| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Endocrinology and Metabolism (J.W., J.A.K., S.B., E.P., H.K., J.A.F.), University of Cincinnati College of Medicine, Cincinnati, Ohio 45267; and Istituto di Endocrinologia ed Oncologia Sperimentale (M.S., A.F.), Consiglio Nazionale delle Ricerche c/o Dipartimento di Biologia e Patologia Cellulare e Molecolare, University "Federico II," Naples, Italy
Address all correspondence and requests for reprints to: James A. Fagin, M.D., Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, P.O. Box 670547, Cincinnati, Ohio 45267-0547. E-mail: James.Fagin{at}uc.edu.
| ABSTRACT |
|---|
|
|
|---|
. Acute expression of the oncoprotein decreased TSH-mediated growth stimulation due to interference of TSH signaling by RET/PTC at multiple levels. Taken together, these data indicate that RET/PTC is a weak tumor-initiating event and that TSH action is disrupted by this oncoprotein at several points, and also predict that secondary genetic or epigenetic changes are required for clonal expansion. | INTRODUCTION |
|---|
|
|
|---|
cAMP-dependent protein kinase A (3). RET/PTC3 is also a result of an intrachromosomal rearrangement and is formed by fusion with the RFG/ELE1 gene (4, 5). Recently, several additional variants of RET/PTC have been observed in papillary carcinomas arising in children exposed to radiation after Chernobyl (6, 7). The fusion proteins generated by these chimeric genes dimerize in a ligand-independent manner and constitutively activate the TK function of RET, thus exerting their transforming potential. RET rearrangements are found in 540% of PTC in the adult population (1). By contrast, RET rearrangements are more common in pediatric PTC, and in cancers from children exposed to radiation after the Chernobyl nuclear accident (8, 9, 10). There are several lines of evidence pointing to RET/PTC as a key first step in thyroid cancer pathogenesis: 1) thyroid- specific overexpression of either RET/PTC1 (11, 12) or RET/PTC3 (13) in transgenic mice leads to development of tumors with histological features consistent with PTC. 2) There is a high prevalence of RET/PTC expression in occult or microscopic PTC (14, 15). 3) Exposure of cell lines (16) and fetal thyroid explants (17) to ionizing radiation results in induction of expression of RET/PTC within hours, supporting a direct role for radiation in the illegitimate recombination of RET. 4) The breakpoints in the RET and ELE1/RFG genes resulting in the RET/PTC3 rearrangements of radiation-induced pediatric thyroid cancers from Chernobyl are consistent with direct double-strand DNA breaks resulting in illegitimate reciprocal recombination (18). Moreover, the H4 and RET genes, although lying at a considerable linear distance from each other within chromosome 10, are spatially juxtaposed during interphase in thyroid cells and presumably present a target for simultaneous double-strand breaks in each gene after ionizing radiation, thus giving rise to the RET/PTC1 rearrangement (19).
RET/PTC1 has been reported to confer PCCL3 cells with the ability to grow in a TSH-independent manner, and to decrease expression of the TSH receptor (TSH-R), thyroglobulin, and thyroid peroxidase (20). These effects of RET/PTC on thyroid cell growth and differentiation were observed in cells stably overexpressing the oncoprotein, and it is possible that some of the observed changes occurred during selection and adaptation to the genetic manipulation in vitro. To explore potential early changes associated with tumor initiation by RET/PTC, we developed rat thyroid cell lines with conditional expression of either RET/PTC1 or RET/PTC3. We report that RET/PTC is indeed associated with loss of thyroid-specific differentiation. Moreover, we show that RET/PTC interferes with TSH-R-mediated intracellular signaling at various levels, by blocking expression of the receptor, and by effects on adenylyl cyclase as well as distal to cAMP generation. Acute activation of RET/PTC is not, however, sufficient to allow cells to grow in the absence of TSH, as the oncoprotein stimulates both DNA synthesis and apoptosis in PCCL3 cells, suggesting that secondary events must be necessary to allow unregulated growth and clonal expansion.
| RESULTS |
|---|
|
|
|---|
|
by Western blotting with phospho-specific antibodies (Fig. 2C
|
|
|
|
or Shc, respectively. We report elsewhere the development and characterization of PCCL3 cells with doxycycline-inducible expression of RET/PTC3Y541F, and of RET/PTC2-PDZ (Knauf, J. A., M. Croyle, E. Kimura, and J. A. Fagin, submitted). We also confirmed the inability of RET/PTC3Y541F to associate with or phosphorylate PLC
, whereas the interaction with Shc is unaffected. Conversely, RET/PTC2-PDZ associates with and activates PLC
, but not Shc-Ras (22). As shown in Fig. 6
or Shc-Ras-MEK-MAPK by RET/PTC is not required for the RET/PTC-induced effects on growth and apoptosis.
|
|
and Shc.
|
|
| DISCUSSION |
|---|
|
|
|---|
Considerable progress has been made in identifying signaling pathways activated by RET that may be responsible for its biological effects (23, 24, 25, 26, 27). Deletions or substitutions of specific tyrosine residues in the intracellular domain of RET have been performed to explore the relative contribution of the distinct signaling effectors to which they couple to the transforming effects of the oncoprotein. Y1062 plays an essential role in RET signaling because its mutation impairs transformation of fibroblasts mediated by oncogenic mutants such as RET/MEN2A, RET/MEN2B, and RET/PTC2 (22, 28, 29). De Vita et al. (30) reported that mutation of Y1062 abolished the ability of RET/MEN2A to promote neuronal differentiation in PC12 cells. Y1062 appears to be involved in complex associations with several docking proteins, such as Shc (31, 32) and FRS-2 (33), both ultimately resulting in Ras activation, and IRS-1 (30). RET/PTC2, which like all other RET/PTC chimeric proteins lacks a transmembrane domain, is recruited to the cell surface in part by interaction with the protein Enigma, also through tyrosine 1062. Unlike Shc and the other effectors, the interaction of Y1062 with Enigma is not affected by Y1062 phosphorylation, but nevertheless this association is required for mitogenesis in fibroblasts (22). Thus, mutation of this single tyrosine residue, in addition to blocking interaction with Shc-Ras and perhaps other signaling effectors, may interfere more broadly with the function of the oncoprotein through mislocalization away from the cell surface. Because of this concern, we explored the role of Y1062 by using a truncated fragment of RET/PTC2 lacking the C terminal 22 residues, including the tyrosine corresponding to Y1062 of wild-type RET. This fragment was fused to an N-terminal PDZ domain, which interacts with Enigma and allows appropriate membrane localization (22). We show elsewhere that after doxycycline- induced expression of RET/PTC2-PDZ (C574-PDZ) in PCCL3 cells, the mutant oncoprotein does not associate with Shc, yet retains its ability to interact and activate other effectors such as PLC
(Knauf, J. A., M. Croyle, E. Kimura, and J. A. Fagin, submitted). Here we show that acute activation of RET/PTC2-PDZ recapitulates in all respects the effects of intact forms of RET/PTC on growth and apoptosis. Thus, direct interaction with Ras through Shc is not required for either of these outcomes. This does not exclude a role for effectors downstream of Ras on this process because MAPK, for example, can be activated through alternative routes. Thus, cAMP can activate MAPK in a PKA-independent manner via Rap1 (34), and protein kinase C (PKC)
has been shown to activate Raf independent of Ras (35). We previously reported that acute activation of oncogenic mutants of H-Ras or of its effector MEKI resulted in a high rate of cell death in PCCL3 cells (36). In this model, H-Ras activation is associated with sustained high intensity activation of MAPK, whereas RET/PTC oncoproteins evoke more transient and less intense activation of this effector (Basu, S., and J. A. Fagin, unpublished).
Similarly, the experiments with the RET/PTC3Y541F mutant, which cannot associate directly with PLC
but signals appropriately through Shc and other effectors, indicate that direct activation of PLC
is not required for the effects on growth or apoptosis. This was of interest because of the observation that PKC
, which is selectively activated by RET/PTC via PLC
and then down-regulated, may play a role in controlling cell survival in thyroid cells (37). Again, these experiments do not exclude participation of PKC
in this process because PKC isozymes can also be activated through alternative pathways. For instance, phosphorylation of PKC isozymes by the phosphatidylinositol 3-kinase-dependent kinase, PDK1 is required for activation (38, 39). Taken together, these data indicate that upstream interference of activation of Shc and PLC
by RET/PTC is not sufficient to block either cell proliferation or apoptosis.
One well-known feature of papillary thyroid carcinomas is that they exhibit decreased expression of thyroid-specific genes and lower radioiodine uptake compared with normal thyroid tissue. Santoro et al. (20) previously reported that expression of RET/PTC1 in PCCL3 cells is associated with lower abundance of thyroglobulin, thyroid peroxidase, and TSH-R mRNA levels. This implies that at least some of the effects of the oncoprotein on differentiation may be accounted for by lower abundance of TSH-R and consequent decreased responsiveness to its ligand. Here, using an acute model of RET/PTC1 and RET/PTC3 activation, we confirm this observation. However, in addition to the likely interference with the TSH-mediated signal at this step, we also show that acute expression of RET/PTC interrupts signal transmission at distal sites along this pathway. Thus, neither forskolin nor cholera toxin evoked appropriate activation of adenylyl cyclase after RET/PTC expression. This cannot be accounted for simply by changes in the abundance of G proteins, or of key adenylyl cyclase isoforms (not shown). The identity of adenylyl cyclase isoforms in other cell types has been shown to be instrumental in modulating proliferative responses because they differ in their response to upstream signal inputs (40). Vanvooren et al. (41) have shown that dog and human thyrocytes express primarily adenylyl cyclases ACIII, ACVI, and ACIX . Of these, ACVI is known to be inhibited by low (µM) concentrations of Ca2+ and is also expressed in rat thyroid cells. Moreover, treatment of dog thyroid cells with thapsigargin in the presence of extracellular calcium markedly inhibits forskolin-induced increases in cAMP levels (41). Treatment with the calcium ionophore A 23187 evoked similar responses (42). A reasonable hypothesis is that RET/PTC may inhibit adenylyl cyclase activity primarily through intracellular Ca2+-mediated inhibition of ACVI. Other effectors engaged by RET/PTC may also play a role in modulating adenylyl cyclase activity. Receptor TKs are thought to modulate adenylyl cyclase acting via serine phosphorylation, although the precise effectors involved may vary (43). IGF-I has been shown to enhance adenylyl cyclase VI activity in human embryonic kidney cells through p74raf1 (43). In PC12 cells, PKC inhibits ACVI activity, likely through either PKC
or
(44). The fact that RET/PTC1 and 3 selectively activate PKC
makes this isozyme an interesting candidate for the effects we report here. Recently, adenylyl cyclase has been termed a "coincidence detector" because it integrates concurrent signal inputs from several pathways (45). The observation that neither RET/PTC3Y541F nor RET/PTC2-PDZ inhibited TSH-induced cAMP levels suggests that the interaction of RET/PTC with both Shc and PLC
are required for this effect. Our data point to critical effects on RET/PTC presumably acting directly on adenylyl cyclase, but the precise biochemical mechanism will require further study.
In addition to its effects on adenylyl cyclase activity, RET/PTC also acts at a more distal step along this signal transduction cascade, as evidenced by lower cAMP-induced DNA synthesis 48 h after RET/PTC activation. Evidence that RET/PTC does not impede CREB phosphorylation points to a PKA-independent mode of action. Recently, Ribeiro-Neto et al. (34) reported that PKA activation of Rap1b is required for TSH-induced mitogenic activity in thyroid follicular cells. The manner in which RET/PTC signaling intersects with effectors distal to Rap1b may help explain these changes.
In conclusion, this study extends previous information on the mechanism of the tumor initiation by RET/PTC in several ways. First, we demonstrate that expression of this oncoprotein is not sufficient to promote cell growth because it simultaneously activates both DNA synthesis and apoptosis. This likely creates a new homeostatic state, in which cells may become susceptible to secondary genetic or epigenetic changes that may disable growth inhibitory or antiapoptotic signaling effectors. We also demonstrate that simple deletion of two of the key signaling pathways activated by RET/PTC is not sufficient to alter the phenotype. Finally, we show for the first time that RET/PTC interferes with thyroid differentiation at steps distal to the TSH-R, predicting that simple restoration of TSH-R expression may not be sufficient to normalize TSH responsiveness in tumors with constitutive activation of RET.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Transfections
We used the expression system developed by Bujard and colleagues (46, 47) to deliver doxycycline-inducible expression based on the high specificity of the Escherichia coli tet repressor-operator-doxycycline interaction. The generation of PCCL3 lines with constitutive expression of the transactivator rtTA, conferring cells with high doxycycline-inducible expression of reporter gene constructs under the control of a tet-operator were previously described (36). One of these lines (PC-rtTA7) was used for secondary transfections with tet-inducible expression vectors for RET/PTC isoforms.
The RET/PTC1 and RET/PTC3 cDNAs were a generous gift from Drs. Sissy Jhiang (Ohio State University) and Massimo Santoro (University of Naples), respectively. The cDNAs were subcloned into the pUHG 103 vector downstream of the heptamerized tetO and a minimal cytomegalovirus promoter. The RET/PTC1 cDNA was removed from the pBluescript vector using SacII and EcoRV. The fragment was gel purified and then subcloned into the pUHG103 vector downstream of the heptamerized tetO and a minimal cytomegalovirus promoter, which had been cut with BamHI, the overhang filled in with Klenow, and then digested with SacII. The RET/PTC3 cDNA was removed from the pcDNA3 vector with HindIII and EcoRV and the overhangs filled in with Klenow. The gel-purified fragment was then ligated into the pUHG103 vector, which had been cut with HindIII and the overhangs filled in with Klenow. The RET/PTC2-PDZ mutant [C574-PDZ; Susan Taylor, University of California, San Diego; (22)] was removed from the pcDNA3 vector with HindIII and XbaI. The overhang created by HindIII was filled in with Klenow and the gel-purified fragment subcloned into the pUHG103 vector, which had been cut with SacII, overhang blunted with T4 polymerase, and then cut by XbaI. The RET/PTC3Y541F mutant was created by site-directed mutagenesis of the RET/PTC3 pUHG103 vector as previously described (Knauf, J. A., M. Croyle, E. Kimura, and J. A. Fagin, submitted). The different constructs were then cotransfected with thymidine kinase-hygro, which contains the hygromycin resistance gene under the control of a minimal TK promoter, into the previously described cell line, PC-rtTA7, using the LipofectAMINE reagent (Life Technologies, Inc., Rockville, MD).
Northern and Western Blot Analyses
RNA was isolated using TRI reagent as directed by the manufacturer (Molecular Research Center, Inc., Cincinnati, OH). Northern blots containing 20 µg of total RNA isolated from cells treated with and without doxycycline for the indicated time were performed as described (36, 48), and hybridized with full-length human [32P]deoxy-CTP-labeled RET/PTC3. Western blots of total cell lysates were performed as previously described (37), and probed with the indicated antibodies. Rabbit anti-RET and rabbit anti-PLC
were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Monoclonal mouse anti-RET IgG was a gift from Dr. Yuri Nikiforov (University of Cincinnati). Rabbit anti-phospho-PLC
and rabbit anti-phospho-CREB were purchased from Cell Signaling (Beverly, MA). Rabbit IgGs against the following proteins were purchased from Calbiochem (San Diego, CA): anti-CREB, anti-Gi
1/Gi
2, anti-Gi
3/G0
, anti-Gi
3, anti-Gs
, and anti-Gß IgGs.
Dimerization of RET/PTC
Cell lysates from either RET/PTC1 or RET/PTC3-expressing cells treated with and without doxycycline (1 µg/ml) for 2 d were incubated with 0.02% glutaraldehyde at 95 C for 0, 1, 2, 4, 8, and 16 min to induce cross-linking. The samples were then resolved by SDS-PAGE (7.5%) and the presence of RET/PTC monomer and dimer assessed by immunoblotting with rabbit anti-RET antibody (Santa Cruz Biotechnology, Inc.).
Assays for RET/PTC Activity
RET/PTC in vitro kinase assay. RET/PTC35 cells were incubated with or without doxycycline for 24 h. Cells were then lysed in RIPA buffer [20 mM Tris pH 7.5; 150 mM NaCl; 5 mM EDTA; 1 mM EGTA; 5 mM NaF; 1% Nonidet P-40; 1% Tween 20; 1 mM sodium orthovanadate; protease inhibitor cocktail (Sigma, St. Louis, MO), 0.2 mM phenylmethylsulfonyl fluoride, and 0.5 mM dithiothreitol (DTT)] and RET/PTC3 immunoprecipitated from the cell lysate with rabbit anti-RET IgG. After washing the immunoprecipitate three times with RIPA buffer, it was resuspended in kinase reaction buffer (50 mM HEPES, pH 7.2; 58 µCi 32P-
ATP; 20 mM MnCl2; 5 mM MgCl2; 1 mM sodium vanadate; and 0.5 mM DTT) and incubated at 30 C for 30 min. The kinase reaction was terminated by the addition of stop buffer (10 mM NaPO4, pH 7.0; 1% Triton X-100; 0.1% sodium dodecyl sulfate; 1 mM sodium vanadate; 1 mM ATP; 5 mM EDTA; and 5 µg/ml aprotinin) and the immunoprecipitate washed three times with kinase buffer without 32P-
ATP. Samples were then subjected to SDS-PAGE, transferred to nitrocelloluse, and autophosphorylation of RET/PTC detected using a phosphorimager (Amersham Biosciences, Sunnyvale, CA).
Phosphorylation of PLC
RET/PTC35 cells were incubated with or without doxycycline for 24 h and cells lysed in RIPA buffer. One hundred micrograms of protein lysates were subjected to SDS-PAGE, transferred to nitrocellulose, and probed with either rabbit anti-PLC
IgG (Santa Cruz Biotechnology, Inc.) or rabbit anti-phospho(Tyr783) PLC
(Cell Signaling).
Growth Curves
Cells (5 x 104) were plated in six-well plates and incubated for 72 h without TSH (i.e. H3 media). Cells were then changed to either H3 or H4 medium in the presence or absence of doxycycline (1 µg/ml) for up to 16 d, with media changes every 2 d. At the indicated times, the cells were washed with PBS, removed from the wells by trypsinization, recovered by centrifugation, resuspended in PBS, and counted using a Z1 Coulter counter.
DNA Synthesis
Cells were plated at a density of 5 x 104 per well in 24-well plates, allowed to attach, and the medium replaced with H3 medium. Cells were then incubated for 3 d, and medium replaced with H3 medium with or without TSH (1 mIU/ml), forskolin (25 µM), or 8-bromo (Br)-cAMP (1 mM) in the presence or absence of 1 µg/ml doxycycline. Cell were incubated for 24 h and then 1 µCi/well of [3H]thymidine was added. After 24 h cells were harvested to quantitate the [3H]thymidine DNA incorporation. Briefly, wells were washed twice with PBS, once with 10% trichloroacetic acid, and once with 100% ethanol. After air-drying, 0.3 ml of 1 N NaOH were added to each well and the plates incubated overnight at 37 C. The content of each well was transferred into a scintillation vial containing 0.3 ml of 5 N HCl and 5 ml of scintillation cocktail and radioactivity counted using a Wallace 1410 liquid scintillation counter.
Cell Detachment Assay
Cells were incubated in H3 medium for 3 d and then medium changed to H3 with or without 1.0 µg/ml of doxycycline. At the indicated times, the medium was removed and the detached cells collected by centrifugation. The cell pellet was resuspended in PBS and counted utilizing a hemocytometer. Attached cells were washed with PBS, removed from the plates by trypsinization, recovered by centrifugation, and resuspended in PBS. The attached cell fraction was stained with trypan blue, and the percentage of alive and dead cells counted utilizing a hemocytometer. The overall number of dead cells was calculated by combining the number of cells in the detached fraction and the number of trypan blue-stained cells in the attached fraction.
Apo-BrdU Assay
Apo-BrdU assays were performed after the manufacturers recommended procedure (PharMingen, San Diego, CA). Briefly, cells were incubated with 1% paraformaldehyde, fixed in 70% ethanol and then stored at -20 C until assayed. For the DNA labeling procedure, cells were washed and resuspended in a DNA labeling solution containing terminal deoxynucleotide transferase and Br-deoxyuridine triphosphatase and incubated at 37 C for 60 min. After labeling, cells were washed and stained with fluorescein-labeled anti-BrdU antibody for 30 min, and then treated with propidium iodide and ribonuclease A. Apo-BrdU-positive cells were evaluated by fluorescence-activated cell sorting analysis.
Real-Time RT-PCR for TSH-R mRNA
Cells were harvested at the indicated time and RNA isolated using TRI reagent as directed by the manufacturer (Molecular Research Center, Inc., Cincinnati, OH). One microgram of total RNA was reverse transcribed with 200 U of Superscript reverse transcriptase (Life Technologies, Inc., Grand Island, NY) in the presence of 2.5 µM of random 9-mer primers, 20 µM deoxynucleotide triphosphate for 60 min at 37 C, followed by a 5-min heat inactivation at 95 C. Two microliters of the cDNA reaction mixture were then used as a template in a PCR containing 1 µM of the primer pairs for amplification of either ß-actin (5'ctgaaccctaaggccaaccgtg3' and 5'ggcatacagggacagcacagcc3') or TSH-R (5'caaagatgcctttggaggag3' and 5'agctctttgaggtgctccag3'). PCR amplifications were performed using the Fast-Start DNA Master SYBR Green real-time PCR kit as directed by manufacturer (Roche Molecular Biochemicals, Indianapolis, IN). The amplification conditions were optimized for the LightCycler instrument (Cepheid, Sunnyvale, CA) and subsequent PCR products were demonstrated to be a single PCR product by melting curve and electrophoretic analysis. To avoid potential problems from contaminating genomic DNA, PCR primers were designed to span a large intron whose location was determined by blasting the rat TSH-R sequence against the NCBI rat genome database. This was further verified by the lack of a signal when reactions were performed in the absence of reverse transcriptase. The cycle threshold (CT) value, which was determined using the second derivative, was used to calculate the normalized expression of the TSH-R mRNA using the Q-Gene program (49).
Cellular cAMP Levels
Cells were plated into 48-well plates, allowed to attach, and then medium replaced with H3 medium. Cells were incubated for 3 d and medium changed to H3 with or without 1 µg/ml doxycycline. Cells were incubated for 24 h and then treated with or without 1 mIU/ml TSH, 25 µM forskolin, 2.0 µg/ml PT, or 2.0 µg/ml cholera toxin in the presence of 1 µM isobutylmethylxanthine (IBMX) for the indicated times. Cells were harvested and solubilized in precooled N-propanol for 3 h. Aliquots were drawn into glass tubes, dried overnight, and resuspended in assay buffer for measurement of intracellular cAMP levels by RIA, after the manufacturers instructions (Amersham Pharmacia Biotech, Piscataway, NJ). cAMP levels were expressed as fmol/well.
Effects of RET/PTC3 on G Protein Subunit Levels
RET/PTC3 cells were grown in H4 medium until confluent and then medium was replaced with H3 medium. Cells were incubated for 3 d, medium replaced with H3 or H4 medium with or without 1 µg/ml doxycycline, and incubated for 24 h. Cells were then washed with 1x PBS and lysed in 300 µl of triple detergent buffer (50 mM Tris, pH 8; 150 mM NaCl; 100 µg/ml phenylmethylsulfonyl fluoride; 0.1% sodium dodecyl sulfate; 1% Nonidet P-40; 0.25% deoxycholate) containing the protease inhibitors tosyl phenylalanyl chloromethylketone and tosyl lysyl chloromethylketone. Fifty micrograms protein lysate were then subjected to SDS-PAGE and Western blotted with antibodies to the G protein subunits Gi
1, GiA2, Gi
3, Gß, Gs
, and G0
.
Effect of RET/PTC3 on 8-Br-cAMP-Induced CREB Phosphorylation
RET/PTC3 cells were grown in H4 medium until confluent and then medium changed to H3 medium. Cells were incubated for 2 d and then medium replaced with fresh H3 medium with or without 1 µg/ml doxycycline. Cells were incubated for 24 h and then treated with or without 1.0 mM Br-cAMP for 06 min. Cells were then washed with 1x PBS and lysed in 300 µl of triple detergent buffer containing the protease inhibitors tosyl phenylalanyl chloromethylketone and tosyl lysyl chloromethylketone. Fifty micrograms of protein lysate were then subjected to SDS-PAGE and Western blotting for either phospho-CREB or total CREB.
| FOOTNOTES |
|---|
Abbreviations: BrdU, Bromodeoxyuridine; CREB, cAMP response element binding protein; DTT, dithiothreitol; IBMX, isobutylmethylxanthine; PKC, protein kinase C; PLC, phospholipase C; PT, pertussis toxin; PTC, papillary carcinomas of the thyroid; TSH-R, TSH receptor; TK, tyrosine kinase.
Received for publication February 5, 2003. Accepted for publication March 31, 2003.
| REFERENCES |
|---|
|
|
|---|
of cyclic AMP-dependent protein kinase A. Mol Cell Biol 13:358366
(PKC
) in thyroid cell death. A truncated chimeric PKC
cloned from a thyroid cancer cell line protects thyroid cells from apoptosis. J Biol Chem 274:2341423425This article has been cited by other articles:
![]() |
G. Riesco-Eizaguirre, I. Rodriguez, A. De la Vieja, E. Costamagna, N. Carrasco, M. Nistal, and P. Santisteban The BRAFV600E Oncogene Induces Transforming Growth Factor {beta} Secretion Leading to Sodium Iodide Symporter Repression and Increased Malignancy in Thyroid Cancer Cancer Res., November 1, 2009; 69(21): 8317 - 8325. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Haymart Understanding the Relationship Between Age and Thyroid Cancer Oncologist, March 1, 2009; 14(3): 216 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications Endocr. Rev., December 1, 2007; 28(7): 742 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Santoro, R. M. Melillo, and A. Fusco RET/PTC activation in papillary thyroid carcinoma: European Journal of Endocrinology Prize Lecture. Eur. J. Endocrinol., November 1, 2006; 155(5): 645 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Knauf, B. Ouyang, E. S. Knudsen, K. Fukasawa, G. Babcock, and J. A. Fagin Oncogenic RAS Induces Accelerated Transition through G2/M and Promotes Defects in the G2 DNA Damage and Mitotic Spindle Checkpoints J. Biol. Chem., February 17, 2006; 281(7): 3800 - 3809. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mitsutake, M. Miyagishi, S. Mitsutake, N. Akeno, C. Mesa Jr, J. A. Knauf, L. Zhang, K. Taira, and J. A. Fagin BRAF Mediates RET/PTC-Induced Mitogen-Activated Protein Kinase Activation in Thyroid Cells: Functional Support for Requirement of the RET/PTC-RAS-BRAF Pathway in Papillary Thyroid Carcinogenesis Endocrinology, February 1, 2006; 147(2): 1014 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Santiago-Walker, A. J. Fikaris, G. D. Kao, E. J. Brown, M. G. Kazanietz, and J. L. Meinkoth Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest J. Biol. Chem., September 16, 2005; 280(37): 32107 - 32114. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Puxeddu, J A Knauf, M A Sartor, N Mitsutake, E P Smith, M Medvedovic, C R Tomlinson, S Moretti, and J A Fagin RET/PTC-induced gene expression in thyroid PCCL3 cells reveals early activation of genes involved in regulation of the immune response Endocr. Relat. Cancer, June 1, 2005; 12(2): 319 - 334. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mitsutake, J. A. Knauf, S. Mitsutake, C. Mesa Jr., L. Zhang, and J. A. Fagin Conditional BRAFV600E Expression Induces DNA Synthesis, Apoptosis, Dedifferentiation, and Chromosomal Instability in Thyroid PCCL3 Cells Cancer Res., March 15, 2005; 65(6): 2465 - 2473. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Venkateswaran, D. K. Marsee, S. H. Green, and S. M. Jhiang Forskolin, 8-Br-3',5'-Cyclic Adenosine 5'-Monophosphate, and Catalytic Protein Kinase A Expression in the Nucleus Increase Radioiodide Uptake and Sodium/Iodide Symporter Protein Levels in RET/PTC1-Expressing Cells J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 6168 - 6172. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Hwang, D. W. Kim, J. H. Hwang, H. S. Jung, J. M. Suh, Y. J. Park, H. K. Chung, J. H. Song, K. C. Park, S. H. Park, et al. Regulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT1-Dependent Genes by RET/PTC (Rearranged in Transformation/Papillary Thyroid Carcinoma) Oncogenic Tyrosine Kinases Mol. Endocrinol., November 1, 2004; 18(11): 2672 - 2684. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Puxeddu, N. Mitsutake, J. A. Knauf, S. Moretti, H. W. Kim, K. A. Seta, D. Brockman, L. Myatt, D. E. Millhorn, and J. A. Fagin Microsomal Prostaglandin E2 Synthase-1 Is Induced by Conditional Expression of RET/PTC in Thyroid PCCL3 Cells through the Activation of the MEK-ERK Pathway J. Biol. Chem., December 26, 2003; 278(52): 52131 - 52138. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |