| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Research Laboratories of Schering AG, D-13342 Berlin, Germany
Address all correspondence and requests for reprints to: Dr. B. Haendler, Corporate Research Business Area Oncology, Schering AG, Müllerstrasse 178, D-13342 Berlin, Germany. E-mail: bernard.haendler{at}schering.de.
| ABSTRACT |
|---|
|
|
|---|
overexpression had little influence on SRE-mediated AR activity but was repressive when using AREs. Altogether, these results demonstrate that DNA response elements play an important modulatory role in transmitting AR action and may be determinative for specificity of gene expression in cell or tissue types. | INTRODUCTION |
|---|
|
|
|---|
Recently, DNA response elements mediating a preferential response to androgen stimulation have been described in some androgen-regulated genes including probasin and Pem (4, 5, 6). Unlike the SREs, which form imperfect inverted repeats of the 5'-TGTTCT-3' half-site, these selective androgen response elements (AREs) have direct repeat features (4, 5, 6). Mutational analyses indicate that AREs, but not SREs, are recognized by the AR in an assymetrical mode (4, 5). Furthermore, domain-swapping experiments between the AR and GR demonstrate that the second zinc finger and the C-terminal extension of the hinge region are essential for recognition of selective elements (7). Altogether, this suggests a different mode of interaction between the AR and the two classes of response elements, which might be instrumental for the preferential recruitment of cofactors and hence the selective stimulation of target genes.
To analyze this, we studied the implications of the interaction between the AR and the two response element classes by different approaches. After purification of DNA-bound complexes, we probed the accessibility of the AR to proteases, as an indicator of the protein conformation induced by response elements. Furthermore, we determined the importance of the dimerization interface of the AR DNA-binding domain (DBD) for transactivation potential and compared the regulatory effects of different cofactors in the presence of representative response elements. The results strongly suggest that AR conformation varies depending on the bound response element, thereby altering the role of the dimerization interface and adjusting the response to cofactors. These results underscore the importance of DNA elements as modulators of AR function.
| RESULTS |
|---|
|
|
|---|
|
|
To verify that this selectivity was not unique to CV-1 cells, we performed similar experiments in the human prostate adenocarcinoma cell line PC-3, which contains no endogenous AR or GR. The different reporter constructs were introduced into the cells together with an AR-expressing plasmid. After androgen treatment, a stronger response of Pem ARE-1- and ARE-2-driven plasmids than of CRISP-1 SRE-, 2.43 SRE-, or consensus SRE-containing plasmids was observed (Fig. 2B
). The opposite situation was seen after transfection of a GR-expressing plasmid and glucocorticoid treatment (Fig. 2B
).
The results show that small variations in the DNA sequence of response elements lead to important differences in AR effects. They also allow the definition of two classes of elements: those exhibiting a selective response to androgen stimulation when compared with glucocorticoid treatment (Pem ARE-1 and Pem ARE-2), and those with the opposite pattern (CRISP-1 SRE, 2.43 SRE, and consensus SRE).
Distinct AR Protease Digestion Patterns Result from Binding to Different Response Elements
To determine whether the two response element classes influenced the conformation of bound AR, we purified complexes formed of DNA elements and associated proteins (Fig. 3A
). Biotinylated double-stranded oligonucleotides containing the various response elements as tandem repeats were bound to streptavidin sepharose. Aliquots were incubated with nuclear extracts prepared from androgen-treated PC-3/AR cells that stably express the AR. After thorough washing to remove nonspecifically attached proteins, the captured AR-protein complexes were eluted from the DNA using high-salt buffer and precipitated with trichloroacetic acid. The samples were resuspended, separated on sodium dodecyl sulfate gel, and analyzed by Coomassie staining (not shown). The pattern of the major protein bands was highly similar for all the response elements, strongly suggesting that no systematic bias due to nonspecific binding to a given DNA sequence had taken place.
|
To test whether DNA elements had an influence on the conformation of bound AR, we probed the accessibility by protease digestions using chymotrypsin or trypsin. The purified complexes were separated on a denaturing gel, and the bands corresponding to digested AR were detected by an antibody recognizing the C-terminal moiety. As observed above, more AR was associated with the SREs than with the AREs in the undigested complexes (Fig. 4
, A and B, 0 ng/µl protease, lanes 1 and 2 compared with lanes 3 and 4). Some digestion products closely reproduced this pattern so that a differential sensitivity to proteases could not necessarily be inferred. There were instances, however, where more product was formed from the ARE complex than from the SRE complex. Using chymotrypsin at a concentration of 0.2 ng/µl, a rapid degradation of AR associated with the selective elements was apparent for band C1 (Fig. 4A
, lanes 3 and 4), whereas only a very weak band corresponding to intact AR remained (band AR). Considering that more AR tethered to the nonselective elements was originally present, the product C1 was proportionally less represented than in the samples where ARE-bound complexes were digested (lanes 3 and 4). Also, the fact that a band of lower molecular weight (C2) exhibited a pattern opposite to that of C1 and comparable to that of undigested AR indicated that the ARE-bound complexes were not altogether more accessible to chymotrypsin. When trypsin was used at a concentration of 2 ng/µl, a prominent digestion product labeled T1 was generated from selective element-bound complexes (Fig. 4B
, lanes 3 and 4) but was less apparent for the nonselective elements (lanes 1 and 2). The opposite pattern was seen for a digestion product with a lower molecular weight (band T2). This band was stronger for the nonselective than for the selective elements (lanes 1 and 2 compared with lanes 3 and 4).
|
Mutations in the AR Dimerization Box Differentially Affect Transactivation Transmitted by Different Response Elements
AR-selective DNA elements have an opposite half-site orientation compared with nonselective DNA elements and are recognized in an asymmetrical way by the AR (4, 5). These observations and the different protease digestion patterns generated in the present study suggest that the AR homodimer adopts a different conformation, depending on the bound element class. This, in turn, may impinge on the role of domains directly implicated in receptor dimerization. The second zinc finger and especially its D box have been shown to partake in the dimerization interface of steroid receptors (11). From the crystal structure of the GR DBD and from mutagenesis experiments, it is known that two charged amino acids of the D box are engaged in intermolecular salt bridges (11). Mutation for a residue of the opposite charge disrupts this interface, leading to a dramatic loss of activity on a single DNA element but, surprisingly, to an enhanced activity on multiple elements (12). The equivalent mutations R598D and D600R were introduced into the AR (Fig. 5
). The activity of each mutant was compared with that of wild-type AR after transfection into CV-1 cells and using reporter plasmids harboring the different response elements as tandem repeats (Fig. 6A
). AR D600R behaved similarly to the wild-type form for transactivation through Pem ARE-1 and Pem ARE-2, but was twice as active in the presence of CRISP-1 SRE and 2.43 SRE (Fig. 6B
). With AR R598D, the effects were much more pronounced. Here, a doubling of activity was seen in the presence of the Pem elements and an 8- to 9-fold increase for the two other elements, when compared with wild-type AR (Fig. 6B
). Western blot analysis showed that the expression levels of wild-type AR and AR mutants were comparable after transfection of the corresponding expression plasmids into CV-1 cells (Fig. 6C
).
|
|
|
The Coactivators Transcriptional Intermediary Factor 2 (TIF2) and ARA55 Differentially Modulate AR Activity Depending on the Response Element
In the next step we examined whether the different conformations elicited by binding to DNA elements affected AR response to cofactors. TIF2 and ARA55 stimulate the ligand-dependent activity of the AR and of other steroid receptors (6, 14). CV-1 cells were cotransfected with reporter plasmids containing two copies of the different DNA elements and expression plasmids for the AR and for the coactivators TIF2 or ARA55. In the control experiments, the same amount of an expression vector expressing ß-galactosidase, rather than the cofactor, was added. For both cofactors and for all elements tested, enhancement of androgen-driven transcriptional activity was noted after overexpression (Fig. 8
). A peak at 0.1 nM followed by a small decline of stimulation was observed for TIF2 (Fig. 8
, left column). This was not the case for ARA55, where an increase of stimulation followed by a plateau effect was noted (Fig. 8
, right column). In absolute terms, cofactor overexpression led to stronger AR action through AREs than through SREs, parallelling the activity seen without added cofactor. When analyzing the effects elicited by TIF2 or ARA55 via each DNA element, we found that, in comparison to the natural CRISP-1 SRE, the increase in response mediated by Pem ARE-2 was less at all concentrations tested. For Pem ARE-1, highly significant differences were only noted at low androgen levels. Conversely, the cofactor effects mediated by the 2.43 SRE did not differ significantly from those mediated by the CRISP-1 SRE.
|
Sumoylation Enzymes Modulate AR Function in a DNA Element-Dependent Fashion
Sumoylation of AR has been reported to either stimulate or repress AR activity, depending on the experimental setting (15, 16). Both ubiquitin-conjugating enzyme 9 (Ubc9) and the PIAS (protein inhibitor of activated STAT) family are involved in this process (15, 16, 17, 18). Using cotransfection experiments as above, we analyzed the effect of ectopic Ubc9 or PIASx
expression on AR function mediated by various response elements. When overexpressing Ubc9, AR action transmitted by SREs, but not by AREs, was stimulated at all hormone concentrations from 0.01 nM onward. Using CRISP-1 SRE as reference, we found that both Pem AREs, but not the 2.43 SRE, interpreted Ubc9 overexpression in a significantly different way (Fig. 9
, left column). Thus, AREs and SREs fall into two classes with regard to transmission of Ubc9 effects. When overexpressing PIASx
, virtually no effect on AR stimulation was visible at any concentration for the nonselective elements. Conversely, a marked inhibitory effect on AR activity mediated by the selective AREs was observed at 0.1 nM and higher androgen concentrations (Fig. 9
, right column). Statistical analysis confirmed the significance of these results, allowing again the distinction between the ARE and the SRE classes.
|
on AR function to greatly vary, depending on the response elements tested. Ubc9 enhances AR activity transmitted by nonselective elements but not by selective elements. Conversely, PIASx
hardly affects AR activity conveyed by nonselective elements but significantly represses it in the presence of selective ones. It can therefore be concluded that the modulatory effects of two enzymes involved in the sumoylation pathway are differently interpreted by each class of DNA response elements. | DISCUSSION |
|---|
|
|
|---|
The Pem AREs mediated a higher androgen response than the SREs. Even though the AR affinities for the different element classes were not quantified, our data suggest that AR binding and transactivation potential do not necessarily correlate. Altered intra- and interdomain interactions as well as differential cofactor recruitment may be instrumental in modulating AR function, and a model in which DNA elements impart conformational modifications onto bound AR leading to such novel interactions can be postulated. Very recent results documenting the differential importance of the amino/carboxyl-terminal interaction in AR-mediated transactivation via specific and nonspecific response elements are in line with this (19). It should be noted, however, that a competitive effect of AR-binding factors or of other proteins present in the complexes cannot be excluded at this point.
Limited protease digests were performed on DNA-AR complexes purified from PC-3/AR nuclear extracts. This had the advantage of keeping the AR in its native conformation, bound to DNA and associated with cofactors. We found differences in the sensitivity to chymotrypsin and trypsin depending on whether the AR was attached to AREs or SREs. The chymotrypsin digestion experiments showed a differential accessibility of ARE-associated AR than of SRE-bound AR. Similar results were obtained after trypsin treatment. The cleavage sites were difficult to localize precisely, but all were in the AR N-terminal domain. The C1 band was generated by means of cutting near the N-terminal end, and the T1 and T2 bands were generated by cutting close to the C-terminal end of the AR N-terminal domain. Even though an effect linked to differential association and dissociation at beads carrying the various oligonucleotides cannot be ruled out, our results suggest that the DNA elements induced changes outside of the DBD and that interdomain communication existed in the AR. Another, non-mutually-exclusive possibility is that different coregulator sets were recruited by the AR tethered to different response elements, thereby altering protease accessibility. Recent data indicate that estrogen response element sequences may also affect the conformation of bound ER (20, 21).
The AR D box is part of the dimerization interface. Disruption of salt bridges by mutating specific residues in this region of the GR or mineralocorticoid receptor leads to enhanced activity on multiple SREs, indicating a role in restraining transcriptional synergy rather than in stabilizing the receptor homodimer (12, 22). We found that the equivalent mutations R598D and D600R increased AR activity mainly on the nonselective SREs. Far fewer (R598D) or no effects (D600R) were observed when testing the selective Pem AREs. This documents that self-synergy varies depending on response elements and opens up the possibility that control of AR activity may be achieved at this level. Another residue of the AR D box likely to play a role in receptor dimerization is alanine at position 596. The A596T mutation has been identified in the AR of patients suffering from Reifenstein syndrome, a form of partial androgen insensitivity (13). Due to its inability to bind to promoters containing a single response element, the mutant receptor cannot transactivate. It is fully active, however, on promoters with multiple response elements in vitro (13). We found that AR A596T possessed a reduced transactivation potential toward the selective AREs. The situation was not the same for the SREs. Little change was noted for the CRISP-1 SRE and a much enhanced activity for the 2.43 SRE. This indicates that, here again, disruption of the dimerization interface had very different effects on AR function, depending on the response elements analyzed. Even though the results were biased by the lower expression of the mutant AR as compared with the wild-type form, it can be concluded that the selective AREs behaved similarly. It is also noteworthy that all D box mutations we tested had the strongest stimulating effects on transactivation potential mediated by the 2.43 SRE, which was originally identified as the optimal AR binding sequence using an in vitro selection procedure (8). Conversely, the weak AR binders generally responded less, or even negatively, to disruption of the dimerization interface. Altogether, the results show the effects of the mutations to be context dependent and are in line with an influence of DNA elements on the contacts formed within the dimer interface. Previous studies on the ER and GR have shown this interface to form only after DNA binding, implying that its conformation is not fixed beforehand (23, 24). By affecting the dimerization interface, DNA elements might furthermore allosterically influence the position and activity of the synergy control motifs described in the AR N-terminal domain (25). These motifs are operative only when the dimerization interface is intact and have recently been shown to harbor sites for sumoylation (18).
The changes in AR conformation brought about by DNA elements might, in turn, affect the recruitment and activity of coregulatory proteins. TIF2 and ARA55 have been identified as potent AR coactivators (6, 14). We found their ectopic expression to enhance AR activity in transactivation assays. The peak noted at 0.1 nM for TIF2 overexpression showed the role of this coactivator to be more important at low than at high ligand concentrations. In absolute terms, the effects of both cofactors were much more pronounced on the AREs than on the SREs, with Pem ARE-1 exhibiting the strongest response to overexpression of both TIF2 and ARA55. Interestingly, the cofactor-enhanced response of the SREs attained about the levels reached by AREs without added cofactors. This demonstrates that the respective strengths of response elements may be dramatically influenced by cofactors. It should also be noted that despite the high overall induction, the relative enhancement of androgen effects by TIF2 and ARA55 was significantly less in the presence of Pem ARE-2 than for the other response elements. The fact that the effects of cofactors known to associate with the AR N-terminal region or ligand-binding domain are affected by the response element recognized by the DBD indicates that, indeed, information originating from DNA elements can be transmitted to distal domains. Since the contact interface between nuclear receptors and cofactors is generally small (26), it is conceivable that even limited conformational changes affect recruitment of regulatory proteins. An influence of DNA elements on TIF2 association with the ER (27, 28) as well as on SRC-1 interaction with the thyroid hormone receptor (29) have already been reported. A function of DNA elements in inducing changes in receptor conformation leading to selective cofactor recruitment may thus represent a general mechanism for control of gene expression.
Posttranslational modifications are emerging as important regulatory steps in AR function. Among these, the process of sumoylation has been shown to dramatically repress AR transactivation (18). Recent data indicate that Ubc9 and the PIAS proteins are implicated in AR sumoylation as E2 conjugase and E3 ligase, respectively (15, 17). We found that the effects of Ubc9 differed, depending on the class of DNA elements tested. A parallel enhancement of AR response was seen for the nonselective SREs. For the selective AREs, little effect or even repression was observed. Concerning PIASx
cotransfection, we noted no effect for the nonselective SREs but a dramatic repression of AR activity when the selective AREs were tested. Altogether, our data show that the response to cofactors implicated in protein sumoylation is different for the nonselective SREs and the selective AREs. The parallel shift toward repression of AR action observed for a given element when comparing the effects of Ubc9 and PIASx
is striking. A possible explanation is that in the sumoylation pathway, Ubc9 acts upstream of different PIAS proteins, some with repressing and some with stimulating effects on AR activity, indicating the existence of a regulatory network (15, 16, 30, 31). In addition, sumoylation-independent effects of Ubc9 on AR activity have also been described (17) so that the effects of both enzymes need not necessarily be identical. Finally, sumoylation affects the function of many proteins, including TIF2, leading to complex effects within the cell (15). The AR sumoylation sites have recently been identified within the synergy control motifs present in the N-terminal region. Mutation of these motifs has effects similar to mutations of the DBD dimer interface on AR activation, suggesting a functional link between both domains (18). The recent discovery that ablation of the AR sumoylation sites leads to loss of recruitment of the corepressor silencing mediator of retinoid and thyroid hormone receptor in the presence of an antiandrogen might explain, at least in part, how control of self-synergy is achieved (32). Finally, the observation that sumoylation also has repressive effects on progesterone receptor and GR function (33, 34) suggests that this posttranslational modification represents a general mechanism for regulation of steroid receptor function. Our finding that DNA elements differentially interpret the effects of two sumoylating enzymes adds another level of complexity in transcriptional control.
In summary, we have shown that DNA elements convey information to bound AR and act as regulators affecting the effects of cofactors and protein-modifying coregulators. As proposed for other transcription factors (35), allosteric modification induced by DNA elements may represent an essential mechanism used to control the activity of individual genes, and future studies will show whether modulation of transcription can be achieved at this level.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids
Expression vectors containing cDNAs for full-length AR, GR, TIF2, ARA55, Ubc9, and PIASx
inserted in the pSG5 plasmid (Stratagene, La Jolla, CA) were generated and used for transfections. Site-directed mutagenesis of pSG5-AR was carried out using the QuikChange kit (Stratagene) and the heat-stable polymerase mix from the Advantage kit (CLONTECH, Palo Alto, CA). The luciferase reporter plasmids were based on the pGL3-Basic plasmid (Promega, Madison, WI). The murine Pem proximal promoter construct has been described (5). Replacement of both AREs by the 2.43 SREs was performed by site-directed mutagenesis using PCR fragments as megaprimers (36). Briefly the primers 5'-CATGAACTGTGTCCATCTTGCAGGAACAAAATGTCCCTTACATCCCCAAACTGCTATCAC-3' and 5'-GGGCCCCTGGTGTCCCCGGGGACATTTTGTTCCGTGATGCTCAACCTGG- CAGGG-3' were used to amplify a 221-bp long fragment of the Pem promoter flanked by the novel 2.43 SRE sequences (underlined). After purification on gel, this amplification product was mixed with the Pem promoter luciferase plasmid for insertion mutagenesis using the QuikChange kit, as described (36). In the minimal reporter constructs two copies of the DNA response elements Pem ARE-1 (5), Pem ARE-2 (5), CRISP-11253 ARE, hereafter named CRISP-1 SRE (9), 2.43 SRE (8), or of the consensus high-binder SRE element (10) were placed upstream of the thymidine kinase minimal promoter and of the luciferase reporter gene (Table 1
). Spacing and sequence of the regions between the response elements and upstream of the minimal promoter were identical in all cases. DNA sequencing was performed using standard procedures.
|
Preparation of DNA-Protein Complexes and Protease Digestions
DNA-protein complexes were purified and analyzed for AR content using an adapted avidin-biotin complex DNA-binding assay (37, 38). The following biotinylated oligonucleotides containing two copies of each element (underlined) and their complementary sequence were mixed in annealing buffer [40 mM Tris-HCl (pH 7.5), 20 mM MgCl2, 50 mM NaCl], heated to 100 C, and cooled slowly to room temperature. They were then incubated with Streptavidin Sepharose beads (Sigma) overnight in binding buffer.
Pem ARE-1:
5'-GATAATTCTTAAAGATCTCATTCTGTTCCATTGATTTT- TAGAGATCTCATTCTGTTCCAATTCATTGATT-3';
Pem ARE-2:
5'-GATAATTCTTAAAGCACATCGTGCTCAATTGATTTTTAGAGCACATCGTGCTCAAATTCATTGATT -3';
CRISP-1 SRE:
5'-GATAATTCTTAAGGTACATTGTGTTCAATTGATTTTTAGGGTACATTGTGTTCAAATTCATTGATT-3';
2.43 SRE:
5'-GATAATTCTTAAGGAACAAAATGTCCCATTGATTTTTAGGGAACAAAATGTCCCAATTCATTGATT-3';
Consensus SRE:
5'-GATAATTCTTAAGGTACATTGTGTTCTATTGATTTTTAGGGTACATTGTGTTCTAATTCATTGATT-3'.
The flowthrough containing excess oligonucleotides was removed, and the oligonucleotide-loaded sepharose was washed with binding buffer. Binding of the oligonucleotides was verified by comparing the A260 values of the input and the flowthrough to ensure saturation of the streptavidin beads. After that, 70 µl of the 1:1 oligonucleotide-loaded sepharose solution were mixed with 100 µl of 1 mg/ml nuclear extract supplemented with 2.6 µg of poly(dI-dC) and 2.6 µg of poly(dA-dT) in a Micro Bio-Spin chromatography column (Bio-Rad Laboratories, Inc., Hercules, CA). Incubation was for 20 min at room temperature followed by 2 h at 4 C under constant shaking. After removal of the flowthrough, the beads were washed twice with 1 ml of binding buffer without protease inhibitor. Elution of bound proteins was performed with high-salt buffer (binding buffer supplemented with 1.2 M NaCl) which was followed by trichloroacetic acid precipitation. The protein content of the complexes was assessed by gel separation (412% polyacrylamide gel, Invitrogen, San Diego, CA) and Coomassie blue staining. For determination of AR content, the proteins were transferred from the gel onto a polyvinylidene fluoride membrane (Invitrogen) and probed with an anti-AR antibody (sc-7305; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Processing was carried out with the Enhanced Chemiluminescence detection kit (Perkin Elmer Corp., Norwalk, CT).
For the protease digestions 75 µl of chymotrypsin or trypsin dilutions in binding buffer were added to the beads-associated protein-DNA complexes. After 10 min at room temperature the reaction was stopped by adding 35 µl of sample buffer (4% sodium dodecyl sulfate, 20% glycerin, 120 mM Tris base, 100 mM DTT, 0.02% bromophenol blue, 150 mM Pefablock SC) and heating to 95 C for 5 min. After centrifugation, aliquots of the supernatants were loaded onto polyacrylamide gels for Coomassie blue or Western blot analyses. Coomassie blue staining was performed to check that the total protein amounts were identical. Western blot analysis of the AR digestion products was carried out after transfer to a polyvinylidene fluoride membrane by incubating with the anti-AR C-19 antibody (Santa Cruz Biotechnology, Inc.) and processing with an enhanced chemiluminescence detection kit, as above.
Transfections
CV-1 and PC-3 cells were cultured and transfected as described (5) with 100 ng of pSG5-AR or pSG5-GR plasmids. Hormone treatment was with 1 nM R1881 or dexamethasone, unless indicated otherwise. Luciferase activity was measured 24 h later in the presence of LucLite Plus reagent (Packard Instruments, Meriden, CT) in a Lumicount luminometer (Packard Instruments). The average value of six wells treated in parallel was determined, and the experiments were repeated at least three times independently. The amount of reporter plasmid harboring the different response elements was identical (100 ng) in all experiments. For the cofactor assays, 25 ng of pSG5-AR and 70 ng of cofactor-expressing plasmid or of ß-galactosidase control plasmid were used.
Statistical Analysis
The significance of the results obtained after cofactor overexpression was determined by performing an ANOVA for each cofactor. The fixed factors used were: DNA element, hormone level, experiment, and statistical interaction between DNA element and hormone level. If the interaction factor was significant using ANOVA, a comparison of cofactor effects on response elements was carried out. The local
levels of the t tests used were adapted for multiple comparisons by means of a Bonferroni adjustment.
| ACKNOWLEDGMENTS |
|---|
and ARA55 cDNAs. We are indebted to M. Preuss, I. Schüttke, and F. Knoth for excellent technical assistance. The help of S. Schwenke with statistical analysis is gratefully acknowledged. | FOOTNOTES |
|---|
Abbreviations: AR, Androgen receptor; ARE, androgen response element; CRISP-1, cysteine-rich secretory protein 1; DBD, DNA-binding domain; DTT, dithiothreitol; ER, estrogen receptor; GR, glucocorticoid receptor; PIAS, protein inhibitor of activated STAT; SRE, steroid response element; TIF2, transcriptional intermediary factor 2; Ubc9, ubiquitin-conjugating enzyme 9.
Received for publication November 15, 2002. Accepted for publication May 29, 2003.
| REFERENCES |
|---|
|
|
|---|
function as SUMO-E3 ligases towards androgen receptor and repress androgen receptor-dependent transcription. J Biol Chem 277:4131141317
. Mol Cell Endocrinol 174:151166[CrossRef][Medline]
NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
I. N. Karatsoreos, A. Wang, J. Sasanian, and R. Silver A Role for Androgens in Regulating Circadian Behavior and the Suprachiasmatic Nucleus Endocrinology, November 1, 2007; 148(11): 5487 - 5495. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lai, M.-A. Kedda, K. Hinze, R. L.G. Smith, J. Yaxley, A. B. Spurdle, C.P. Morris, J. Harris, and J. A. Clements PSA/KLK3 AREI promoter polymorphism alters androgen receptor binding and is associated with prostate cancer susceptibility Carcinogenesis, May 1, 2007; 28(5): 1032 - 1039. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Z. Lu, S. E. Wardell, K. L. Burnstein, D. Defranco, P. J. Fuller, V. Giguere, R. B. Hochberg, L. McKay, J.-M. Renoir, N. L. Weigel, et al. International Union of Pharmacology. LXV. The Pharmacology and Classification of the Nuclear Receptor Superfamily: Glucocorticoid, Mineralocorticoid, Progesterone, and Androgen Receptors Pharmacol. Rev., December 1, 2006; 58(4): 782 - 797. [Full Text] [PDF] |
||||
![]() |
J. A. MacLean II, M. K. Rao, K. M.H. Doyle, J. S. Richards, and M. F. Wilkinson Regulation of the Rhox5 Homeobox Gene in Primary Granulosa Cells: Preovulatory Expression and Dependence on SP1/SP3 and GABP Biol Reprod, December 1, 2005; 73(6): 1126 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Brodie and I. J McEwan Intra-domain communication between the N-terminal and DNA-binding domains of the androgen receptor: modulation of androgen response element DNA binding J. Mol. Endocrinol., June 1, 2005; 34(3): 603 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Steketee, A. C J Ziel-van der Made, H. A G M van der Korput, A. B Houtsmuller, and J. Trapman A bioinformatics-based functional analysis shows that the specifically androgen-regulated gene SARG contains an active direct repeat androgen response element in the first intron J. Mol. Endocrinol., October 1, 2004; 33(2): 477 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Callewaert, G. Verrijdt, A. Haelens, and F. Claessens Differential Effect of Small Ubiquitin-Like Modifier (SUMO)-ylation of the Androgen Receptor in the Control of Cooperativity on Selective Versus Canonical Response Elements Mol. Endocrinol., June 1, 2004; 18(6): 1438 - 1449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Centrella, T. L. McCarthy, W.-Z. Chang, D. C. Labaree, and R. B. Hochberg Estren (4-Estren-3{alpha},17{beta}-diol) Is a Prohormone that Regulates Both Androgenic and Estrogenic Transcriptional Effects through the Androgen Receptor Mol. Endocrinol., May 1, 2004; 18(5): 1120 - 1130. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Shaffer, A. Jivan, D. E. Dollins, F. Claessens, and D. T. Gewirth Structural basis of androgen receptor binding to selective androgen response elements PNAS, April 6, 2004; 101(14): 4758 - 4763. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |