Molecular Endocrinology, doi:10.1210/me.2002-0409
Molecular Endocrinology 17 (7): 1283-1295
Copyright © 2003 by The Endocrine Society
Crystal Structure and Nuclear Magnetic Resonance Analyses of the SAND Domain from Glucocorticoid Modulatory Element Binding Protein-1 Reveals Deoxyribonucleic Acid and Zinc Binding Regions
Paola Lo Surdo,
Matthew J. Bottomley,
Michael Sattler and
Klaus Scheffzek
European Molecular Biology Laboratory (P.L.S., M.J.B., M.S., K.S.), Structural and Computational Biology Programme, 69117 Heidelberg, Germany; and Istituto di Ricerche di Biologia Molecolare (P.L.S., M.J.B.), 00040 Pomezia (Roma), Italy
Address all correspondence and requests for reprints to: Klaus Scheffzek, European Molecular Biology Laboratory, Structural and Computational Biology Programme, Meyerhofstrasse 1, 69117 Heidelberg, Germany. E-mail: scheffzek{at}embl-heidelberg.de; or Matthew J. Bottomley, Istituto di Ricerche di Biologia Molecolare P. Angeletti, Via Pontina Km 30.600, 00040 Pomezia (Roma), Italy. E-mail: matthew_bottomley{at}merck.com.
 |
ABSTRACT
|
|---|
The glucocorticoid-modulatory element-binding proteins, GMEB1 and GMEB2, are ubiquitous, multifunctional DNA-binding proteins with important roles in the modulation of transcription upon steroid hormone activation. The GMEB proteins have intrinsic transactivation ability, but also control the glucocorticoid response via direct binding to the glucocorticoid receptor. They are also mandatory host proteins for Parvovirus replication. Here we present the 1.55 Å resolution crystal structure of a central portion of GMEB1, encompassing its SAND domain, which shares 80% sequence identity with the GMEB2 SAND domain. We demonstrate that this domain, also present in numerous proteins implicated in chromatin-associated transcriptional regulation, is necessary and sufficient to bind the glucocorticoid-modulatory element (GME) DNA target. We use nuclear magnetic resonance (NMR) and binding studies to map the DNA recognition surface to an
-helical region exposing the conserved KDWK motif. Using site-directed mutagenesis, key residues for DNA binding are identified. In contrast to the previously determined NMR structure of the Sp100b SAND domain, we find that the GMEB1 SAND domain also comprises a zinc-binding motif. Although the zinc ion is not necessary for DNA binding, it is found to determine the C-terminal conformation of the GMEB1 SAND domain. We also show that homologous zinc-binding motifs exist in a subset of SAND domain proteins and probe the roles of this novel motif.
 |
INTRODUCTION
|
|---|
THE TRANSCRIPTIONAL ACTIVATION of the tyrosine amino transferase (TAT) gene in response to glucocorticoids has been a paradigm for gene regulation by steroid hormones (1, 2). Induction of TAT transcription first requires the binding of the hormone-receptor complex to glucocorticoid response element (GRE) DNA. However, the transcriptional response is further modulated by a 21-bp DNA element (CTTCTGCGTCAGCGCCAGTAT) termed the glucocorticoid modulatory element (GME), which lies 3.6 kb upstream of the TAT promoter and 1 kb upstream of the TAT-associated GREs (3, 4, 5, 6). The GME is a unique cis-acting DNA element, which powerfully modulates the transcriptional activity of receptors bound to GREs (2). Consequently, the GME is a key regulator of the dose-response curve of glucocorticoid receptor (GR)-bound agonists and of the partial activity of antagonists. These functions are of particular interest, because 1) they determine the activity of physiological concentrations of hormone-receptor complexes, 2) regulation of dose-response curves enables differential control of gene expression during disease treatments, and 3) the partial agonist activity of an antisteroid must be considered when using antihormone therapies (7).
During glucocorticoid signaling, GME activity is expressed through its binding of a complex of two large, regulatory proteins: GME binding protein-1 (GMEB1) and -2 (GMEB2). Indeed, the GMEB1/GMEB2 dimer was identified via its binding to the GCGT and GCGC motifs in the GME (8, 9, 10, 11). The human GMEB proteins (GMEBs) recruit the histone acetylase CREB binding protein, which may explain their transactivation ability (11, 12). However, their modulation of the glucocorticoid response is also mediated by direct interactions with the GR, involving residues 46171 of GMEB1 (7, 11, 12). Additionally, the GMEB heterodimer was independently isolated as Parvovirus initiation factor, after its role in the replication of the minute virus of mice (MVM) (13). The GMEB/Parvovirus initiation factor binding site in MVM DNA comprises two ACGT motifs, separated by five nucleotides (14, 15). Consequently, a consensus PuCGPy DNA motif (Pu: purine, Py: pyrimidine) has emerged as the target site for GMEBs.
The GMEBs are also ubiquitously expressed in rats (9, 10), and homologs have been found in mice, fish, and Caenorhabditis elegans (8, 11) but not in prokaryotes. Interestingly, the human GMEB1 and GMEB2 genes lie on different chromosomes and show different tissue distribution levels, suggesting that both homo- and heterodimers have biological activity. The human GMEBs share approximately 40% overall sequence identity, and residues 89182 in GMEB1 and 81174 in GMEB2 are 80% identical. This portion encompasses the SAND domain, an approximately 80-residue domain with a highly conserved KDWK motif found in various proteins implicated in chromatin-associated transcriptional regulation (16). The SAND domain proteins include the Sp100 family (17, 18), autoimmune regulator 1 (AIRE1) (19), nuclear phosphoprotein NucP41/75, and deformed epidermal autoregulatory factor 1 (DEAF1) (20) [the Drosophila ortholog of human nuclear DEAF1-related (NUDR) (21)].
The biological functions of the SAND domain proteins commonly include DNA binding and transcriptional repression or activation, but the specific roles of their SAND domains are largely uncharacterized. For example, DEAF1, the only Drosophila SAND domain-containing protein, was originally identified as a DNA-binding protein specific for TTCG nucleotide motifs in the deformed response element (20). Recent studies have shown that DEAF1 is essential for early embryonic development and that a mutation in its SAND domain results in developmental abnormalities (22). DEAF1 associates with many (
200) sites on polytene chromosomes, suggesting that it may be a general regulator of gene expression, but the involvement of its SAND domain in this function has not been clarified. The human ortholog NUDR has been more extensively characterized than DEAF1. Not surprisingly, NUDR was also found to bind TTCG motifs, and the DNA-binding function was subsequently mapped to a small region (
140 residues) spanning the SAND domain (23, 24). NUDR was shown to repress transcription from the heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1 promoter, which contains TTCG motif repeats (24). As such, the SAND domain of NUDR may mediate down-regulation of the production of hnRNP A2/B1 and, consequently, it has been suggested that inactivation of NUDR may contribute to the overexpression of hnRNP A2/B1 observed in some human lung cancers.
The AIRE1 protein, in which the SAND domain was initially identified (16), has also been shown to bind DNA targets, including ATTGGTTA or TTATTA motifs (25). AIRE is a large protein harboring multiple domains and motifs implicated in transcriptional regulation (e.g. the PHD zinc finger and LXXLL motifs), but its SAND domain represents its only putative DNA-binding region. Mutations in AIRE1, including at least three different mutations within the SAND domain, result in the APECED syndrome, characterized by autoimmune diseases of the endocrine organs, chronic candidiasis of mucous membranes, and ectodermal disorders [as reviewed recently (26)].
The Sp100 proteins (including Sp100b, Sp110, Sp110b, and Sp140) are typically colocalized with the promyelocytic leukemia tumor suppressor protein in nuclear bodies (also known as promyelocytic leukemia bodies). Nuclear bodies comprise distinct subnuclear entities that undergo structural changes in response to DNA and RNA viral infections and the disruption of which is associated with neurodegenerative disorders and acute promyelocytic leukemia (17, 27). The Sp100 proteins interact with numerous cellular regulatory factors (e.g. the HMG and HP1 proteins) and can be involved in either transcriptional repression (28, 29) or activation (17, 18). Moreover, the NMR structure of the Sp100b SAND domain (Sp100b.SAND) was recently solved and found to be a novel DNA-binding fold (23). To investigate the structural basis of the GMEB-modulated glucocorticoid response, and the involvement of GMEBs in parvoviral replication, we crystallized the approximately 100-residue region of GMEB1 with partial homology to Sp100b.SAND, and determined its structure by x-ray crystallography at 1.55 Å resolution. To identify the functional determinants of this new structure (hereafter termed G1.SAND), we performed site-directed mutagenesis, EMSAs, fluorescence titrations, and NMR analyses. These combined biochemical and biophysical analyses provide insight into the structural basis of DNA binding governing the function of GMEBs. We provide the first evidence that the DNA binding activity of GMEB1 is localized to its SAND domain and have identified an unexpected zinc ion in the structure, which stabilizes a C-terminal extension of the SAND domain. These results provide insight into the roles of SAND domains and will facilitate site-directed mutagenesis studies to enhance our understanding of the biological functions of the various proteins described above.
 |
RESULTS AND DISCUSSION
|
|---|
Overall Structure
The G1.SAND protein (human GMEB1 from Glu-89 to Lys-182) was expressed in Escherichia coli, purified and crystallized as described in Materials and Methods. The structure was solved using multiple wavelength anomalous dispersion (MAD) data of the crystalline Seleno-Methionine-labeled protein and was refined to 1.55 Å resolution (Rwork 19.4%, Rfree 21.0%) with data from a native protein crystal. The structural model of the asymmetric unit contains 2 polypeptide chains (spanning GMEB1 residues 91178), 2 zinc ions, and 215 water molecules. A summary of the crystallographic analysis is given in Table 1
. The G1.SAND structure exhibits a compact fold with an
-helical face and a twisted ß-sheet face (Fig. 1
), with numerous hydrophobic side chains packing into the core and the
-helical face exposing the highly conserved KDWK sequence motif (Lys-143 to Lys-146). The spatial distribution of the conserved residues (Fig. 1
) resembles that of Sp100b.SAND (23). Structural similarity was not found with any other proteins in the Protein Data Bank (PDB), with the exception of the Ski protein in the recently determined structure of the Smad4/Ski complex (PDB code 1MR1), a protein complex involved in the regulation of TGF-ß signaling. Accordingly, Wu et al. (30) reported that Ski and Sp100b.SAND share 28% sequence identity and their structures can be aligned with a root mean square deviation (RMSD) of 1.7 Å for 49 C
atoms.

View larger version (59K):
[in this window]
[in a new window]
|
Figure 1. The G1.SAND Structure Has an /ß Fold and a Zinc-Binding Motif
A, Ribbon diagram of G1.SAND [prepared with MOLMOL (52 )] shows four -helices (red) packed against six ß-strands (blue). A zinc ion (gray) is coordinated by sulfur and nitrogen atoms (yellow/green balls) of Cys-113, His-170, Cys-174, and Cys-178 side chains (blue/cyan). Additional side chain coloring reflects the analyses discussed in text: mutation of a yellow residue reduced DNA binding, mutation of a cyan residue did not. Side chains are labeled using single-letter amino acid code and GMEB1 wild-type numbering. B, 90° Y-axis rotation of Fig. 1A shows the KDWK motif (residues Lys-143 to Lys-146) centered in the helical face, below which is the zinc-binding motif. C, Part of the density-modified experimental electron density map at 2 Å resolution, revealing zinc coordination. Contouring is at 1.2 (blue) and 4 (red). D, Multiple-sequence alignment and structural features of SAND domains. Partial to full residue conservation is indicated with a point, colon, or asterisk according to the Gonnet Pam 250 matrix in CLUSTAL-X (53 ). Above, Secondary structure elements; observed G1. SAND zinc-binding residues (Z); potential zinc-chelating residues in NUDR and DEAF1 (X); and key GMEB residues (G), which pack between the zinc-binding motif and the SAND domain. Below, Point mutations used and numbering for GMEB1. Coloring denotes residue-type conservation, e.g. hydrophobic (yellow). Sequences are human, except for DEAF1 (Drosophila melanogaster) and C44F1, the C. elegans GMEB homolog.
|
|
The most striking feature of the G1.SAND structure is the unexpected presence of an electron density maximum corresponding to a tetrahedrally coordinated zinc ion (Fig. 1
), as confirmed by total x-ray fluorescence (TXRF) analysis (Mertens, M., and C. Rittmeyer, University of Frankfurt, Frankfurt, Germany) and by x-ray absorption spectroscopy of G1.SAND crystals (Leonard, G., European Synchrotron Radiation Facility, Grenoble, France). This finding was particularly intriguing because the Ski protein also binds a zinc ion with tetrahedral coordination. Therefore, we performed both sequence and structure alignments of the G1.SAND and Ski proteins. Although G1.SAND and Ski share only approximately 20% overall sequence identity, there are nevertheless regions of considerable similarity (1.73 Å RMSD for all C
atoms of the core G1.SAND structure). However, upon viewing the three-dimensional (3-D) alignment, it is clear that the two zinc-binding regions of the proteins reside in different locations (Fig. 2
). Moreover, despite some structural similarity in their ß-sheets, these proteins are quite different in their activity-determining loops, which cannot be closely superimposed (Fig. 2
). In Ski, the Smad4-binding I-loop comprises an extended motif of approximately 13 residues, whereas in Sp100b.SAND this loop binds DNA, is considerably shorter (
6 residues), and is partly helical. Thus, we consider that whereas the structural similarity of these domains may indicate a common ancestor, the Ski and SAND proteins are unlikely to share common functions.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 2. The Structural Similarity of G1.SAND and Ski Proteins Does Not Extend to Their Zinc-Binding Regions
The backbone structures of G1.SAND (blue) and Ski (gray) proteins were superimposed with an RMSD of 1.73 Å for all C atoms of the G1.SAND core (residues Tyr-95 to Gln-164). This relatively small RMSD reflects the close superposition of the ß-sheets. However, the functional loops of the proteins (i.e. the KDWK motif in G1.SAND and the I loop in Ski) are clearly structurally divergent. The zinc ions (indicated by arrows; blue for G1.SAND, gray for Ski) are on opposite sides of the proteins. In Ski, the zinc ion is required for the overall fold and activity of the I loop, whereas in G1.SAND the zinc ion is largely coordinated by a C-terminal extension (see text).
|
|
Structural and Functional Roles of the Zinc Ion
Although three of the G1.SAND zinc-binding groups come from C-terminal residues beyond the SAND domain (His-170, Cys-174, and Cys-178), the first zinc-binding residue (Cys-113) lies within the SAND domain itself (Fig. 1
). The four metal-chelating residues are conserved in all GMEBs from humans to C. elegans. Moreover, the zinc-binding motif is packed against the SAND domain through conserved residues, suggesting an evolutionary importance of the spatial relationship between these regions (Fig. 1D
). To investigate further the relationship between SAND domains and adjacent zinc-binding motifs, we extended our TXRF analyses to the GMEB2.SAND and NUDR.SAND proteins and found that they also bind zinc in a 1:1 molar ratio. Intriguingly, NUDR and its Drosophila ortholog, DEAF1, lack potential zinc-binding residues corresponding to G1.SAND Cys-113, but an alternative fourth zinc-binding residue could be one of two additional C-terminal cysteine residues (Fig. 1D
). Also, NUDR and DEAF1 lack His-170, but this may be compensated by their substitution of Tyr-168 by His. Consequently, NUDR and DEAF1 have zinc-binding motifs that flank the SAND domain but presumably have different conformations from those seen in GMEBs. Interestingly, these findings were not predicted either by multiple sequence analyses (15) or by structure analysis of the Sp100b.SAND structure (23), which lacks the zinc-binding motif and does not bind zinc (data not shown). Therefore, these observations, and the lack of zinc-binding motifs in the AIRE and Sp100 SAND proteins, prompt a reclassification of SAND domains according to their zinc-binding properties, with the structural and functional implications discussed below.
Because the zinc-binding motif interacts with the SAND domain, we sought to determine whether the two are structurally dependent. We found that dialysis of G1.SAND against a sodium phosphate buffer containing 10 mM EDTA, pH 8.0, removed zinc from the protein but did not cause aggregation or precipitation of the sample. Moreover, the native zinc-bound form of G1.SAND could be restored by the addition of equimolar ZnCl2 (data not shown). We recorded 1H-15N NMR spectra to study the backbone conformation of G1.SAND in the presence or absence of zinc. Comparison of the spectra shows that the removal of zinc affects only a relatively small subset of residues (Fig. 3
). We assigned the backbone NMR signals of G1.SAND and found that the residues affected are located either in the C-terminal zinc-binding region or around the zinc-chelating Cys-113 within the SAND domain (Fig. 3
). In short, whereas the zinc ion relies on the SAND domain for its full tetrahedral coordination and determines the conformation of the C-terminal region (Ile-165 to Thr-181), the SAND domain core (Tyr-95 to Gln-164) does not require zinc to stabilize its fold.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 3. Removal of Zinc Does Not Affect the Core SAND Domain Structure
A, Superimposed 1H-15N HSQC NMR spectra of G1.SAND with zinc (blue) and without zinc (red). A small subset of resonances from the native protein (blue labels) undergo notable changes in chemical shift (>half a peak width) upon removal of the zinc ion. For clarity, peaks not displaying large chemical shift changes are not labeled. The native protein displays a well dispersed spectrum, indicating a polypeptide with defined structural elements. In contrast, the spectrum of the zinc-depleted protein shows more signals (some highlighted with arrows) restricted to a narrow, central region of the spectrum, characteristic of unstructured residues. B, Worm diagram of the G1.SAND backbone (Asp-90 to Cys-178), with the zinc ion, showing residues affected by removal of zinc (red), unaffected residues (blue), and two zinc-proximal residues that could not be evaluated (yellow). Diagram was prepared with GRASP (54 ) and orientation is as in Fig. 1A .
|
|
After iron, zinc is the most common metal in human proteins, where its roles can be either structural or catalytic (31). Typically, structural zinc ions are buried and coordinated by cysteine and histidine, whereas catalytic zinc ions tend to be solvent exposed and chelated by histidine, glutamate, and aspartate (32). The buried cysteine-histidine coordination scheme seen here suggested a structural role for the GMEB1 zinc ion, potentially required for stabilization of a DNA-binding region, as for some zinc finger proteins. However, neither zinc depletion nor site-directed mutagenesis of Cys-178
Ser affected the DNA binding properties of G1.SAND [Fig. 4A
(lanes 13), B, and C]. The binding pattern to a GMEB DNA target containing two ACGT motifs (as found in the MVM genome) appears to be very similar for both zinc-depleted and native wild-type G1.SAND, as seen in EMSAs (Fig. 4
, C and D). Thus, neither the zinc ion nor the conformation of the zinc-binding motif appears to be required for the binding of G1.SAND to either the 5'- or the 3'-ACGT motif in the GMEB DNA target.

View larger version (23K):
[in this window]
[in a new window]
|
Figure 4. Both Native and Zinc-Depleted G1. SAND Proteins Bind Specifically to GMEB Target DNA Containing One or Two Target Sites
A and B, The binding specificity of G1.SAND for single-site target GMEB DNA (5'-GGATCATCACGTCACTTCATGGAAGC) vs. single-site target NUDR DNA (5'-GGAATTCTTCGGCTTCCCACTTTTGAATTGG) was investigated using the following proteins (at 2 µM concentration): wild-type G1.SAND (i.e. no point mutations and zinc present), wild-type G1.SAND from which the zinc was removed by dialysis against 10 mM EDTA, a Cys-178 Ser mutant (C178S), and a double mutant in which both the Lys residues of the KDWK motif are mutated (Lys-143 Ala and Lys-146 Ala; labeled "ADWA"). The lower bands represent the free DNA. A, The EMSAs were performed using a GMEB target with one consensus site; and B, the EMSAs were performed using an NUDR target with one consensus site. C and D, The native (zinc-bound) and zinc-depleted G1.SAND proteins also bind DNA targets containing two consensus motifs (5'-GGATCATCACGTCACTTACGTGAAGC), and bind with similar affinities.C, The EMSAs were performed with a GMEB DNA target containing two consensus ACGT motifs and using native, wild-type G1.SAND (zinc present). D, The EMSAs were performed with a GMEB DNA target containing two consensus ACGT motifs and using wild-type G1.SAND from which the zinc was removed by dialysis against 10 mM EDTA buffer, pH 8.0. The protein concentrations (micromolar) used in each lane are indicated below panel D. To preclude rechelation of metal cations by the zinc-depleted G1.SAND, the EDTA concentration in the polyacrylamide gel, running buffer, and reaction tubes was raised to 1 mM for these experiments. All apparatus was washed with 10 mM EDTA solution before assembly.
|
|
Our gel-filtration, light-scattering, and NMR studies (data not shown) indicate that G1.SAND does not oligomerize in solution, even at 1 mM concentration. Therefore, it would seem unlikely that zinc is a key mediator of dimerization in full-length GMEBs. To fully understand the role of this structural zinc ion, one should keep in mind that G1.SAND is a module in a larger molecular context. Therein, the zinc-binding motif may serve an auxiliary role either in stabilizing the overall GMEB architecture or in stabilizing interactions between GMEBs and additional protein partners. An interesting example of a zinc ion performing such a structural role was recently identified in the Ski protein. Ski uses conserved cysteine and histidine residues to tetrahedrally coordinate a zinc ion, stabilizing its fold in the conformation required for binding to Smad4 (30).
Characterization of the DNA-Binding Interface
The SAND domain cores of GMEB1 and Sp100b are structurally very similar, as discussed above. However, the observation that the G1.SAND zinc-binding motif partially occludes its
-helical face (Fig. 1
) led us to investigate whether the DNA-binding interfaces of G1.SAND and Sp100b.SAND are comparable. In EMSAs, we found that wild-type G1.SAND induces a band shift of a GMEB1 DNA target with one consensus (ACGT) motif (Fig. 4A
, lane 3), thus demonstrating a G1.SAND-DNA interaction. Specificity is shown by the result that the same protein produces only very minimal band shifts of an NUDR target motif (TTCGG) (Fig. 4B
). Moreover, these minimal shifts are not affected by KDWK motif mutations, suggesting that they reflect a nonspecific interaction (Fig. 4B
). Thus the DNA-binding role of the KDWK motif, first demonstrated in Sp100b.SAND, is also conserved in a GMEB protein. These results are supported by the observation that simultaneous Lys
Ala mutations of the KDWK motif in the native GMEB protein (termed the "ADWA" mutant) abolish interactions with GMEB DNA in EMSAs (Fig. 4A
, lane 4).
To map the site of the G1.SAND-DNA interaction, we monitored protein-DNA complex formation by 1H-15N heteronuclear single-quantum coherence (HSQC) NMR experiments. In the following NMR experiments, we used native G1.SAND from which the zinc had not been removed. We analyzed all the assigned peaks and observed many chemical shift changes upon addition of a 10-bp DNA target containing one consensus ACGT target motif, clearly indicating binding (Fig. 5
). These chemical shift changes almost exclusively map to the
-helical face of G1.SAND and define this as the DNA-binding interface (Fig. 5
). Notably, the DNA-binding interface encompasses many charged groups, most of which are derived from positively charged Lys and Arg side chains (Fig. 5
), as commonly found for DNA-binding surfaces. Many of these residues, including the KDWK motif, have also been implicated in DNA binding by the Sp100b SAND domain (23).

View larger version (54K):
[in this window]
[in a new window]
|
Figure 5. NMR Mapping and Charge Characteristics of the DNA-Binding Interface
A, Superimposed 1H-15N HSQC NMR spectra of native G1.SAND (zinc present) in the absence (blue) and presence (red) of DNA with one target (ACGT) motif representing the consensus GMEB target site. Many peaks show chemical shift changes upon addition of DNA, identifying a large binding surface. For clarity, only peaks showing notable changes are labeled (using single-letter amino acid code and wild-type numbering; W145SC indicates that this signal arises from the tryptophan NE1/HE1 side chain group). B, Superimposed 1H-15N HSQC NMR spectra of native G1.SAND (zinc present) in the absence (blue) and presence (green) of a nonspecific DNA bearing one TTCGG motif typical of NUDR SAND domain targets. Only six peaks show notable chemical shift changes upon addition of a 3-fold molar excess of DNA, corresponding to residues Ser-140, Leu-142, Trp-145 [backbone and side chain N-H signals affected (center and bottom left of figure, respectively)], Ile-149, and Arg-179. These very few changes suggest only a minimal interaction between the molecules, but indicate that the binding interface is the same as when G1.SAND binds to the ACGT target. C, Mapping the chemical shift perturbation data onto the G1.SAND surface reveals that the residues affected by ACGT-motif DNA binding (green) predominantly lie on the -helical face, next to the zinc-binding region (ZBR). The reverse, ß-sheet face displays very few chemical shift changes (not shown). D, Surface representation of G1.SAND, colored according to electrostatic potential (blue, positive; red, negative). Surface plots were made with GRASP; orientation is as in Fig. 1B .
|
|
As a control of binding specificity, we also performed 1H-15N HSQC NMR experiments to test for the formation of a complex between G1.SAND and a nonspecific DNA target. For this study, we chose an oligonucleotide containing one copy of the TTCGG motif, as recognized by the NUDR SAND domain (24), thus representing a related but nonspecific probe. Even in the presence of a 3-fold excess of this probe, there were very few chemical shift changes in the G1.SAND NMR spectrum (Fig. 5B
), indicating that there is no specific protein-DNA complex formation. We noted that the few peaks in the NMR spectrum that did change upon introduction of the nonspecific (TTCGG) oligonucleotide arise from the spatially clustered residues Ser-140, Leu-142, Trp-145, Ile-149, and Arg-179. This may suggest there is some very low-affinity occupancy of the same site to which the ACGT target binds, but we do not consider this physiologically relevant, because the chemical shift changes seen are very few and very small and are notable only when an excess of DNA is added.
Although the GMEB and Sp100b DNA-binding interfaces map to similar regions, it is interesting that the chemical shift changes in the G1.SAND spectra also extend to its zinc-binding motif (Fig. 5
). Although the results above (Fig. 4
) show that the zinc-binding structure is not required for interaction with DNA, these results show that it is, nevertheless, influenced by DNA binding.
Having defined a large DNA-binding interface, we made point mutations within this interface to identify specific residues mediating the interaction. For charged residues we replaced the functional groups with alanine. For cysteine and tryptophan, we used mutations to serine and tyrosine, respectively, which delete the functional groups yet partially conserve the side chain characteristics; therefore, these mutations were not expected to disrupt the overall protein fold. Indeed, all the mutants studied were folded, as seen in analytical gel filtration and/or NMR studies (data not shown). We used the mutant proteins alongside wild-type G1.SAND in EMSAs testing for binding to various GMEB target DNA motifs.
Like the GMEB-binding sites in the GME and the MVM genome, the first DNA target tested contained two target (PuCGPy) motifs (Fig. 6A
). EMSAs with wild-type G1.SAND display two shifted bands, reflecting the occupancy of one or both target sites (Fig. 6A
, lane 2). In contrast, some G1.SAND mutants have reduced DNA binding ability. For example, the alanine mutation of Lys-119 (usually lysine or arginine in SAND domains), which borders the
-helical face, shows reduced binding (Fig. 6A
, lane 4). DNA binding is also reduced by the Trp-145
Tyr mutation in the KDWK motif (Fig. 6A
, lane 8). This may result from 1) disruption of the stabilizing interaction between Trp-145 and Lys-146 side chains (Fig. 1
) and/or 2) loss of the exposed tryptophan indole NH-group, which potentially H bonds with DNA.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 6. Characterization of Key Amino Acids for DNA Binding
A, EMSAs performed with wild-type and mutant G1.SAND proteins and a 26-bp DNA target with two consensus sites (underlined/shaded). B, EMSAs performed with same proteins but a different DNA target with one site intact (underlined/shaded) and the other mutated (lowercase letters).
|
|
Some mutations of conserved G1.SAND residues (e.g. Asp-144
Ala) do not appear to affect DNA binding, (Fig. 6A
, lane 7). In contrast, DNA binding requires the lysine residues in the KDWK motif, because neither the Lys-143
Ala nor Lys-146
Ala nor ADWA mutants induce band shifts (Fig. 6A
, lanes 6, 9, and 10). Other conserved residues exposing positively charged groups on the
-helical face (Fig. 5
) are also implicated in DNA binding, because both Lys-139
Ala and Arg-157
Ala mutations greatly reduce binding (Fig. 6A
, lanes 5 and 11). However, in agreement with our mapping of the DNA-binding interface by these mutagenesis and NMR studies, the mutation of Lys-109
Ala (outside the binding interface) does not affect DNA-binding ability (Fig. 6A
, lane 3).
To demonstrate that G1.SAND is sufficient to mediate sequence-specific binding of the reported GMEB target, we repeated EMSAs with a target lacking one of the two consensus motifs. Wild-type protein induces only one band shift of this mutant target (Fig. 6B
, lane 2), confirming the sequence specificity of G1.SAND/DNA interactions. Moreover, the G1.SAND wild-type and mutant proteins bind the single- and double-site DNA targets with the same pattern (Fig. 6
, A and B). Thus, a single G1.SAND monomer is sufficient to recognize a consensus PuCGPy DNA target. In EMSAs (Fig. 6
and additional data not shown), we observed that the G1.SAND protein studied herein (residues Glu-89 to Lys-182) does not appear to bind cooperatively to tandem binding sites. This observation is in agreement with recent reports (7) that the region of GMEB1 mediating dimerization does not encompass the SAND domain or a significant portion of the zinc-binding motif (specifically, the GMEB1 residues that Chen et al. demonstrate to be sufficient for heterooligomerization and homooligomerization are residues 230306 and 177324, respectively). However, all GMEB targets are reported to contain two consensus motifs. Although dimerization is not fundamentally required for binding to DNA, cooperative binding of tandem sites by dimeric full-length GMEB proteins in vivo may enhance their relatively low binding affinity observed herein. Further, it is conceivable that different combinations of GMEB dimerization and target site spacing may enable differential signaling, as for nuclear receptors (33). To estimate the affinity of wild-type G1.SAND-DNA interactions, we performed fluorescence titrations. G1.SAND displayed a dissociation constant (Kd) of 600 ± 40 nM for a 12-bp target with one PuCGPy motif. Comparable affinities are observed between isolated nuclear receptor DNA-binding domains and their single-site targets (34).
Based on our experimental data obtained by EMSAs and NMR titration studies, we constructed a model of the G1.SAND-DNA interaction (Fig. 7
). A graphical inspection of the G1.SAND structure revealed that its two major helices (helices
2 and
4) expose numerous positively charged side chains implicated in binding DNA (e.g. Lys-131, His-135, Arg-157, and Lys-158; see Fig. 5
). Because helices
2 and
4 are separated by 1620 Å, we consider it likely that they interact with the DNA phosphate backbone ridges, which flank the major groove and are typically separated by 1819 Å in B-form DNA. By manually docking the protein on the DNA with helices
2 and
4 accordingly placed, it was possible to position the conserved KDWK motif and its adjacent helical turn (helix
3) simultaneously, such that it projects toward the major groove in close proximity to the PuCGPy motif characteristic of GMEB DNA targets.

View larger version (49K):
[in this window]
[in a new window]
|
Figure 7. A Docking Model of the G1.SAND Interaction with DNA
An initial model was prepared by manual docking of the 1.55 Å G1.SAND structure onto a computer-generated, standard B-form DNA molecule. Subsequently, a model- refinement step was performed using the consistent-valence force-field (CVFF) for energy minimization of side chain conformations in the DNA-protein interface. For both protein and DNA structures, the backbone coordinates were unchanged. Energy minimization and graphical manipulations were performed using InsightII (Accelrys, Inc., San Diego, CA). The figure presented was prepared with MOLMOL (52 ). The protein secondary structure elements are shown as ribbons, colored as in Fig. 1 , with the side chain bonds of the residues mutated in the EMSA analyses highlighted in yellow and additional bonds chelating the zinc ion (gray sphere) in gray. The DNA molecule used has the same palindromic, 10-bp nucleotide sequence as used in the NMR studies (5'-CTTACGTAAG), and its backbone is represented as cyan ribbons, with the sugar and base moieties shown as solid plates (cyan). The bases of the central C-G base pairs are distinguished as green plates. The relative orientation of the molecules is based on the experimental data discussed. Helices 2 (rear) and 4 (front) expose positively charged side chains placed such that they might interact with the negatively charged DNA backbone phosphate groups. Simultaneously, helix 3 and the KDWK motif are proximal to the major groove, above the central C-G base pairs of the target PuCGPy motif. The ß-sheet region, which the NMR studies do not implicate in DNA binding, is distal from the DNA. The alanine mutation of residue Lys-109 displays wild-type binding in EMSAs, in agreement with its location far from the modeled binding interface. The zinc-binding region is adjacent to the major DNA-binding interface, consistent with the observations (from NMR) that this region may be affected by DNA binding, but that its structure is not absolutely required for DNA binding (from EMSA studies).
|
|
Concluding Remarks
Glucocorticoid signaling is of vital importance both from physiological and pharmacological viewpoints (35, 36). Structural studies of the GR alone (37) or bound to DNA (38, 39) or ligand (40) have revealed many details of the transcriptional activation of glucocorticoid-responsive genes. However, the proteins regulating these processes via the GME (the GMEBs) were hitherto structurally uncharacterized. Here we have presented the first structural module from a GMEB, encompassing its SAND domain and revealing a novel zinc-binding motif. This is a first step in characterizing the GMEBs on a detailed molecular level and has relevance to steroid signaling and hormone disease therapy.
We have revealed the zinc-binding properties of GMEBs and their homologs, prompting a reclassification of SAND domain proteins into zinc-binding or nonbinding families. We have also shown that the SAND domain is sufficient to bind GMEB DNA targets and, as this fold is unique, the protein/DNA recognition mechanism is presumably distinct from those currently known. We have found key residues that mediate DNA binding, involving a conserved KDWK motif in a positively charged
-helical face. Our identification of point mutants that abolish DNA binding sets the stage for future in vivo studies of SAND domain proteins in general. A recent analysis of 100 human promoters showed that more than 50% contained a consensus GMEB target site (41), suggesting that numerous different GMEB-DNA interactions may regulate the transcription of many genes.
The new goals emerging are to solve the structure of this unique protein-DNA complex and to explore the roles of zinc- and DNA binding in full-length GMEBs. However, the GMEBs also recruit protein partners and, interestingly, the G1.SAND structure overlaps with the region of GMEB1 recently reported to bind the GR (7). It is tempting to speculate that the GR may bind the G1.SAND ß-sheet surface, consistent with the observation that ß-sheet residues are not directly involved in DNA binding but, in NUDR.SAND, they are implicated in transactivation (23). Therefore, whereas we have demonstrated the conserved zinc- and DNA-binding functions of the GMEB SAND domain, future studies may reveal additional protein-binding roles in transcriptional regulation.
 |
MATERIALS AND METHODS
|
|---|
Sample Preparation for NMR and Biochemical Assays
The extended SAND domains of GMEB1 (Glu-89 to Lys-182), GMEB2 (Glu-81 to Lys-178), and NUDR (Lys-187 to Leu-324) were cloned from a human cDNA library into modified pET-24d vectors (Novagen Inc., Madison, WI). Site-directed mutants were made by standard overlap-extension methods. The DNA sequences of expression constructs were verified in house. The modified pET-24d vectors expressed proteins with N-terminal 6-His tags, removable by cleavage with TEV (tobacco etch virus) protease, enabling use of nontagged proteins in all studies.
Unlabeled and uniformly 15N- and 13C/15N-labeled proteins were prepared and purified as described previously (42). In short, proteins were purified by affinity chromatography using Ni2+-NTA Superflow resin (QIAGEN, Chatsworth, CA) from which they were eluted in 40 mM Tris (pH 8.0), 0.2 M NaCl, 0.3 M imidazole, 5 mM ß-mercaptoethanol. The 6-His tag was removed by incubation at 23 C with TEV protease. During incubation, the sample was dialyzed against 40 mM Tris (pH 8.0), 0.2 M NaCl, 5 mM imidazole, and 5 mM ß- mercaptoethanol. The noncleavable 6-His-tagged TEV protease was removed by repassing the sample over Ni2+-NTA resin. The sample was diluted 2-fold and loaded on Mono-Q Sepharose resin. The unbound SAND domain fraction was loaded on SP-Sepharose resin and eluted in 20 mM Tris (pH 8.0), 0.5 M NaCl, and 2 mM DTT. These highly purified samples were exchanged into appropriate buffers for use in EMSAs and fluorescence titrations.
Before concentration, isotope-labeled NMR samples were further purified by gel filtration using Superdex-75 resin (Amersham Biosciences, Milan, Italy) equilibrated in 40 mM Tris (pH 8.0), 0.2 M NaCl, 3 mM DTT. For NMR experiments performed for the assignment of the G1.SAND backbone chemical shifts, 1 mM NMR samples were made in 20 mM sodium phosphate NMR buffer (pH 6.4), 0.1 M NaCl, 3 mM DTT, and 0.02% NaN3 in 90% H2O, 10% D2O. The G1.SAND-DNA complexes (using native G1.SAND containing the zinc ion) were made at 50 µM and concentrated to 0.5 mM in the same NMR buffer described above, but with the pH adjusted to pH 7.5. The GMEB-specific DNA target used was 5'-CTTACGTAAG, of which a 10% molar excess of DNA was sufficient to saturate DNA binding. The nonspecific DNA target was 5'-GGGTTCGGCCA. A 3-fold molar excess of this DNA saturated the binding but produced only very few chemical shifts.
The zinc-depleted samples of G1.SAND were prepared by 24-h dialysis at 23 C against 25 mM sodium phosphate buffer (pH 8.0), 0.1 M NaCl, 10 mM EDTA, 3 mM DTT, before exchange into NMR buffer. The successful removal of zinc was confirmed by TXRF analyses.
Protein Preparation for Crystallographic Analysis
Native G1.SAND was expressed as above, whereas a Seleno-Methionyl (Se-Met) derivative was expressed at 23 C in E. coli strain B834, in minimal medium containing L-selenomethionine (ACROS), as the only source of methionine. During incubation with TEV protease, the sample was dialyzed against 50 mM HEPES (pH 7.5), 0.2 M NaCl, 10 mM ß-mercaptoethanol. The protein was then diluted 4-fold with 50 mM HEPES (pH 7.5), 10 mM ß-mercaptoethanol (buffer A), and loaded on HP-S Sepharose resin from which it was eluted at 0.6 M NaCl using a linear gradient with buffer B (buffer A + 1.0 M NaCl). The protein was further purified by gel filtration in 20 mM Tris (pH 7.5), 0.2 M NaCl, 5 mM DTT and concentrated for crystallization.
Crystallization, Data Collection, Structure Determination, and Refinement
Diffraction-quality crystals (space group P212121; unit cell dimensions: a = 40.8 Å, b = 48.98 Å, c = 88.8 Å,
= ß =
= 90°) were obtained from the native protein (60 mg/ml) with the hanging-drop vapor diffusion technique in condition no. 38 of Hampton Research Crystal Screen I (0.1 M HEPES, pH 7.5, 1.4 M sodium citrate) after overnight incubation at room temperature. Crystals of the Se-Met protein (15 mg/ml) were obtained under similar conditions.
A single Se-Met-labeled G1.SAND crystal was flash frozen in liquid nitrogen and placed in a 100 K cryostream for MAD data collection at beam line BM14 at the European Synchrotron Radiation Facility, yielding a high-quality 2 Å resolution data set. A native data set at 1.55 Å resolution was collected under cryogenic conditions similar to those described above. The programs XDS (43) and CNS (44) were used for data processing and MAD analysis, respectively (see table). The electron density map was readily interpretable, allowing placement of the Sp100b.SAND NMR structure (23) into the two monomers of the asymmetric unit. Alternate model building and refinement cycles were carried out with the programs O (45) and CNS, respectively. The model derived from the MAD-phased map was ultimately refined against the native data set; water molecules were added using standard CNS protocols.
NMR Spectroscopy
NMR spectra were acquired at 30 C on Bruker DRX spectrometers operating at a 1H frequency of 600 MHz and equipped with triple resonance probes and pulsed field gradients. Two-dimensional 1H-15N HSQC experiments were recorded using a gradient-enhanced sensitivity pulse program with a water flip-back pulse to minimize cross-saturation of amide NH signals, as discussed previously (46, 47). HSQC experiments were acquired with 1024 complex t2 data points and 144 complex t1 increments, and with spectral widths of 12626 Hz (1H) and 1666 Hz (15N). Spectra were processed with NMRPIPE (48), applying phase-shifted sine bell-weighting functions and zero filling before Fourier transformation. All spectra were analyzed using NMRVIEW (49). The 1H, 13C, and 15N chemical shifts were assigned by standard methods (42, 47, 50) and a complete description of the two- and three-dimensional triple-resonance NMR experiments used has been published elsewhere (51).
EMSAs
EMSAs were performed with duplex DNA targets, 32P-labeled by the Klenow fill-in method. Unless otherwise indicated, reactions were prepared at 2 µM protein, and 10 nM DNA in 20 µl 20 mM Tris (pH 7.5) buffer, 0.1 M KCl, 5 mM DTT, 1 mM EDTA, 10 ng/µl sheared, salmon sperm competitor DNA, and 3% Ficoll. The presence of EDTA in the EMSA experiments was found not to affect the results (data not shown) but was considered beneficial because it prevented degradation of the DNA target during the EMSA by any low-level contamination of cation-dependent deoxyribonuclease enzymes. Mixtures were incubated at 4 C for 30 min and were then loaded onto a 10% (30:1) polyacrylamide-bisacrylamide gel, prepared in Tris-glycine buffer (pH 7.5), 2 mM DTT, 0.4 mM EDTA. After electrophoresis for 2 h, 120 V, 4 C, DNA mobility was measured with a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA). Results are representative of at least three experiments.
Fluorescence Titration Assays
DNA-SAND domain interactions were followed by monitoring the quenching of tryptophan fluorescence upon introduction of duplex DNA (5'-GCTTACGTAAGC), as described previously (23).
Data Deposition
The atomic coordinates of the GMEB1 SAND domain structure have been deposited in the PDB, accession code 1OQJ. The backbone resonance assignments have been deposited in the BioMagResBank with entry no. 5592, as described in Ref. 51 .
 |
ACKNOWLEDGMENTS
|
|---|
We thank the staff at BM14 of the European Synchrotron Radiation Facility (Grenoble, France) for support; M. Mertens and C. Rittmeyer (University of Frankfurt, Frankfurt, Germany) for the TXRF analyses; A. Vannini and U. Koch (Instituto di Ricerche di Biologia Molecolare, Rome, Italy) for help in protein-DNA complex modeling; A. Stark and R. Russell for useful discussions; and S. Denger, R. Metivier, D. Suck, P. Gallinari, and A. Carfì for critical comments on the manuscript.
We are deeply indebted to our mentor Matti Saraste, to whose memory we dedicate this work.
 |
FOOTNOTES
|
|---|
This work was supported by the European Molecular Biology Laboratory (to P.L.S.), European Molecular Biology Organization (to M.J.B.), and the Deutsche Forschungsgemeinschaft (Grant Sa823/2, to M.S.).
P.L.S. and M.J.B. contributed equally to this work.
Abbreviations: AIRE1, Autoimmune regulator 1; CREB, cAMP response element binding protein; DEAF1, deformed epidermal autoregulatory factor; DTT, dithiothreitol; GME, glucocorticoid-modulatory element; GMEB, GME-binding protein; GR, glucocorticoid receptor; GRE, glucocorticoid response element; hnRNP, heterogeneous nuclear ribonucleoprotein; HSQC, heteronuclear single-quantum coherence; MAD, multiple wavelength anomalous dispersion; MVM, minute virus of mice; NMR, nuclear magnetic resonance; NUDR, nuclear DEAF1-related; PDB, Protein Data Bank; RMSD, root mean square deviation; SAND, proteins Sp100, AIRE1, NucP41/75, and DEAF1; Sp100, speckled 100-kDa protein; TAT, tyrosine amino transferase; TEV, tobacco etch virus; TXRF, total x-ray fluorescence.
Received for publication December 6, 2002.
Accepted for publication April 7, 2003.
 |
REFERENCES
|
|---|
- Simons Jr SS, Oshima H, Szapary D 1992 Higher levels of control: modulation of steroid hormone-regulated gene transcription. Mol Endocrinol 6:9951002[CrossRef][Medline]
- Zeng H, Plisov SY, Simons Jr SS 2000 Ability of the glucocorticoid modulatory element to modify glucocorticoid receptor transactivation indicates parallel pathways for the expression of glucocorticoid modulatory element and glucocorticoid response element activities. Mol Cell Endocrinol 162:221234[CrossRef][Medline]
- Oshima H, Simons Jr SS 1993 Sequence-selective interactions of transcription factor elements with tandem glucocorticoid-responsive elements at physiological steroid concentrations. J Biol Chem 268:2685826865[Abstract/Free Full Text]
- Oshima H, Simons Jr SS 1992 Modulation of transcription factor activity by a distant steroid modulatory element. Mol Endocrinol 6:416428[Abstract]
- Collier CD, Oshima H, Simons Jr SS 1996 A negative tyrosine aminotransferase gene element that blocks glucocorticoid modulatory element-regulated modulation of glucocorticoid-induced gene expression. Mol Endocrinol 10:463476[Abstract]
- Jackson DA, Collier CD, Oshima H, Simons Jr SS 1998 Modulation of TAT gene induction by glucocorticoids involves a neutralizing sequence. J Steroid Biochem Mol Biol 66:7991[CrossRef][Medline]
- Chen J, Kaul S, Simons Jr SS 2002 Structure/activity elements of the multifunctional protein, GMEB-1. Characterization of domains relevant for the modulation of glucocorticoid receptor transactivation properties. J Biol Chem 277:2205322062[Abstract/Free Full Text]
- Jimenez-Lara AM, Heine MJ, Gronemeyer H 2000 Cloning of a mouse glucocorticoid modulatory element binding protein, a new member of the KDWK family. FEBS Lett 468:203210[CrossRef][Medline]
- Oshima H, Szapary D, Simons Jr SS 1995 The factor binding to the glucocorticoid modulatory element of the tyrosine aminotransferase gene is a novel and ubiquitous heteromeric complex. J Biol Chem 270:2189321901[Abstract/Free Full Text]
- Theriault JR, Charette SJ, Lambert H, Landry J 1999 Cloning and characterization of hGMEB1, a novel glucocorticoid modulatory element binding protein. FEBS Lett 452:170176[CrossRef][Medline]
- Zeng H, Jackson DA, Oshima H, Simons Jr SS 1998 Cloning and characterization of a novel binding factor (GMEB-2) of the glucocorticoid modulatory element. J Biol Chem 273:1775617762[Abstract/Free Full Text]
- Kaul S, Blackford Jr JA, Chen J, Ogryzko VV, Simons Jr SS 2000 Properties of the glucocorticoid modulatory element binding proteins GMEB-1 and -2: potential new modifiers of glucocorticoid receptor transactivation and members of the family of KDWK proteins. Mol Endocrinol 14:10101027[Abstract/Free Full Text]
- Christensen J, Cotmore SF, Tattersall P 1997 Parvovirus initiation factor PIF: a novel human DNA-binding factor which coordinately recognizes two ACGT motifs. J Virol 71:57335741[Abstract]
- Christensen J, Cotmore SF, Tattersall P 1997 A novel cellular site-specific DNA-binding protein cooperates with the viral NS1 polypeptide to initiate parvovirus DNA replication. J Virol 71:14051416[Abstract]
- Christensen J, Cotmore SF, Tattersall P 1999 Two new members of the emerging KDWK family of combinatorial transcription modulators bind as a heterodimer to flexibly spaced PuCGPy half-sites. Mol Cell Biol 19:77417750[Abstract/Free Full Text]
- Gibson TJ, Ramu C, Gemund C, Aasland R 1998 The APECED polyglandular autoimmune syndrome protein, AIRE-1, contains the SAND domain and is probably a transcription factor. Trends Biochem Sci 23:242244[CrossRef][Medline]
- Bloch DB, Nakajima A, Gulick T, Chiche JD, Orth D, de La Monte SM, Bloch KD 2000 Sp110 localizes to the PML-Sp100 nuclear body and may function as a nuclear hormone receptor transcriptional coactivator. Mol Cell Biol 20:61386146[Abstract/Free Full Text]
- Bloch DB, de la Monte SM, Guigaouri P, Filippov A, Bloch KD 1996 Identification and characterization of a leukocyte-specific component of the nuclear body. J Biol Chem 271:2919829204[Abstract/Free Full Text]
- Nagamine K, Peterson P, Scott HS, Kudoh J, Minoshima S, Heino M, Krohn KJ, Lalioti MD, Mullis PE, Antonarakis SE, Kawasaki K, Asakawa S, Ito F, Shimizu, N 1997 Positional cloning of the APECED gene. Nat Genet 17:393398[CrossRef][Medline]
- Gross CT, McGinnis W 1996 DEAF-1, a novel protein that binds an essential region in a deformed response element. EMBO J 15:19611970[Medline]
- Huggenvik JI, Michelson RJ, Collard MW, Ziemba AJ, Gurley P, Mowen KA 1998 Characterization of a nuclear deformed epidermal autoregulatory factor-1 (DEAF-1)-related (NUDR) transcriptional regulator protein. Mol Endocrinol 12:16191639[Abstract/Free Full Text]
- Veraksa A, Kennison J, McGinnis W 2002 DEAF-1 function is essential for the early embryonic development of Drosophila. Genesis 33:6776[CrossRef][Medline]
- Bottomley MJ, Collard MW, Huggenvik JI, Liu Z, Gibson TJ, Sattler M 2001 The SAND domain structure defines a novel DNA-binding fold in transcriptional regulation. Nat Struct Biol 8:626633[CrossRef][Medline]
- Michelson RJ, Collard MW, Ziemba AJ, Persinger J, Bartholomew B, Huggenvik JI 1999 Nuclear DEAF-1-related (NUDR) protein contains a novel DNA binding domain and represses transcription of the heterogeneous nuclear ribonucleoprotein A2/B1 promoter. J Biol Chem 274:3051030519[Abstract/Free Full Text]
- Kumar PG, Laloraya M, Wang CY, Ruan QG, Davoodi-Semiromi A, Kao KJ, She JX 2001 The autoimmune regulator (AIRE) is a DNA-binding protein. J Biol Chem 276:4135741364[Abstract/Free Full Text]
- Pitkanen J, Peterson P 2003 Autoimmune regulator: from loss of function to autoimmunity. Genes Immun 4:1221[CrossRef][Medline]
- Hodges M, Tissot C, Howe K, Grimwade D, Freemont PS 1998 Structure, organization, and dynamics of promyelocytic leukemia protein nuclear bodies. Am J Hum Genet 63:297304[CrossRef][Medline]
- Lehming N, Le Saux A, Schuller J, Ptashne M 1998 Chromatin components as part of a putative transcriptional repressing complex. Proc Natl Acad Sci USA 95:73227326[Abstract/Free Full Text]
- Seeler JS, Marchio A, Sitterlin D, Transy C, Dejean A 1998 Interaction of SP100 with HP1 proteins: a link between the promyelocytic leukemia-associated nuclear bodies and the chromatin compartment. Proc Natl Acad Sci USA 95: 73167321
- Wu JW, Krawitz AR, Chai J, Li W, Zhang F, Luo K, Shi Y 2002 Structural mechanism of Smad4 recognition by the nuclear oncoprotein Ski: insights on Ski-mediated repression of TGF-ß signaling. Cell 111:357367[CrossRef][Medline]
- Chi YI, Sadler I, Jablonski LM, Callantine SD, Deobald CF, Stauffacher CV, Bohach GA 2002 Zinc-mediated dimerization and its effect on activity and conformation of staphylococcal enterotoxin type C. J Biol Chem 277:2283922846[Abstract/Free Full Text]
- Alberts IL, Nadassy K, Wodak SJ 1998 Analysis of zinc binding sites in protein crystal structures. Protein Sci 7:17001716[Abstract]
- Rastinejad F 2001 Retinoid X receptor and its partners in the nuclear receptor family. Curr Opin Struct Biol 11:3338[CrossRef][Medline]
- Lee MS, Kliewer SA, Provencal J, Wright PE, Evans RM 1993 Structure of the retinoid X receptor
DNA binding domain: a helix required for homodimeric DNA binding. Science 260:11171121[Abstract/Free Full Text]
- Jenkins BD, Pullen CB, Darimont BD 2001 Novel glucocorticoid receptor coactivator effector mechanisms. Trends Endocrinol Metab 12:122126[CrossRef][Medline]
- Yudt MR, Cidlowski JA 2002 The glucocorticoid receptor: coding a diversity of proteins and responses through a single gene. Mol Endocrinol 16:17191726[Abstract/Free Full Text]
- Baumann H, Paulsen K, Kovacs H, Berglund H, Wright AP, Gustafsson JA, Hard T 1993 Refined solution structure of the glucocorticoid receptor DNA-binding domain. Biochemistry 32:1346313471[CrossRef][Medline]
- Remerowski ML, Kellenbach E, Boelens R, van der Marel GA, van Boom JH, Maler BA, Yamamoto KR, Kaptein R 1991 1H NMR studies of DNA recognition by the glucocorticoid receptor: complex of the DNA binding domain with a half-site response element. Biochemistry 30:1162011624[CrossRef][Medline]
- Luisi BF, Xu WX, Otwinowski Z, Freedman LP, Yamamoto KR, Sigler PB 1991 Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352:497505[CrossRef][Medline]
- Bledsoe RK, Montana VG, Stanley TB, Delves CJ, Apolito CJ, McKee DD, Consler TD, Parks DJ, Stewart EL, Willson TM, Lambert MH, Moore JT, Pearce KH, Xu HE 2002 Crystal structure of the glucocorticoid receptor ligand binding domain reveals a novel mode of receptor dimerization and coactivator recognition. Cell 110:93105[CrossRef][Medline]
- Burnett E, Christensen J, Tattersall P 2001 A consensus DNA recognition motif for two KDWK transcription factors identifies flexible-length, CpG-methylation sensitive cognate binding sites in the majority of human promoters. J Mol Biol 314:10291039[CrossRef][Medline]
- Liu Z, Macias MJ, Bottomley MJ, Stier G, Linge JP, Nilges M, Bork P, Sattler M 1999 The three-dimensional structure of the HRDC domain and implications for the Werner and Bloom syndrome proteins. Structure Fold Des 7:15571566[Medline]
- Kabsch W 1993 Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants. J Appl Crystallogr 26:795800[CrossRef]
- Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J, Nilges M, Pannu NS, Read RJ, Rice LM, Simonson T, Warren GL 1998 Crystallography & NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr D 54:905921[CrossRef][Medline]
- Jones TA, Zou JY, Cowan SW, Kjeldgaard M 1991 Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr A 47:110119
- Grzesiek S, Bax A 1993 The importance of not saturating H2O in protein NMR. Application to sensitivity enhancement and NOE measurements. J Am Chem Soc 115:1259312594[CrossRef]
- Sattler M, Schleucher J, Griesinger C 1999 Heteronuclear multidimensional NMR experiments for the structure determination of proteins in solution employing pulsed field gradients. Prog NMR Spectrosc 34:93158[CrossRef]
- Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, Bax A 1995 NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6:277293[Medline]
- Johnson B, Blevins RA 1994 NMRView: a computer program for the visualization and analysis of NMR data. J Biomol NMR 4:603614[CrossRef]
- Clore GM, Gronenborn AM 1998 Determining the structures of large proteins and protein complexes by NMR. Trends Biotechnol 16:2234[Medline]
- Bottomley MJ, Sattler M 2003 1H, 13C and 15N backbone resonance assignments of the SAND domains from the glucocorticoid modulatory element binding proteins-1 and -2. J Biomol NMR 25:259260[CrossRef][Medline]
- Koradi R, Billeter M, Wüthrich K 1996 MOLMOL: a program for display and analysis of macromolecular structures. J Mol Graph 14:5155[CrossRef][Medline]
- Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG 1997 The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:48764882[Abstract/Free Full Text]
- Nicholls A, Sharp KA, Honig B 1991 Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins 11: 281296
NURSA Molecule Pages Link:
- Nuclear Receptors:
GR
- Coregulators:
GMEB-1
|
GMEB-2
This article has been cited by other articles:

|
 |

|
 |
 
D. E. Reed, X. M. Huang, J. A. Wohlschlegel, M. S. Levine, and K. Senger
DEAF-1 regulates immunity gene expression in Drosophila
PNAS,
June 17, 2008;
105(24):
8351 - 8356.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T Thye, E N Browne, M A Chinbuah, J Gyapong, I Osei, E Owusu-Dabo, S Niemann, S Rusch-Gerdes, R D Horstmann, and C G Meyer
No associations of human pulmonary tuberculosis with Sp110 variants.
J. Med. Genet.,
July 1, 2006;
43(7):
e32 - e32.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Bottomley, G. Stier, D. Pennacchini, G. Legube, B. Simon, A. Akhtar, M. Sattler, and G. Musco
NMR Structure of the First PHD Finger of Autoimmune Regulator Protein (AIRE1): INSIGHTS INTO AUTOIMMUNE POLYENDOCRINOPATHY-CANDIDIASIS-ECTODERMAL DYSTROPHY (APECED) DISEASE
J. Biol. Chem.,
March 25, 2005;
280(12):
11505 - 11512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Carles, D. Choffnes-Inada, K. Reville, K. Lertpiriyapong, and J. C. Fletcher
ULTRAPETALA1 encodes a SAND domain putative transcriptional regulator that controls shoot and floral meristem activity in Arabidopsis
Development,
March 1, 2005;
132(5):
897 - 911.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Jensik, J. I. Huggenvik, and |