., C. Mounier, J. Wu, and B. I. Posner, J Biol Chem, 2000, 275:36035–36042). More recently, we found that EGF-dependent tyrosine phosphorylation of endogenous Gab2 is essential for EGF-induced DNA synthesis in rat hepatocytes. Here we show that, after EGF treatment, ErbB3-p85 and Shc-p85 complexes were localized to plasma membrane and endosomes, whereas the multimeric Gab2-Grb2-SHP2-p85 complex was formed rapidly (peak at 30 sec) and exclusively in cytosol. Western blotting of subcellular fractions from intact liver and immunofluorescence analyses in cultured hepatocytes demonstrated that EGF did not promote the association of cytosolic Gab2 with cell membranes. These observations prompted us to evaluate the role of the PH domain of Gab2 in regulating its function. Overexpression of the PH domain of Gab2 did not affect EGF-induced Gab2 phosphorylation, PI3K activation, and DNA synthesis. Overexpressed Gab2 lacking the PH domain ({Delta}PHGab2) was comparable to wild-type Gab2 in respect to EGF-induced tyrosine phosphorylation, recruitment of p85, and DNA synthesis. In summary, after EGF stimulation, ErbB3, Shc, and Gab2 are differentially compartmentalized in rat liver, where they associate with and activate PI3K. Our data demonstrate that Gab2 mediates EGF-induced PI3K activation and DNA synthesis in a PH domain-independent manner.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE EPIDERMAL GROWTH FACTOR (EGF)-like family, encompassing over a dozen different growth factor ligands, signals through four receptors of the ErbB family: ErbB1/EGFR, ErbB2/human EGF receptor (HER)2/Neu, ErbB3/HER3, and ErbB4/HER4. ErbB receptors undergo a variety of ligand-stimulated receptor homo- and heterodimerization events (1), allowing the generation of a broad range of intracellular signals and thus a variety of cellular responses (2). In adult liver, numerous studies have linked EGF action to organ repair through increased mitogenesis (3). The activated EGFR leads to a cascade of intracellular signaling, including activation of the phosphatidylinositol 3-kinase (PI3K) and Ras-Raf-MAPK pathways.

PI3K is an important modulator of cell survival, mitogenesis, cytoskeletal remodeling, metabolic control, and vesicular trafficking in various cell systems (4). Class I PI3K consists of a 110-kDa catalytic subunit and an 85-kDa regulatory subunit, the binding of which to phosphotyrosine residues activates the p110 subunit (5). Our previous work in primary hepatocyte cultures demonstrated that the activation of PI3K is necessary and sufficient for EGF-induced DNA synthesis (6, 7). We showed that p85 was recruited to Gab2, ErbB3, and Shc in an EGF-dependent manner with phosphotyrosine Gab2 being responsible for more than 80% of EGF-induced p85 recruitment and PI3K activation (7). More recently, we found that EGF-dependent tyrosine phosphorylation of endogenous Gab2 is essential for EGF-induced DNA synthesis in rat hepatocytes (7A ).

Gab2 belongs to a super family of docking proteins, including Gab1, Gab2, Gab3, insulin receptor substrates (IRS-1, IRS-2, IRS-3), fibroblast growth factor substrate 2, linker of T cell and downstream of kinase (for review, see Refs. 8 and 9). All Gab family proteins contain binding sites for various signaling molecules, such as the adapter molecule Grb2, the phosphotyrosine phosphatase SHP2, as well as the p85 subunit of PI3K (10, 11). In addition, all family members possess an N-terminal pleckstrin homology (PH) domain, best known for its ability to bind phosphoinositides and thus contribute to the membrane targeting of the protein (reviewed in Ref. 12). The Gab1 PH domain has been shown preferentially to bind phosphatidylinositol 3,4,5-triphosphate, a product of PI3K (13), and has been shown to be responsible for the membrane localization and signaling function of Gab1 (14, 15). The function of the PH domain in Gab2 is currently not established.

A number of studies have shown that the precise cellular location of activated receptors and/or associated signaling molecules is important in realizing cell signaling by hormones, cytokines, and growth factors (16). In the present study, we evaluated the subcellular localization of Gab2, ErbB3, and Shc after EGF treatment and the role of the PH domain of Gab2 in effecting signaling. We found that a cytosolic complex, Gab2-Grb2-SHP2-p85, accounted for approximately 80% of EGF-induced PI3K activation in liver; and that the PH domain of Gab2 is neither required for Gab2 tyrosine phosphorylation nor for its mediation of EGF-induced mitogenesis.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We recently demonstrated the critical role played by the recruitment of p85 to phosphotyrosine (PY) proteins in mediating EGF-induced PI3K activity (7) and identified three distinct p85-containing complexes in primary rat hepatocytes in response to EGF. One complex contained ErbB3, a second Shc, and a third Gab2, SHP-2, and Grb2. In the present study, we evaluated the relationship between compartmentalization of these complexes and signaling, and hence isolated hepatic subcellular fractions from EGF-treated rats to evaluate them for the presence of the different complexes after ligand administration.

Effect of EGF on the Subcellular Localization of the p85-ErbB3 Complex
We analyzed the distribution of the ErbB3 protein in rat liver after EGF injection. The ErbB3 protein, which belongs to the EGFR family, was found both in plasma membrane (PM) and endosomes (ENs), but not in the cytosol (Cyt; data not shown). We subsequently investigated the EGF-induced association of ErbB3 with p85 in these different fractions. Equal amounts of protein from each fraction were subjected to immunoprecipitation with anti-p85 antibody and were subsequently immunoblotted with an anti-ErbB3 antibody (Fig. 1AGo). No signal for ErbB3 was detected in Cyt (Fig. 1AGo, top panel). However, EGF induced the association of p85 with ErbB3 in PM and ENs with a maximum reached at 5 and 15 min, respectively; and a return of the latter to basal at 30 min (Fig. 1AGo, bottom panel). These data suggest that, upon EGF treatment, a complex containing ErbB3 and p85 is formed at the PM and then internalized into ENs. To confirm that the association with p85 reflected activated PI3K, we measured this activity, at the time of maximal association in PM and ENs, in an anti-ErbB3 immunoprecipitate. As shown in Fig. 1BGo, there was a 2-fold increase in the ErbB3-associated PI3K activity in both PM and ENs 5 and 15 min after EGF injection, respectively.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Subcellular Distribution and Associated PI3K Activity of the ErbB3-p85 Complex in Rat Liver

After fasting overnight, rats received a single intrajugular dose of EGF (1 µg/100 g BW), and were killed at the noted times thereafter. PM ({circ}), EN ({bullet}), and Cyt were prepared as described in Materials and Methods. A, Aliquots of each fraction (500 µg protein) were immunoprecipitated with {alpha}p85. Immunoprecipitates were resolved on 7.5% SDS-PAGE and subjected to immunoblotting with {alpha}ErbB3. Upper panel, Representative immunoblots at different times after injection of EGF. Lower panel, Levels of ErbB3 in {alpha}p85 immunoprecipitates were quantified using scanning densitometry and the results plotted as a percentage of the maximum value obtained (PM, 5 min after EGF treatment). Each point is the mean ± SE of three separate experiments. B, Aliquots (500 µg protein) from PM and ENs were immunoprecipitated with {alpha}ErbB3 and analyzed for PI3K activity as described in Materials and Methods. Upper panel, Autoradiograph of a representative experiment indicating the location of the reaction product, phosphatidylinositol-3-phosphate (PIP3). Lower panel, quantification of the PIP3s generated in PM and ENs fractions 5 or 15 min post EGF injection, respectively. Results are expressed as the percentage of basal activity (that in non-EGF-treated rats) in each fraction (mean ± SE, three separate experiments).

 
Effect of EGF on the Subcellular Localization of the p85-Shc Complex
To investigate the subcellular localization of the p85-Shc complex in rat liver, we performed the same experiments as described for the p85-ErbB3 complex. Cyt, PM, and EN fractions were subjected to immunoprecipitation with anti-p85 antibody and subsequently immunoblotted with an anti-Shc antibody (Fig. 2AGo). Although Shc proteins were detected in all subcellular fractions (data not shown), we could not observe any association of Shc with p85 in Cyt (Fig. 2AGo, top panel). In PM, Shc association with p85 reached a maximum at 30 sec and declined rapidly thereafter (Fig. 2AGo, middle panel). In ENs, its association with p85 increased from 30 sec, reached a maximum at 5 min, and then declined (Fig. 2AGo, bottom panel). These data suggest that, upon EGF treatment, a complex of the adapter protein Shc and p85 is formed at the PM and undergoes rapid internalization into ENs. As shown in Fig. 2BGo, Shc-associated PI3K activity increased about 2.5-fold in PM and 2-fold in ENs at 30 sec and 5 min, respectively, after EGF injection.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Subcellular Distribution and Associated PI3K Activity of the Shc-p85 Complex in Rat Liver

After fasting overnight, rats received a single intrajugular dose of EGF (1 µg/100 g BW), and were killed at the noted times thereafter. PM ({circ}), EN ({bullet}), and Cyt were prepared as described in Materials and Methods. A, Aliquots (500 µg protein) were immunoprecipitated with {alpha}p85. Immunoprecipitates were resolved on 7.5% SDS-PAGE and subjected to immunoblotting with {alpha}Shc. Upper panel, representative immunoblot at different times after EGF. Lower panel, Levels of Shc in {alpha}p85 immunoprecipitates were quantified using scanning densitometry and the results plotted as a percentage of the maximum value obtained (PM, 0.5 min after EGF treatment). Each point is the mean ± SE of three separate experiments. B, Aliquots (500 µg protein) immunoprecipitated with {alpha}Shc were analyzed for PI3K activity as described in Materials and Methods. Upper panel, Autoradiograph of a representative experiment indicating the location of the reaction product (PIP3). Lower panel, quantification of the PIP3s in PM and ENs 0.5 or 5 min, respectively, after EGF injection. Results are expressed as the percentage of basal values (non-EGF-treated rats) for each fraction (mean ± SE, three separate experiments).

 
Effect of EGF on the Subcellular Distribution of the Gab2-SHP2-Grb2-p85 Complex
We have previously shown that a multimeric Gab2-SHP2-Grb2-p85 complex accounts for 80% of the total EGF-induced PI3K activity in rat primary hepatocytes (7). First we assessed the subcellular localization of Gab2 upon EGF stimulation, using Western blot analyses on equal amounts (100 µg) of protein from intact samples of Cyt, PM, and ENs. As shown in Fig. 3AGo, Gab2 is detected in each subcellular fraction, although with different intensities. It is barely detectable in ENs but seems to be more concentrated in the PM. It is noteworthy that, although the Gab2 protein bands in Cyt are weaker than in PM, the main bulk of the Gab2 protein is localized in the cytosolic fraction because the amount of cytosolic protein obtained per gram of liver (~50 mg) far exceeds that isolated in PM (~0.3 mg) and endosomal fractions (~0.5 mg) (Ref. 17).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 3. Subcellular Localization of the Gab2-Grb2-SHP2-p85 Complex in Rat Liver

After fasting overnight, rats received a single intrajugular dose of EGF (1 µg/100 g BW) and were killed at the noted times thereafter. PM, EN, and Cyt were prepared as described in Materials and Methods. Panels show representative immunoblots of three separate experiments performed in each case, with the times after EGF injection indicated in minutes. A, 100 µg protein of each fraction were subjected to SDS-PAGE, transferred to Immobilon-P membranes, and immunoblotted with {alpha}Gab2. B, Aliquots of each fraction (500 µg protein) were immunoprecipitated with {alpha}p85, resolved on 7.5% SDS-PAGE and subjected to immunoblotting with {alpha}Gab2. For C and D, aliquots of each fraction (500 µg protein) were immunoprecipitated with {alpha}Gab2, resolved on 12.5% SDS-PAGE, and then subjected to immunoblotting with either {alpha}Grb2 or {alpha}SHP2, respectively.

 
We then assessed the subcellular distribution of Gab2-p85 complexes after EGF treatment. Protein (500 µg) from Cyt, PM, and ENs was subjected to immunoprecipitation with {alpha}p85 and immunoblotted with {alpha}Gab2. As seen in Fig. 3BGo, EGF treatment induced a rapid association of Gab2 with p85 in all three subcellular fractions. In ENs, we detected an increased association at 30 sec after EGF treatment. However, the intensity of the detected complex was much lower than that observed in PM and Cyt. In PM, EGF also induced the association of Gab2 to p85 at 30 sec after EGF treatment reaching a maximum at 2 min and returning to basal levels by 15 min post injection. In Cyt, the maximal association was observed at 30 sec and was followed by a rapid decrease to basal levels by 15 min post injection. Thus, Gab2 associates with p85 principally in PM and Cyt, reaching a maximal association at 2 min and 30 sec, respectively. This time course suggests that the activation of PI3K is initiated by its association with cytosolic Gab2.

In further studies, we analyzed the association of the two other Gab2 binding partners, Grb2 and SHP2, in each subcellular fraction. Proteins were first immunoprecipitated with anti-Gab2 antibody and then immunoblotted with either {alpha}Grb2 or {alpha}SHP2 (Fig. 3Go, C and D, respectively). Grb2 and SHP2 were found in all three subcellular fractions. However, after EGF treatment Grb2 was found to associate with Gab2 only in the Cyt. Furthermore, this EGF-induced increase in association was rapid and transient [150.8 ± 7.1% above control (mean ± SE, n = 3; P < 0.03) at 30 sec after EGF] (Fig. 3CGo). SHP2 and Gab2 were also found to associate only in the Cyt after EGF treatment (Fig. 3DGo). The maximum increase observed was 158.7 ± 10.0% above control (mean ± SE, n = 3; P < 0.01) at 30 min post EGF. However, in contrast to Grb2, this interaction, which was detectable at 30 sec, was sustained up to 30 min after EGF treatment. Taken together, our data show that ErbB3-p85 and Shc-p85 complexes were localized to PM and ENs, whereas the multimeric Gab2-Grb2-SHP2-p85 complex was detected exclusively in Cyt.

Localization of Gab2 by Immunofluorescence
We were unable to detect any significant net translocation of Gab2 from the Cyt to either PM or ENs upon EGF stimulation (Fig. 3AGo). To further assess these findings, we studied the effect of EGF on the cellular distribution of overexpressed Gab2 using confocal immunofluorescence microscopy (Fig. 4Go). As can be seen, no fluorescence was detected in LacZ infected cells, but strong cytosolic staining was visualized in hemagglutinin (HA)-wild-type Gab2 (WTGab2) infected cells. EGF treatment for 1 or 5 min did not alter the pattern of cytosolic staining, suggesting that EGF treatment had minimal or no effect on recruitment of Gab2 to PM.



View larger version (123K):
[in this window]
[in a new window]
 
Figure 4. Immunolocalization of WTGab2 in Hepatocytes after EGF Treatment

Primary hepatocytes were infected with either LacZ or WTGab2 adenoviruses. Cell were grown for 48 h on glass coverslips and then stimulated or not by 100 ng/ml EGF for the indicated times. Cells were then treated as described in Materials and Methods and labeled with anti-HA followed by fluorescein isothiocyanate-conjugated antirabbit. Cells were visualized with a confocal microscope and photographs were taken at a magnification of x60.

 
Role of the PH Domain in Gab2 Activation
Various studies have demonstrated that the PH domain in IRSs and Gab1 facilitate phosphorylation and activation of these molecules by directing their recruitment to membranes through binding to PIP3 (9, 18, 19). Furthermore overexpression of the PH domain of Gab1 suppresses Gab1-mediated responses (i.e. acts as a dominant negative; Ref. 13). We found that, after in vivo EGF treatment, Gab2 did not undergo net translocation to membranes but rather formed a multimeric complex with p85 in the Cyt (Figs. 3Go and 4Go). We sought to examine the role of the PH domain of Gab2 on its phosphorylation and downstream signaling. We therefore constructed two recombinant adenoviruses (see Material and Methods), one containing the entire PH domain of Gab2 linked to a Myc epitope (PHGab2) and one where the PH domain was deleted from the full-length Gab2 sequence ({Delta}PHGab2). Hepatocytes infected with PHGab2 containing recombinant adenovirus readily expressed the Myc tagged molecule (Fig. 5AGo, lower panel, lanes 3 and 4). Overexpression of PHGab2 did not interfere with EGF-induced phosphorylation of endogenous Gab2 (Fig. 5AGo, upper panel, compare lanes 2 and 4), EGF-induced PI3K activation (Fig. 5BGo, upper panel, compare lanes 2 and 4), Akt phosphorylation (Fig. 5CGo, upper panel, compare lanes 2 and 4), or DNA synthesis (Fig. 5DGo, compare black bars). Western blot analyses of PM/mitochondria/nuclei (PMN) and cytosolic fractions from LacZ or PHGab2 infected primary hepatocytes showed that overexpressed PHGab2 was exclusively detected in PMN independent of EGF treatment (Fig. 5EGo). However, the expression of PHGab2 minimally affected the amount of endogenous Gab2 present in membrane fractions (Fig. 5EGo, top panel, compare lanes 1 and 2 vs. 3 and 4).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 5. Effect of Overexpression of PHGab2 on EGF-Induced Gab2 Phosphorylation and Activation of Downstream Responses

Hepatocytes were infected with 10 moi LacZ, WTGab2 or PHGab2 recombinant adenoviruses for 3 h and then starved for 48 h. A, Serum-deprived hepatocytes were treated with (+) or without (-) 100 ng/ml EGF for 1 min. Upper panel, Cell lysates were immunoprecipitated with {alpha}Gab2, subjected to SDS-PAGE (7.5% gel) followed by immunoblot analysis with {alpha}PY. Lower panel, Cell lysates were subjected to SDS-PAGE (7.5% gel) followed by immunoblot analysis with {alpha}Myc. B, Serum-deprived hepatocytes were treated with (+) or without (-) 100 ng/ml EGF for 1 min. Upper panel, Cell lysates were immunoprecipitated with {alpha}Gab2 and immunoprecipitated proteins were subjected to PI3K activity assay. Lower panel, Cell lysates were subjected to SDS-PAGE (7.5% gel) followed by immunoblot analysis with {alpha}Myc. C, Serum-deprived hepatocytes were treated with (+) or without (-) 100 ng/ml EGF for 5 min. Cell lysates were subjected to SDS-PAGE (10% gel) followed by immunoblot analysis with an anti-phospho-Akt473 (top panel), {alpha}Akt (middle panel) or {alpha}Myc (bottom panel). D, Virus-infected hepatocytes were starved for 24 h before an 18-h incubation in serum-free medium containing 5 µCi of [3H] methylthymidine without (hatched bars) or with 100 ng/ml EGF (black bars). Incorporation of [3H]methylthymidine into DNA was determined as described in Materials and Methods. Results are expressed as fold over basal level (LacZ cells; mean ± SE, three separate experiments). E, Serum-deprived hepatocytes were treated with (+) or without (-) 100 ng/ml EGF for 1 min. PMN and Cyt were prepared as described in Materials and Methods. One hundred micrograms of protein of PMN and 10 µg protein of Cyt were subjected to 10% SDS-PAGE, transferred to Immobilon-P membranes, and immunoblotted with {alpha}Gab2 (upper panel) or {alpha}Myc (lower panel).

 
We further examined the significance of the PH domain using {Delta}PHGab2, the Gab2 construct lacking the entire PH domain. As seen in Fig. 6AGo, overexpressed {Delta}PHGab2 is tyrosine phosphorylated upon EGF treatment to a similar extent as overexpressed WTGab2 (top panel) and can similarly recruit p85 (middle panel). Furthermore {Delta}PHGab2 potentiated EGF-induced thymidine incorporation into DNA to a comparable extent as WTGab2 (Fig. 6BGo). Finally, we evaluated the effect of the PH domain deletion on Gab2 distribution by performing Western blot analyses of PMN and cytosolic fractions from primary hepatocytes infected with WTGab2 or {Delta}PHGab2. As seen in Fig. 6CGo, both overexpressed WTGab2 and {Delta}PHGab2 were detected in Cyt and the PMN. Interestingly, compared with WTGab2, there was less {Delta}PHGab2 bound to membranes even though {Delta}PHGab2 equally potentiated EGF-induced DNA synthesis with the WTGab2. Surprisingly, EGF treatment further reduced membrane-associated {Delta}PH Gab2 (48.3±0.25%, mean ± 1/2 range, n = 2) compared with non-EGF treated. Taken together, these observations indicate that the PH domain of Gab2 is not required for the EGF-induced tyrosine phosphorylation of Gab2 and downstream signaling.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 6. Effect of Overexpression of {Delta}PHGab2 on EGF-Induced Gab2 Phosphorylation and DNA Synthesis

A, Hepatocytes were infected with 10 moi WTGab2 or {Delta}PHGab2 recombinant adenoviruses for 3 h and then starved for 48 h. Serum-deprived hepatocytes were treated with (+) or without (-) 100 ng/ml EGF for 1 min. Cell lysates were immunoprecipitated with {alpha}Gab2, subjected to SDS-PAGE (7.5% gel) followed by immunoblot analysis with {alpha}PY (top panel) or {alpha}p85 (middle panel). The membrane was then striped and reblotted with {alpha}Gab2 (bottom panel). B, Hepatocytes were infected with 10 moi LacZ, WTGab2 or {Delta}PHGab2 recombinant adenoviruses for 3 h. Virus-infected hepatocytes were starved for 24 h before an 18-h incubation in serum-free medium containing 5 µCi of [3H] methylthymidine without (hatched bars) or with 100 ng/ml EGF (black bars). Incorporation of [3H]methylthymidine into DNA was determined as described in Materials and Methods. Results are expressed as fold over basal level (LacZ cells; mean ± SE, four separate experiments). C, Serum-deprived hepatocytes were treated with (+) or without (-) 100 ng/ml EGF for 1 min. PMN and Cyt were prepared as described in Materials and Methods. One hundred micrograms of protein of PMN and 10 µg protein of Cyt were subjected to 7.5% SDS-PAGE, transferred to Immobilon-P membranes, and immunoblotted with {alpha}HA.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
We previously showed that EGF-induced PI3K activation is critical for its ability to promote mitogenesis in rat hepatocytes. We found that EGF stimulated the association of p85 with three different tyrosine phosphorylated molecules and determined these to be ErbB3, Shc, and Gab2, with the latter constituting approximately 80% of EGF-induced PI3K activation (7). The importance of Gab2 in this process has been confirmed in more recent work in which we demonstrated that EGF induced tyrosine phosphorylation of Gab2, and not ErbB3 or Shc, is via a Gab2-associated src family kinase. The prevention of Gab2 tyrosine phosphorylation prevented EGF-induced DNA synthesis (7A ). A number of studies have now shown that ligand-induced compartmentalization of key signaling molecules is important for transducing at least some aspects of the downstream response (16, 20). Therefore, in the present study, we determined the hepatic subcellular localization of the p85-containing complexes formed after EGF stimulation. Our observation that the p85-Gab2 complex largely accumulated in Cyt led us to study the significance of the PH domain of Gab2 on its function. Interestingly, we observed that both the tyrosine phosphorylation of Gab2 and EGF mitogenesis occur in a PH domain-independent manner.

Subcellular Localization of p85-Containing Complexes
The association of ErbB3 with p85 after EGF treatment leads to PI3K activation both in PM and ENs. The time course of association was consistent with translocation of ErbB3-p85 from PM to ENs. Previous studies have documented an association of ErbB3 with Shc upon EGF treatment (21, 22). Although we detected an association between p85 and Shc in PM and ENs, we were unable to detect any association between ErbB3 and Shc arguing against the formation of an ErbB3-Shc-p85 complex in liver (7). Although a role for Shc in the regulation of PI3K activity has been previously noted, this appeared to be through its association with the docking proteins Gab1 (23) and Gab2 (24). However, Gab1 is not expressed in liver, and after EGF treatment we found that Shc did not associate with Gab2 (7). Rather, in liver Shc seems to be directly involved in EGF-induced activation of PI3K.

In the present study, Gab2-p85 association was detected in Cyt, PM, and ENs. However, the multimeric Gab2-SHP2-Grb2-p85 complex was found exclusively in Cyt. In previous work, we demonstrated that in primary hepatocyte cultures EGF induced the formation of a Gab2-SHP2-Grb2-p85 complex without evidence for other Gab2-containing complexes (7). This probably reflects the fact that, in hepatocyte lysates, cytosolic proteins predominate, and less abundant complexes are difficult to observe. In the present in vivo studies, the isolated PM and ENs were enriched in their associated proteins, allowing identification of the lower abundance Gab2-p85 complexes in these cellular compartments. Our data are consistent with the possibility that the majority of EGF-induced PI3K activation is initiated in Cyt because: 1) the association of Gab2 with p85 reaches peak activity at 30 sec in Cyt but only by 2 min in PM; and 2) the multimeric complex Gab2-SHP2-Grb2-p85, which accounts for over 80% of the total PI3K, is exclusively found in Cyt.

An important question is how activated PI3K associated with Gab2 accesses its membrane substrate(s). One possibility is that the cytosolic Gab2 complex loosely associates with membranes in vivo in a dynamic manner, permitting a catalytic interaction between PI3K and its lipid substrates. It is also possible that membrane-associated Gab2 plays a critical role in signaling. Thus, EGF induced tyrosine phosphorylation of membrane-associated Gab2, and the recruitment of PI3K to this pool of Gab2, may occur independently from the effect of EGF on cytosolic Gab2. It is also possible that, after EGF treatment, PI3K is activated first in the Cyt and then translocated to the PM. The fact that tyrosine phosphorylated Gab2-p85 was maximal in the Cyt at 30 sec and in PM at 2 min (Fig. 3BGo) is consistent with this possibility. Our current data do not permit us to distinguish amongst these different possibilities.

Gab2 Phosphorylation and Membrane Localization Are PH Domain Independent
Our data demonstrate that Gab2 membrane concentration does not change after EGF treatment. This is based on our immunofluorescence studies showing no recruitment of HA-tagged WTGab2 to the PM (Fig. 4Go), the absence of EGF-induced net translocation of Gab2 to PM in vivo (Fig. 3AGo), the cytosolic location of the bulk of the Gab2-p85 complex (Fig. 3Go, C and D), and the lack of Gab2 association with the EGFR (7) after EGF treatment. Various studies have established the essential role of the PH domain for Gab1 tyrosine phosphorylation and membrane translocation (13, 14, 15, 25). The PH domain of IRS1 is also critical for insulin-induced tyrosine phosphorylation and association of IRS1 with the IR (18, 19). In contrast to what has been observed with these docking proteins, overexpressing PHGab2 did not inhibit EGF-induced Gab2 phosphorylation, PI3K, or Akt activation or DNA synthesis in primary rat hepatocytes, although it was completely bound to cell membranes (Fig. 5Go). Furthermore we found that {Delta}PHGab2 was comparable to WTGab2 in respect to the extent of tyrosine phosphorylation, association with p85, and potentiation of DNA synthesis (Fig. 6Go). Thus, the PH domain of Gab2 is not necessary for EGF-induced tyrosine phosphorylation and function of Gab2.

In these studies, overexpressed PHGab2 did not significantly decrease the membrane association of endogenous Gab2, and {Delta}PHGab2 was found to associate with membranes, suggesting that the PH domain of Gab2 is not required for its membrane targeting. Analysis of the Gab2 sequence suggests that the association of Gab2 with membranes may be mediated by two myristoylation sites located at amino acids 74–79 (GLTFNK) and 412–417(GSGESA) of the Gab2 protein. Interestingly, compared with WTGab2, a smaller proportion of {Delta}PHGab2 was found associated with membranes. This may reflect the loss of one of the myristoylation sites within the deleted PH domain. Despite the fact that the amount of membrane bound {Delta}PHGab2 in PM was decreased, {Delta}PHGab2 equally potentiated EGF-induced signaling as WTGab2. This suggests that the cytosolic form of Gab2 might be important for EGF induced PI3K activation and DNA synthesis.

The present work is compatible with the study of others showing that, in BAF3 cells, IL-3 induced comparable tyrosine phosphorylation of Gab2 and {Delta}PHGab2 (24). By contrast, after EGF treatment Gab1 recruitment to PM has been clearly demonstrated (13, 14). Therefore, although Gab1 and Gab2 are closely related, they appear to be activated by different mechanisms. These two docking proteins also seem to play a nonredundant role in RTK signaling because they exhibit overlapping but distinct expression patterns (10) and reciprocal effects in mediating Elk-1 induction (26). Furthermore, Gab1 and Gab2 knockout mice exhibit different phenotypes (27, 28, 29). The fact that Gab2 is tyrosine phosphorylated by src family kinases (7A ) may explain the lack of dependence of this process on the PH domain of Gab2.

In conclusion, we show that, in normal rat hepatocytes, EGF action involves the formation of three distinct p85-containing complexes. The most abundant multimeric Gab2-p85-Grb2-SHP2 complex is detected exclusively in Cyt, whereas the other two complexes are found in the PM and ENs. In contrast to what has been found with Gab1 and IRS1, EGF-induced Gab2 phosphorylation and DNA synthesis occurs in a PH domain-independent manner.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Animals
For the in vivo studies, 160–180 g female Sprague Dawley rats (Charles River Laboratories, Inc., St. Constant, Québec, Canada) were housed at 25 C in an animal facility with a 12-h light, 12-h dark cycle and fed ad libitum. All animals were fasted 16–18 h before use.

Materials
Mouse EGF was obtained from Collaborative Biomedical Products (Bedford, MA). Collagenase was from Worthington Biochemical Corp. (Halls Mills Road, NJ). Cell culture medium and antibiotics were from Invitrogen (Burlington, Ontario, Canada). Vitrogen-100 was from Collagen Corp. (Toronto, Canada). [3H]-methylthymidine, [125I]-labeled goat antirabbit antibody ([125I]-GAR) was from ICN Biomedicals Canada Ltd. (Mississauga, Ontario, Canada). [{gamma}-32P]ATP was purchased from Perkin-Elmer Life Science (Wilmington, DE). Protein A-Sepharose was from Amersham Biosciences (Montréal, Québec, Canada). The anti-PY antibody (PY99), Grb2, SHP2, and HA antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The p85, ErbB3, Shc, Myc, and Gab2 (for immunoblotting) antibodies were from Upstate Biotechnology, Inc. (Lake Placid, NY). Phospho-Akt473, Akt, phospho-Erk1/2, Erk1/2 were from New England Biolabs, Inc. (Beverly, MA). All other reagents were obtained from Sigma (St. Louis, MO) and were of the highest grade available.

Generation of a Gab2 Antibody
A glutathione-S-transferase (GST)-Gab2 fusion construct containing the amino acids 376–552 of the rat Gab2 cDNA sequence (7) was generated by PCR with 5'-ACTGGGATCCAGATCTGTAGCTGCTACTATCC as the sense primer and 5' CCCTTAGTACTGGGAGGAACTGGAG as the antisense primer. The amplified product was digested with SmaI and BamHI and then subcloned into the corresponding sites of the pGEX 4T-1 vector (Amersham Biosciences, Baie d’ Urfé, Québec, Canada). Ligated DNAs were transformed into E. coli strain DH5{alpha}, and colonies were screened for the correct insert by restriction digestion. GST fusion proteins were prepared from DH5{alpha} lysates by adsorption to glutathione-agarose as described in the Amersham Biosciences GST Gene Fusion System manual and were used to immunize rabbits. The anti-Gab2 antibody generated was used for immunoprecipitation studies.

Preparation of Subcellular Fractions
Rats were anaesthetized and killed by decapitation after intrajugular injections of EGF at the indicated times in the text [1 µg/100 g body weight (BW)]. Livers were rapidly excised, and minced at scissor point in ice-cold buffer (5 mM Tris-HCl buffer at pH 7.4, containing 0.25 M sucrose, 1 mM benzamidine, 1 mM PMSF, 1 mM MgCl2, 2 mM NaF, and 2 mM sodium orthovanadate). PM, ENs, and Cyt were prepared as previously described (30). Plasma PMN and Cyt were prepared from primary hepatocytes as previously described (31). The protein content of these fractions was measured using a modification of Bradford’s method with BSA as standard (32).

Preparation of the Gab2 Mutants
The PH domain of Gab2 and {Delta}PH Gab2 constructs were generated by PCR amplification of cDNA sequences encoding amino acids 1–119 and 120–666 of rat Gab2, respectively. These constructs were then verified by DNA sequencing. To produce the adenoviruses, mutants as well as the full-length cDNA were first subcloned into pShuttle between the NheI and NotI sites using 5'-oligonucleotides containing an NheI site and the sequences encoding different tags (HA for WTGab2 and {Delta}PH Gab2, Myc for PHGab2) and 3'-oligonucleotides containing a NotI site. The adenoviral DNAs were further generated using the Adeno-X expression system (CLONTECH Laboratories, Inc., Palo Alto, CA) according to the manufacturer’s instructions.

Adenovirus Production and Titration
Large-scale production of recombinant viral particles was performed by infecting 293A cells. The titer of viral particles was determined using the Tissue Culture Infectious Dose 50 (TCID50) method as described in the protocol of the Ad-easy vector system (Qbiogene, Carlsbad, CA).

Cell Culture and Viral Infection
Primary hepatocytes were prepared as previously described (7). Cells were first bathed for 24 h in seeding medium DMEM/Ham’s F-12 containing 10% FBS, 10 mM HEPES, 20 mM NaHCO3, 500 IU/ml penicillin, and 500 µg/ml streptomycin) and then infected with different adenoviruses for 3 h at 37 C. The infected cells were serum-starved for 48 h in serum-free medium before harvesting.

Immunoprecipitation and Immunoblotting
Cell fractions were incubated in 1% (vol/vol) Triton X-100 and 0.5% (wt/vol) sodium deoxycholate at 4 C for 1 h. Cell lysates, prepared as previously described (7), from EGF-treated (100 ng/ml EGF) or nontreated cells were precleared with nonimmune rabbit IgG (Sigma) and protein A-Sepharose for 1 h at 4 C. After centrifugation, the resulting supernatants were incubated for 2 h at 4 C with the antibody indicated in the figure legend. Protein A-Sepharose (50 µl of a 50% slurry) was added to each sample, and the incubation was continued for an additional hour. Immune complexes were isolated by centrifugation, washed three times in PBS, and boiled in Laemmli sample buffer. Immunoprecipitates or intact samples where subjected to SDS-PAGE, transferred to Immobilon-P membranes (Millipore Ltd., Mississauga, Ontario, Canada), and immunoblotted with the indicated first antibody for 90 min followed by 1 h incubation with horseradish peroxidase-, or [125I]-labeled GAR or goat antimouse antibody (GAM) IgG. Immunoreactive proteins were detected by autoradiography or by ECL system (Amersham Biosciences). Densitometric quantification of the signals was performed using a densitometer (Model GS-700, Bio-Rad Laboratories, Inc., Hercules, CA).

PI3K Activity Assay
Cell fractions or cell lysates (500 µg protein) were subjected to immunoprecipitation with Protein A-Sepharose and the antibodies indicated in the figure legends. Immunoprecipitates were extensively washed, and the immune complexes were resuspended in 50 µl of kinase assay buffer (20 mM Tris-HCl, pH 7.5; 100 mM NaCl; 0.5 mM EGTA) containing 0.5 mg/ml L-{alpha}-phosphatidylinositol (Avanti Polar Lipids, Inc., Alabaster, AL), and assayed for PI3K activity as previously described (6).

[3H]-Thymidine Incorporation Assay
Infected cells were serum-starved for 20 h in serum-free medium, then 100 ng/ml EGF and [3H]methylthymidine (5 µCi/ml) were added to the medium. After an 18-h incubation, cells were rinsed three times with 3 ml cold PBS, incubated for 15 min at 4 C in 10% trichloro-acetic acid, solubilized at room temperature in 1 ml 1 N NaOH, neutralized with 1 ml 1 N HCl, and transferred to scintillation vials for counting of [3H].

Immunofluorescence
Primary hepatocytes were plated on glass coverslips (Fisher Scientific, Ottawa, Ontario, Canada) in a 6-well dish. Cells were infected with an HA epitope-tagged Gab2-expressing adenovirus. After 48 h of starvation, cells treated with or without 100 ng/ml EGF were fixed in 4% paraformaldehyde for 10 min at room temperature, washed five times in PBS, and incubated for 5 min in 0.5% Triton to permeabilize the cells. After washing, the cells were treated with PBS containing 0.5 mg/ml NaBH4 for 10 min at room temperature. After the wash, {alpha}HA antibody, at a 1:200 dilution in PBS containing 5% BSA, was added to the cells for 1 h (room temperature). After washing, the secondary antibody (anti-GAR IgG fluorescein isothiocyanate-conjugated, Sigma), at a 1:300 dilution in the same buffer, was added for 1 h (room temperature). After four to five final washes, the glass coverslips were mounted onto slides (Gold Seal, Portsmouth, NH) in moviol medium (Calbiochem, San Diego, CA) and visualized using an Axiovert 135 confoncal microscope (Carl Zeiss, Jena, Germany). Photographs were taken using a Carl Zeiss LSM microsystem.


    ACKNOWLEDGMENTS
 
We appreciate the continuing generosity of the Cleghorn Fund at McGill University, and the Maurice Pollack Foundation of Montréal. We thank Christian Band for his critical reading of the manuscript.


    FOOTNOTES
 
This work was supported by the Medical Research Council and the National Cancer Institute of Canada.

Abbreviations: Cyt, Cytosol; EGF, epidermal growth factor; Gab1, Grb2-associated binder 1; Gab2, Grb2-associated binder 2; GAR, goat antirabbit antibody; Grb2, growth factor receptor bound 2; GST, glutathione-S-transferase; HA, hemagglutinin; HER, human EGF receptor; IRS, insulin receptor substrate; moi, multiplicity of infection; PH domain, pleckstrin homology domain; PI3K, phosphatidylinositol 3-kinase; PM, plasma membrane; PMN, PM/mitochondria/nuclei; PY, phosphotyrosine; SHP2, src homology 2 domain-containing protein tyrosine phosphatase-2.

Received for publication November 21, 2002. Accepted for publication February 10, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Sweeney C, Carraway III KL 2000 Ligand discrimination by ErbB receptor: differential signaling trough differential phosphorylation site usage. Oncogene 19:5568–5573[CrossRef][Medline]
  2. Riese 2nd DJ, Stern DF 1998 Specificity within the EGF family/ErbB receptor family signaling network. Bioessays 20:41–48[CrossRef][Medline]
  3. Marti U, Burwen SJ, Jones AL 1989 Biological effects of epidermal growth factor, with emphasis on the gastrointestinal tract and liver: an update. Hepatology 9:126–138[Medline]
  4. Fruman DA, Meyers RE, Cantley LC 1998 Phosphoinositide kinases. Annu Rev Biochem 67:481–507[CrossRef][Medline]
  5. Fruman DA, Cantley LC, Carpenter CL 1996 Structural organization and alternative splicing of the murine phosphoinositide 3-kinase p85{alpha} gene. Genomics 37:113–121[CrossRef][Medline]
  6. Band CJ, Mounier C, Posner BI 1999 Epidermal growth factor and insulin-induced deoxyribonucleic acid synthesis in primary rat hepatocytes is phosphatidylinositol 3-kinase dependent and dissociated from protooncogene induction. Endocrinology 140:5626–5634[Abstract/Free Full Text]
  7. Kong M, Mounier C, Wu J, Posner BI 2000 Epidermal growth factor-induced phosphatdylinositol 3-kinase activation and DNA synthesis: identification of Grb2-associated binder 2 as the major mediator in rat hepatocytes. J Biol Chem 275:36035–36042[Abstract/Free Full Text]
  8. Kong M, Mounier C, Dumas V, Posner BI 2003 Epidermal growth factor-induced DNA synthesis. Key role for Src phosphorylation of the docking protein Gab2. J Biol Chem 278:5837–5844[Abstract/Free Full Text]
  9. White MF 1998 The IRS-signalling system: a network of docking proteins that mediate insulin action. Mol Cell Biochem 182:3–11[CrossRef][Medline]
  10. Liu Y, Rohrschneider LR 2002 The gift of Gab. FEBS Lett 515:1–7[CrossRef][Medline]
  11. Gu H, Pratt JC, Burakoff SJ, Neel BG 1998 Cloning of p97/Gab2, the major SHP2-binding protein in hematopoietic cells, reveals a novel pathway for cytokine-induced gene activation. Mol Cell 2:729–740[CrossRef][Medline]
  12. Nishida K, Yoshida Y, Itoh M, Fukada T, Ohtani T, Shirogane T, Atsumi T, Takahashi-Tezuka M, Ishihara K, Hibi M, Hirano T 1999 Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B-cell antigen receptors. Blood 93:1809–1816[Abstract/Free Full Text]
  13. Lemmon MA, Ferguson KM 2000 Signal-dependent membrane targeting by pleckstrin homology (PH) domains. Biochem J 350(Part 1):1–18
  14. Rodrigues GA, Falasca M, Zhang Z, Ong SH, Schlessinger J 2000 A novel positive feedback loop mediated by the docking protein Gab1 and phosphatidylinositol 3-kinase in epidermal growth factor receptor signaling. Mol Cell Biol 20:1448–1459[Abstract/Free Full Text]
  15. Maroun CR, Holdago-Madruga M, Royal I, Naujokas MA, Fournier TM, Wong AJ, Park M 1999 The Gab1 PH domain is required for localization of Gab1 at sites of cell-cell contact and epithelial morphogenesis downstream from the met receptor tyrosine kinase. Mol Cell Biol 19:1784–1799[Abstract/Free Full Text]
  16. Maroun CR, Moscatello DK, Naujokas MA, Holgado-Madruga M, Wong AJ, Park M 1999 A conserved inositol phospholipid binding site within the pleckstrin homology domain of the Gab1 docking protein is required for epithelial morphogenesis. J Biol Chem 274:31719–31726[Abstract/Free Full Text]
  17. Sorkin A, Von Zastrow M 2002 Signal transduction and endocytosis: close encounters of many kinds. Nat Rev Mol Cell Biol 3:600–614[CrossRef][Medline]
  18. Bergeron JJ, Posner BI, Josefsberg Z, Sikstrom R 1978 Intracellular polypeptide hormone receptors. The demonstration of specific binding sites for insulin and human growth hormone in Golgi fractions isolated from the liver of female rats. J Biol Chem 253:4058–4066[Free Full Text]
  19. Myers Jr MG, Grammer TC, Brooks J, Glasheen EM, Wang LM, Sun XJ, Blenis J, Pierce JH, White MF 1995 The pleckstrin homology domain in insulin receptor substrate-1 sensitizes insulin signaling. J Biol Chem 270:11715–11718[Abstract/Free Full Text]
  20. Yenush L, Makati KJ, Smith-Hall J, Ishibashi O, Myers Jr MG, White MF 1996 The pleckstrin homology domain is the principal link between the insulin receptor and IRS-1. J Biol Chem 271:24300–24306[Abstract/Free Full Text]
  21. Balbis A, Baquiran G, Bergeron JJ, Posner BI 2000 Compartimentalization and insulin-induced translocations of insulin receptor substrates, phosphatidylinositol 3-kinase, and protein kinase B in rat liver. Endocrinology 141:4041–4049[Abstract/Free Full Text]
  22. Pringent SA, Gullick WG 1994 Identification of c-erbB-3 binding sites for phosphatidylinositol 3-kinase and SHC using an EGF receptor/c-erbB-3 chimera. EMBO J 13:2831–2841[Medline]
  23. Vijapurkar U, Cheng K, Koland JG 1998 Mutation of a Shc binding site tyrosine residue in ErbB3/HER3 blocks heregulin-dependent activation of mitogen-activated protein kinase. J Biol Chem 273:20996–21002[Abstract/Free Full Text]
  24. Hayashi H, Ichihara M, Iwashita T, Murakami H, Shimono Y, Kawai K, Kurokawa K, Murakumo Y, Imai T, Funahashi H, Nakao A, Takahashi M 2000 Characterization of intracellular signals via tyrosine 1062 in RET activated by glial cell line-derived neurotrophic factor. Oncogene 19:4469–4475[CrossRef][Medline]
  25. Gu H, Maeda H, Moon JJ, Lord JD, Yoakim M, Nelson BH, Neel BG 2000 New role for Shc in activation of the phosphatidylinositol 3-kinase/Akt pathway. Mol Cell Biol 20:7109–7120[Abstract/Free Full Text]
  26. Ingham RJ, Santos L, Dang-Lawson M, Holgado-Madruga M, Dudek P, Maroun CR, Wong AJ, Matsuuchi L, Gold MR 2001 The Gab1 docking protein links the b cell antigen receptor to the phosphatidylinositol 3-kinase/Akt signaling pathway and to the SHP2 tyrosine phosphatase. J Biol Chem 276:12257–12265[Abstract/Free Full Text]
  27. Zhao C, Yu DH, Shen R, Feng GS 1999 Gab2, a new pleckstrin homology domain-containing adapter protein, acts to uncouple signaling from ERK kinase to Elk-1. J Biol Chem 274:19649–19654[Abstract/Free Full Text]
  28. Itoh M, Yoshida Y, Nishida K, Narimatsu M, Hibi M, Hirano T 2000 Role of Gab1 in heart, placenta, and skin development and growth factor- and cytokine-induced extracellular signal-regulated kinase mitogen-activated protein kinase activation. Mol Cell Biol 20:3695–3704[Abstract/Free Full Text]
  29. Sachs M, Brohmann H, Zechner D, Muller T, Hulsken J, Walther I, Schaeper U, Birchmeier C, Birchmeier W 2000 Essential role of Gab1 for signaling by the c-Met receptor in vivo. J Cell Biol 150:1375–1384[Abstract/Free Full Text]
  30. Gu H, Saito K, Klaman LD, Shen J, Fleming T, Wang Y, Pratt JC, Lin G, Lim B, Kinet JP, Neel BG 2001 Essential role for Gab2 in the allergic response. Nature 412:186–190[CrossRef][Medline]
  31. Khan MN, Baquiran G, Brule C, Burgess J, Foster B, Bergeron JJ, Posner BI 1989 Internalization and activation of the rat liver insulin receptor kinase in vivo. J Biol Chem 264:12931–12940[Abstract/Free Full Text]
  32. Phung TL, Roncone A, Jensen KL, Sparks CE, Sparks JD 1997 Phosphoinositide 3-kinase activity is necessary for insulin-dependent inhibition of apolipoprotein B secretion by rat hepatocytes and localizes to the endoplasmic reticulum. J Biol Chem 272:30693–30702[Abstract/Free Full Text]
  33. Bradford MM 1976 A rapid and sensitive method for the quantification of microgram quantities of proteins utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y. Wang, S. D. Pennock, X. Chen, A. Kazlauskas, and Z. Wang
Platelet-derived Growth Factor Receptor-mediated Signal Transduction from Endosomes
J. Biol. Chem., February 27, 2004; 279(9): 8038 - 8046.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/5/935    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, M.
Right arrow Articles by Posner, B. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, M.
Right arrow Articles by Posner, B. I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals