help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2002-0429
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/8/1534    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mittelstadt, P. R.
Right arrow Articles by Ashwell, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mittelstadt, P. R.
Right arrow Articles by Ashwell, J. D.
Molecular Endocrinology 17 (8): 1534-1542
Copyright © 2003 by The Endocrine Society

Disruption of Glucocorticoid Receptor Exon 2 Yields a Ligand-Responsive C-Terminal Fragment that Regulates Gene Expression

Paul R. Mittelstadt and Jonathan D. Ashwell

Laboratory of Immune Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Jonathan D. Ashwell, Building 10, Room 1B-40, National Institutes of Health, Bethesda, Maryland 20892. E-mail: jda{at}pop.nci.nih.gov.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mice in which exon 2 of the glucocorticoid receptor (GR) has been disrupted [GR exon 2 knockout (GR2KO)] have been used as a model to study the requirement for this receptor in a number of biological systems. A recent report showed that these mice actually express a truncated ligand-binding GR fragment, prompting us to ask whether this mutation truly results in a glucocorticoid-insensitive phenotype. Based on cDNA microarray analysis of fetal thymocytes, we found that glucocorticoids were able to enhance or repress activation-induced gene expression in GR2KO and wild-type thymocytes to a similar degree. Moreover, although changes in gene expression induced by glucocorticoids alone were blunted, the expression of a substantial number of genes in GR2KO thymocytes was modulated by stimulation with glucocorticoids. Among these genes, as confirmed by quantitative real-time PCR, was the classic glucocorticoid-responsive gene glutamine synthetase as well as genes implicated in T cell development and function such as IL-7 receptor {alpha}-chain and glucocorticoid-induced leucine zipper (GIL2). Thus, the truncated C-terminal GR2KO product, which lacks the major transactivation domain, retains, to a large extent, the ability to regulate gene expression both positively and negatively in a ligand-responsive manner when expressed in vivo.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
GLUCOCORTICOIDS INITIATE THEIR biological functions by binding to the ubiquitously expressed and cytoplasmically located glucocorticoid receptor (GR). The ligand/receptor complex migrates to the nucleus where, in a dimeric state, it binds to specific nucleotide sequences (glucocorticoid response elements, or GREs) to activate or repress transcription of the corresponding genes (1). The GR contains a number of functionally distinct domains (Fig. 1Go). The N-terminal half of the molecule, encoded by exon 2, contains the major transcriptional activation domain {tau}1 (residues 85–269 in the mouse) (2). The central portion, encoded by exons 3 and 4, contains a pair of zinc fingers that are sufficient for both DNA binding and homodimerization, as demonstrated by crystallographic analysis (3). Homodimerization is important for the induction of gene transcription in most cases (4, 5). The remaining portion (encoded by exons 5–9) contains two transcriptional activation domains [{tau}2 and activation function 2 (AF-2)], the ligand-binding domain, and sequences required for nuclear localization and binding to the cytoplasmic chaperone heat shock protein 90 (2, 6).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Structure of the Mouse GR

The upper portion of the figure shows some of the functional domains of the GR, with additional functions indicated above, and the lower portion shows the exon structure. The forward arrow indicates the translation start site, and the asterisk indicates the position of the epitope recognized by the antibody BUGR-2.

 
In addition to its ability to directly regulate gene transcription, the liganded GR can alter transcriptional activity at many gene loci by interfering with or, in some cases, enhancing the activity of other transcription factors. For example, the GR can bind activator protein 1 (AP-1) and nuclear factor-{kappa}B (NF-{kappa}B) and inhibit their induction of gene transcription (transrepression) (reviewed in Refs. 7, 8, 9). The GR can also bind signal transducer and activator of transcription (Stat)3 (10, 11), Stat5 (12, 13), and Ets2 (14), enhancing the activity of these transcription factors. The transrepressive activity of the GR against AP-1 requires an intact DNA-binding domain (DBD), although heterologous DBDs from other nuclear hormone receptors can substitute (15, 16, 17, 18, 19). It is thought that transrepression accounts for much of the biological activity of glucocorticoids, perhaps the strongest evidence for this being a mouse in which the endogenous GR was replaced with a dimerization-defective mutant (GRdim) (20). This mutation results in a marked loss in the ability of the GR to transactivate but not to transrepress (4, 5, 21). Although animals expressing the GRdim mutation had some abnormalities [lack of thymocyte apoptosis in response to glucocorticoids, defects in erythropoiesis (20, 22)], they were remarkably normal in most aspects, including viability, fertility, and glucocorticoid-mediated immunosuppression and antiinflammatory activity (5, 20).

To better understand the role that the GR plays in biological processes, mice have been created in which the gene encoding the GR was disrupted by insertion of a neomycin-resistance cassette into the second exon (GR2KO) (23). The majority of these animals died at birth due to respiratory insufficiency, so initial studies focused on fetal tissues. GR2KO fetal thymocytes were resistant to glucocorticoid-induced apoptosis, but otherwise the thymi were of normal size and contained normal ratios of CD4 and CD8 cells (24). Furthermore, when transplanted fetal liver cells were allowed to develop in an irradiated wild-type host, the thymi and peripheral lymphoid compartments appeared to be similar whether reconstituted with wild-type or GR2KO cells (25). Although antigen-specific development was not studied, it was concluded that glucocorticoids are not required for normal T cell development and function, a finding at odds with a number of studies suggesting that glucocorticoids participate in normal T cell development and antigen-specific selection (26). Studies with GR2KO mice have also been used to argue that the GR is not involved in glucocorticoid-mediated regulation of particular genes such as those encoding cytochrome P-450 monooxygenase 3A (CYP3A), P-450 reductase, and the 5-hydroxytryptamine 1A receptor (5-HT1A) (27, 28). However, it has recently been reported that GR2KO mice actually express a C-terminal GR fragment of approximately 40 kDa (full-length GR migrates at >90 kDa) (29). Immunoblot analysis with an anti-C-terminal GR antibody showed that the truncated and wild-type proteins were expressed at comparable levels in the thymus, and binding studies found that cytosols from a variety of tissues from GR2KO mice bound radiolabeled dexamethasone (Dex) 30–60% as well as those from wild-type animals. Because glucose-6-phosphatase mRNA was not induced by the synthetic glucocorticoid Dex in cultured GR2KO fetal hepatocytes, it was argued that these mice are profoundly glucocorticoid resistant. Nonetheless, given that much of the biological activity of the GR is mediated by transrepression and that there are transactivation domains in the C-terminal half of the molecule, we asked whether, in fact, GR2KO mice are unresponsive to glucocorticoids. Using DNA microarray analysis and real-time PCR to measure gene expression in GR2KO tissues, we find that global transrepression is relatively intact and, although less so than in wild-type tissues, glucocorticoids can induce the expression of many genes, including some that are important in T cell development and function.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The GR2KO Mutation Encodes a GR Variant Lacking Exon 2
The mature GR mRNA is composed of nine exons, the first of which is one of three possible alternatives: 1A, 1B, and 1C, each driven by a different tissue-specific promoter (Fig. 1Go) (30). Translation is initiated at the beginning of exon 2, which encodes the major transcription activation domain. The GR2KO mutation was produced by inserting a neomycin-resistance cassette into exon 2 (23). Although initially characterized as GR-null, it was later reported that GR2KO mice express an immunoreactive C-terminal fragment, presumably an alternate splice event in which the 1.2-kb exon 2 is bypassed and exons 1A and 3 become contiguous (29). The size of the aberrant GR protein is consistent with translation initiating from a potential translation start codon at amino acid position 406, three residues into the third exon, which would create a protein of 378 amino acids (residues 406–783). To determine whether an mRNA species that includes the 5'-end of exon 3 (and therefore the putative start site) can be found in GR2KO cells, RT-PCR was performed with a forward primer corresponding to the beginning of exon 3 and a reverse primer located within exon 5: this yielded an RT-PCR product of the expected size (data not shown). Thus, the data suggest that insertion of the Neo cassette into exon 2 causes alternate splicing, and the resulting GR fragment encoded by exons 3–9 would lack the major N-terminal transcriptional activation domain {tau}1 yet retain intact DNA-binding, dimerization, and hormone-binding domains, as well as the secondary transactivation domains {tau}2 and AF-2.

Studies in which truncated forms of the GR have been expressed in cell lines found that most of the transrepressive activity resides in the C-terminal half of the molecule (15). Given that this corresponds to the fragment expressed in GR2KO mice, we asked whether the GR2KO fragment can transrepress gene induction. To assess this, fetal d 18 (d 18) thymocytes from wild-type or GR2KO mice were stimulated with phorbol 12-myristate 13-acetate (PMA) and ionomycin in the absence or presence of 1 µM Dex. This treatment up-regulates many of the genes, including cytokines, that are subject to repression by glucocorticoids. After 5 h, RNA was isolated and used to generate linearly amplified antisense RNA, from which cDNA probes were generated and used to probe microarrays containing approximately 10,000 murine cDNAs. A comparison between two representative microarray scatter plots was made in which the relative change of individual genes in each array was plotted along each logarithmically scaled axis (Fig. 2Go). Genes repressed in both cell types appear in the lower left quadrant and those induced in both appear in the upper right quadrant. If the GR2KO mutation resulted in a functionless receptor, there would be no response to Dex in these cells and the data points would be distributed horizontally. Alternatively, if the GR2KO product functioned similarly to the wild-type GR, the data would be distributed along a 45° diagonal. As shown in Fig. 2Go, most of the data points were distributed along a diagonal, indicating that both cell types responded to Dex in a grossly similar fashion. Thus, the GR2KO possesses a substantial amount of activity, and many of the regulated genes are similarly controlled by the wild-type GR.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of Dex-Induced Changes in Gene Expression in PMA- and Ionomycin-Stimulated d 18 Fetal Thymocytes

cDNA microarrays were probed with cDNA derived from d 18 wild-type and GR2KO fetal thymocytes activated with PMA and ionomycin in the presence or absence of Dex. Dex-induced changes in the expression individual genes appearing in both arrays are shown, with the position along the axes indicating the fold change relative to untreated cells. The data represent approximately 7700 genes and are plotted as log2 ratios so that induction and repression can be presented equivalently.

 
Dex Induces Gene Expression in GR2KO Fetal Thymocytes
The observation that in the presence of PMA and ionomycin the GR2KO protein induced and repressed gene expression may reflect both direct and indirect effects of the truncated GR, the latter due to interactions with other transcription factors. To evaluate the ability of the GR2KO protein to activate transcription in response to glucocorticoids, cDNA microarrays were probed with cDNA probes from wild-type and GR2KO fetal thymocytes stimulated by Dex for 5 h (Fig. 3Go). Gene regulation was less robust in GR2KO than in wild-type cells, with a smaller amplitude in the distribution of responses, consistent with the loss of the {tau}1 transactivation domain. However, there were still many genes whose expression was altered by Dex in both cell types, suggesting that the GR2KO protein is able to activate or repress a subset of the normal repertoire of glucocorticoid-regulated genes. A list of known genes most strongly regulated by Dex in GR2KO and WT fetal thymocytes is shown in Table 1Go.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Comparison of Changes in Gene Expression in d 18 Fetal Thymocytes Stimulated with Dex Alone

The average values of the Dex-induced changes of genes that could be detected above the background hybridization signal in at least two of three independent arrays from wild-type animals and at least three of four independent arrays from GR2KO animals are plotted as in Fig. 2Go. The data represent approximately 3300 genes. The regression line represents the least squares fit of the data.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Dex-Regulated Genes

 
Immune-Related Genes Are Induced in Dex-Stimulated GR2KO Fetal Thymocytes
To obtain independent verification of the results of the cDNA microarray analyses, and to quantitatively compare the activity of the wild-type GR and GR2KO proteins, changes in mRNA expression of individual genes were assessed by real-time PCR. The gene that was up-regulated most strongly by Dex in the microarrays in both wild-type and GR2KO thymocytes encodes GILZ (glucocorticoid-induced leucine zipper), a transcriptional repressor of AP-1 and NF-{kappa}B that blocks IL-2 and Fas Ligand up-regulation and, consequently, activation-induced apoptosis of T cell hybridomas (31, 32, 33). It is noteworthy that GILZ was also the most strongly induced gene in a cDNA microarray analysis of Dex-induced genes in human peripheral T cells (34). Real-time PCR analysis of wild-type thymocytes stimulated with Dex for 3 h showed an 11-fold increase (Fig. 4AGo). Mice heterozygous for the GR2KO gene were less responsive to Dex (7-fold increase in GILZ mRNA), consistent with a gene dose effect. Importantly, in GR2KO thymocytes the level of induction by Dex was approximately 4-fold, confirming that although the GR2KO protein is less efficient at inducing GILZ than the wild-type GR, it is nonetheless capable of transactivating this gene. Another gene identified in the arrays encodes the IL-7 receptor {alpha}-chain (IL-7R{alpha}), a receptor involved in T cell differentiation and function whose gene was previously identified as glucocorticoid responsive in a human peripheral blood mononuclear cell (PBL) microarray (34). In wild-type thymocytes IL-7R{alpha} mRNA levels increased by 1.7-fold after 3 h of Dex treatment (Fig. 4BGo). Thymocytes from mice heterozygous or homozygous for GR2KO responded similarly to the wild-type thymocytes. Thus, two genes with roles in T cell development and/or function are induced by glucocorticoids in thymocytes.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4. Real-Time PCR Analysis of mRNA Expression in d 18 Fetal Thymocytes Treated for 3 h with Dex

Relative mRNA levels are expressed as fold increases over the levels in untreated cells. n, Number of independent fetal thymi analyzed. Error bars show the SE */÷ the geometric mean of the fold inductions.

 
There were also examples of genes that were up-regulated in response to Dex in wild-type but not GR2KO thymocytes. One such gene, encoding the immunophilin FKBP51, was previously identified as a glucocorticoid target in a screen for genes induced in a murine thymoma (35). Real-time PCR analysis of d 18 thymocytes treated for 3 h with Dex revealed that FKBP51 mRNA was induced almost 2.7-fold in wild fetal thymocytes, 2.2-fold in thymocytes heterozygous for the GR2KO allele, and was uninduced in GR2KO fetal thymocytes (Fig. 4CGo). Thus, unlike GILZ or IL-7R{alpha}, FKBP51 represents a gene whose induction is dependent upon the presence of the N-terminal region of the GR.

Glutamine synthetase is a classic glucocorticoid-responsive gene (36). To examine the regulation of its mRNA in GR2KO cells, fetal lung cells were cultured for 5 h in the absence or presence of Dex and subjected to analysis by real-time PCR (Fig. 5Go). Dex treatment caused a 2-fold increase in glutamine mRNA in both wild-type and GR2KO tissues, providing another example (along with the IL-7R{alpha}) in which the GR2KO molecule exhibits transcriptional activation similar to that of the wild-type GR.



View larger version (7K):
[in this window]
[in a new window]
 
Fig. 5. Real-Time PCR Analysis of mRNA Expression in d 18 Fetal Lung Treated for 4 h with Dex, Plotted as in Fig. 4Go.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The GR2KO mutation was deemed to result in an absent, or at least functionless, gene product based on the observations that glucocorticoids failed to induce a reporter gene driven by the classic GRE in embryonic fibroblasts (23) or to induce glucose-6-phosphatase mRNA in fetal hepatocytes (29). Gene induction, however, is only one means by which glucocorticoids mediate their biological effects. In addition to transactivation, glucocorticoids promote the physical interaction between the liganded GR and other transcription factors, either in solution or in association with DNA, typically inhibiting their activity. In the classic transrepression model first identified for AP-1, liganded GR binds and inhibits transcription factor activity in the absence of any identifiable GRE, either by interfering with DNA binding (16) or by tethering itself to the DNA-bound transcription factor (17). In favor of the tethering model, in vivo footprinting showed that the collagenase promoter AP-1 element remained occupied while being repressed by Dex (37), although it is possible that Fos-Jun heterodimers, but not the relatively inactive Jun-Jun homodimers, were displaced from the AP-1 element by the GR (18). Glucocorticoid interference with other transcription factors associated with the inflammatory response, including the p65 subunit of NF-{kappa}B (38, 39), cAMP response element-binding protein (CREB) (40), octamer transcription factor 1 (OTF-1) (41), and nuclear factor of activated T cells (NFAT) (42), has been attributed to transrepression.

Several groups have evaluated the relative importance of different GR regions for transrepression. A human GR mutant lacking the 185-amino acid {tau}1 domain retained greater than 70% of the ability of WT GR to repress AP-1-driven reporters (16, 17), and a human GR mutant in which residues 9–385 had been deleted retained 36% of wild-type transrepression activity (15). These data suggest that the N-terminal portion of the GR may contribute to, but not be necessary for, transrepressive activity. In contrast, removal of the ligand-binding domain in the C-terminal half of the molecule ablated the majority of the repressive activity (15), and expression of simply the DBD of the rat GR was sufficient to inhibit DNA binding by Jun-Fos heterodimers in the absence of a GRE (18). Therefore, sequences in the C-terminal half of the GR appear to possess the majority of the transrepressive potential of the molecule.

Given that the GR2KO gene product is predicted to lack the {tau}1 domain but retain the DNA- and ligand-binding domains, we asked whether it, in fact, is capable of modulating the expression of genes induced (or repressed) by other transcription factors. The combination of a phorbol ester and a Ca2+ ionophore is a potent means of activating lymphocytes, causing the up-regulation of a host of transcription factors, including AP-1, NF-{kappa}B, CREB-activating transcription factor (ATF), and others (43, 44). cDNA microarray analysis revealed that many genes whose expression was modulated by this stimulus were affected by glucocorticoids. Importantly, this was found to be the case with GR2KO thymocytes as well. In fact, on a global level there was little difference between normal and GR2KO cells, with similar numbers of genes being up-regulated or repressed in both cases. This argues that transrepression is, in fact, relatively well preserved in cells expressing approximately the C-terminal half of the GR.

Three transcriptional activation domains have been identified in the GR. The N-terminal {tau}1 interacts with the general transcription factors TATA binding protein (45), Ada2 (46), transcription factor IID (47), and CREB-binding protein (CBP) (48), as well as the chromatin-remodeling complex SWI/SNF (49). The C-terminal half of the GR contains the transactivation domains {tau}2, located within the N-terminal end of the ligand-binding domain (50), and AF-2, located at the C terminus. Within {tau}2 is a motif mediating nuclear matrix attachment (51). AF-2 contains sites for interaction with the coactivators steroid receptor coactivator 1, CBP/p300, p300/CBP-associated factor (P/CAF), and transcriptional intermediary factor 2/GR-interacting protein 1 (52), the last of which can also act as a corepressor in certain contexts (53). Mutations in {tau}2 and AF-2 have shown that these regions contribute to gene transactivation (6, 54). Thus, along with sites mediating trafficking, DNA binding, dimerization, heat shock protein binding, and ligand binding, the C-terminal half of the GR contains sites of interaction with many transcriptional cofactors.

Different conclusions have been reached regarding the relative roles of the N- and C-terminal portions of the GR in transactivation. Deletion of most or all of the N-terminal GR (15, 55), and specifically of {tau}1 (50), caused nearly complete loss of transcriptional activity as assessed by reporter genes driven by the mouse mammary tumor virus long terminal repeat. In contrast, deletion of human {tau}1 caused only a minor (20%) reduction on reporter gene induction (54). The differences between these studies might be explained by gene- and tissue-specific factors. For example, an N-terminal deletion of the human GR caused an approximately 3- to 5-fold reduction in MMTV-driven reporter gene GR responsiveness in CV-1 cells, but less than a 2-fold reduction in HeLa cells (56). Several studies have described instances in which the {tau}1 activation domain is not required for GR-mediated enhancement of gene transcription. For example, a human GR mutant lacking {tau}1 cooperated with Stat5 to induce the ß-casein promoter (57). In another case, the rat GR DBD alone bound and synergized with Ets2 to induce the cytochrome P-450c27 promoter (14). Our examination of cells expressing the {tau}1-lacking GR2KO gene product showed that many genes were still glucocorticoid responsive on a global level, although to a lesser extent than in wild-type cells. Quantitation by real-time PCR revealed examples of genes in GR2KO cells that were nonresponsive (FKBP51), hyporesponsive (GILZ), and normally responsive (IL-7R{alpha} and glutamine synthetase) to glucocorticoids. Therefore, although aberrant, the C-terminal half of the GR contains a considerable amount of ligand-regulated transcriptional activity. A second GR mutant mouse has been generated in which the coding sequence of exon 2 was targeted for deletion from the germline (58). Like GR2KO mice, these mice die perinatally and their thymocytes are insensitive to Dex-induced apoptosis. However, because the strategy used to produce these animals was similar to that for the GR2KO mice, one must consider the possibility that they too produce an aberrant GR protein. The evidence that GR protein is absent in these mice is the lack of immunoreactivity with the anti-GR antibody BUGR-2 (58). However, BUGR-2 recognizes an epitope formed by amino acid residues 395–404 of the mouse GR (59), residues encoded by exon 2 and therefore not present in a transcript lacking exon 2. Therefore, whether these animals do or do not express a truncated GR protein remains to be determined.

The pregnane X receptor (PXR) and the mineralocorticoid receptor are transcriptional regulators that can respond to glucocorticoids (60). Using semiquantitative RT-PCR we were unable to detect PXR mRNA in either wild-type or GR2KO fetal thymocytes, although it was abundant in adult liver (data not shown). Moreover, previous studies indicated that the mineralocorticoid receptor is not expressed in the thymus (61, 62). Therefore, although a role for another receptor in glucocorticoid responsiveness cannot be excluded, the overlap between the Dex-specific gene expression profiles observed in wild-type and GR2KO fetal thymocytes suggests that the response to Dex in the latter is mediated by the GR2KO protein.

The GR2KO mice have been used to address the role of the GR in thymocyte development. The apparently normal development of thymocytes and peripheral T cells derived from GR2KO bone marrow cells transplanted into irradiated wild-type hosts was taken as evidence that glucocorticoids play little, if any, role in normal T cell development (25). The finding that the GR2KO gene product has biological activity, however, calls this interpretation into question. GR2KO mice have also been used to examine the role of the GR in other biological systems. For example, glucocorticoid induction of CYP3A and P-450 reductase was found to be intact in GR2KO mice (28), which was taken as evidence that these genes are regulated by the PXR (60). In another study, corticosterone-mediated suppression of the 5-hydroxytryptamine 1A receptor was found to be normal in the hippocampus of the GR2KO mouse, the interpretation being that this effect was mediated by the mineralocorticoid receptor (27). The intestine of the GR2KO late-stage fetus was found to develop normally, contradicting a literature supporting the notion that glucocorticoids play a role in bringing about changes in the processing capacity of the fetal intestine (63). Finally, certain steps of mammary development were found to be unexpectedly unaffected by the GR2KO mutation (64). In light of the present report, conclusions about the role of the GR in biological processes based upon analysis of GR2KO mice should be reconsidered.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Mice
GR2KO mice (23) were backcrossed for at least three generations onto the C57BL6 strain (Jackson Laboratories, Bar Harbor, ME).

Cell Culture
Day 18 fetal thymocytes were cultured in suspension at 2.5 x 105/ml in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (Biosource International, Camarillo, CA), 2 mM L-glutamine, 50 µM 2-ME, and 50 µg/ml gentamicin. In some experiments cells were treated with 20 ng/ml phorbol 12-myristate 13-acetate (PMA), 1 µg/ml ionomycin, and 1 µM Dex, as indicated. Lungs were isolated from d18 fetuses, sectioned, and cultured as solid tissues in DMEM (Biosource International) supplemented as above. After treatments, cells and tissues were snap frozen in liquid nitrogen.

Microarrays
Total RNA was harvested using Ultraspec reagent (Biotecx, Houston, TX) and further purified with the RNeasy kit (QIAGEN, Valencia, CA). Mouse expression microarrays (10,000 cDNA elements) were printed at the National Cancer Institute array facility (Advanced Technology Center). Two micrograms of total RNA were used to generate amplified antisense RNA by the method of Phillips and Eberwine (65) (http://nciarray.nci.nih.gov/reference/Probe_From_TotalRNA.html). Briefly, first-strand cDNA, primed with a T7-oligo(dT) oligonucleotide, was synthesized with Superscript II reverse transcriptase (Invitrogen), and second-strand cDNA was synthesized with DNA polymerase I. In vitro-transcribed amplified RNA was generated with the T7 Megascript kit (Ambion, Inc., Austin, TX). Fluorescently labeled cDNA probe generation and hybridization were performed using the procedures described for total RNA (http://nciarray.nci.nih.gov/reference/Probe_From_Total RNA.html), except that random hexamers (50 ng/µl) were used as primers, and 2.5 µg (Cy3, Dex-treated samples) or 5 µg (Cy5, non-Dex-treated samples) amplified RNA were used as templates. Hybridization was performed at 65 C in buffer containing 3.5x standard saline citrate and 0.25% sodium dodecyl sulfate. Microarrays were scanned with a GenePix 4000B scanner (Axon Instruments, Union City, CA), and array data was generated with GenePix Pro 3.0 software (Axon Instruments). Data were filtered and analyzed with server-based software provided by the Advanced Technology Center.

Real-Time PCR
cDNA was synthesized from total RNA at a concentration of 100 ng/µl using random hexamers and Superscript II reverse transcriptase (Invitrogen). For real-time PCR, cDNA was used at a concentration of 10 ng input RNA per µl of reaction volume. Real-time PCR was performed with the TaqMan sequence detection system (Applied Biosystems, Foster City, CA). TaqMan primers and probes were designed using PrimerExpress software to span intron/exon boundaries to prevent amplification of genomic DNA. Primers and probes are as follows: GILZ: forward, GTGGTGGCCCTAGACAACAAG; reverse, TCACAGCGTACATCAGGTGGTT; probe, CACGAGGTCCATGGCCTGCTCA. IL-7R{alpha}: forward, GCTTAATTCAAGCTGTTTCTGGAGA; reverse, CAACTGGCTGTGGCACCA; probe, TGCAGACGCGGACGATCACTCCTT. FKBP51: forward, ACCTGGCCATGTGCTACCTG; reverse, GTCCAGTCCAAGGGCCTTGT; probe, AGCACTCCACGGCTTTGTTGTACTCTCG. Glutamine synthetase: forward, CAGGCTGCCATACCAACTTCA; reverse, GCCTCCTCAATGCACTTCAGA; probe, TCTCCTCCCGCATGGCCTTGG. Hypoxanthine phosphoribosyltransferase: forward, AAACAATGCAAACTTTGCTTTCC; reverse, TCCTTTTCACCAGCAAGCTTG; probe, AACCATTTTGGGGCTGTACTGCTTAACCA. Samples are quantified using relative standard curves for each amplification reaction, and results were normalized to the internal control hypoxanthine phosphoribosyltransferase.


    ACKNOWLEDGMENTS
 
We are grateful to Remy Bosselut for helpful discussions and to Stoney Simons for critical reading of the manuscript. We thank Timothy Cole and Dale Godfrey for providing the GR2KO mice.


    FOOTNOTES
 
Abbreviations: AF-2, Activation function 2; AP-1, activator protein 1; CREB, cAMP response element-binding protein; d 18, fetal d 18; DBD, DNA-binding domain; Dex, dexamethasone; GILZ, glucocorticoid-induced leucine zipper; GR, glucocorticoid receptor; GRE, glucocorticoid response element; GR2KO, GR exon 2 knockout; IL-7R{alpha}, IL-7 receptor {alpha}-chain; NF-{kappa}B, nuclear factor {kappa}B; PMA, phorbol 12-myristate 13-acetate; PXR, pregnane X receptor; Stat, signal transducer and activator of transcription.

Received for publication December 18, 2002. Accepted for publication May 5, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Adcock IM 2000 Molecular mechanisms of glucocorticosteroid actions. Pulm Pharmacol Ther 13:115–126[CrossRef][Medline]
  2. Giguere V, Hollenberg SM, Rosenfeld MG, Evans RM 1986 Functional domains of the human glucocorticoid receptor. Cell 46:645–652[CrossRef][Medline]
  3. Luisi BF, Xu WX, Otwinowski Z, Freedman LP, Yamamoto KR, Sigler PB 1991 Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352:497–505[CrossRef][Medline]
  4. Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P, Cato AC 1994 A distinct modulating domain in glucocorticoid receptor monomers in the repression of activity of the transcription factor AP-1. EMBO J 13:4087–4095[Medline]
  5. Reichardt HM, Tuckermann JP, Gottlicher M, Vujic M, Weih F, Angel P, Herrlich P, Schutz G 2001 Repression of inflammatory responses in the absence of DNA binding by the glucocorticoid receptor. EMBO J 20:7168–7173[CrossRef][Medline]
  6. Danielian PS, White R, Lees JA, Parker MG 1992 Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J 11:1025–1033[Medline]
  7. Herrlich P 2001 Cross-talk between glucocorticoid receptor and AP-1. Oncogene 20:2465–2475[CrossRef][Medline]
  8. Newton R 2000 Molecular mechanisms of glucocorticoid action: what is important? Thorax 55:603–613[Free Full Text]
  9. Karin M 1998 New twists in gene regulation by glucocorticoid receptor: is DNA binding dispensable? Cell 93:487–490[CrossRef][Medline]
  10. Zhang G, Zhang L, Duff GW 1997 A negative regulatory region containing a glucocorticosteroid response element (nGRE) in the human interleukin-1ß gene. DNA Cell Biol 16:145–152[Medline]
  11. Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM 1997 STAT3 acts as a co-activator of glucocorticoid receptor signaling. J Biol Chem 272:30607–30610[Abstract/Free Full Text]
  12. Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  13. Reichardt HM, Horsch K, Grone HJ, Kolbus A, Beug H, Hynes N, Schutz G 2001 Mammary gland development and lactation are controlled by different glucocorticoid receptor activities. Eur J Endocrinol 145:519–527[Abstract]
  14. Mullick J, Anandatheerthavarada HK, Amuthan G, Bhagwat SV, Biswas G, Camasamudram V, Bhat NK, Reddy SE, Rao V, Avadhani NG 2001 Physical interaction and functional synergy between glucocorticoid receptor and Ets2 proteins for transcription activation of the rat cytochrome P-450c27 promoter. J Biol Chem 276:18007–18017[Abstract/Free Full Text]
  15. Schule R, Rangarajan P, Kliewer S, Ransone LJ, Bolado J, Yang N, Verma IM, Evans RM 1990 Functional antagonism between oncoprotein c-Jun and the glucocorticoid receptor. Cell 62:1217–1226[CrossRef][Medline]
  16. Yang-Yen HF, Chambard JC, Sun YL, Smeal T, Schmidt TJ, Drouin J, Karin M 1990 Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to direct protein-protein interaction. Cell 62:1205–1215[CrossRef][Medline]
  17. Jonat C, Rahmsdorf HJ, Park KK, Cato AC, Gebel S, Ponta H, Herrlich P 1990 Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone. Cell 62:1189–1204[CrossRef][Medline]
  18. Kerppola TK, Luk D, Curran T 1993 Fos is a preferential target of glucocorticoid receptor inhibition of AP-1 activity in vitro. Mol Cell Biol 13:3782–3791[Abstract/Free Full Text]
  19. Simons SSJ 1994 Function/activity of specific amino acids in glucocorticoid receptors. Vitam Horm 49:49–130[Medline]
  20. Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, Schmid W, Herrlich P, Angel P, Schutz G 1998 DNA binding of the glucocorticoid receptor is not essential for survival. Cell 93:531–541[CrossRef][Medline]
  21. Tuckermann JP, Reichardt HM, Arribas R, Richter KH, Schutz G, Angel P 1999 The DNA binding-independent function of the glucocorticoid receptor mediates repression of AP-1-dependent genes in skin. J Cell Biol 147:1365–1370[Abstract/Free Full Text]
  22. Bauer A, Tronche F, Wessely O, Kellendonk C, Reichardt HM, Steinlein P, Schutz G, Beug H 1999 The glucocorticoid receptor is required for stress erythropoiesis. Genes Dev 13:2996–3002[Abstract/Free Full Text]
  23. Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K, Schutz G 1995 Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 9:1608–1621[Abstract/Free Full Text]
  24. Purton JF, Boyd RL, Cole TJ, Godfrey DI 2000 Intrathymic T cell development and selection proceeds normally in the absence of glucocorticoid receptor signaling. Immunity 13:179–186[CrossRef][Medline]
  25. Purton JF, Zhan Y, Liddicoat DR, Hardy CL, Lew AM, Cole TJ, Godfrey DI 2002 Glucocorticoid receptor deficient thymic and peripheral T cells develop normally in adult mice. Eur J Immunol 32:3546–3555[CrossRef][Medline]
  26. Ashwell JD, Lu FW, Vacchio MS 2000 Glucocorticoids in T cell development and function. Annu Rev Immunol 18:309–345[CrossRef][Medline]
  27. Meijer OC, Cole TJ, Schmid W, Schutz G, Joels M, De KER 1997 Regulation of hippocampal 5-HT1A receptor mRNA and binding in transgenic mice with a targeted disruption of the glucocorticoid receptor. Brain Res Mol Brain Res 46:290–296[Medline]
  28. Schuetz EG, Schmid W, Schutz G, Brimer C, Yasuda K, Kamataki T, Bornheim L, Myles K, Cole TJ 2000 The glucocorticoid receptor is essential for induction of cytochrome P-4502B by steroids but not for drug or steroid induction of CYP3A or P-450 reductase in mouse liver. Drug Metab Dispos 28:268–278[Abstract/Free Full Text]
  29. Cole TJ, Myles K, Purton JF, Brereton PS, Solomon NM, Godfrey DI, Funder JW 2001 GRKO mice express an aberrant dexamethasone-binding glucocorticoid receptor, but are profoundly glucocorticoid resistant. Mol Cell Endocrinol 173:193–202[CrossRef][Medline]
  30. Strahle U, Schmidt A, Kelsey G, Stewart AF, Cole TJ, Schmid W, Schutz G 1992 At least three promoters direct expression of the mouse glucocorticoid receptor gene. Proc Natl Acad Sci USA 89:6731–6735[Abstract/Free Full Text]
  31. D’Adamio F, Zollo O, Moraca R, Ayroldi E, Bruscoli S, Bartoli A, Cannarile L, Migliorati G, Riccardi C 1997 A new dexamethasone-induced gene of the leucine zipper family protects T lymphocytes from TCR/CD3-activated cell death. Immunity 7:803–812[CrossRef][Medline]
  32. Mittelstadt PR, Ashwell JD 2001 Inhibition of ap-1 by the glucocorticoid-inducible protein gilz. J Biol Chem 276:29603–29610[Abstract/Free Full Text]
  33. Ayroldi E, Migliorati G, Bruscoli S, Marchetti C, Zollo O, Cannarile L, D’Adamio F, Riccardi C 2001 Modulation of T-cell activation by the glucocorticoid-induced leucine zipper factor via inhibition of nuclear factor {kappa}B. Blood 98:743–753[Abstract/Free Full Text]
  34. Galon J, Franchimont D, Hiroi N, Frey G, Boettner A, Ehrhart-Bornstein M, O’Shea JJ, Chrousos GP, Bornstein SR 2002 Gene profiling reveals unknown enhancing and suppressive actions of glucocorticoids on immune cells. FASEB J 16:61–71[Abstract/Free Full Text]
  35. Baughman G, Wiederrecht GJ, Campbell NF, Martin MM, Bourgeois S 1995 FKBP51, a novel T-cell-specific immunophilin capable of calcineurin inhibition. Mol Cell Biol 15:4395–4402[Abstract]
  36. Chan L, Means AR, O’Malley BW 1978 Steroid hormone regulation of specific gene expression. Vitam Horm 36:259–295[Medline]
  37. Konig H, Ponta H, Rahmsdorf HJ, Herrlich P 1992 Interference between pathway-specific transcription factors: glucocorticoids antagonize phorbol ester-induced AP-1 activity without altering AP-1 site occupation in vivo. EMBO J 11:2241–2246[Medline]
  38. Ray A, Prefontaine KE 1994 Physical association and functional antagonism between the p65 subunit of transcription factor NF-{kappa}B and the glucocorticoid receptor. Proc Natl Acad Sci USA 91:752–756[Abstract/Free Full Text]
  39. Scheinman RI, Gualberto A, Jewell CM, Cidlowski JA, Baldwin AS 1995 Characterization of mechanisms involved in transrepression of NF-{kappa}B by activated glucocorticoid receptors. Mol Cell Biol 15:943–953[Abstract]
  40. Akerblom IE, Slater EP, Beato M, Baxter JD, Mellon PL 1988 Negative regulation by glucocorticoids through interference with a cAMP responsive enhancer. Science 241:350–353[Abstract/Free Full Text]
  41. Kutoh E, Stromstedt PE, Poellinger L 1992 Functional interference between the ubiquitous and constitutive octamer transcription factor 1 (OTF-1) and the glucocorticoid receptor by direct protein-protein interaction involving the homeo subdomain of OTF-1. Mol Cell Biol 12:4960–4969[Abstract/Free Full Text]
  42. Chen R, Burke TF, Cumberland JE, Brummet M, Beck LA, Casolaro V, Georas SN 2000 Glucocorticoids inhibit calcium- and calcineurin-dependent activation of the human IL-4 promoter. J Immunol 164:825–832[Abstract/Free Full Text]
  43. Cippitelli M, Sica A, Viggiano V, Ye J, Ghosh P, Birrer MJ, Young HA 1995 Negative transcriptional regulation of the interferon-{gamma} promoter by glucocorticoids and dominant negative mutants of c-Jun. J Biol Chem 270:12548–12556[Abstract/Free Full Text]
  44. Isakov N, Altman A 2002 Protein kinase C{theta} in T cell activation. Annu Rev Immunol 20:761–794[CrossRef][Medline]
  45. Ford J, McEwan IJ, Wright AP, Gustafsson JA 1997 Involvement of the transcription factor IID protein complex in gene activation by the N-terminal transactivation domain of the glucocorticoid receptor in vitro. Mol Endocrinol 11:1467–1475[Abstract/Free Full Text]
  46. Henriksson A, Almlof T, Ford J, McEwan IJ, Gustafsson JA, Wright AP 1997 Role of the Ada adaptor complex in gene activation by the glucocorticoid receptor. Mol Cell Biol 17:3065–3073[Abstract]
  47. McEwan IJ, Wright AP, Dahlman-Wright K, Carlstedt-Duke J, Gustafsson JA 1993 Direct interaction of the tau 1 transactivation domain of the human glucocorticoid receptor with the basal transcriptional machinery. Mol Cell Biol 13:399–407[Abstract/Free Full Text]
  48. Almlof T, Wallberg AE, Gustafsson JA, Wright AP 1998 Role of important hydrophobic amino acids in the interaction between the glucocorticoid receptor {tau}1-core activation domain and target factors. Biochemistry 37:9586–9594[CrossRef][Medline]
  49. Wallberg AE, Neely KE, Hassan AH, Gustafsson JA, Workman JL, Wright AP 2000 Recruitment of the SWI-SNF chromatin remodeling complex as a mechanism of gene activation by the glucocorticoid receptor {tau}1 activation domain. Mol Cell Biol 20:2004–2013[Abstract/Free Full Text]
  50. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906[CrossRef][Medline]
  51. Yang L, Guerrero J, Hong H, DeFranco DB, Stallcup MR 2000 Interaction of the {tau}2 transcriptional activation domain of glucocorticoid receptor with a novel steroid receptor coactivator, Hic-5, which localizes to both focal adhesions and the nuclear matrix. Mol Biol Cell 11:2007–2018[Abstract/Free Full Text]
  52. Torchia J, Glass C, Rosenfeld MG 1998 Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol 10:373–383[CrossRef][Medline]
  53. Rogatsky I, Zarember KA, Yamamoto KR 2001 Factor recruitment and TIF2/GRIP1 corepressor activity at a collagenase-3 response element that mediates regulation by phorbol esters and hormones. EMBO J 20:6071–6083[CrossRef][Medline]
  54. Keeton EK, Fletcher TM, Baumann CT, Hager GL, Smith CL 2002 Glucocorticoid receptor domain requirements for chromatin remodeling and transcriptional activation of the mouse mammary tumor virus promoter in different nucleoprotein contexts. J Biol Chem 277:28247–28255[Abstract/Free Full Text]
  55. Danielsen M, Northrop JP, Jonklaas J, Ringold GM 1987 Domains of the glucocorticoid receptor involved in specific and nonspecific deoxyribonucleic acid binding, hormone activation, and transcriptional enhancement. Mol Endocrinol 1:816–822[Abstract]
  56. Bocquel MT, Kumar V, Stricker C, Chambon P, Gronemeyer H 1989 The contribution of the N- and C-terminal regions of steroid receptors to activation of transcription is both receptor and cell-specific. Nucleic Acids Res 17:2581–2595[Abstract/Free Full Text]
  57. Doppler W, Windegger M, Soratroi C, Tomasi J, Lechner J, Rusconi S, Cato AC, Almlof T, Liden J, Okret S, Gustafsson JA, Richard-Foy H, Starr DB, Klocker H, Edwards D, Geymayer S 2001 Expression level-dependent contribution of glucocorticoid receptor domains for functional interaction with STAT5. Mol Cell Biol 21:3266–3279[Abstract/Free Full Text]
  58. Brewer JA, Kanagawa O, Sleckman BP, Muglia LJ 2002 Thymocyte apoptosis induced by T cell activation is mediated by glucocorticoids in vivo. J Immunol 169:1837–1843[Abstract/Free Full Text]
  59. Ip MM, Shea WK, Sykes D, Young DA 1991 The truncated glucocorticoid receptor in the P1798 mouse lymphosarcoma is associated with resistance to glucocorticoid lysis but not to other glucocorticoid-induced functions. Cancer Res 51:2786–2796[Abstract/Free Full Text]
  60. Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, McKee DD, Oliver BB, Willson TM, Zetterstrom RH, Perlmann T, Lehmann JM 1998 An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 92:73–82[CrossRef][Medline]
  61. Reul JM, Pearce PT, Funder JW, Krozowski ZS 1989 Type I and type II corticosteroid receptor gene expression in the rat: effect of adrenalectomy and dexamethasone administration. Mol Endocrinol 3:1674–1680[Abstract]
  62. Krozowski ZS, Rundle SE, Wallace C, Castell MJ, Shen JH, Dowling J, Funder JW, Smith AI 1989 Immunolocalization of renal mineralocorticoid receptors with an antiserum against a peptide deduced from the complementary deoxyribonucleic acid sequence. Endocrinology 125:192–198[Abstract]
  63. Gartner H, Graul MC, Oesterreicher TJ, Finegold MJ, Henning SJ 194 2003 Development of the fetal intestine in mice lacking the glucocorticoid receptor (GR). J Cell Physiol 194:80–87[CrossRef][Medline]
  64. Kingsley-Kallesen M, Mukhopadhyay SS, Wyszomierski SL, Schanler S, Schutz G, Rosen JM 2002 The mineralocorticoid receptor may compensate for the loss of the glucocorticoid receptor at specific stages of mammary gland development. Mol Endocrinol 16:2008–2018[Abstract/Free Full Text]
  65. Phillips J, Eberwine JH 1996 Antisense RNA amplification: a linear amplification method for analyzing the mRNA population from single living cells. Methods 10:283–288[CrossRef][Medline]

NURSA Molecule Pages Link:

Nuclear Receptors:   GR
Ligands:   Dexamethasone



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
W. Chen, I. Rogatsky, and M. J. Garabedian
MED14 and MED1 Differentially Regulate Target-Specific Gene Activation by the Glucocorticoid Receptor
Mol. Endocrinol., March 1, 2006; 20(3): 560 - 572.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. M. Bula, J. Huhtakangas, C. Olivera, J. E. Bishop, A. W. Norman, and H. L. Henry
Presence of a Truncated Form of the Vitamin D Receptor (VDR) in a Strain of VDR-Knockout Mice
Endocrinology, December 1, 2005; 146(12): 5581 - 5586.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. J. Cole, D. R. Liddicoat, and D. I. Godfrey
Intrathymic Glucocorticoid Production and Thymocyte Survival: Another Piece in the Puzzle
Endocrinology, June 1, 2005; 146(6): 2499 - 2500.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. B. Conze, L. Albert, D. A. Ferrick, D. V. Goeddel, W.-C. Yeh, T. Mak, and J. D. Ashwell
Posttranscriptional Downregulation of c-IAP2 by the Ubiquitin Protein Ligase c-IAP1 In Vivo
Mol. Cell. Biol., April 15, 2005; 25(8): 3348 - 3356.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. M. Wintermantel, D. Bock, V. Fleig, E. F. Greiner, and G. Schutz
The Epithelial Glucocorticoid Receptor Is Required for the Normal Timing of Cell Proliferation during Mammary Lobuloalveolar Development but Is Dispensable for Milk Production
Mol. Endocrinol., February 1, 2005; 19(2): 340 - 349.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Cho, B. L. Kagan, J. A. Blackford Jr., D. Szapary, and S. S. Simons Jr.
Glucocorticoid Receptor Ligand Binding Domain Is Sufficient for the Modulation of Glucocorticoid Induction Properties by Homologous Receptors, Coactivator Transcription Intermediary Factor 2, and Ubc9
Mol. Endocrinol., February 1, 2005; 19(2): 290 - 311.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
I. Cima, N. Corazza, B. Dick, A. Fuhrer, S. Herren, S. Jakob, E. Ayuni, C. Mueller, and T. Brunner
Intestinal Epithelial Cells Synthesize Glucocorticoids and Regulate T Cell Activation
J. Exp. Med., December 20, 2004; 200(12): 1635 - 1646.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Rogatsky, J.-C. Wang, M. K. Derynck, D. F. Nonaka, D. B. Khodabakhsh, C. M. Haqq, B. D. Darimont, M. J. Garabedian, and K. R. Yamamoto
Target-specific utilization of transcriptional regulatory surfaces by the glucocorticoid receptor
PNAS, November 25, 2003; 100(24): 13845 - 13850.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
17/8/1534    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mittelstadt, P. R.
Right arrow Articles by Ashwell, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mittelstadt, P. R.
Right arrow Articles by Ashwell, J. D.