| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Laboratory of Immune Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: Jonathan D. Ashwell, Building 10, Room 1B-40, National Institutes of Health, Bethesda, Maryland 20892. E-mail: jda{at}pop.nci.nih.gov.
| ABSTRACT |
|---|
|
|
|---|
-chain and glucocorticoid-induced leucine zipper (GIL2). Thus, the truncated C-terminal GR2KO product, which lacks the major transactivation domain, retains, to a large extent, the ability to regulate gene expression both positively and negatively in a ligand-responsive manner when expressed in vivo. | INTRODUCTION |
|---|
|
|
|---|
1 (residues 85269 in the mouse) (2). The central portion, encoded by exons 3 and 4, contains a pair of zinc fingers that are sufficient for both DNA binding and homodimerization, as demonstrated by crystallographic analysis (3). Homodimerization is important for the induction of gene transcription in most cases (4, 5). The remaining portion (encoded by exons 59) contains two transcriptional activation domains [
2 and activation function 2 (AF-2)], the ligand-binding domain, and sequences required for nuclear localization and binding to the cytoplasmic chaperone heat shock protein 90 (2, 6).
|
B (NF-
B) and inhibit their induction of gene transcription (transrepression) (reviewed in Refs. 7, 8, 9). The GR can also bind signal transducer and activator of transcription (Stat)3 (10, 11), Stat5 (12, 13), and Ets2 (14), enhancing the activity of these transcription factors. The transrepressive activity of the GR against AP-1 requires an intact DNA-binding domain (DBD), although heterologous DBDs from other nuclear hormone receptors can substitute (15, 16, 17, 18, 19). It is thought that transrepression accounts for much of the biological activity of glucocorticoids, perhaps the strongest evidence for this being a mouse in which the endogenous GR was replaced with a dimerization-defective mutant (GRdim) (20). This mutation results in a marked loss in the ability of the GR to transactivate but not to transrepress (4, 5, 21). Although animals expressing the GRdim mutation had some abnormalities [lack of thymocyte apoptosis in response to glucocorticoids, defects in erythropoiesis (20, 22)], they were remarkably normal in most aspects, including viability, fertility, and glucocorticoid-mediated immunosuppression and antiinflammatory activity (5, 20). To better understand the role that the GR plays in biological processes, mice have been created in which the gene encoding the GR was disrupted by insertion of a neomycin-resistance cassette into the second exon (GR2KO) (23). The majority of these animals died at birth due to respiratory insufficiency, so initial studies focused on fetal tissues. GR2KO fetal thymocytes were resistant to glucocorticoid-induced apoptosis, but otherwise the thymi were of normal size and contained normal ratios of CD4 and CD8 cells (24). Furthermore, when transplanted fetal liver cells were allowed to develop in an irradiated wild-type host, the thymi and peripheral lymphoid compartments appeared to be similar whether reconstituted with wild-type or GR2KO cells (25). Although antigen-specific development was not studied, it was concluded that glucocorticoids are not required for normal T cell development and function, a finding at odds with a number of studies suggesting that glucocorticoids participate in normal T cell development and antigen-specific selection (26). Studies with GR2KO mice have also been used to argue that the GR is not involved in glucocorticoid-mediated regulation of particular genes such as those encoding cytochrome P-450 monooxygenase 3A (CYP3A), P-450 reductase, and the 5-hydroxytryptamine 1A receptor (5-HT1A) (27, 28). However, it has recently been reported that GR2KO mice actually express a C-terminal GR fragment of approximately 40 kDa (full-length GR migrates at >90 kDa) (29). Immunoblot analysis with an anti-C-terminal GR antibody showed that the truncated and wild-type proteins were expressed at comparable levels in the thymus, and binding studies found that cytosols from a variety of tissues from GR2KO mice bound radiolabeled dexamethasone (Dex) 3060% as well as those from wild-type animals. Because glucose-6-phosphatase mRNA was not induced by the synthetic glucocorticoid Dex in cultured GR2KO fetal hepatocytes, it was argued that these mice are profoundly glucocorticoid resistant. Nonetheless, given that much of the biological activity of the GR is mediated by transrepression and that there are transactivation domains in the C-terminal half of the molecule, we asked whether, in fact, GR2KO mice are unresponsive to glucocorticoids. Using DNA microarray analysis and real-time PCR to measure gene expression in GR2KO tissues, we find that global transrepression is relatively intact and, although less so than in wild-type tissues, glucocorticoids can induce the expression of many genes, including some that are important in T cell development and function.
| RESULTS |
|---|
|
|
|---|
1 yet retain intact DNA-binding, dimerization, and hormone-binding domains, as well as the secondary transactivation domains
2 and AF-2.
Studies in which truncated forms of the GR have been expressed in cell lines found that most of the transrepressive activity resides in the C-terminal half of the molecule (15). Given that this corresponds to the fragment expressed in GR2KO mice, we asked whether the GR2KO fragment can transrepress gene induction. To assess this, fetal d 18 (d 18) thymocytes from wild-type or GR2KO mice were stimulated with phorbol 12-myristate 13-acetate (PMA) and ionomycin in the absence or presence of 1 µM Dex. This treatment up-regulates many of the genes, including cytokines, that are subject to repression by glucocorticoids. After 5 h, RNA was isolated and used to generate linearly amplified antisense RNA, from which cDNA probes were generated and used to probe microarrays containing approximately 10,000 murine cDNAs. A comparison between two representative microarray scatter plots was made in which the relative change of individual genes in each array was plotted along each logarithmically scaled axis (Fig. 2
). Genes repressed in both cell types appear in the lower left quadrant and those induced in both appear in the upper right quadrant. If the GR2KO mutation resulted in a functionless receptor, there would be no response to Dex in these cells and the data points would be distributed horizontally. Alternatively, if the GR2KO product functioned similarly to the wild-type GR, the data would be distributed along a 45° diagonal. As shown in Fig. 2
, most of the data points were distributed along a diagonal, indicating that both cell types responded to Dex in a grossly similar fashion. Thus, the GR2KO possesses a substantial amount of activity, and many of the regulated genes are similarly controlled by the wild-type GR.
|
1 transactivation domain. However, there were still many genes whose expression was altered by Dex in both cell types, suggesting that the GR2KO protein is able to activate or repress a subset of the normal repertoire of glucocorticoid-regulated genes. A list of known genes most strongly regulated by Dex in GR2KO and WT fetal thymocytes is shown in Table 1
|
|
B that blocks IL-2 and Fas Ligand up-regulation and, consequently, activation-induced apoptosis of T cell hybridomas (31, 32, 33). It is noteworthy that GILZ was also the most strongly induced gene in a cDNA microarray analysis of Dex-induced genes in human peripheral T cells (34). Real-time PCR analysis of wild-type thymocytes stimulated with Dex for 3 h showed an 11-fold increase (Fig. 4A
-chain (IL-7R
), a receptor involved in T cell differentiation and function whose gene was previously identified as glucocorticoid responsive in a human peripheral blood mononuclear cell (PBL) microarray (34). In wild-type thymocytes IL-7R
mRNA levels increased by 1.7-fold after 3 h of Dex treatment (Fig. 4B
|
, FKBP51 represents a gene whose induction is dependent upon the presence of the N-terminal region of the GR.
Glutamine synthetase is a classic glucocorticoid-responsive gene (36). To examine the regulation of its mRNA in GR2KO cells, fetal lung cells were cultured for 5 h in the absence or presence of Dex and subjected to analysis by real-time PCR (Fig. 5
). Dex treatment caused a 2-fold increase in glutamine mRNA in both wild-type and GR2KO tissues, providing another example (along with the IL-7R
) in which the GR2KO molecule exhibits transcriptional activation similar to that of the wild-type GR.
|
| DISCUSSION |
|---|
|
|
|---|
B (38, 39), cAMP response element-binding protein (CREB) (40), octamer transcription factor 1 (OTF-1) (41), and nuclear factor of activated T cells (NFAT) (42), has been attributed to transrepression.
Several groups have evaluated the relative importance of different GR regions for transrepression. A human GR mutant lacking the 185-amino acid
1 domain retained greater than 70% of the ability of WT GR to repress AP-1-driven reporters (16, 17), and a human GR mutant in which residues 9385 had been deleted retained 36% of wild-type transrepression activity (15). These data suggest that the N-terminal portion of the GR may contribute to, but not be necessary for, transrepressive activity. In contrast, removal of the ligand-binding domain in the C-terminal half of the molecule ablated the majority of the repressive activity (15), and expression of simply the DBD of the rat GR was sufficient to inhibit DNA binding by Jun-Fos heterodimers in the absence of a GRE (18). Therefore, sequences in the C-terminal half of the GR appear to possess the majority of the transrepressive potential of the molecule.
Given that the GR2KO gene product is predicted to lack the
1 domain but retain the DNA- and ligand-binding domains, we asked whether it, in fact, is capable of modulating the expression of genes induced (or repressed) by other transcription factors. The combination of a phorbol ester and a Ca2+ ionophore is a potent means of activating lymphocytes, causing the up-regulation of a host of transcription factors, including AP-1, NF-
B, CREB-activating transcription factor (ATF), and others (43, 44). cDNA microarray analysis revealed that many genes whose expression was modulated by this stimulus were affected by glucocorticoids. Importantly, this was found to be the case with GR2KO thymocytes as well. In fact, on a global level there was little difference between normal and GR2KO cells, with similar numbers of genes being up-regulated or repressed in both cases. This argues that transrepression is, in fact, relatively well preserved in cells expressing approximately the C-terminal half of the GR.
Three transcriptional activation domains have been identified in the GR. The N-terminal
1 interacts with the general transcription factors TATA binding protein (45), Ada2 (46), transcription factor IID (47), and CREB-binding protein (CBP) (48), as well as the chromatin-remodeling complex SWI/SNF (49). The C-terminal half of the GR contains the transactivation domains
2, located within the N-terminal end of the ligand-binding domain (50), and AF-2, located at the C terminus. Within
2 is a motif mediating nuclear matrix attachment (51). AF-2 contains sites for interaction with the coactivators steroid receptor coactivator 1, CBP/p300, p300/CBP-associated factor (P/CAF), and transcriptional intermediary factor 2/GR-interacting protein 1 (52), the last of which can also act as a corepressor in certain contexts (53). Mutations in
2 and AF-2 have shown that these regions contribute to gene transactivation (6, 54). Thus, along with sites mediating trafficking, DNA binding, dimerization, heat shock protein binding, and ligand binding, the C-terminal half of the GR contains sites of interaction with many transcriptional cofactors.
Different conclusions have been reached regarding the relative roles of the N- and C-terminal portions of the GR in transactivation. Deletion of most or all of the N-terminal GR (15, 55), and specifically of
1 (50), caused nearly complete loss of transcriptional activity as assessed by reporter genes driven by the mouse mammary tumor virus long terminal repeat. In contrast, deletion of human
1 caused only a minor (20%) reduction on reporter gene induction (54). The differences between these studies might be explained by gene- and tissue-specific factors. For example, an N-terminal deletion of the human GR caused an approximately 3- to 5-fold reduction in MMTV-driven reporter gene GR responsiveness in CV-1 cells, but less than a 2-fold reduction in HeLa cells (56). Several studies have described instances in which the
1 activation domain is not required for GR-mediated enhancement of gene transcription. For example, a human GR mutant lacking
1 cooperated with Stat5 to induce the ß-casein promoter (57). In another case, the rat GR DBD alone bound and synergized with Ets2 to induce the cytochrome P-450c27 promoter (14). Our examination of cells expressing the
1-lacking GR2KO gene product showed that many genes were still glucocorticoid responsive on a global level, although to a lesser extent than in wild-type cells. Quantitation by real-time PCR revealed examples of genes in GR2KO cells that were nonresponsive (FKBP51), hyporesponsive (GILZ), and normally responsive (IL-7R
and glutamine synthetase) to glucocorticoids. Therefore, although aberrant, the C-terminal half of the GR contains a considerable amount of ligand-regulated transcriptional activity. A second GR mutant mouse has been generated in which the coding sequence of exon 2 was targeted for deletion from the germline (58). Like GR2KO mice, these mice die perinatally and their thymocytes are insensitive to Dex-induced apoptosis. However, because the strategy used to produce these animals was similar to that for the GR2KO mice, one must consider the possibility that they too produce an aberrant GR protein. The evidence that GR protein is absent in these mice is the lack of immunoreactivity with the anti-GR antibody BUGR-2 (58). However, BUGR-2 recognizes an epitope formed by amino acid residues 395404 of the mouse GR (59), residues encoded by exon 2 and therefore not present in a transcript lacking exon 2. Therefore, whether these animals do or do not express a truncated GR protein remains to be determined.
The pregnane X receptor (PXR) and the mineralocorticoid receptor are transcriptional regulators that can respond to glucocorticoids (60). Using semiquantitative RT-PCR we were unable to detect PXR mRNA in either wild-type or GR2KO fetal thymocytes, although it was abundant in adult liver (data not shown). Moreover, previous studies indicated that the mineralocorticoid receptor is not expressed in the thymus (61, 62). Therefore, although a role for another receptor in glucocorticoid responsiveness cannot be excluded, the overlap between the Dex-specific gene expression profiles observed in wild-type and GR2KO fetal thymocytes suggests that the response to Dex in the latter is mediated by the GR2KO protein.
The GR2KO mice have been used to address the role of the GR in thymocyte development. The apparently normal development of thymocytes and peripheral T cells derived from GR2KO bone marrow cells transplanted into irradiated wild-type hosts was taken as evidence that glucocorticoids play little, if any, role in normal T cell development (25). The finding that the GR2KO gene product has biological activity, however, calls this interpretation into question. GR2KO mice have also been used to examine the role of the GR in other biological systems. For example, glucocorticoid induction of CYP3A and P-450 reductase was found to be intact in GR2KO mice (28), which was taken as evidence that these genes are regulated by the PXR (60). In another study, corticosterone-mediated suppression of the 5-hydroxytryptamine 1A receptor was found to be normal in the hippocampus of the GR2KO mouse, the interpretation being that this effect was mediated by the mineralocorticoid receptor (27). The intestine of the GR2KO late-stage fetus was found to develop normally, contradicting a literature supporting the notion that glucocorticoids play a role in bringing about changes in the processing capacity of the fetal intestine (63). Finally, certain steps of mammary development were found to be unexpectedly unaffected by the GR2KO mutation (64). In light of the present report, conclusions about the role of the GR in biological processes based upon analysis of GR2KO mice should be reconsidered.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Culture
Day 18 fetal thymocytes were cultured in suspension at 2.5 x 105/ml in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (Biosource International, Camarillo, CA), 2 mM L-glutamine, 50 µM 2-ME, and 50 µg/ml gentamicin. In some experiments cells were treated with 20 ng/ml phorbol 12-myristate 13-acetate (PMA), 1 µg/ml ionomycin, and 1 µM Dex, as indicated. Lungs were isolated from d18 fetuses, sectioned, and cultured as solid tissues in DMEM (Biosource International) supplemented as above. After treatments, cells and tissues were snap frozen in liquid nitrogen.
Microarrays
Total RNA was harvested using Ultraspec reagent (Biotecx, Houston, TX) and further purified with the RNeasy kit (QIAGEN, Valencia, CA). Mouse expression microarrays (10,000 cDNA elements) were printed at the National Cancer Institute array facility (Advanced Technology Center). Two micrograms of total RNA were used to generate amplified antisense RNA by the method of Phillips and Eberwine (65) (http://nciarray.nci.nih.gov/reference/Probe_From_TotalRNA.html). Briefly, first-strand cDNA, primed with a T7-oligo(dT) oligonucleotide, was synthesized with Superscript II reverse transcriptase (Invitrogen), and second-strand cDNA was synthesized with DNA polymerase I. In vitro-transcribed amplified RNA was generated with the T7 Megascript kit (Ambion, Inc., Austin, TX). Fluorescently labeled cDNA probe generation and hybridization were performed using the procedures described for total RNA (http://nciarray.nci.nih.gov/reference/Probe_From_Total RNA.html), except that random hexamers (50 ng/µl) were used as primers, and 2.5 µg (Cy3, Dex-treated samples) or 5 µg (Cy5, non-Dex-treated samples) amplified RNA were used as templates. Hybridization was performed at 65 C in buffer containing 3.5x standard saline citrate and 0.25% sodium dodecyl sulfate. Microarrays were scanned with a GenePix 4000B scanner (Axon Instruments, Union City, CA), and array data was generated with GenePix Pro 3.0 software (Axon Instruments). Data were filtered and analyzed with server-based software provided by the Advanced Technology Center.
Real-Time PCR
cDNA was synthesized from total RNA at a concentration of 100 ng/µl using random hexamers and Superscript II reverse transcriptase (Invitrogen). For real-time PCR, cDNA was used at a concentration of 10 ng input RNA per µl of reaction volume. Real-time PCR was performed with the TaqMan sequence detection system (Applied Biosystems, Foster City, CA). TaqMan primers and probes were designed using PrimerExpress software to span intron/exon boundaries to prevent amplification of genomic DNA. Primers and probes are as follows: GILZ: forward, GTGGTGGCCCTAGACAACAAG; reverse, TCACAGCGTACATCAGGTGGTT; probe, CACGAGGTCCATGGCCTGCTCA. IL-7R
: forward, GCTTAATTCAAGCTGTTTCTGGAGA; reverse, CAACTGGCTGTGGCACCA; probe, TGCAGACGCGGACGATCACTCCTT. FKBP51: forward, ACCTGGCCATGTGCTACCTG; reverse, GTCCAGTCCAAGGGCCTTGT; probe, AGCACTCCACGGCTTTGTTGTACTCTCG. Glutamine synthetase: forward, CAGGCTGCCATACCAACTTCA; reverse, GCCTCCTCAATGCACTTCAGA; probe, TCTCCTCCCGCATGGCCTTGG. Hypoxanthine phosphoribosyltransferase: forward, AAACAATGCAAACTTTGCTTTCC; reverse, TCCTTTTCACCAGCAAGCTTG; probe, AACCATTTTGGGGCTGTACTGCTTAACCA. Samples are quantified using relative standard curves for each amplification reaction, and results were normalized to the internal control hypoxanthine phosphoribosyltransferase.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
, IL-7 receptor
-chain; NF-
B, nuclear factor
B; PMA, phorbol 12-myristate 13-acetate; PXR, pregnane X receptor; Stat, signal transducer and activator of transcription. Received for publication December 18, 2002. Accepted for publication May 5, 2003.
| REFERENCES |
|---|
|
|
|---|
B. Blood 98:743753
B and the glucocorticoid receptor. Proc Natl Acad Sci USA 91:752756
B by activated glucocorticoid receptors. Mol Cell Biol 15:943953[Abstract]
promoter by glucocorticoids and dominant negative mutants of c-Jun. J Biol Chem 270:1254812556
in T cell activation. Annu Rev Immunol 20:761794[CrossRef][Medline]
1-core activation domain and target factors. Biochemistry 37:95869594[CrossRef][Medline]
1 activation domain. Mol Cell Biol 20:20042013
2 transcriptional activation domain of glucocorticoid receptor with a novel steroid receptor coactivator, Hic-5, which localizes to both focal adhesions and the nuclear matrix. Mol Biol Cell 11:20072018NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
W. Chen, I. Rogatsky, and M. J. Garabedian MED14 and MED1 Differentially Regulate Target-Specific Gene Activation by the Glucocorticoid Receptor Mol. Endocrinol., March 1, 2006; 20(3): 560 - 572. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Bula, J. Huhtakangas, C. Olivera, J. E. Bishop, A. W. Norman, and H. L. Henry Presence of a Truncated Form of the Vitamin D Receptor (VDR) in a Strain of VDR-Knockout Mice Endocrinology, December 1, 2005; 146(12): 5581 - 5586. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Cole, D. R. Liddicoat, and D. I. Godfrey Intrathymic Glucocorticoid Production and Thymocyte Survival: Another Piece in the Puzzle Endocrinology, June 1, 2005; 146(6): 2499 - 2500. [Full Text] [PDF] |
||||
![]() |
D. B. Conze, L. Albert, D. A. Ferrick, D. V. Goeddel, W.-C. Yeh, T. Mak, and J. D. Ashwell Posttranscriptional Downregulation of c-IAP2 by the Ubiquitin Protein Ligase c-IAP1 In Vivo Mol. Cell. Biol., April 15, 2005; 25(8): 3348 - 3356. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Wintermantel, D. Bock, V. Fleig, E. F. Greiner, and G. Schutz The Epithelial Glucocorticoid Receptor Is Required for the Normal Timing of Cell Proliferation during Mammary Lobuloalveolar Development but Is Dispensable for Milk Production Mol. Endocrinol., February 1, 2005; 19(2): 340 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cho, B. L. Kagan, J. A. Blackford Jr., D. Szapary, and S. S. Simons Jr. Glucocorticoid Receptor Ligand Binding Domain Is Sufficient for the Modulation of Glucocorticoid Induction Properties by Homologous Receptors, Coactivator Transcription Intermediary Factor 2, and Ubc9 Mol. Endocrinol., February 1, 2005; 19(2): 290 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Cima, N. Corazza, B. Dick, A. Fuhrer, S. Herren, S. Jakob, E. Ayuni, C. Mueller, and T. Brunner Intestinal Epithelial Cells Synthesize Glucocorticoids and Regulate T Cell Activation J. Exp. Med., December 20, 2004; 200(12): 1635 - 1646. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Rogatsky, J.-C. Wang, M. K. Derynck, D. F. Nonaka, D. B. Khodabakhsh, C. M. Haqq, B. D. Darimont, M. J. Garabedian, and K. R. Yamamoto Target-specific utilization of transcriptional regulatory surfaces by the glucocorticoid receptor PNAS, November 25, 2003; 100(24): 13845 - 13850. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |