| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Internal Medicine, Division of Endocrinology and Metabolism, Department of Pharmacology, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75390-8857
Address all correspondence and requests for reprints to: Stephen R. Hammes, Department of Internal Medicine, 5323 Harry Hines Boulevard, Dallas, Texas 75390-8857. E-mail: stephen.hammes{at}utsouthwestern.edu.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
In addition to mediating nongenomic estrogen effects, classical steroid receptors may also be promoting nongenomic steroid-mediated signaling in Xenopus laevis oocytes. (8, 9, 10, 11). Modulation of classical progesterone receptor (PR) levels in oocytes by overexpression of PR or through the use of antisense oligonucleotides to reduce PR expression modestly altered progesterone-mediated maturation of isolated oocytes, suggesting that the PR might be playing a role in mediating progesterone-induced signaling in vitro (9, 11). Furthermore, androgen-induced maturation, which may be the primary physiologic pathway mediating Xenopus oocyte maturation in vivo, was attenuated by classical androgen receptor (AR) antagonists, suggesting that androgen-induced signaling in oocytes may be in part mediated by a classical Xenopus androgen receptor (XeAR; Refs. 10 and 12). Interestingly, although testosterone and androstenedione (AD) are equally or more potent promoters of oocyte maturation than progesterone and are produced at significantly higher levels than progesterone in vivo, no studies to date have confirmed that androgen-induced oocyte maturation does indeed occur independent of transcription. Furthermore, the role of dihydrotestosterone (DHT), the most potent physiologic promoter of mammalian AR-mediated transcription, in mediating Xenopus oocyte maturation has yet to be determined.
The effects of AD, testosterone, DHT, and the AR ligand R1881 on both genomic and nongenomic signaling were examined to 1) characterize the signaling pathways involved in androgen-induced maturation; 2) further examine the role of the XeAR, in mediating androgen-induced maturation; and 3) compare the relative abilities of DHT and other compounds to promote oocyte maturation.
We found that androgen-induced maturation did in fact occur independent of transcription, and, like progesterone-induced signaling, could be inhibited by Gß
signaling. Further, injection of double-stranded RNA oligonucleotides targeted against the XeAR into oocytes specifically attenuated AD-mediated maturation and activation of the MAPK signaling pathway, suggesting that the XeAR was playing a role in mediating these processes. Finally, whereas testosterone, DHT, and R1881 were all potent promoters of XeAR-mediated transcription, only AD and testosterone induced nongenomic signaling and maturation in oocytes. In fact, both DHT and R1881 served as antagonists of testosterone- and human chorionic gonadotropin (hCG)-induced oocyte maturation. The identification of AR ligands that differentially modulate genomic and nongenomic signaling may lead to the development of other selective AR modulators that can be useful both scientifically and clinically.
| RESULTS |
|---|
|
|
|---|
|
Signaling
signaling that is inhibiting maturation (14). The nongenomic nature of androgen-induced maturation suggested that androgens might be functioning in a similar fashion. As seen with progesterone, overexpression of Gß
in oocytes significantly inhibited testosterone-induced maturation (Fig. 2A
signaling by overexpression of the G
i-coupled muscarinic receptor type 2 (M2R) and treatment with the M2R agonist carbachol inhibited both testosterone-induced maturation (Fig. 2C
|
|
|
|
To examine endogenous XeAR expression, immunohistochemistry was performed on sections from uninjected oocytes using two different anti-XeAR rabbit polyclonal antibodies that recognized either the amino (Fig. 4B
) or carboxyl termini (Fig. 4C
) of the protein. Oocytes from albino frogs were used in these studies to eliminate background signal from melanin around the cell surface of the animal pole. These studies confirmed that endogenous XeAR was expressed throughout the oocyte, with significant staining in the cytoplasm and nucleus, as well as within the plasma membrane. Addition of testosterone had no effect on receptor localization (data not shown). In contrast, XeAR expressed in COS cells was found in both the cytoplasm and nucleus in the absence of steroid but localized primarily to the nucleus upon stimulation with testosterone (Fig. 4D
). Unlike in Xenopus oocytes, no significant membrane expression of the XeAR was observed in these or nonpermeabilized COS cells overexpressing the XeAR (data not shown). These results indicate that the subcellular localization of the XeAR may be dependent upon the cell type, and they also suggest that the AR expression pattern within a given cell might predict the nature (genomic vs. nongenomic) of its response to androgens.
Testosterone, DHT, and R1881 Are Potent Promoters of XeAR-Mediated Transcription in CV1 Cells
To begin studying XeAR-mediated signaling, androgen-induced activation of transcription was examined in Xenopus oocytes and CV1 cells. Nuclear injection of both double- and single-stranded plasmids containing either the mouse mammary tumor virus (MMTV) promoter or an androgen response element driving luciferase expression resulted in very high constitutive luciferase activity that was not enhanced by addition of testosterone, AD, DHT, or R1881 (data not shown). These results are consistent with earlier studies demonstrating constitutive activation of these promoters in oocytes (16). Interestingly addition of flutamide often resulted in a 2- to 3-fold reduction in this constitutive activity (data not shown), suggesting that endogenous XeAR might be mediating this constitutive transcriptional activity.
Because the high constitutive activity of the AR-promoters precluded studying XeAR-mediated transcription in oocytes, transcriptional studies of the XeAR were instead performed in parallel with the human AR (HuAR) using CV1 cells, which do not express endogenous AR. As noted in Table 1
, testosterone, DHT, and R1881 were all potent promoters of XeAR-mediated transcription, with EC50 values of 32 nM, 14 nM, and 44 pM, respectively. By comparison, the EC50 values for testosterone, DHT, and R1881-induced transcription via the HuAR were approximately 10-fold lower, at 4.2 nM, 1.7 nM, and 5.5 pM, respectively. Notably, although the EC50 values varied, the maximum signals induced by all three ligands through both the human and Xenopus ARs were virtually identical (data not shown). Additionally, AD-mediated transcription in CV-1 cells could not be examined due to their innate ability to rapidly convert AD to testosterone (data not shown).
The Dissociation Rates of Ligands from the AR Correlate with Ligand Sensitivity
The 10-fold higher potency of the HuAR relative to the XeAR could be due to differences in receptor interactions with DNA, ligands, or transcription cofactors. To determine which region of the AR was most involved in regulating the potency of steroid-induced transcription, the ligand-binding domain (LBD) of the XeAR was replaced with the homologous region from the HuAR to make a Xe/Hu chimera (Fig. 5
). The LBDs of the human and Xenopus ARs share approximately 90% identity, whereas the DNA binding domains (DNABD) and A/B regions are 100% and 35% identical, respectively. Surprisingly, testosterone and DHT responses by the Xe/Hu chimera were similar to those of the wild-type HuAR (6.9 nM and 4.3 nM), suggesting that receptor-ligand interactions may be playing important roles in regulating the potency of Xenopus and human AR-mediated transcription.
|
R1881 and DHT Antagonize Nongenomic Testosterone-Mediated Signaling in Oocytes
Having determined that all of the AR ligands tested were potent promoters of XeAR-mediated transcription, we next examined their effects on nongenomic signaling. Initial studies revealed that all ligands bound to and were absorbed by Xenopus oocytes equally (data not shown). As previously shown (10), testosterone (Fig. 6A
) and AD (Fig. 3B
) were potent promoters of oocyte maturation. Surprisingly, DHT, an important androgen in mammalian male sexual development and a potent promoter of XeAR-mediated transcription in CV-1 cells (Table 1
), was a poor promoter of maturation, with an EC50 more than 10-fold higher than that of testosterone (Fig. 6A
). Additionally, R1881, the most potent promoter of XeAR-mediated transcription (Table 1
), did not induce oocyte maturation at concentrations of up to 1 µM. Instead, R1881 was a potent antagonist of testosterone-induced maturation (Fig. 6B
) and almost completely blocked testosterone-induced phosphorylation of p42 (95% inhibition; Fig. 6C
). These results suggest that R1881 is acting as an inhibitor of nongenomic testosterone-induced signaling, perhaps through binding to the XeAR. DHT also inhibited testosterone-induced maturation and phosphorylation of p42 (Fig. 6
, B and C), though to a lesser extent than R1881 due to the lower concentration of DHT used to avoid its partial agonist qualities. As seen previously with flutamide (10), the R1881 and DHT inhibitory effects on maturation were specific to androgen-induced signaling, as they did not attenuate progesterone-induced events in oocytes (data not shown). In addition, the inhibitory effects of R1881 and DHT appeared to occur independent of transcription, as they blocked testosterone-induced maturation similarly both in the presence and absence of actinomycin D (data not shown). Furthermore, 1 µM R1881 and 100 nM DHT had minimal effects on both constitutive MMTV-luciferase activity (3.2- and 1.2-fold induction over baseline, respectively) and MMTV-luciferase activity in the presence of testosterone (1.5- and 1.4-fold induction above activity with testosterone alone, respectively) in oocytes. Given its lower affinity for the XeAR and its own high potency for promoting maturation, we were unable to find a concentration of AD that inhibited testosterone-induced oocyte maturation.
|
50 ng/g ovarian tissue) and AD (
25 ng/g ovarian tissue) in the setting of virtually undetectable production of progesterone (
1 ng/g ovarian tissue). Notably, DHT production was also nearly undetectable under these conditions (data not shown). The high levels of androgen production by hCG-stimulated ovaries likely explain the incomplete inhibition by DHT, flutamide, and R1881, as they cannot completely antagonize endogenous androgen binding to the XeAR at the concentrations produced over the course of 12 h. In fact, addition of micromolar amounts of AD or testosterone does not significantly increase hCG-induced oocyte maturation in the frog ovary (12), suggesting that saturating amounts of androgens are produced under these conditions. | DISCUSSION |
|---|
|
|
|---|
One example of a physiologic response that can be modulated by selective inhibition of nongenomic androgen-mediated signaling is the marked inhibition of hCG-induced oocyte maturation by R1881 and DHT in intact X. laevis ovarian follicles (Fig. 6
). These functional studies are also significant in that they confirm the physiologic importance of androgens in mediating oocyte maturation in the Xenopus ovary (10, 12). Although the direct role of androgens in mammalian oocyte maturation has yet to be determined, androgens do appear to play important roles in normal mammalian ovarian and oocyte development (19), as well as in ovarian disease states such as polycystic ovarian syndrome (PCOS; Ref. 20). If these androgen-mediated effects are similarly transcription-independent, then the development of molecules capable of specifically modulating nongenomic signaling in the ovary might be useful in treating PCOS or other forms of infertility. Notably, the relatively weak AR antagonist flutamide improves infertility in some women with PCOS (21, 22); however, the large-scale use of flutamide in treating PCOS will likely be limited, given its ability to block both genomic and nongenomic AR-mediated signaling in a number of different tissues.
How are androgens mediating nongenomic signaling in oocytes? These and other data suggest that they may be signaling at least in part through the classical XeAR expressed in oocytes. First, we have shown here that oocytes injected with XeAR-targeted double-stranded RNA oligonucleotides were less responsive to AD-induced maturation and phosphorylation of p42 than mock-injected cells but were equally sensitive to progesterone and insulin-induced signaling (Fig. 3
). The specificity of these XeAR-targeted RNA oligonucleotides was further supported the inability of several nonspecific RNA oligonucleotide pairs to alter maturation induced by any of the agonists tested (data not shown). Second, several known inhibitors of AR-mediated transcription, including flutamide, hydroxflutamide, and bicalutamide, significantly reduced AD- and testosterone-induced signaling and maturation in Xenopus oocytes (10), as did the known AR-binding proteins DHT and R1881 (Fig. 6
). Together, these data suggest that flutamide, hydroxyflutamide, bicalutamide, R1881, and DHT may be inhibiting maturation by blocking testosterone and AD binding to the XeAR. Although plausible, in order for an AR other than the XeAR to be the primary mediator of androgen-induced oocyte maturation, this novel receptor would have to bind to the same array of AR ligands as the classical XeAR. Further, given the results of the RNA interference studies (Fig. 3
), the activity of this alternative androgen receptor would have to be regulated in part by endogenous XeAR expression levels within the oocyte.
It is still possible, however, that one or more molecules are playing additional role(s) in mediating androgen-induced oocyte maturation. Recent work has described a novel family of high affinity membrane steroid receptors with structure and signaling similarities to G protein-coupled receptors that may be involved in mediating progesterone-induced oocyte maturation in fish (23). When expressed in somatic cells, the spotted seatrout membrane progesterone receptor appeared to modulate a pertussis-sensitive decrease in intracellular cAMP in response to progesterone, suggesting a role for G
i in the maturation process. Similar membrane steroid receptors might be involved in frog oocyte maturation as well; however, as shown here and elsewhere (14, 24), frog oocyte maturation is not dependent on G
i signaling; in fact, activation of a G
i-coupled G protein-coupled receptor (M2R) inhibits androgen induced signaling and maturation in Xenopus oocytes (Fig. 2
). Notably, this inhibitory effect by M2R signaling does not appear to be due to changes in endogenous XeAR-mediated transcription, as MMTV-luciferase activity in oocytes treated with or without testosterone is minimally affected by M2R signaling (<2-fold changes in activity compared with baseline, data not shown). If a member of this novel family of steroid receptors were involved in Xenopus oocyte maturation, it would likely be signaling through different G proteins and would need to bind to androgens as well as progesterone.
Given that a population of XeARs appeared to be associated with the plasma membrane (Fig. 4
), one possible model to reconcile much of the existing data might be that the classical and novel steroid receptors are acting in concert in the membrane, much like the classical ER and GPR30 (2, 3, 25) may be doing in breast cells. Such a model might explain why overexpression of the XeAR alone is not sufficient to significantly enhance androgen-mediated signaling and maturation (10). Furthermore, this model adds another level of complexity to androgen-mediated signaling, suggesting that the complete actions of an individual steroid may depend not only on the expression levels of classical steroid receptors and cofactors within the cell, but also on the subcellular location of the classical steroid receptors, the presence of other signaling cofactors or steroid binding proteins in the membrane, and the binding properties of the ligand itself.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Steroid Maturation Assays
Oocytes were washed with MBSH and incubated with the individual steroid [progesterone from Sigma (St. Louis, MO); AD, testosterone, and DHT from Steraloids (Newport, RI); and R1881 from Perkin-Elmer Corp. (Boston, MA)] for 16 h. Twenty oocytes were used per condition. The ethanol concentration was kept constant. Maturation was detected by visualizing germinal vesicle breakdown (13). For the maturation inhibition experiments, oocytes were pretreated for 1 h with 30 µM carbachol (Sigma), 100 nM DHT, or 1 µM R1881, before addition of steroid and throughout the signaling or maturation assay. Again, ethanol concentrations were kept constant.
MAPK Assay
Activation of the MAPK cascade was measured by examining p42 phosphorylation (14). Twenty oocytes per condition were preincubated with or without the inhibitors for 1 h, followed by incubation for 4 h with the inhibitors and the indicated steroids. Steroid concentrations were used at or near the EC50 for maturation of the oocyte preparation used for each experiment. Oocytes were then solubilized in lysis buffer, lysates were resolved by electrophoresis on 10% polyacrylamide gels, and proteins were transferred to Immobilon-P membranes (Millipore Corp., Bedford, MA). Membranes were probed with a rabbit anti-phospho-p44/42 MAPK antibody (Cell Signaling Technology, Beverly, MA), stripped, and reprobed using a corresponding rabbit anti-p44/42 MAPK polyclonal antibody that binds all p44/p42 regardless of phosphorylation status.
RNA Synthesis and Injection
cDNAs encoding the XeAR (10), the Gß and G
proteins (14), and the M2 muscarinic receptor (gift from L. Jan, University of California, San Francisco, CA) were cloned into the Xenopus oocyte expression vector pGEM HE (L. Jan). All pGEM constructs were linearized and transcribed in vitro with T7 RNA polymerase (Promega Corp., Madison, WI). Stage V and VI oocytes were injected with 50.6 nl cRNA at a concentration of approximately 200 ng/µl using a Drummond automatic injector and injected oocytes were incubated 3648 h in MBSH before maturation or MAPK assays were performed. Oocytes were incubated for 48 h before membrane preparations were prepared.
RNA oligonucleotides were purchased from Dharmacon (Lafeyette, CO). The coding sequence for the RNA oligonucleotide was AAGCAGAAGCAGCGCCGCAAA. Stage V and VI oocytes were injected with 50.6 nl of a 30 µM solution of the double-stranded oligonucleotides and incubated for approximately 50 h before the maturation or MAPK assays were performed.
For the actinomycin D experiment, oocytes were pretreated with either 10 µg/ml actinomycin D (Sigma) or an equal volume of dimethylsulfoxide for 24 h. Oocyte nuclei were then injected with 23 nl (20 pg) of a CMV-luciferase expression plasmid [gift from D. Mangelsdorf, University of Texas Southwestern (UTSW), Dallas, TX] and immediately incubated overnight with either ethanol or testosterone at the indicated concentrations in the continued presence of either ethanol or actinomycin D. Oocytes were lysed in Reporter Lysis buffer (Promega Corp.) and luciferase assays performed as described (10).
XeAR Western Blot, Immunohistochemistry, and Immunofluorescence
Oocytes were injected with either 10 mM HEPES or XeAR cRNA as described (10). After 48 h, oocyte membrane and nuclear/cytoplasmic fractions were isolated (14), and XeAR was detected by Western blot (10) using a rabbit anti-amino-terminal antibody (Bio-Synthesis, Inc., Lewisville, TX).
For the immunohistochemistry studies, oocytes were isolated from albino X. laevis frogs (Nasco, Fort Atkinson, WI), fixed in paraffin, sectioned, and mounted on slides (Molecular Pathology Core Facility, UTSW). Slides were incubated overnight with a rabbit anti-carboxyl-terminal XeAR antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) that had been previously treated with either PBS or excess neutralizing peptide (Santa Cruz Biotechnology, Inc.). Alternatively, slides were incubated with serum containing the rabbit anti-amino-terminal antibody or its corresponding prebleed serum. XeAR was then detected using the Vectasin ABC kit (Vector Laboratories, Inc., Burlingame, CA), and slides were viewed and photographed using a Nikon (Kanagawa, Japan) stereoscope and digital camera.
For the immunofluorescence studies, COS cells were transfected with the XeAR cDNA as described (10). After 48 h, cells were treated with either ethanol or 100 nM testosterone for 1 h at 37 C. Cells were then treated as described (28). Briefly, cells were fixed for 15 min with 3% paraformaldehyde in PBS and permeabilized for 10 min on ice with 0.1% TX-100 in PBS. Slides were then incubated with the rabbit anti-carboxyl-terminal AR antibody, followed by incubation with a fluorescein isothiocyanate-conjugated antirabbit antibody (DAKO Corp., Carpinteria, CA). Cells were then examined and photographed using a fluorescent microscope (Carl Zeiss, Jena, Germany).
Transcription and Ligand Dissociation Assays
Cells were grown in complete medium consisting of DMEM, 10% fetal bovine serum, 100 IU/ml penicillin, and 0.1 mg/ml streptomycin.
The Xe/Hu chimera cDNA was created by PCR. The A/B, DNABD, and hinge regions of the XeAR were cloned using the primers ATGGAGGTGCACATAGGGCTCGGC (corresponding to the start codon of the XeAR) and AATGGCTTCCAGGACATTCAGAAAGAT (corresponding to 16271653 in the XeAR coding sequence). The LBD of the HuAR was cloned using the primers ATCTTTCTGAATGTCCTGGAAGCCATT (corresponding to 20082034 in the HuAR coding sequence) and TCACTGGGTGTGGAAATAGATGGG (corresponding to the stop codon of the HuAR). The two PCR fragments were then added together, and a final PCR was performed using the two outside primers. The chimera was sequenced to confirm its identity.
For the transcription assays, CV1 cells were transfected by calcium phosphate precipitation with an MMTV-luciferase plasmid and cDNAs encoding either the XeAR, HuAR, or the Xe/Hu chimera. Cells were then incubated in complete medium containing 5% charcoal-stripped fetal bovine serum and the indicated steroids for 48 h, and luciferase expression was measured as described (10).
For the ligand binding and dissociation assays, COS cells were plated into 12- or 24-well plates and transfected with the empty pcDNA3.1 vector or cDNAs encoding either the XeAR, HuAR, or Xe/Hu chimera (10). For the binding assays, transfected cells were washed once at 4 C with DMEM containing 20 mM HEPES and 1 mg/ml BSA (DME/H/BSA) and incubated for 1 h at 4 C with DME/H/BSA containing varying concentrations of [1, 2, 6, 7-3H(N)]-testosterone, [1, 2-3H(N)]-DHT, or 17
-methyl-3H]-R1881 (Perkin-Elmer Corp.). Cells were then washed three times with cold DME/H/BSA and steroids extracted from cells by incubating with 100% ethanol for 30 min. The total counts bound to cells and in the supernatants were measured by liquid scintillation and the Kds calculated using Scatchard plots. AD binding was studied similarly, only transfected cells were treated with 1 nM radiolabeled testosterone and increasing concentrations of unlabeled AD. Kd values were then determined using the Prism software (GraphPad Software, Inc., San Diego, CA). For the dissociation assays, transfected cells were washed once at 4 C with DME/H/BSA and incubated for 1 h with DME/H/BSA containing either radiolabeled 1 nM testosterone, 2 nM DHT, or 1 nM R1881. Cells were then washed three times with cold DME/H/BSA and incubated with 10 µM unlabeled steroid at either room temperature (DHT and testosterone) or 37 C (R1881) for 0, 30, 60, 120, 180, 240, or 300 min. At the appropriate time points, cells were washed three times with DME/H/BSA and steroids extracted. The total counts bound were measured by liquid scintillation and the specific counts bound calculated by subtraction of the background counts from the pcDNA3.1-transfected cells. Dissociation rates were then calculated from plots of time (x-axis) vs. the natural log of the percent of specific counts bound relative to t = 0 (y-axis).
hCG-Mediated Maturation of Oocyte in Ovarian Fragments
Ovarian fragments of approximately 100200 mg were washed in MBSH and treated for 1 h in 2 ml MBSH with either ethanol, 20 µM flutamide, 100 nM DHT, or 1 µM R1881. Ethanol concentrations were kept constant. hCG was then added at a concentration of 100 U/ml, and the ovarian fragments were incubated at 16 C for approximately 12 h. The MBSH was removed, and steroids were extracted and analyzed by RIA (10). Oocytes were manually removed from the ovarian fragments, and maturation was determined by visualization of a white spot on the animal pole.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: AD, Androstenedione; AR, androgen receptor; CMV, cytomegalovirus; DHT, dihydrotestosterone; DME/H/BSA, DMEM containing 20 mM HEPES and 1 mg/ml BSA; DNABD, DNA binding domain; hCG, human chorionic gonadotropin; HuAR, human AR; Kd, equilibrium constant; LBD, ligand binding domain; MBSH, modified Barths solution; M2R, muscarinic receptor type 2; MMTV, mouse mammary tumor virus; PCOS, polycystic ovarian syndrome; PR, progesterone receptor; XeAR, Xenopus classical AR; XePR, Xenopus classical PR.
Received for publication January 28, 2003. Accepted for publication March 7, 2003.
| REFERENCES |
|---|
|
|
|---|
-Shc association and Shc pathway activation. Mol Endocrinol 16:116127
with phosphatidylinositol 3-OH kinase. Steroids 67:935939[CrossRef][Medline]
and endothelial nitric oxide synthase are organized into a functional signaling module in caveolae. Circ Res 87:E44E52
mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen. J Clin Invest 103:401406[Medline]
subunits inhibit nongenomic progesterone-induced signaling and maturation in Xenopus laevis oocytes. Evidence for a release of inhibition mechanism for cell cycle progression. J Biol Chem 275:4151241520NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
M. T. Mizwicki and A. W. Norman The Vitamin D Sterol-Vitamin D Receptor Ensemble Model Offers Unique Insights into Both Genomic and Rapid-Response Signaling Sci. Signal., June 16, 2009; 2(75): re4 - re4. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Narayanan, C. C. Coss, M. Yepuru, J. D. Kearbey, D. D. Miller, and J. T. Dalton Steroidal Androgens and Nonsteroidal, Tissue-Selective Androgen Receptor Modulator, S-22, Regulate Androgen Receptor Function through Distinct Genomic and Nongenomic Signaling Pathways Mol. Endocrinol., November 1, 2008; 22(11): 2448 - 2465. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, J.-S. Ai, B.-Z. Xu, B. Xiong, S. Yin, S.-L. Lin, Y. Hou, D.-Y. Chen, H. Schatten, and Q.-Y. Sun Testosterone Potentially Triggers Meiotic Resumption by Activation of Intra-Oocyte SRC and MAPK in Porcine Oocytes Biol Reprod, November 1, 2008; 79(5): 897 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Deng, S. Lang, C. Wylie, and S. R. Hammes The Xenopus laevis Isoform of G Protein-Coupled Receptor 3 (GPR3) Is a Constitutively Active Cell Surface Receptor that Participates in Maintaining Meiotic Arrest in X. laevis Oocytes Mol. Endocrinol., August 1, 2008; 22(8): 1853 - 1865. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Hammes and E. R. Levin Extranuclear Steroid Receptors: Nature and Actions Endocr. Rev., December 1, 2007; 28(7): 726 - 741. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Cinar, N. K. Mukhopadhyay, G. Meng, and M. R. Freeman Phosphoinositide 3-Kinase-independent Non-genomic Signals Transit from the Androgen Receptor to Akt1 in Membrane Raft Microdomains J. Biol. Chem., October 5, 2007; 282(40): 29584 - 29593. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-G. Liang, Y.-Q. Su, H.-Y. Fan, H. Schatten, and Q.-Y. Sun Mechanisms Regulating Oocyte Meiotic Resumption: Roles of Mitogen-Activated Protein Kinase Mol. Endocrinol., September 1, 2007; 21(9): 2037 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kousteni, M. Almeida, L. Han, T. Bellido, R. L. Jilka, and S. C. Manolagas Induction of Osteoblast Differentiation by Selective Activation of Kinase-Mediated Actions of the Estrogen Receptor Mol. Cell. Biol., February 15, 2007; 27(4): 1516 - 1530. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Jasavala, H. Martinez, J. Thumar, A. Andaya, A.-C. Gingras, J. K. Eng, R. Aebersold, D. K. Han, and M. E. Wright Identification of Putative Androgen Receptor Interaction Protein Modules: Cytoskeleton and Endosomes Modulate Androgen Receptor Signaling in Prostate Cancer Cells Mol. Cell. Proteomics, February 1, 2007; 6(2): 252 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Shao, K. Ljungstrom, B. Weijdegard, E. Egecioglu, J. Fernandez-Rodriguez, F.-P. Zhang, A. Thurin-Kjellberg, C. Bergh, and H. Billig Estrogen-induced upregulation of AR expression and enhancement of AR nuclear translocation in mouse fallopian tubes in vivo Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E604 - E614. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Evaul, M. Jamnongjit, B. Bhagavath, and S. R. Hammes Testosterone and Progesterone Rapidly Attenuate Plasma Membrane G{beta}{gamma}-Mediated Signaling in Xenopus laevis Oocytes by Signaling through Classical Steroid Receptors Mol. Endocrinol., January 1, 2007; 21(1): 186 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rasar, D. B. DeFranco, and S. R. Hammes Paxillin Regulates Steroid-triggered Meiotic Resumption in Oocytes by Enhancing an All-or-None Positive Feedback Kinase Loop J. Biol. Chem., December 22, 2006; 281(51): 39455 - 39464. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Haas, S. N. White, L. B. Lutz, M. Rasar, and S. R. Hammes The Modulator of Nongenomic Actions of the Estrogen Receptor (MNAR) Regulates Transcription-Independent Androgen Receptor-Mediated Signaling: Evidence that MNAR Participates in G Protein-Regulated Meiosis in Xenopus laevis Oocytes Mol. Endocrinol., August 1, 2005; 19(8): 2035 - 2046. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Yang and S. R Hammes Xenopus laevis CYP17 Regulates Androgen Biosynthesis Independent of the Cofactor Cytochrome b5 J. Biol. Chem., March 18, 2005; 280(11): 10196 - 10201. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Huhtakangas, C. J. Olivera, J. E. Bishop, L. P. Zanello, and A. W. Norman The Vitamin D Receptor Is Present in Caveolae-Enriched Plasma Membranes and Binds 1{alpha},25(OH)2-Vitamin D3 in Vivo and in Vitro Mol. Endocrinol., November 1, 2004; 18(11): 2660 - 2671. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Unni, S. Sun, B. Nan, M. J. McPhaul, B. Cheskis, M. A. Mancini, and M. Marcelli Changes in Androgen Receptor Nongenotropic Signaling Correlate with Transition of LNCaP Cells to Androgen Independence Cancer Res., October 1, 2004; 64(19): 7156 - 7168. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fix, C. Jordan, P. Cano, and W. H. Walker Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells PNAS, July 27, 2004; 101(30): 10919 - 10924. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Hammes Steroids and Oocyte Maturation--A New Look at an Old Story Mol. Endocrinol., April 1, 2004; 18(4): 769 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Houk, E. J. Pearson, N. Martinelle, P. K. Donahoe, and J. Teixeira Feedback Inhibition of Steroidogenic Acute Regulatory Protein Expression in Vitro and in Vivo by Androgens Endocrinology, March 1, 2004; 145(3): 1269 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gill, M. Jamnongjit, and S. R. Hammes Androgens Promote Maturation and Signaling in Mouse Oocytes Independent of Transcription: A Release of Inhibition Model for Mammalian Oocyte Meiosis Mol. Endocrinol., January 1, 2004; 18(1): 97 - 104. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |