Molecular Endocrinology, doi:10.1210/me.2002-0304
Molecular Endocrinology 17 (7): 1203-1215
Copyright © 2003 by The Endocrine Society
Identification and Characterization of Novel Rat and Human Gonad-Specific Organic Anion Transporters
Takehiro Suzuki,
Tohru Onogawa,
Naoki Asano,
Hiroya Mizutamari,
Tsuyoshi Mikkaichi,
Masayuki Tanemoto,
Michiaki Abe,
Fumitoshi Satoh,
Michiaki Unno,
Kazuo Nunoki,
Masanori Suzuki,
Takanori Hishinuma,
Junichi Goto,
Tooru Shimosegawa,
Seiki Matsuno,
Sadayoshi Ito and
Takaaki Abe
Division of Nephrology, Endocrinology, and Vascular Medicine (T.S., M.T., M.A., F.S., S.I., T.A.), Department of Medicine; Division of Gastroenterological Surgery (T.O., M.U., M.S., S.M.), Department of Surgery, Division of Gastroenterology (N.A., H.M., T.S.), Department of Medicine, Department of Molecular Pharmacology (K.N.), Tohoku University Graduate School of Medicine, Sendai 980-8575, Japan; Department of Clinical Pharmacy (T.M., T.H., J.G.), Tohoku University Graduate School of Pharmaceutical Sciences, Sendai 980-8575, Japan; and Precursory Research for Embryonic Science and Technology (T.A.), Japan Science and Technology Corporation, Saitama 332-0012, Japan
Address all correspondence and requests for reprints to: Takaaki Abe, Division of Nephrology, Endocrinology, and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8574, Japan. E-mail: takaabe{at}mail.cc tohoku.ac.jp.
 |
ABSTRACT
|
|---|
We have isolated three novel organic anion transporter cDNAs designated rat GST-1 (gonad-specific transporter), rat GST-2, and human GST, expressed at high levels in the testis. Rat GST-1, GST-2, and human GST consist of 748, 702, and 719 amino acids, respectively, and all molecules possess the 12 predicted transmembrane domains, which is a common structure of organic anion transporters. Northern blot analyses and in situ hybridization revealed that both of the rat molecules are highly expressed in the testis, especially in Sertoli cells, spermatogonia, and Leydig cells. Weak signals are also detected in the epididymis and ovary in adult rat. The exclusive expression of human GST mRNA in the testis was confirmed by RT-PCR. The pharmacological experiments of Xenopus laevis oocytes injected with the respective rat GST-1- and GST-2-cRNAs revealed that both rat GST-1 and GST-2 transport taurocholic acid, dehydroepiandrosterone sulfate, and T4 with Michaelis-Menten kinetics (taurocholic acid, Km = 8.9 and 2.5 µM, dehydroepiandrosterone sulfate, Km = 25.5 and 21.µM, and T4, Km = 6.4 and 5.8 for rat GST-1 and GST-2, respectively). T3 was also transported by rat GST-1 and GST-2. These data suggest that rat GST-1 and GST-2 might be one of the molecular entities responsible for transporting dehydroepiandrosterone sulfate and thyroid hormones involved in the regulation of sex steroid transportation and spermatogenesis in the gonad.
 |
INTRODUCTION
|
|---|
THE HOMEOSTASIS OF the testis is maintained strictly constant and is regulated by exchanges of various compounds between the blood and the seminiferous tubule fluids (1, 2). The biological barrier properties existed in the testis, the blood-testis barrier (BTB), is mainly derived from Sertoli cells with tight junctions (3). The BTB effectively excludes serum macromolecules from the testis and regulates the intraseminiferous fluid components (2, 4). It also plays an important role in the integrity of spermatogenesis (5). Disruption of this barrier causes impairment of gametogenesis (5). In this sense, the Sertoli cells act as nurse cells of germ cells by both direct contact and by paracrine cell-to-cell interactions (5, 6). However, little is known about the precise mechanism of the BTB at the cellular and molecular level.
In the brain, there is also a barrier, known as the blood-brain barrier (7). Recently, the molecular basis of this barrier has been elucidated (8, 9). We have isolated several members of the organic anion transporter polypeptide (oatp)/liver-specific transporter (LST) family (8, 10, 12, 13, 14, 15). The transporter family posses 12 predicted hydrophobic transmembrane domains. The organic anion transporter family transports partially negative charged substances, such as bile acids, thyroid hormones, prostaglandins (PGs), conjugated steroids, antibiotics, and nonsteroidal antiinflammatory drugs (8, 9, 16, 17, 18, 19, 20). Because of the lipophilic nature of thyroid hormone, it was thought that they traversed the plasma membrane by simple diffusion. However, in the past decade, a membrane transport system for thyroid hormone has been postulated to exist in various tissues. In 1998, we revealed two oatp/LST family members termed oatp2 and oatp3, which are identified as thyroid hormone transporters (8). Both oatp2 and oatp3 are expressed in the brain and retinal and are involved in the barrier function of the blood-brain barrier (21, 22) and retina (23). Other oatp/LST family members, human OATP (24), LST-1/OATP-C/OATP2 (13, 25, 26, 27), LST-2/OATP8 (15, 28), and OATP-E (10), are also involved in transporting thyroid hormone (reviewed in Ref. 29). However, little has been known about the molecule transporting thyroid hormone in the testis.
In this study we have isolated two rat and one human novel organic anion transporters from the testis. The pharmacological study revealed that rat transporters transport dehydroepiandrosterone sulfate (DHEAS), T4, and T3. By in situ hybridization, both rat GST-1 and GST-2 mRNA are expressed in Sertoli and Leydig cells in prepubertal and adult rat testis. Expression of human GST mRNA in the testis is also detected by RT-PCR. These data suggest the role of those transporters in the spermatogenesis in the BTB.
 |
RESULTS
|
|---|
Isolation and Structural Analysis of Rat GST-1 and GST-2 and Human GST
Rapid amplification of cDNA ends (RACE) was performed with primers designed based on database research of the GenBank database dbEST with all known mammalian oatp/LST family and PG transporters (described precisely in Materials and Methods). The RACE reaction products from Marathon-Ready cDNA kit of human testis (CLONTECH Laboratories, Inc., Palo Alto, CA) was subcloned to pCR-XL-TOPO (Invitrogen, Carlsbad, CA) and the sequences of these clones were analyzed. The longest insert isolated was named pH1, but the approximately 200- to 300-bp sequence of the 5'-end was deleted by amino acid analysis. Therefore, we used the insert of pH1 as the DNA probe to screen human testis-derived cDNA library by the hybridization method.
A human testis cDNA library was screened with the approximately 1000-bp EcoRV-EcoRI fragment of the 3'-noncoding region of pH1 under a low stringent condition, and six clones were isolated and subcloned into pBluescript SK (-). These clones showed identical restriction enzyme patterns and one representative clone (pH4), which has the largest insert, was used for further analysis. pH4 was composed of approximately 2.5 kb (719 amino acids with Mr of 79,199) and the amino acid sequence of pH4 was not identical to any of known organic anion transporter family cDNAs. We designated pH4 as human GST (gonad-specific transporter) because of its abundant distribution in the testis and ovary (discussed later).
A rat testis cDNA library was also screened with the approximately 1000-bp EcoRV-EcoRI fragment of the 3'-noncoding region of human GST under a low stringent condition, and four clones were isolated and subcloned into pBluescript SK (-). Among these, three clones showed identical restriction enzyme patterns and one representative clone (pR4), which had the largest insert, was used for further analysis. pR4 was composed of approximately 2.7 kb (748 amino acids with Mr of 83,128) and the amino acid sequence of pR4 was not identical to any of the organic anion transporter family. The restriction enzyme pattern of the remaining one clone (pR1) was different from that of pR4. pR1 showed a nucleotide sequence that was not identical to any of the organic anion transporter family cDNAs, including pH4 (discussed later) and pR4. pR1 encodes a novel organic anion transporter subtype of 701 amino acids (Mr 78,012). We designated pR4 and pR1 as rat GST-1 and -2, respectively, because of its abundant distribution in the testis (discussed later). Figure 1
shows the amino acid sequence alignments of rat GST-1 and GST-2. Rat GST-1 and GST-2 showed the identity of 42.0% at the amino acid level. Figure 2
shows the amino acid sequence of human GST.1 Human GST has 45.3% and 39.0% identity with rat GST-1 and GST-2, respectively, at the amino acid level. Table 1
further shows the amino acid sequence identities of GSTs with other OATP superfamilies. GSTs show relatively high identity to rat oatp-E and human OATP-E.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1. Amino Acid Comparison of Rat GST-1 and GST-2
The deduced amino acid sequences of the two transporters are aligned by inserted gap (-) to achieve maximum homology. Exact matches and conservative substitutions are shown by bars and colons, respectively. The 12 putative transmembrane segments(Ito XII) were assigned on the basis of hydrophobicity analysis. The putative transmembrane regions are indicated by solid lines. Arrowheads indicate potential N-glycosylation sites; asterisks show possible phosphorylation sites.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
Figure 2. The Amino Acid Sequence of Human GST
The 12 putative transmembrane segments (Ito XII) were assigned on the basis of hydrophobicity analysis. The putative transmembrane reagions are indicated by solid lines. Arrowheads indicate potential N-glycosylation sites; asterisks show possible phosphorylation sites.
|
|
Hydrophobicity analysis (30) of rat GST-1, GST-2, and human GST predicted 12 hydrophobic segments in each amino acid polypeptide, which is a characteristic of the organic anion transporter family. For rat GST-1, three N-glycosylation sites were predicted in the extracellular loops, and there were five potential phosphorylation sites for protein kinase C but no potential phosphorylation site for cAMP-dependent protein kinase in the intracellular hydrophilic loops (Fig. 1
) (31).
For rat GST-2, three N-glycosylation sites were predicted in the extracellular loops, and there were two potential phosphorylation sites for protein kinase C and one potential phosphorylation site for cAMP-dependent protein kinase in the intracellular hydrophilic loops (Fig. 1
).
For human GST, five N-glycosylation sites were predicted in the extracellular loops, and there were six potential phosphorylation sites for protein kinase C but no potential phosphorylation site for cAMP-dependent protein kinase in the intracellular hydrophilic loops (Fig. 2
).
The phylogenetic tree analysis using the neighbor-joining and the maximum-likelihood methods showed that rat GST-1, GST-2, and human GST are positioned between the LST family and OATP-E/oatp-E branch (Fig. 3
). Therefore, it is possible to categorize rat GST-1, GST-2, and human GST as a novel supergene branch of the oatp/LST family.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3. Phylogenetic Relationship between Human GST, Rat GST-1, Rat GST-2, LST1/rlst1, LST2, OATP-E/oatp-E, the Other oatp Family, moat1, PG Transporters, Rat OAT-K1, and Rat OAT-K2
Branch length is drawn to scale.
|
|
Pharmacological Characterization of Rat GST-1 and GST-2
Based on the structural similarities between the oatp/LST family and rat GST-1 and GST-2, we first examined the uptake of [3H]taurocholic acid in the rat GST-1 and GST-2 cRNA-injected oocytes. The uptake of [3H]taurocholic acid by rat GST-1 cRNA-injected oocytes was 5-fold compared with that of the water-injected oocytes: 0.84 ± 0.19 vs. 0.16 ± 0.014 pmol/oocyte/60 min at 30 µM [3H]taurocholic acid (P < 0.01). This taurocholic acid transport followed Michaelis-Menten kinetics with an apparent Km value of 8.9 ± 1.3 µM (Fig. 4A
). In addition, in the oocytes injected with rat GST-1 cRNA, [3H]DHEAS was also transported according to the saturation kinetics with an apparent Km value of 25.5 ± 3.7 µM (Fig. 4B
). The GST-1 cRNA-injected oocytes transported [125I]T4 and [125I]T3 more significantly than the water-injected oocytes (Table 2
). The apparent Km value for [125I]T4 in rat GST-1 cRNA-injected oocytes was 6.4 ± 0.8 µM (Fig. 4C
). In contrast, unconjugated steroids such as aldosterone, testosterone, androstenedione, dihydrotestosterone [dehydroepiandrosterone (DHEA)], and eicosanoids (i.e. PGE2, PGD2, PGF2
, and thromboxane B2) were not transported (Table 2
).

View larger version (8K):
[in this window]
[in a new window]
|
Figure 4. Taurocholic Acid, DHEAS, and T4 Transport by Rat GST-1-Expressing Oocytes
The transport rates of [3H]taurocholic acid (A) or [3H]DHEAS (B) were measured (60 min) in rat GST-1 cRNA-injected oocytes. The transport rate of [125I]T4 (C) was also measured (10 min) in rat GST-1 cRNA-injected oocytes. From all uptake values, nonspecific uptake by water-injected oocytes was subtracted. A representative of three experiments is shown for each uptake experiment. Symbols are the mean ± SEM of five to nine oocyte determinations.
|
|
Rat GST-2 cRNA-injected oocytes also transported [3H]taurocholic acid, [3H]DHEAS, and [125I]T4 with apparent Km values of 2.5 ± 0.3 µM, 21.5 ± 7.8 µM, and 5.8 ± 0.8 µM, respectively (Fig. 5
, AC). As in rat GST-1, neither unconjugated steroids nor eicosanoids were transported by rat GST-2 cRNA-injected oocytes (Table 3
).

View larger version (8K):
[in this window]
[in a new window]
|
Figure 5. Taurocholic acid, DHEAS, and T4 Transport by Rat GST-2-Expressing Oocytes
The transport rates of [3H]taurocholic acid (A) or [3H]DHEAS (B) were measured (60 min) in rat GST-2 cRNA-injected oocytes. The transport rate of [125I]T4 (C) was also measured (10 min) in rat GST-2 cRNA-injected oocytes. From all uptake values, nonspecific uptake by water-injected oocytes was subtracted. A representative of three experiments is shown for each uptake experiment. Symbols are the mean ± SEM of five to nine oocyte determinations.
|
|
To characterize the pharmacological properties of rat GST-1-mediated uptake of taurocholic acid, we examined the effects of other compounds (100 µM) on the [3H]taurocholic acid (10 µM) uptake. Taurocholic acid and DHEAS significantly inhibited [3H]taurocholic acid uptake (Fig. 6
).

View larger version (11K):
[in this window]
[in a new window]
|
Figure 6. Effects of Various Compounds on Rat GST-1-Mediated Taurocholic Acid Transport
Oocytes were injected with 25 ng GST-1-cRNA or water. Taurocholic acids, DHEAS, ß-estradiol, and testosterone were added at the concentration of 100 µM to inhibit 10 µM [3H]taurocholic acid uptake by rat GST-1-expressing oocytes. Data represent the mean ± SEM of five to nine oocytes. Statistical significance was determined by unpaired Students t test (*, P < 0.05; **, P < 0.01).
|
|
Northern Blot Analyses of Rat GST-1 and GST-2
The relative levels of expression of the rat GST-1 and GST-2 mRNAs were analyzed by Northern blot analysis. A single band for rat GST-1 of approximately 2.7 kilonucleotides was found in the testis, but no significant hybridization signals were observed in the heart, brain, spleen, lung, liver, skeletal muscle, and kidney (Fig. 7A
). The rat GST-1 mRNA expression of adult testis was more intensive than that of 3-wk-old rats (Fig. 7B
). In the epididymis, ovary, and adrenal gland, rat GST-1 mRNA was also detected (Fig. 7B
), although the expression was much lower in these tissues than in the testis.

View larger version (50K):
[in this window]
[in a new window]
|
Figure 7. Northern Blot Analysis of the Rat GST-1 and Rat GST-2 mRNA
A, Rat multiple tissue Northern blots [2 µg of poly (A)+ RNAs] were hybridized with 3'-noncoding region (the 531-bp 19822513 nucleotides PCR product) of rat GST-1 or (C) with 3'-noncoding region (911-bp HincII-NotI fragment) of the rat GST-2. B, Rat total testis RNA (20 µg), epididymis, ovary, and adrenal gland from 10-wk-old rats or testis, epididymis, and adrenal gland from 3-wk-old male rats were analyzed. The same probe for rat GST-1 mRNA was used. The same Northern blot membrane was used with the probe for rat GST-2 mRNA (D).
|
|
Northern blot analysis of rat GST-2 revealed three hybridization bands with estimated mRNA sizes of about 2.5, about 6.0, and 7.5 kilonucleotides in the testis (Fig. 7D
). The three different sizes of rat GST-2 are probably derived from the same gene, because these bands were seen under a high stringent washing condition using a probe of the 3'-noncoding region that has less than 48% identity to any other member of the organic anion transporter family except GST-1. In contrast to rat GST-1, GST-2 mRNA expression was restricted to the testis and no obvious band was observed in other tissues (Fig. 7
, C and D).
In Situ Hybridization
To further characterize the mRNA distribution of rat GST-1 and GST-2, in situ hybridization using specific antisense riboprobes was performed in the adult testis, epididymis, and ovary as well as the testis of 3-wk-old male rats. As in Fig. 8
, in the adult rat testis, both GST-1 and GST-2 signals were observed in the spermatogonia, Sertoli cells, and Leydig cells, and relatively weak signals were also seen in the spermatocytes (Fig. 8
, A and B). No significant signal was seen in spermatozoa. In the epididymis, the mRNA signals of both rat GST-1 and GST-2 were shown in epithelial cells of both the ductuli efferentes and ductus epididymis (Fig. 8
, C and D). In the ovary, rat GST-1 and GST-2 signals were also observed in follicular epithelial cells of both the theca interna and stratum granulosum (Fig. 8
, E and F). In contrast to the results with antisense riboprobes, no positive hybridization signal was obtained with sense probes, confirming the specific reactivity of the antisense riboprobes (data not shown).

View larger version (121K):
[in this window]
[in a new window]
|
Figure 8. In Situ Hybridization of the Rat GST-1 and Rat GST-2 mRNA in Adult Rat Testis, Epididymis, and Ovary
Adult rat testis sections were hybridized with rat GST-1 antisense probe (A) or rat GST-2 antisense probe (B). Adult rat epididymis sections were hybridized with rat GST-1 antisense probe (C) or rat GST-2 antisense probe (D). Adult rat ovary sections were hybridized with rat GST-1 antisense probe (E) or rat GST-2 antisense probe (F). Scale bar, 100 µm.
|
|
RT-PCR of Human GST
The tissue distribution of human GST was characterized by RT-PCR. A human multiple-tissue cDNA panel was used as a template. RT-PCR product was amplified from human testis, but not from brain, heart, lung, liver, kidney, and colon (Fig. 9
). RT-PCR products from glyceraldehyde-3-phosphate dehydrogenase (G3PDH) confirm the quality of the cDNA.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 9. Distribution of Human GST mRNA Detected by RT-PCR
Upper panel: Lane 1, whole brain; lane 2, heart; lane 3, lung; lane 4, liver; lane 5, colon; lane 6, kidney; lane 7, testis. G3PDH primer set was used as a control (lower panel).
|
|
 |
DISCUSSION
|
|---|
This paper presents the cloning of a novel human organic anion transporter, human GST, that is expressed at high levels in the testis. We have isolated the rat counterparts, two novel cDNA clones encoding rat organic anion transporter subtypes rat GST-1 and GST-2 from the testis, and showed their functional characteristics and tissue distribution. Rat GST-1, GST-2, and human GST can be categorized as a supergene branch of the organic anion transporter family that includes the PG transporter. Among the family members, these GSTs are relatively closer to rat oatp-E and human OATP-E (10) at the amino acid level. OATP-E transports taurocholate and thyroid hormone and OATP-E mRNA is abundantly expressed in various peripheral tissues, suggesting a role in transporting thyroid hormone to tissues (10). In the human, several different molecules are involved in transporting thyroid hormone and show organ-specific distribution: OATP (24) in the brain, LST-1/OATP-C/OATP2 in the liver (13, 14, 25, 26), and OATP-E (10) in peripheral tissues. In rat, members of the organic anion transporter family except OAT-K1/K2 [kidney specific (32, 33)] are distributed rather broadly, i.e. oatp1 in the liver, brain, and kidney (20), oatp2 in the brain and liver (8, 9), and oatp3 in the liver and kidney (8). On the other hand, although they are members of a supergene family, rat GST-1, GST-2, and human GST are expressed at high levels in the testis and are the first identified organic anion transporters in both rat and human testis.
DHEAS was a preferable substrate for both rat GST-1 and GST-2 (Figs. 4B
and 5B
). DHEAS is a sulfated and water-soluble form of DHEA, which is the intermediate product in both androgen and estrogen synthesis (34). DHEAS is produced in the adrenal gland and hydrolyzed by sulfatase in the liver. In the circulation, most DHEAS exists in a protein-bound form and at a much higher concentration than DHEA (35, 36). DHEAS can be converted to DHEA by sulfatase and may be a source of precursors for androgen synthesis in reproductive organs (37). However, DHEAS is hydrophilic and has a low transport rate through the cell membrane (1, 38). Rat GST-1 and GST-2 are expressed at high levels in the testis. Uptake experiments using radiolabeled compounds revealed that rat GST-1 and GST-2 transport DHEAS. These data suggest that rat GST-1 and GST-2 might be molecules responsible for transporting DHEAS in the testis. In humans, the conversion of DHEA and DHEAS to androgen and estrogen in the ovary has been reported (37). Because mRNA of rat GST-1 and GST-2 is expressed in ovarian follicular epithelial cells, and they synthesize sex steroid hormones (39), rat GST-1 and GST-2 also might work as transporters of DHEAS in the ovary, providing precursors of androgen and estrogen synthesis. Identification of the molecules that mediate DHEAS transport from the blood to the reproductive organs provides physiological and pharmacological insight concerning active steroid metabolism across the cell membrane in the gonadal system.
Both rat GST-1 and rat GST-2 transport T3 and T4. Previously, the testis had been considered to be an organ unresponsive to thyroid hormone because of the low oxygen consumption response to thyroid hormone (40) and low thyroid hormone-binding sites in adult rat (41). However, several recent investigations have revealed that thyroid hormone regulates the maturation and growth of the testis, affecting especially Sertoli cells, Leydig cells, and spermatogenesis in prepubertal rat (42, 43, 44). In addition, expression of thyroid hormone receptor was reported in Sertoli cells (45, 46), spermatogonia (46), and interstitial cells in the testis (45). The existence of 5'-deiodinase, which converts T4 to T3 in rat seminal plasma, has also been reported (47). Thus the finding of rat GST-1 and GST-2 transporting thyroid hormone also suggests the role of the hormone in development of the testis and spermatogenesis.
Rat GST-1 and GST-2 are also expressed in epididymal epithelial cells from the caput to cauda. In the epididymis, absorption and secretion by the epithelial cells create a specific and stable environment in the tubules, so that the spermatids are equipped with the capacity for fertilization (2, 48). So far, the substrates for the GSTs in the epididymis have not been elucidated. Further investigation is needed.
The finding of human and rat novel organic anion transporters expressed at high levels in the testis, which actively transport the substrates in an organ-specific manner, will provide new insights into the understanding of gonadal molecule exchange and metabolic regulatory systems at the molecular level.
 |
MATERIALS AND METHODS
|
|---|
Materials
[3H]taurocholic acid, [3H]testosterone, [3H]androst-4-ene-3, 17-dione, [3H]dihydrotestosterone, [3H]DHEAS, [3H] thromboxane B2, [125I]T4, and [125I]T3 were purchased form NEN Life Science Products (Boston, MA). [3H]aldosterone, [3H]PGE2, [3H]PGD2, and [3H]PGF2
were purchased from Amersham Pharmacia Biotech (Buckinghamshire, UK).
Isolation of Rat and Human cDNAs
The GenBank database dbEST was searched for all known mammalian oatp/LST family and PG transporters. Two clones that had weak-to-moderate similarity to both the oatp/LST family and PG transporters were identified (GenBank accession nos. AL040864 and AL042741, respectively). PCR primers were designed from each EST sequence to perform RACE. We used Marathon-Ready cDNA kit of human testis (CLONTECH Laboratories, Inc.). As homology analysis with the oatp/LST family suggested that AL040864 might be the partial fragment of middle portion of the new human transporter and AL042741 was predicted to be placed at the 3'-end region of the unknown transporter, we designed PCR primers for both 5'- and 3'-RACE from AL040864 and only 5'-RACE primers from AL042741. The sequences of the 5'-RACE primers are 5'-TACCTGCCAAGTGTAGTTGCCACAGTGGGTG-3' and 5'-GGTGCTCCTAGCACATAACCCAGAGCATAT-3' (nested primer) from AL040864, and 5'-TAGCCAATTGACAGATGGTAAGCTGGCCTG-3' and 5'-CACAGTTACATCTGGGAAGTCAGTGTTCTCA-3' (nested primer) from AL042741.
3'-RACE primers designed from AL040864 sequence are 5'-ATATGCTCTGGGTTATGTGCTAGGAGCACC-3' and 5'-CACCCACTGTGGCAACTACACTTGGCAGGTA-3'(nested primer).
RACE was performed by the hot-start amplification protocol using LA Taq (Takara) combined with the Taq Start Antibody (CLONTECH Laboratories, Inc.) according to the following schedule: 94 C for 1 min for the first cycle and then 94 C for 0.5 min and 67 C for 5 min for 30 cycles.
The RACE reaction products were then subcloned into pCR-XL-TOPO (Invitrogen), and the sequences of these clones were determined using the ABI Prism 377 DNA sequencer (Perkin-Elmer Corp., Norwalk, CT). As a result, AL040864 and AL042741 proved to be the partial segment of middle portion and 3'-end of the one novel human organic anion transporter, respectively. However, even the longest clone [pH1, obtained from Marathon-Ready cDNA kit of human testis (CLONTECH Laboratories, Inc.)] lacked the putative sequence (
200300 bp) of the 5'-end. Therefore, we shifted the cloning strategy from the RACE procedure to human and rat testis cDNA library screening with the DNA probe prepared from pH1.
The rat testis cDNA library consisting of cDNAs of larger than 2 kb was constructed in a
ZAPII vector (Stratagene, Palo Alto, CA) (8, 49), and 4 x 105 independent clones were screened with the approximately 1000-bp EcoRV-EcoRI fragment of the 3'-noncoding region of pH1 under a low-stringency condition. Briefly, hybridization was carried out in the hybridization buffer containing 25% formamide, 5x saline sodium citrate (SSC), 5x Denhardts solution, and 1% sodium dodecyl sulfate (SDS) at 42 C overnight, and filter washing was performed in a solution containing 2x SSC and 0.1% SDS at 55 C. After screening, four clones were identified. Among these clones, three were identical and the longest one, pR4 (rat GST-1), was chosen for further analysis. The remaining clone, pR1 (rat GST-2), was also analyzed.
A human testis cDNA library consisting of larger than 2.0-kb cDNAs was newly constructed in a
ZAPII vector (Stratagene) (8, 49), 8 x 105 independent clones were screened with the same probe used in rat cDNA library screening, and hybridization was carried out under the same condition as described above. Finally six clones were identified from human testis cDNA library. Among these clones, clone pH4 was chosen for analysis.
The sequences of identified clones were determined using ABI Prism 377 DNA sequencer (Perkin-Elmer Corp.).
Homology Analysis
Multiple-sequence alignments of amino acid sequences and phylogenetic tree construction were carried out using ClustalW (50). The phylogenetic tree was constructed using TreeView (51) (http://taxonomy.zoology.gla.ac.uk/rod/treeview.html).
Functional Characterization of Rat GST-1 and GST-2 in Xenopus Oocytes
cRNAs were synthesized in vitro using T7 RNA polymerase in the presence of cap analog m7GpppG from linearized pR4 (rat GST-1) and pR1 (rat GST-2). Xenopus laevis oocytes were prepared as described previously (8, 47). After an overnight incubation at 18 C, transcribed cRNA (25 ng) was injected into defolliculated healthy oocytes. Injected oocytes were cultured for approximately 57 d in modified Barths medium [88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 0.3 mM CaNO3, 0.41 mM CaCl2, 0.82 mM MgSO4, 15 mM HEPES, (pH 7.6)].
The uptake of radiolabeled chemicals was measured in a medium containing 100 mM choline chloride, 2 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and 10 mM HEPES (pH 7.5). Approximately five to nine oocytes were prewashed in the uptake medium and incubated at room temperature in 100 µl of the same medium containing radiolabeled substrate at the indicated concentration for 1 h. Uptake was terminated by addition of 1 ml of ice-cold uptake buffer, and oocytes were washed three times with 3 ml of ice-cold uptake buffer. Each oocyte was dissolved in 500 µl of 10% SDS and 4 ml of scintillation fluid (Packard Instruments, Meriden, CT), and the oocyte-associated radioactivity was counted in a Packard Tri-Carb 2100 liquid scintillation counter (Packard Instruments). Oocytes injected with water were used as a control. The rat GST-1- and GST-2-mediated uptake of ligands was linear for at least 60 min (data not shown).
Each value represents the mean ± SEM of at least three independent experiments in different oocytes. Statistical analysis was performed using Students unpaired t test.
Northern Blot Analysis
A rat multiple-tissue Northern blot containing 2 µg polyadenylated RNA was purchased from CLONTECH Laboratories, Inc. For analysis of the adult and prepubertal rat mRNA expression of rat GST-1 and GST-2, total RNA was isolated using TRIzol (Life Technologies, Inc., Gaithersburg, MD). Adult male and female Sprague Dawley (SD) rats (10 wk old; body weight,
200250 g) or 3-wk-old male SD rats (body weight, 50 g) were used. Total RNA (20 µg) from SD rat tissues (testis, epididymis, ovary, and adrenal gland) was electrophoresed on 1.0% agarose gel and transferred onto a nylon membrane. Because pR4 (rat GST-1) had a very long polyadenylated tail (>100 bp) and there was no proper restriction enzyme site in its 3'-noncoding region, we used a 32P-labeled fragment from the 531-bp (
19822513 nucleotides) PCR product in the 3'-noncoding region for the hybridization of pR4 (rat GST-1). The sequences of the 5'- and 3'-primers to amplify the fragment were CCAGTTCAGCTAGTATACCCAT (
19822003 nucleotides) and CTCTTATGAAATTACAGTGCTGCCA (
24892513 nucleotides), respectively. The 32P-labeled fragment from the approximately 900-bp HincIINotI fragment of the 3'-noncoding region was used for pR1 (rat GST-2). Hybridization was performed in a hybridization buffer containing 50% formamide, 5x SSC, 5x Denhardts solution, and 1% SDS at 42 C overnight. The hybridized filter was washed in 1x SSC, 0.1% SDS at 50 C and exposed to a film at -80 C for 3 d. To avoid any cross-hybridization, the two probes were designed to have less than 60% identity to each other and less than 48% identity to any other member of the organic anion transporter family. The filters were further hybridized with ß-actin probe to confirm the RNA quality.
In Situ Hybridization of Rat GST-1 and GST-2
For in situ hybridization of rat GST-1 and GST-2 mRNA, the same approximately 531-bp (
19812513 bp) fragment of the 3'-noncoding region for pR4 (rat GST-1) and the same 900-bp 3'-noncoding HincII-NotI fragment for pR1 (rat GST-2) were subcloned, and antisense and sense RNAs were synthesized by T7 or T3 RNA polymerase using digoxigenin-labeled UTP (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturers instructions. The synthesized RNAs were hydrolyzed to make approximately 150-nucleotide fragments. The sections of the testis (with epididymis), adrenal gland, and ovary of SD rats were fixed with 4% paraformaldehyde and incubated with digoxigenin-UTP-labeled probes in hybridization solution [50% formamide, 300 mM NaCl, 20 mM Tris-HCl (pH 8.0), 2.5 mM EDTA, 1x Denhardts solution, 10% dextran sulfate, and 1 mg/ml Escherichia coli tRNA] at 50 C for 16 h, washed subsequently with 2x SSC containing 50% formamide at 42 C, treated with RNase A (20 mg/ml) for 30 min at 37 C, and washed with 1x SSC containing 50% formamide for 1 h at 42 C. Blocking was performed with 0.5% blocking reagent (Roche Molecular Biochemicals) for 30 min at room temperature. The sections were incubated with alkaline phosphatase-conjugated antidigoxigenin antibody (diluted 1:500, Roche Molecular Biochemicals) overnight at 4 C. For coloration, the sections were washed with PBS [80 mM Na2HPO4, 20 mM NaH2PO4, and 100 mM NaCl (pH 7.5)], and coloring was performed with NBT/BCIP kit (Roche Molecular Biochemicals) according to the manufacturers instructions. For the specificity control experiment, hybridization was also performed using the sense probes.
RT-PCR of Human GST
The tissue distribution of human GST was characterized by RT-PCR. The sequences of the forward and reverse primers were 5'-ATATGCTCTGGGTTATGTGCTAGGAGCACC-3'(
954983 nucleotides) and 5'-TGAGAACACTGACTTCCCAGATGTAACTGT-3' (
22212240 nucleotides), respectively. Human multiple-tissue cDNA panel (CLONTECH Laboratories, Inc.) was used as templates. For control, G3PDH primers were used: forward, 5'-TCCACCACCCTGTTGCTGTAG-3' and reverse, 5'-GACCACAGTCCATGCCATCACT-3'. PCR amplification was performed using a hot-start amplification protocol with LA Taq (Takara) combined with the Taq Start Antibody (CLONTECH Laboratories, Inc.) according to the following schedule: 94 C for 1 min for the first cycle and then 94 C for 0.5 min and 67 C for 5 min for 30 cycles. PCR products were electrophoresed on 1.0% agarose gel containing ethidium bromide at a concentration of 0.5 µg/ml. Fluorescence was detected and visualized using GelDoc 2000 (Bio-Rad Laboratories, Inc., Hercules, CA).
Addendum
Human OATP-F, which is also expressed in the brain and testis, has recently been reported by Pizzagalli (56) during preparation of our manuscript.
 |
FOOTNOTES
|
|---|
1 The sequences of human GST, rat GST-1, and GST-2 have been deposited under GenBank accession nos. AF505657, AF321415, and AF326133, respectively. 
This work was supported in part by research grants from the Ministry of Education, Science and Culture of Japan, Kowa Life Science Foundation, Suzuken Memorial Foundation, and the Takeda Medical Research Foundation.
Abbreviations: BTB, Blood-testis barrier; DHEA, dehydroepiandrosterone; DHEAS, DHEA sulfate; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; GST, gonad-specific transporter; LST, liver-specific transporter; oatp, organic anion-transporting polypeptide; PG, prostaglandin; RACE, rapid amplification of cDNA ends; SD, Sprague Dawley; SDS, sodium dodecyl sulfate; SSC, sodium saline citrate.
Received for publication August 31, 2002.
Accepted for publication March 13, 2003.
 |
REFERENCES
|
|---|
- Sechell DW, Waites GMH 1975 The endocrine system: male reproductive system. In: Hamilton VW, Greep RO, eds. Handbook of physiology, section 7, vol 5. Washington, DC: American Physiological Society; 143172
- Whates GMH, Gladwell RT 1982 Physiological significance of fluid secretion in the testis and blood testis-barrier. Physiol Rev 62:624671[Free Full Text]
- Russell LD, Peterson RN 1985 Sertoli cell junction: morphological and functional correlates. Int Rev Cytol 94:177211[Medline]
- Griswald MD 1988 Protein secretion of Sertoli cells. Int Rev Cytol 110:133156[Medline]
- Griswold MD 1995 Interactions between germ cells and Sertoli cells in the testis. Biol Reprod 52:211216[Abstract]
- Skinner MK 1991 Cell-cell interaction in the testis. Endocr Rev 12:4577[Abstract/Free Full Text]
- Brightman MW, Reese TS 1969 Junctions between intimately apposed cell membrane in the vertebrate brain. J Cell Biol 40:648677[Abstract/Free Full Text]
- Abe T, Kakyo M, Sakagami H, Tokui T, Nishio T, Tanemoto M, Nomura H, Hebert SC, Matsuno S, Kondo H, Yawo H 1998 Molecular characterization and tissue distribution of a new organic anion transporter subtype (oatp3) that transports thyroid hormones and taurocholate and comparison with oatp2. J Biol Chem 273:2239522401[Abstract/Free Full Text]
- Noé B, Hagenbuch B, Stieger B, Meier PJ 1997 Isolation of a multispecific organic anion and cardiac glycoside transporter from rat brain. Proc Natl Acad Sci USA 94:1034610350[Abstract/Free Full Text]
- Fujiwara K, Adachi H, Nishio T, Tokui T, Okabe M, Onogawa T, Suzuki T, Asano N, Tanemoto M, Seki M, Shiiba K, Suzuki M, Kondo Y, Nunoki K, Shimosegawa T, Ito S, Iinuma K, Unno M, Matsuno S, Abe T 2000 Identification of thyroid hormone transporters in human; different molecules are involved in a tissue-specific manner. Endocrinology 142:20052012
- Deleted in proof
- Nishio T, Adachi H, Nakagomi R, Tokui T, Sato E, Tanemoto M, Fujiwara K, Okabe M, Onogawa T, Suzuki T, Nakai D, Shiiba K, Suzuki M, Ohtani H, Kodo Y, Unno M, Ito S, Iinuma K, Nunoki K, Matsuno S, Abe T 2000 Molecular identification of a rat novel organic anion transporter moat1, which transports prostaglandin D2, leukotriene C4, and taurocholate. Biochem Biophys Res Commun 275:831838[CrossRef][Medline]
- Abe T, Kakyo M, Tokui T, Nakagomi R, Nishio T, Nakai D, Nomura H, Unno M, Suzuki M, Naitoh T, Matsuno S, Kondo H, Yawo H 1999 Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem 274:1715917163[Abstract/Free Full Text]
- Kakyo M, Unno M, Tokui T, Nakagomi R, Nishio T, Iwasashi H, Nakai D, Seki M, Suzuki M, Naito T, Matuno S, Yawo H, Abe T 1999 Molecular characterization and functional regulation of a novel rat liver-specific organic anion transporter rlst-1. Gastroenterology 117:770775[CrossRef][Medline]
- Abe T, Unno M, Onogawa T, Tokui T, Kondo N, Nakagomi R, Adachi H, Fujiwara K, Okabe M, Suzuki T, Nunoki K, Sato E, Kakyo M, Nishio T, Sugita J, Tanemoto M, Seki M, Date F, Ono K, Kondo Y, Shiiba K, Suzuki M, Ohtani H, Iinuma K, Nagura H, Ito S, Matsuno S 2001 LST-2, A human liver-specific organic anion transporter, determines methotrexate sensitivity in gastrointestinal cancers. Gastroenterology 120:16891699[CrossRef][Medline]
- Müller M, Jansen PLM 1997 Molecular aspects of hepatobiliary transport. Am J Physiol 272:G1285G1303
- van Aubel RAMH, Masereeuw R, Russel FGM 2000 Molecular pharmacology of renal organic anion transporters. Am J Physiol 279:F216F232
- Kanai N, Lu R, Satriano JA, Bao Y, Wolkoff AW, Schuster VL 1995 Identification and characterization of a prostaglandin transporter. Science 268:866869[Abstract/Free Full Text]
- Jacquemin E, Hagenbuch B, Stieger B, Wolkoff AW, Meier PJ 1994 Expression cloning of a rat liver Na+-independent organic anion transporter. Proc Natl Acad Sci USA 91:133137[Abstract/Free Full Text]
- Kullak-Ublick GA, Fisch T, Oswald M, Hagenbuch B, Meier PJ, Beuers U, Paumgartner G 1998 Dehydroepiandrosterone sulfate (DHEAS): identification of a carrier protein in human liver and brain. FEBS Lett 424:173176[CrossRef][Medline]
- Asaba H, Hosoya K, Takanaga H, Ohtsuki S, Tamura E, Takizawa T, Terasaki T 2000 Blood-brain barrier is involved in the efflux transport of a neuroactive steroid, dehydroepiandrosterone sulfate, via organic anion polypeptide 2. J Neurochem 75:19071916[CrossRef][Medline]
- Gao B, Stieger B, Noé B, Fritschy, JM, Meier PJ 1999 Localization of the organic anion transporting polypeptide 2 (Oatp2) in capillary endothelium and choroid plexus epithelium of rat brain. J Histochem Cytochem 47:12551264[Abstract/Free Full Text]
- Ito A, Yamaguchi K, Onogawa T, Unno, M, Suzuki T, Nishio T, Suzuki T, Sasano H, Abe T, Tamai M 2002 Distribution of organic anion-transporting polypeptide 2 (oatp2) and oatp3 in the rat retina. Invest Ophthalmol Vis Sci 43:858863[Abstract/Free Full Text]
- Kullak-Ublick GA, Hagenbuch B, Stieger B, Schteingart CD, Hofmann AF, Wolkoff AW, Meier PJ 1995 Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 109:12741282[CrossRef][Medline]
- König J, Cui Y, Nies AT, Keppler D 2000 A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am J Physiol 278:G156G164
- Hsiang B, Zhu Y, Wang Z, Wu Y, Sasseville V, Yang WP, Kirchgessner TG 1999 A novel human hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA reductase inhibitor transporters. J Biol Chem 274:3716137168[Abstract/Free Full Text]
- Tamai I, Nezu J, Uchino H, Sai Y, Oku A, Shimane M, Tsuji A 2000 Molecular identification and characterization of novel member of the human organic anion transporter (OATP) family. Biochem Biophys Res Commun 273:251260[CrossRef][Medline]
- König J, Cui Y, Nies AT, Keppler D 2000 Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 275:2316123168[Abstract/Free Full Text]
- Abe T, Suzuki T, Unno M, Tokui T, Ito S 2002 Thyroid hormone transporters: recent advances. Trends Endocrinol Metab 13:215220[CrossRef][Medline]
- Kyte J, Doolittle RFJ 1982 A simple method for displaying the hydropathic character of a protein. J Mol Biol 157:105132[CrossRef][Medline]
- Kennelly PJ, Krebs EG 1991 Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases. J Biol Chem 266:1555515558[Free Full Text]
- Saito H, Masuda S, Inui K 1996 Cloning and functional characterization of a novel rat organic anion transporter mediating basolateral uptake of methotrexate in the kidney. J Biol Chem 271:2071920725[Abstract/Free Full Text]
- Masuda S, Ibaramoto K, Takeuchi A, Saito H, Hashimoto Y, Inui K 1999 Cloning and functional characterization of a new multispecific organic anion transporter, OAT-K2, in rat kidney. Mol Pharmacol 55:743752[Abstract/Free Full Text]
- Longcope C 1995 Metabolism of dehydroepiandrosterone. Ann NY Acad Sci 91:143148
- Baulieu EE 1996 Dehydroepiandrostetone (DHEA): a fountain of youth? J Clin Endocrinol Metab 81:31473151[CrossRef][Medline]
- Wang DY, Bullbrook RD 1967 Binding of the sulphate esters of dehydroepiandrosterone, testosterone, 17-acetoxypregnenolone and pregnenolone in the plasma of man, rabbit, and rat. J Endocrinol 39:405413[Abstract/Free Full Text]
- Haning RV, Hckett RJ, Flood CA, Loughlin JS, Zhao QY, Longcope C 1993 Plasma dehydroepiandrosterone sulfate serves as a prehormone for 48% of follicular fluid testosterone during treatment with menotropins. J Clin Endocrinol Metab 76:13011307[Abstract]
- Cooper TG, Waites GNH 1975 Steroid entry into rat testis fluid and the blood-testis barrier. J Endocrinol 65:195205[Abstract/Free Full Text]
- Carr BR 1998 Disorders of the ovaries and female productive tract. In: William RH, Larsen PR, Wilson JD, Shlomo M, Foster DW, Kronenberg HM, eds. Williams textbook of endocrinology. 10th ed. Philadelphia: WB Saunders Co.; 751777
- Barker SB, Klitgaard HM 1952 Metabolism of tissues excised from thyroxine-injected rats. Am J Physiol 170:8186[Free Full Text]
- Oppenheimer JH, Schwartz HL, Surks MI 1974 Tissue differences in the concentration of triiodothyronine nuclear binding sites in the rat: liver, kidney, pituitary, heart, brain, spleen and testis. Endocrinology 95:897903[Abstract/Free Full Text]
- Francavilla S, Cordeschi G, Properzi G, Cicco LD 1991 Effect of thyroid hormone on the pre- and post-natal development of the rat testis. J Endocrinol 129:3542[Abstract/Free Full Text]
- Cooke PA, Meisami E 1991 Early hypothyroidism in rats causes increased adult testis and reproductive organ size but does not change testosterone levels. Endocrinology 129:237243[Abstract/Free Full Text]
- Cooke PS Porcelli J, Hess RA 1992 Induction of increased testis growth and sperm production in adult rats by neonatal administration of the goitrogen propylthiouracil (PTU): the critical period. Biol Reprod 46:146154[Abstract]
- Jannini EA, Carosa E, Rucci N, Screponi E, DíArmiento M 2000 Ontogeny and regulation of variant thyroid hormone receptor isoforms in developing rat testis. J Endocrinol Invest 22:843848
- Buzzard JJ, Morrison JR, OBryan MK, Song Q, Wreford NG 2000 Developmental expression of thyroid hormone receptors in the rat testis. Biol Reprod 62:664669[Abstract/Free Full Text]
- Brzezinska-Slebodzinska E, Slebodzinski AB, Kowalska K 2000 Evidence for presence of 5'-deiodinase in mammalian seminal plasma and for the increase in enzyme activity in the prepubertal testis. Int J Androl 23:218224[CrossRef][Medline]
- Turner TT 1991 Spermatozoa are exposed to a complex microenvironment as they traverse the epididymis. Ann NY Acad Sci 72:364383
- Abe T, Sugihara H, Nawa H, Shigemoto R, Mizuno N, Nakanishi S 1992 Molecular characterization of a novel metabotropic glutamate receptor mGluR5 coupled to inositol phosphate/Ca2+ signal transduction. J Biol Chem 267:1336113368[Abstract/Free Full Text]
- Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:46734680[Abstract/Free Full Text]
- Page RDM 1996 TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357357[Free Full Text]
- Lu R, Kanai N, Schuster V 1996 Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter cDNA(hPGT). J Clin Invest 98:11421149[Medline]
- Cattori V, Hagenbuch B, Hagenbuch N, Stieger B, Ha R, Winterhalter KE, Meier PJ 2000 Identification of organic anion transporting polypeptide 4 (Oatp4) as a major full-length isoform of the liver specific transporter1 (rlst-1) in rat liver. FEBS Lett 474:242245[CrossRef][Medline]
- Choudhuri S, Ogura K, Klaassen CD 2001 Cloning, expression, and ontogeny of mouse organic anion-transporting polypeptide-5, a kidney-specific organic anion transporter. Biochem Biophys Res Commun 280:9298[CrossRef][Medline]
- Choudhuri S, Ogura K, Klaassen CD 2000 Cloning of the full-length coding sequence of rat liver-specific organic anion transporter-1 (rlst-1) and a splice variant and partial characterization of the rat lst-1 gene. Biochem Biophys Res Commun 274:7986[CrossRef][Medline]
- Pizzagalli F, Hagenbuch B, Stieger B, Klenk U, Folkers G, Meier PJ 2002 Identification of a novel human organic anion transporting polypeptide as a high affinity thyroxine transporter. Mol Endocrinol 16:22832296[Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. S. Wagner, S. M. Wajner, and A. L. Maia
The role of thyroid hormone in testicular development and function
J. Endocrinol.,
December 1, 2008;
199(3):
351 - 365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. D. Klaassen and H. Lu
Xenobiotic Transporters: Ascribing Function from Gene Knockout and Mutation Studies
Toxicol. Sci.,
February 1, 2008;
101(2):
186 - 196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Geyer, B. Doring, K. Meerkamp, B. Ugele, N. Bakhiya, C. F. Fernandes, J. R. Godoy, H. Glatt, and E. Petzinger
Cloning and Functional Characterization of Human Sodium-dependent Organic Anion Transporter (SLC10A6)
J. Biol. Chem.,
July 6, 2007;
282(27):
19728 - 19741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Wajner, M. dos Santos Wagner, R. C N Melo, G. G Parreira, H. Chiarini-Garcia, A. C Bianco, C. Fekete, E. Sanchez, R. M Lechan, and A. L. Maia
Type 2 iodothyronine deiodinase is highly expressed in germ cells of adult rat testis
J. Endocrinol.,
July 1, 2007;
194(1):
47 - 54.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kobayashi, A. Tsuchiya, T. Hayashi, N. Kohyama, M. Ohbayashi, and T. Yamamoto
Isolation and Characterization of Polyspecific Mouse Organic Solute Carrier Protein 1 (mOscp1)
Drug Metab. Dispos.,
July 1, 2007;
35(7):
1239 - 1245.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Cheng, J. Maher, C. Chen, and C. D. Klaassen
TISSUE DISTRIBUTION AND ONTOGENY OF MOUSE ORGANIC ANION TRANSPORTING POLYPEPTIDES (OATPS)
Drug Metab. Dispos.,
July 1, 2005;
33(7):
1062 - 1073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.M. Ben Saad and D.L. Maurel
Reciprocal Interaction Between Seasonal Testis and Thyroid Activity in Zembra Island Wild Rabbits (Oryctolagus cuniculus): Effects of Castration, Thyroidectomy, Temperature, and Photoperiod
Biol Reprod,
April 1, 2004;
70(4):
1001 - 1009.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Mikkaichi, T. Suzuki, T. Onogawa, M. Tanemoto, H. Mizutamari, M. Okada, T. Chaki, S. Masuda, T. Tokui, N. Eto, et al.
Isolation and characterization of a digoxin transporter and its rat homologue expressed in the kidney
PNAS,
March 9, 2004;
101(10):
3569 - 3574.
[Abstract]
[Full Text]
[PDF]
|
 |
|