help button home button Endocrine Society Molecular Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Molecular Endocrinology, doi:10.1210/me.2003-0436
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
18/10/2388    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow NURSA Molecule Pages Link
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masiello, D.
Right arrow Articles by Balk, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masiello, D.
Right arrow Articles by Balk, S. P.
Molecular Endocrinology 18 (10): 2388-2401
Copyright © 2004 by The Endocrine Society

Recruitment of ß-Catenin by Wild-Type or Mutant Androgen Receptors Correlates with Ligand-Stimulated Growth of Prostate Cancer Cells

David Masiello, Shao-Yong Chen, Youyuan Xu, Manon C. Verhoeven, Eunis Choi, Anthony N. Hollenberg and Steven P. Balk

Cancer Biology Program/Hematology-Oncology Division (D.M., S.-Y.C., Y.X., M.C.V., E.C., S.P.B.) and the Thyroid Unit/Endocrinology Division (A.N.H.), Department of Medicine, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts 02215; and University of Utrecht (M.C.V.), 3508 GA, Utrecht, The Netherlands

Address all correspondence and requests for reprints to: Steven P. Balk, Hematology-Oncology Division, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, Massachusetts 02215. E-mail: sbalk{at}bidmc.harvard.edu.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Prostate cancers respond to treatments that suppress androgen receptor (AR) function, with bicalutamide, flutamide, and cyproterone acetate (CPA) being AR antagonists in clinical use. As CPA has substantial agonist activity, it was examined to identify AR coactivator/corepressor interactions that may mediate androgen-stimulated prostate cancer growth. The CPA-liganded AR was coactivated by steroid receptor coactivator-1 (SRC-1) but did not mediate N-C terminal interactions or recruit ß-catenin, indicating a nonagonist conformation. Nonetheless, CPA did not enhance AR interaction with nuclear receptor corepressor, whereas the AR antagonist RU486 (mifepristone) strongly stimulated AR-nuclear receptor corepressor binding. The role of coactivators was further assessed with a T877A AR mutation, found in LNCaP prostate cancer cells, which converts hydroxyflutamide (HF, the active flutamide metabolite) into an agonist that stimulates LNCaP cell growth. The HF and CPA-liganded T877A ARs were coactivated by SRC-1, but only the HF-liganded T877A AR was coactivated by ß-catenin. L-39, a novel AR antagonist that transcriptionally activates the T877A AR, but still inhibits LNCaP growth, similarly mediated recruitment of SRC-1 and not ß-catenin. In contrast, ß-catenin coactivated a bicalutamide-responsive mutant AR (W741C) isolated from a bicalutamide-stimulated LNCaP subline, further implicating ß-catenin recruitment in AR-stimulated growth. Androgen-stimulated prostate-specific antigen gene expression in LNCaP cells could be modulated by ß-catenin, and endogenous c-myc expression was repressed by dihydrotestosterone, but not CPA. These results indicate that interactions between AR and ß-catenin contribute to prostate cell growth in vivo, although specific growth promoting genes positively regulated by AR recruitment of ß-catenin remain to be identified.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE ANDROGEN RECEPTOR (AR) is a steroid hormone receptor member of the larger nuclear receptor family of ligand-activated transcription factors (1, 2). Similarly to other steroid hormone and nuclear receptors, the AR recruits to specific genes a number of proteins and protein complexes that serve to remodel chromatin and stimulate transcription (3). The AR is composed of an N-terminal transactivation domain, a central DNA binding domain (DBD), and a C-terminal ligand binding domain (LBD) that also has transactivation activity. The transcriptional activity of the LBD, activation function-2, is largely due to a ligand induced shift in the position of helix 12 that generates a binding site for a short hydrophobic helical motif (leucine-X-X-leucine-leucine, LXXLL, where X can be any amino acid) (4, 5, 6, 7). The LXXLL motif forms the core of the nuclear receptor box (NR box), which is found in single or multiple copies in many transcriptional coactivator proteins that associate with agonist-liganded nuclear receptors (4, 8). Steroid receptor coactivator-1 (SRC-1) and SRC-2 [transcriptional intermediary factor 2 and glucocorticoid receptor (GR)-interacting protein 1] are two such well-characterized NR box-containing coactivator proteins that clearly contribute to nuclear receptor functions (9, 10, 11, 12).

In contrast to other steroid hormone receptors, the AR LBD binds very weakly to the SRC-1 or -2 NR boxes and has minimal transactivation activity when it is expressed independently of the N terminus, whereas the AR N terminus has a very strong autonomous transactivation function (activation function 1) (13, 14). AR binding to SRC-1 and -2 is mediated primarily by the AR N terminus and a glutamine-rich domain in the SRC proteins (15, 16, 17). Although the AR LBD interacts very weakly with the NR boxes in SRC proteins, it binds strongly to an LXXLL-related motif (FXXLF) found in the AR N terminus (18). This binding makes a major contribution to AR transcriptional activity and mediates what appears to be an intermolecular interaction between the AR N and C termini in the AR homodimer (15, 19, 20, 21, 22). Nonetheless, the AR N-C interaction is not absolutely required for transcriptional activity as ligands that do not support the interaction can still stimulate AR when used at relatively high concentrations, and peptides that block the N-C interaction do not necessarily inhibit AR transcriptional activity (23, 24). These results have suggested that the AR N-C interaction, in conjunction with helix 12, may serve to stabilize agonist ligand binding and receptor conformation at physiological agonist concentrations.

The AR plays a central role in normal prostate development and in the development and progression of prostate cancer, with the majority of prostate cancer patients responding to therapies that decrease androgen levels (medical or surgical castration) or directly block AR functions (AR antagonists) (25). However, the molecular mechanisms and transcriptional targets mediating AR effects on normal vs. neoplastic prostate growth remain unclear. Bicalutamide, flutamide, and cyproterone acetate (CPA) are the AR antagonists that have been used most extensively for prostate cancer treatment (26). Bicalutamide and hydroxyflutamide (HF, the active metabolite of flutamide) are relatively pure AR antagonists in vivo, although HF has weak agonist activity at high concentrations in transient transfection assays (27, 28, 29). Although HF is an antagonist of the wild-type AR, it is an agonist for certain mutant ARs identified in prostate cancer patients and stimulates the growth of LNCaP prostate cancer cells, which express an AR with a threonine to alanine mutation in codon 877 (T877A) of the LBD (30, 31). Significantly, this T877A mutation is found at increased frequency in prostate cancers that relapse after flutamide therapy, supporting the hypothesis that these prostate cancers in vivo behave similarly to LNCaP cells and are stimulated by the HF-liganded T877A mutant AR (32).

In contrast to bicalutamide and HF, CPA has substantial AR agonist activity when assayed in transient transfections against episomal reporter genes, as well as androgenic activity in vivo in castrated rodents, indicating that it may function as a selective modulator of AR functions (23, 33, 34). Drugs that function as selective modulators of other steroid hormone receptors, particularly the estrogen receptor, are in clinical use and have been extensively studied. They appear to function by altering the position of helix 12 in the LBD, thereby preventing the formation of a binding site for LXXLL motif containing coactivator proteins and favoring the binding of the transcriptional corepressor proteins nuclear receptor corepressor (NCoR) and SMRT through a related extended helical motif (5, 6, 35, 36, 37, 38). Previous studies have shown that the AR can interact with NCoR and SMRT, but the role of this and other protein-protein interactions in determining the biological activities of AR remain unclear (39, 40, 41). This study examines in detail the CPA- and HF-liganded wild-type and T877A mutant ARs as models to determine whether there are particular AR-protein interactions that may be critical for prostate cancer growth. The results support an important role for AR recruitment of ß-catenin, recently identified as an AR coactivator protein (42, 43, 44, 45, 46, 47, 48), in androgen-stimulated prostate cancer growth.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Partial Agonist Activities of AR Antagonists on Wild-Type and Mutant ARs
The agonist activities of dihydrotestosterone (DHT), CPA, HF, and bicalutamide on the wild-type and T877A mutant ARs were compared in transient transfection assays in CV1 cells (steroid hormone receptor deficient), using an androgen-responsive element (ARE)-regulated Firefly luciferase reporter plasmid. Consistent with previous reports, CPA had substantial agonist activity, whereas HF was a very weak agonist and bicalutamide functioned as a pure antagonist of the wild-type AR (Fig. 1AGo). As shown previously, the agonist activity of HF was markedly enhanced with the T877A mutant AR (Fig. 1BGo). This mutation also markedly enhanced the agonist activity of CPA but did not have an effect on bicalutamide.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Partial Agonist Activities of AR Antagonists on Wild-Type (WT) and T877A Mutant ARs

CV1 cells were transfected with wild-type AR (A) or T877A mutant AR (B) expression vectors (pSVARWT or pSVART877A, respectively, 100 ng), Firefly luciferase reporter (ARE4-luciferase, 200 ng), and Renilla luciferase control (pRL-CMV, 0.1 ng) for 24 h in steroid hormone depleted medium (DMEM/10% CDS-FBS). Fresh medium and drugs as indicated were then added for another 24 h. Firefly and Renilla luciferase activities from triplicate samples were then determined. BIC, Bicalutamide.

 
A previous report suggested that the agonist activity of CPA may only occur with episomal reporters and not with integrated genes, which would be consistent with its antagonist activity in prostate cancer (49). Therefore, the agonist activity of CPA on the wild-type AR was assessed in CV1 cells containing an integrated mouse mammary tumor virus (MMTV)-regulated luciferase reporter gene (50). CPA-stimulated AR activity on this integrated reporter was equivalent to or greater than that observed with the episomal reporter (Fig. 2AGo). The agonist activity of CPA on an integrated gene was further assessed by examining the endogenous AR-regulated prostate-specific antigen (PSA) gene in LNCaP cells. LNCaP cells were cultured for 24 h in steroid hormone-depleted medium [RPMI-1640 with 10% charcoal dextran-stripped (CDS)-fetal bovine serum (FBS)] and then stimulated with 10 µM CPA. RNA analysis by quantitative real-time RT-PCR demonstrated a clear increase in PSA mRNA within 2–3 h (Fig. 2BGo). These results showed that the substantial agonist activity of CPA toward the wild-type and LNCaP T877A mutant ARs could be seen on integrated genes as well as episomal reporter genes.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. CPA Effects on Integrated Reporter and LNCaP Cells

A, CV1 cells with an integrated AR-regulated luciferase reporter gene (CV1-MMTV-Luc cells) were transfected with AR (pSVARWT, 100 ng) and pRL-CMV control (0.1 ng) vectors in DMEM/10% CDS-FBS and then treated with DHT or CPA as indicated. B, LNCaP cells grown for 3 d in steroid hormone-depleted medium (RPMI-1640/10% CDS-FBS) were stimulated with 10 µM CPA, and RNA was isolated at the indicated times. PSA message was determined by real-time RT-PCR. C, LNCaP cells growing in complete medium (RPMI-1640/10% FBS) were treated with CPA as indicated and the fraction of cells in S-phase was determined by PI staining after 24 h. WT, Wild-type.

 
LNCaP proliferation is suppressed by bicalutamide, which inhibits the T877A AR, but is stimulated by HF (30, 31, 51). Previous studies in LNCaP cells have generally shown that CPA can stimulate proliferation when cells are grown in the absence of androgens but represses androgen-stimulated growth (30, 52, 53). Consistent with these data, CPA caused a dosedependent decrease in the S-phase fraction of LNCaP cells grown in androgen containing medium (RPMI-1640 with 10% FBS) (Fig. 2CGo). Under these conditions, bicalutamide similarly decreased proliferation, whereas DHT at 1–10 nM caused an increase in the rate of proliferation (data not shown). Taken together, these results indicated that there were critical functional differences between the DHT- and CPA-liganded wild-type AR, as well as the CPA- vs. HF-liganded T877A mutant AR. Subsequent studies were carried out to identify molecular mechanisms for these functional differences.

AR N-C Terminal Interaction Mediated by CPA vs. HF
A possible difference between DHT and CPA was in their ability to support the AR N-C terminal interaction. To assess this interaction, the AR wild-type and T877A mutant LBDs were fused to the heterologous Gal4 DBD (Gal4DBD-ARLBDWT and -ARLBDT877A). These were cotransfected with a Gal4-regulated reporter plasmid (pG5-Luciferase) and the AR N-terminal domain fused to the heterologous VP16 transactivation domain (VP16-ARNTD). As reported previously with the wild-type LBD, a strong interaction was induced by DHT, but not by CPA or HF (Fig. 3AGo) (23). In contrast, there was an interaction between the HFliganded T877A LBD and the AR N-terminal domain in the presence of HF, although it was weaker than with DHT (Fig. 3BGo). This indicated that CPA and HF induced distinct conformational changes in the LBD, with the HF induced conformation in the T877A mutant AR being similar to the DHT-induced agonist conformation and possibly contributing to HF-stimulated growth of LNCaP cells.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. AR N-C Terminal Interactions Mediated by CPA and HF

CV1 cells (in DMEM/10% CDS-FBS) were transfected with expression vectors encoding the Gal4 DBD fused to the wild-type (WT) AR LBD (pGal4DBD-ARLBDWT, 100 ng) (A) or the T877A mutant AR LBD (pGal4DBD-ARLBDT877A, 100 ng) (B), in conjunction with a VP16-AR N-terminal domain vector (VP16-ARNTD, 100 ng), pG5-Luc reporter (100 ng), and pRL-CMV control. The transfected cells were then stimulated for 24 h with drugs as indicated and luciferase activities were determined from triplicate samples.

 
Although the lack of an AR N-C interaction correlated with prostate cancer inhibition by CPA, and with the ability of HF to stimulate LNCaP proliferation, it was not clear whether or how this interaction altered AR recruitment of other proteins and qualitatively altered the transcriptional activity of the AR. Previous reports have indicated that the N-C terminal interaction can inhibit binding of SRC-1 and -2 to the AR LBD, although binding of these coactivators to the AR appears to be mediated primarily by the N-terminus (15, 20, 21, 22). Other data suggest that the function of the AR N-C interaction may be to stabilize the agonist-liganded AR LBD (23, 24). Therefore, further experiments were carried out to directly assess CPA and HF effects on coactivator and corepressor interactions with the AR.

SRC-1 Recruitment by CPA- and HF-Liganded Wild-Type and T877A Mutant ARs
As steroid hormone receptor transcriptional functions are mediated by recruitment of coactivator proteins, and in particular by SRC-1 and -2, one possible difference between CPA and HF on the wild-type and T877A ARs was their recruitment of SRC proteins. As shown previously, the DHT-liganded wild-type AR can be stimulated by SRC-1 (Fig. 4AGo). Significantly, the CPA-liganded wild-type AR was also strongly stimulated by SRC-1 (Fig. 4AGo). This recruitment of SRC-1 (as well as SRC-2, data not shown) by the CPA-liganded AR was presumably mediated by the AR N terminus and was consistent with the substantial agonist activity of CPA. SRC-1 similarly enhanced the activity of the T877A mutant AR when liganded to DHT or CPA and also enhanced the HF-liganded T877A AR (Fig. 4BGo). SRC-1 interaction with the HF-liganded T877A AR was consistent with the agonist activity of HF on this mutant, but the similar CPA mediated interaction indicated that differential SRC protein recruitment was not responsible for the distinct biological activity of CPA.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Coactivation of Wild-Type (WT) and T877A Mutant ARs by SRC-1

CV1 cells were transfected with wild-type AR (A) or T877A mutant AR (B) expression vectors (pSVARWT or pSVART877A, respectively, 100 ng), ARE4-luciferase (200 ng), pRL-CMV (0.1 ng), and SRC-1 vector (100 ng) as indicated in DMEM/10% CDS-FBS. Luciferase activities from triplicate samples treated with drugs for 24 h as indicated were then determined.

 
NCoR Recruitment by Antagonist-Liganded ARs
Published data demonstrate that AR can interact with NCoR, suggesting augmentation of this interaction as a possible mechanism by which CPA could selectively antagonize AR function in cells expressing relatively high levels of NCoR (39, 40, 41). This hypothesis was tested by cotransfecting AR with VP16-NCoRc, which encoded the C-terminal receptor-interacting domains of NCoR fused to the VP16 transactivation domain. The VP16-NCoRc fusion protein did not substantially enhance the CPA-liganded wild-type AR but did strongly coactivate the AR liganded to RU486 (mifepristone, another antagonist of the AR, as well as the GR and progesterone receptor (PR) (Fig. 5AGo). This latter RU486-stimulated AR-NCoR interaction was consistent with previous data showing that NCoR interacted with the RU486-liganded PR and GR, and could block the weak transcriptional activity of the RU486-liganded AR (26, 35, 54, 55, 56).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. NCoR Interaction with Antagonist-Liganded AR

A, CV1 cells were transfected with wild-type AR (pSVARWT, 100 ng), ARE4-luciferase (100 ng), pRL-CMV (0.1 ng), and VP16-NCoRc (100 ng) as indicated. B, CV1 cells were transfected with VP16-AR (100 ng) and Gal4DBD-NCoRc (GAL4-NCoRc, 100 ng) as indicated, pG5-luciferase reporter (100 ng), and pRL-CMV (0.1 ng). Luciferase activities from triplicate samples treated with drugs for 24 h as indicated were then determined.

 
The failure of VP16-NCoRc to clearly enhance the CPA-liganded AR, in conjunction with the strong RU486 positive control, suggested that NCoR did not mediate the antagonist effects of CPA. However, the substantial baseline transcriptional activity of the CPA-liganded AR may have compromised the ability to detect further enhancement by VP16-NCoRc. Therefore, an alternative approach was to use the same receptor-interacting NCoR C-terminus fused to the Gal4 DBD (Gal4DBD-NCoRc) and assay for recruitment of a VP16-AR fusion protein. Consistent with our previous results, this assay detected a weak ligand independent AR-NCoR interaction (39). However, this interaction was not enhanced by CPA, whereas RU486 again induced a strong interaction (Fig. 5BGo). These results confirmed an NCoR interaction with the RU486-liganded AR and indicated that the therapeutic effects of CPA in prostate cancer were not likely due to enhanced NCoR recruitment.

ß-Catenin Recruitment by CPA- vs. HF-Liganded ARs
Recent studies have demonstrated that ß-catenin can bind to the AR LBD and function as a coactivator for the DHT-liganded AR (Fig. 6AGo). However, ß-catenin does not coactivate the CPA-liganded AR, suggesting that the failure to recruit ß-catenin may contribute to the biological effects of CPA in prostate cancer (48, 57). To test this hypothesis, the recruitment of ß-catenin by the CPA- vs. HF-liganded T877A mutant AR was next assessed. Significantly, both the DHT- and HF-liganded T877A ARs were strongly coactivated by ß-catenin, whereas the CPA-liganded T877A AR was not coactivated by ß-catenin and was instead inhibited (Fig. 6BGo). The molecular basis for repression of the CPA-liganded wild-type and mutant AR by ß-catenin is not certain but may reflect sequestration of critical coactivators by ß-catenin. In any case, these findings supported the hypothesis that ß-catenin recruitment by the agonist-liganded AR could play an important role in AR-stimulated prostate cancer growth.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6. ß-Catenin Interaction with Antagonist-Liganded Wild-Type (WT) and T877A Mutant ARs

CV1 cells were transfected with wild-type AR (A) or T877A mutant AR (B) expression vectors (pSVARWT or pSVART877A, respectively, 100 ng), ARE4-luciferase (200 ng), pRL-CMV (0.1 ng), and ß-catenin vectors (100 ng) as indicated in DMEM/10% CDS-FBS. Luciferase activities from triplicate samples treated with drugs for 24 h as indicated were then determined. BIC, Bicalutamide.

 
Functional Analysis of L-39, Another Selective Agonist of the T877A Mutant AR
We next examined a group of additional AR antagonists, L-39, VN-85, and VN-87, that were shown previously to inhibit LNCaP cell growth in vitro and in vivo (58, 59). These drugs were developed as antagonists of the enzyme steroidal 17{alpha}-hydroxylase/C17,20 lyase, which is required for androgen synthesis, but they further function as direct antagonists of DHT-stimulated AR transcriptional activity (Fig. 7AGo). VN-85 and VN-87 also block the LNCaP T877A mutant AR, whereas L-39 functions as a potent agonist for the T877A AR (Fig. 7BGo). The suppression of LNCaP cell growth in conjunction with this strong agonist activity indicated that L-39 was also functioning as a selective agonist. Therefore, further functional studies of the L-39-liganded T877A AR were carried out.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7. Activities of Steroidal 17{alpha}-Hydroxylase/C17,20 Lyase Antagonists against Wild-Type and T877A Mutant ARs

CV1 cells were transfected with wild-type AR (A) or T877A mutant AR (B) expression vectors (pSVARWT or pSVART877A, respectively, 100 ng), ARE4-luciferase (200 ng), and pRL-CMV (0.1 ng) in DMEM/10% CDS-FBS. Luciferase activities from triplicate samples treated with drugs for 24 h as indicated were then determined.

 
Similarly to HF and CPA, the transcriptional activity of the L-39-liganded T877A AR could be enhanced by SRC-1 (Fig. 8AGo). Also similarly to CPA (but not HF), L-39 did not support an interaction between the AR N-terminal domain and the T877A LBD (Fig. 8BGo). Finally, the L-39-liganded T877A AR was not coactivated by ß-catenin (Fig. 8CGo). These findings provided a further correlation between the failure to recruit ß-catenin and the inhibition of LNCaP cell growth.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 8. Functional Analysis of L-39-Liganded T877A Mutant AR

A, CV1 cells were transfected with T877A mutant AR (pSVART877A, 100 ng), ARE4-luciferase (100 ng), pRL-CMV (0.1 ng), and SRC-1 vector (100 ng). B, CV1 cells were transfected with Gal4DBD-ARLBDT877A (100 ng), VP16-ARNTD (100 ng), pG5-luciferase reporter (100 ng), and pRL-CMV (0.1 ng). C, CV1 cells were transfected with pSVART877A (100 ng), ARE4-luciferase (100 ng), pRL-CMV (0.1 ng), and ß-catenin vector (100 ng). Transfected cells in DMEM/10% CDS-FBS were stimulated for 24 h with DHT or L-39 as indicated, and luciferase activities were then determined from triplicate samples.

 
ß-Catenin Interaction with the Bicalutamide-Responsive W741C AR
A W741C mutant AR was recently cloned from LNCaP cells that were selected for growth in medium with bicalutamide, which is an antagonist of the LNCaP T877A AR and inhibits LNCaP cell growth (60). The isolated W741C/T877A mutant AR, as well as the single W741C mutant, were then shown to be bicalutamide activated in transient transfections. Significantly, the identical W741C mutant AR was also recently cloned from an androgen independent prostate cancer in a patient who had relapsed after combined androgen ablation and bicalutamide therapy (61). These observations indicated that the bicalutamide-liganded W741C AR stimulated prostate cancer growth. Therefore, ß-catenin recruitment by this mutant AR was next assessed.

The wild-type AR was not activated by bicalutamide in the absence or presence of ß-catenin (Fig. 9AGo). In contrast, the W741C mutant was strongly activated by bicalutamide (Fig. 9BGo). The DHT-liganded wild-type and W741C mutant ARs were both coactivated by ß-catenin. Significantly, the bicalutamide-liganded W741C AR was also coactivated by ß-catenin. This result further indicated a role for ß-catenin in AR stimulated prostate cancer growth. A summary of the data showing the effects of all the above ligands on wild-type and mutant ARs is shown in Table 1Go.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 9. ß-Catenin Interaction with Bicalutamide-Liganded Wild-Type (WT) and W741C Mutant ARs

CV1 cells were transfected with wild-type AR (A) or W741C mutant AR (B) expression vectors (pSVARWT or pSVARW741C, respectively, 100 ng), ARE4-luciferase (200 ng), pRL-CMV (0.1 ng), and ß-catenin vectors (100 ng) as indicated in DMEM/10% CDS-FBS. Luciferase activities from triplicate samples treated with drugs for 24 h as indicated were then determined. BIC, Bicalutamide.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Coactivator/Corepressor Recruitment by Ligands with Partial Agonist Activities on Wild-Type (wt) or Mutant ARs

 
Effects of the ß-Catenin-AR Interaction on Expression of Endogenous Genes
ß-Catenin can clearly function as an AR coactivator in transient transfections with episomal reporter genes, and recent chromatin immunoprecipitation data have demonstrated its recruitment to the AR-regulated PSA gene enhancer, supporting the conclusion that ß-catenin functions in vivo as an AR coactivator (62). To further assess whether ß-catenin functions as an AR coactivator in vivo, we examined androgen stimulated expression of the endogenous PSA gene in LNCaP cells with decreased or increased levels of ß-catenin. LNCaP cells stably transfected with a ß-catenin short interfering RNA (siRNA) expression vector had reduced levels of ß-catenin and decreased induction of PSA gene expression in response to DHT stimulation (Fig. 10Go, A and B). In contrast, CPA-stimulated PSA gene expression was not markedly altered by the reduced ß-catenin levels (Fig. 10CGo).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 10. AR Coactivation by ß-Catenin in Vivo A, Levels of total whole cell or free (digitonin extracted) ß-catenin in control or ß-catenin siRNA (ß-catenin-pTER) expressing LNCaP cells were assessed by immunoblotting. B and C, Control or ß-catenin siRNA expressing LNCaP cells were androgen starved for 2 d in medium with CDS-FBS and then stimulated with DHT (10 nM) or CPA (10 µM) for the indicated times. PSA transcript levels were then measured by real-time RT-PCR. Levels are expressed as fold induction relative to the unstimulated cells. D, expression of N-terminal truncated ß-catenin in pBI-EGFP-ß-catenin(del1–89) cells uninduced (–) or induced (+) with doxycycline (1 µg/ml for 24 h). E and F, pBI-EGFP-ß-catenin(del1–89) transfected LNCaP cells were treated for 24 h –/+ doxycycline in CDS-FBS medium, and were then stimulated with DHT or CPA.

 
In the converse experiment, we examined LNCaP cells expressing a tetracycline-regulated truncated stable ß-catenin (deletion of the N-terminal GSK3ß sites). Doxycycline induction increased the expression of this stabilized ß-catenin, although substantial levels were also expressed in the absence of doxycycline (perhaps due in part to its prolonged half-life) (Fig. 10DGo). In any case, the induction resulted in increased PSA transcription in response to DHT, but not CPA (Fig. 10Go, E and F). Taken together with the siRNA results above, these findings strongly support the conclusion that ß-catenin can function in vivo as a coactivator for the DHT-liganded AR.

To further assess how the ß-catenin-AR interaction contributes to prostate cell growth, we examined in LNCaP cells the effects of DHT on expression of c-myc, which is regulated by ß-catenin through coactivation of T-cell factor (Tcf) family proteins. Previous transient transfection studies have shown that the DHT-liganded AR can antagonize the transcriptional activity of Tcf4 on Tcf-responsive reporter genes, presumably reflecting competition for limiting nuclear ß-catenin, but such repression has not been demonstrated in vivo on an endogenous Tcf-regulated gene (45, 47, 57, 63). Moreover, we showed previously that the AR could bind directly to Tcf4 as well as ß-catenin, and that the DHT-liganded AR could be recruited to a Tcf4 binding site in the c-myc promoter (57). These latter findings suggested that the DHT dependent recruitment of AR to a ß-catenin/Tcf4 complex on the c-myc promoter might stimulate c-myc expression and contribute to the proliferative effects of DHT.

To determine the effect of AR on c-myc expression, LNCaP cells cultured in steroid hormone-depleted medium were stimulated with DHT, CPA, or vehicle control, and gene expression was quantified by real-time RT-PCR. CPA had no significant effect on c-myc expression, but DHT caused a rapid fall in endogenous c-myc transcript levels (to about 50% of baseline at 2 h) (Fig. 11AGo). These studies were extended to LAPC-4 cells, a prostate cancer cell line that expresses a wild-type AR. Similarly to LNCaP cells, DHT treatment of LAPC-4 cells cultured in steroid hormone-depleted medium caused a decrease in c-myc message (Fig. 11AGo). Significantly, despite this DHT-mediated decrease in c-myc, LAPC-4 cell proliferation was not inhibited by DHT, but was suppressed by CPA (based on cell numbers or fraction of cells in S-phase or S/G2/M) (Fig. 11BGo, and data not shown). These results provide further in vivo evidence for a DHT dependent AR interaction with ß-catenin, although repression of endogenous c-myc by the DHT-liganded AR indicates that the distinct effects of DHT vs. CPA on cell growth must be mediated through other genes.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 11. Effects of DHT vs. CPA on c-myc Expression and LAPC-4 Proliferation

A, Cells were cultured in medium with 10% CDS-FBS (3 d for LNCaP and 2 d for LAPC-4), and then stimulated with CPA (10 µM), DHT (10 nM), or vehicle (ethanol to 0.01% final) for 2–6 h as indicated. RNA extracted from triplicate samples (100 ng) was analyzed for c-myc RNA by real-time RT-PCR, and values were normalized to vehicle controls. B, LAPC-4 cells cultured for 2 d in medium with 10% CDS-FBS were stimulated with CPA, DHT, or vehicle, and the fraction of cells in S-phase (left panel) or in S + G2 + M-phase (right panel) was determined by PI staining after 48 h.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
This study focused on the mechanism of action of CPA, a steroidal AR antagonist widely used outside of the United States for prostate cancer treatment, to identify AR coactivator/corepressor interactions that may contribute to prostate cancer growth. Consistent with previous studies on the wild-type AR, CPA at micromolar concentrations had partial agonist activity but failed to support the interaction between the AR N-terminal domain and the C-terminal LBD. This AR N-C terminal interaction is mediated by an LXXLL-like motif in the AR N terminus, indicating that the CPA-liganded LBD does not assume the agonist conformation required for binding this motif. The CPA-liganded AR was strongly coactivated by SRC-1, consistent with a recent report and previous data showing that SRC-1 binding to the AR is mediated primarily by the N-terminus with little or no contribution from binding of the LXXLL motifs in SRC-1 to the LBD (64). Significantly, although the CPA-liganded AR LBD was not in the agonist conformation, there was no enhancement of NCoR binding. In contrast, the RU486-liganded AR could strongly interact with NCoR.

RU486 is a well-characterized antagonist for the GR and PR and can similarly stimulate NCoR recruitment to these receptors (26, 35, 54, 55, 56). Two very recent reports also demonstrate NCoR interaction with the RU486-liganded AR (65, 66). The structural basis for this activity appears to be the 11ß-substitution on RU486, which is presumed to block helix 12 from moving into the agonist conformation (67, 68, 69). This steric inhibition of helix 12 is observed with the selective estrogen receptor modulators tamoxifen and raloxifene (5, 6). CPA, which lacks this 11ß substitution, has agonist activity for the PR and was recently shown to be an antagonist for the GR (70). Molecular modeling studies with the GR suggest that CPA does not directly block helix 12 but instead alters the conformation of other key residues required to stabilize helix 12 in the agonist conformation. This indirect mechanism of antagonism was observed in the crystal structure of the tetrahydrochrysene-liganded estrogen receptor ß and has been referred to as passive antagonism (71). The lack of enhanced NCoR binding to the CPA-liganded AR is consistent with a passive antagonism model, which is further supported by molecular modeling studies indicating that residues in the AR ligand binding pocket need to be repositioned to accommodate the cyclopropane ring in CPA (72).

Interestingly, a G708A mutation in helix 3 of the AR LBD can convert CPA into a pure antagonist, suggesting that there is further repositioning of key residues in this CPA-liganded mutant AR. The corresponding glycine in the PR is required for the binding of RU486, and the absence of an amino acid side chain in this position may be necessary to accommodate the bulky phenyl-aminodimethyl substitution at the 11ß position of RU486 (67, 68). It is possible that the addition of an amino acid side chain in the G708A mutation would simulate the effects of an 11ß substitution, and it will be of interest to determine whether the CPA-liganded G708A mutant AR interacts more strongly with NCoR.

In contrast to the similar behavior of the CPA- and DHT-liganded wild-type ARs with respect to SRC-1 and NCoR recruitment, the CPA-liganded wild-type AR was not coactivated by ß-catenin. Therefore, additional AR antagonists and mutant ARs were examined to further assess the relationship between ß-catenin recruitment and antagonism of AR-stimulated growth. The agonist activity of CPA was markedly increased by the T877A mutation, which was first identified in the LNCaP cell line and shown to convert HF into a strong AR agonist that could stimulate LNCaP cell growth (30, 31). Studies comparing CPA and HF showed that HF, but not CPA, stimulated an interaction between the AR N-terminal domain and the T877A C-terminal LBD (although this interaction was only observed at 10 µM HF and was modest relative to the DHT-stimulated N-C terminal interaction). Significantly, although the T877A mutation had no effect on ß-catenin recruitment by CPA, the HF-liganded T877A AR was strongly coactivated by ß-catenin.

Studies of another AR antagonist, L-39, provided support for the hypothesis that ß-catenin contributed to AR stimulated growth. L-39 and a series of related steroidal drugs were developed as 17{alpha}-hydroxylase/C17,20 lyase antagonists but were also found to function as direct AR antagonists and to inhibit LNCaP cell growth in vitro and in vivo (58, 59). Nonetheless, the transcriptional activity of the LNCaP encoded T877A mutant AR was strongly stimulated by L-39. This report showed that L-39, similarly to CPA, failed to stimulate the T877A AR N-C terminal interaction or ß-catenin recruitment.

To further assess the biological significance of AR coactivation by ß-catenin, we examined the W741C mutant AR. The W741C mutation was identified in LNCaP cells that were selected for growth in bicalutamide-containing medium (60). The demonstration that bicalutamide could stimulate transactivation by the W741C/T877A double mutant AR (as well as the single W741C mutant) supported the biological significance of the mutation. The significance of this mutation was also suggested by its recent identification in a relapsed androgen-independent prostate cancer obtained from a patient who was treated with bicalutamide (61). Importantly, the bicalutamide-liganded W741C mutant AR was coactivated by ß-catenin, providing further support for the hypothesis that ß-catenin recruitment plays a role in AR-stimulated prostate cancer growth.

ß-Catenin has been well characterized as an effector of the Wnt signaling pathway, functioning as a coactivator for the Tcf/Lef family of transcription factors (73). More recently ß-catenin has been found to function as an AR transcriptional coactivator in transient transfections using reporter genes (42, 43, 44, 45, 46, 47, 48) and has been shown by chromatin immunoprecipitation to associate with the AR on the PSA gene (62). Nonetheless, functional studies on endogenous AR-regulated genes demonstrating coactivation by endogenous ß-catenin have not been reported, and one recent study found that ß-catenin siRNA did not repress AR transactivation of a transfected AR-regulated reporter gene (74). This study found that ß-catenin down- regulation by siRNA decreased DHT-stimulated PSA gene expression, whereas PSA expression was augmented by increased ß-catenin, indicating that ßcatenin can function in vivo as an AR coactivator.

A central role for ß-catenin stabilization in colon cancer is well established, but the functions of ßcatenin in normal and neoplastic prostate are uncertain. Transgenic overexpression of a stable mutant ß-catenin in mouse prostate results in neoplasia, but such mutations in ß-catenin or in other proteins that directly stimulate ß-catenin degradation appear to be uncommon in prostate cancer (75, 76, 77). Nonetheless, ß-catenin levels in prostate cancer may be increased by PTEN loss, with subsequent activation of Akt and inactivation of glycogen synthetase kinase 3ß (78, 79). Immunohistochemical data indicate that levels of cytoplasmic and nuclear ß-catenin are increased in a subset of more advanced prostate cancers, and are also increased in the proliferating prostate epithelium of castrated rodents after androgen replacement, supporting a role for ß-catenin in androgen-stimulated growth (46, 80).

Transient transfection studies have shown that the DHT-liganded AR can inhibit Tcf4 transcriptional activity, an effect that may be due to AR sequestration of limiting nuclear ß-catenin, suggesting that the ßcatenin-AR interaction may suppress prostate cancer cell growth by inhibiting Wnt/ß-catenin activation of Tcf4 (44, 45, 47, 48). However, it has not been clear whether this inhibition of ß-catenin/Tcf4 is a physiological function of endogenous AR in prostate cancer cells. Moreover, we previously demonstrated a direct interaction between AR and Tcf4 and showed AR recruitment to a Tcf4 binding site in the c-myc promoter, suggesting that the DHT dependent interaction with ß-catenin may mediate AR recruitment and coactivation of ß-catenin/Tcf4-regulated genes (57). This study found that DHT (but not CPA) caused a rapid and marked decrease in endogenous c-myc gene expression in LNCaP and LAPC-4 prostate cancer cell lines. The lack of an effect with CPA supports the conclusion derived from transient transfection studies that the mechanism of this repression is ß-catenin sequestration, although a more direct corepressor function for AR cannot be excluded. Overall, these correlative and functional studies support the biological significance of the AR-ß-catenin interaction, but additional studies are clearly needed to further determine how ß-catenin contributes to AR-regulated growth in normal prostate and prostate cancer.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids and Reagents
Expression vectors encoding the wild-type AR (pSVARo, referred to here as pSVARWT), T877A mutant AR (pSVART877A), SRC-1, and ß-catenin have been described (57, 81, 82). pSVARW741C (codon 741 tryptophan to cysteine) was derived from pSVARWT by site directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Stratagene, La Jolla, CA). Gal4DBD-ARLBDWT encodes the Gal4 DBD fused to the AR LBD (amino acids 660–919) in the pBIND vector (Promega, Madison, WI) (83). Gal4DBD-ARLBDT877A was derived from Gal4DBD-ARLBDWT by site directed mutagenesis. VP16-AR has the VP16 transactivation domain fused to the full length human AR in the pACT vector (Promega) (83). VP16-NCoRc encodes the C-terminal receptor interacting domains of NCoR (amino acids 1806–2454) fused to the VP16 transactivation domain in the AASVVP16 vector (referred to previously as VP16-NCoRId) (39, 84). Gal4DBD-NCoRc has the Gal4DBD fused to the NCoR C terminus (amino acids 1806–2454) in the pBIND vector (Promega). ARE4-luciferase has four tandem AREs cloned into pGL3 (Promega) (83). pG5-luciferase (Promega) is regulated by five tandem Gal4 binding sites, and pLR-CMV (Promega) is a cytomegalovirus (CMV) promoter-regulated Renilla control.

DHT, CPA, and RU486 were from Sigma (St. Louis, MO). Hydroxyflutamide was from Shering-Plough (Kenilworth, NJ) and bicalutamide was from Astra-Zeneca (Wilmington, DE). L-39, VN-85, and VN-87 (G20,000, G20,001, and G20,002, respectively) were provided by Genta Inc. (Berkeley Heights, NJ) (58, 59). Mouse monoclonal anti-ß-catenin antibody was from BD Biosciences Transduction Laboratories (Lexington, KY).

Cell Lines
CV1 cells with an integrated MMTV-Luciferase reporter gene have been described (50). LNCaP cells containing the reverse tetracycline transactivator were very kindly provided by Dr. S. Logan (New York University School of Medicine, New York, NY) (85). These cells were transfected with a truncated (deletion of amino acids 1–89) human ß-catenin expression vector in the bidirection tetracycline operon-regulated vector pBI-EGFP (CLONTECH Laboratories, Palo Alto, CA), or with control empty pBI-EGFP, and stable lines were established. Expression was induced with 1 µg/ml doxycycline for 24 h. A ß-catenin siRNA expression vector in the pTER plasmid (ß-catenin-pTER) was kindly provided by Dr. H. Clevers (University Medical Center, Utrecht, The Netherlands), and stable cell lines containing ß-catenin-pTER or pTER were generated. Free ß-catenin (non-membrane associated) was assessed by extraction with 1% digitonin in Tris-buffered saline.

Transfections and Reporter Gene Assays
CV1 cells were plated in DMEM containing 10% CDS-FBS (steroid hormone depleted) (Hyclone, Logan, UT) at 5 x 105 cells/well in 24-well plates (0.5 ml/well). Cells were transfected the following day with the indicated amounts of plasmids using 1.5 µl of Lipofectamine 2000 in a final 0.1 ml Opti-MEM (Invitrogen Life Technologies, Carlsbad, CA). After 24 h, the medium was changed to fresh DMEM/10% CDS-FBS and hormones or drugs were added at the indicated final concentrations. Firefly and Renilla luciferase activities were determined after another 24 h using the Dual Luciferase Kit (Promega). Data are representative experiments and expressed as relative light units (RLU, firefly luciferase divided by Renilla luciferase) and represent the mean and SD from triplicate or quadruplicate samples.

Cell Cycle Analysis
LNCaP or LAPC-4 cells in RPMI-1640 with 10% FBS were grown to approximately 50% confluence. They were then treated for 24 h with DHT, CPA, or vehicle, trypsinized, fixed in ethanol, washed and resuspended in PBS with ribonuclease and propidium iodide (PI), and analyzed by flow cytometry, as described (86).

Real-Time Quantitative RT-PCR
LNCaP or LAPC-4 cells in RPMI-1640 with 10% FBS and supplemented with 10 nM DHT were grown in six-well plates to 60–70% confluence. The media were then changed to RPMI-1640/10% CDS-FBS for 2–3 d, followed by the addition of hormones for the indicated times. RNA was then extracted with TRIzol (Invitrogen Life Technologies) and real-time quantitative RT-PCR was carried out on an ABI Prism 7700 Sequence Detection System using TaqMan Gold RT-PCR reagents (PE Applied Biosystems, Foster City, CA). RNA samples (100 ng) were coamplified with primers and TaqMan probes for 18S RNA and PSA. The PSA primers were hPSA-25F (CCTCACAGCTACCCACTGCA) and hPSA-92R (GATGAAACAGGCTGTGCCG). The TaqMan probe was hPSA-46T (CAGGAACAAAAGCGTGATCTTGCTGGG). The c-myc primers were myc-21F (TGAGGAGACACCGCCCA) and myc-90R (AACATCGATTTCTTCCTCATCTTCTT). The probe was myc-39T (CACCAGCAGCGACTCTGAGGAGGAA).


    ACKNOWLEDGMENTS
 
We thank A. Brinkmann (Erasmus University, Rotterdam, The Netherlands), M. Lu (Brigham and Women’s Hospital, Boston, MA), W. Chin (Eli Lilly, Indianapolis, IN), S. Logan (New York University School of Medicine, New York, NY), and H. Clevers (University Medical Center, Utrecht, The Netherlands) for reagents, and E. Gelmann (Lombardi Cancer Center, Washington, D.C.) for sharing data before publication.


    FOOTNOTES
 
This work was supported by grants from the National Institutes of Health (to S.P.B and A.N.H.), the Dana-Farber/Harvard Cancer Center Prostate Cancer SPORE, and the Hershey Family Prostate Cancer Research Fund.

Abbreviations: AR, Androgen receptor; ARE, androgen-responsive element; CDS, charcoal dextran-stripped; CMV, cytomegalovirus; CPA, cyproterone acetate; DHT, dihydrotestosterone; DBD, DNA binding domain; FBS, fetal bovine serum; GR, glucocorticoid receptor; HF, hydroxyflutamide; LBD, ligand binding domain; MMTV, mouse mammary tumor virus; NCoR, nuclear receptor corepressor; NR, nuclear receptor; PI, propidium iodide; PR, progesterone receptor; RLU, relative light unit; siRNA, short interfering RNA; SRC-1, steroid receptor coactivator-1; Tcf, T-cell factor.

Received for publication November 11, 2003. Accepted for publication July 7, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Quigley CA, De Bellis A, Marschke KB, el Awady MK, Wilson EM, French FS 1995 Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr Rev [Erratum (1995) 16:546] 16:271–321
  2. Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA, Trapman J 1999 Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 69:307–313[CrossRef][Medline]
  3. Belandia B, Parker MG 2003 Nuclear receptors: a rendezvous for chromatin remodeling factors. Cell 114:277–280[CrossRef][Medline]
  4. Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 387:733–736[CrossRef][Medline]
  5. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  6. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  7. Nolte RT, Wisely GB, Westin S, Cobb JE, Lambert MH, Kurokawa R, Rosenfeld MG, Willson TM, Glass CK, Milburn MV 1998 Ligand binding and co-activator assembly of the peroxisome proliferator-activated receptor-{gamma}. Nature 395:137–143[CrossRef][Medline]
  8. Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D, Gronemeyer H 1996 A canonical structure for the ligand-binding domain of nuclear receptors. Nat Struct Biol 3:87–94[CrossRef][Medline]
  9. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  10. Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675[Medline]
  11. Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952[Abstract/Free Full Text]
  12. Xu J, Li Q 2003 Review of the in vivo functions of the p160 steroid receptor coactivator family. Mol Endocrinol 17:1681–1692[Abstract/Free Full Text]
  13. Simental JA, Sar M, Lane MV, French FS, Wilson EM 1991 Transcriptional activation and nuclear targeting signals of the human androgen receptor. J Biol Chem 266:510–518[Abstract/Free Full Text]
  14. Jenster G, van der Korput HA, van Vroonhoven C, van der Kwast TH, Trapman J, Brinkmann AO 1991 Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 5:1396–1404[Abstract]
  15. Berrevoets CA, Doesburg P, Steketee K, Trapman J, Brinkmann AO 1998 Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor 2). Mol Endocrinol 12:1172–1183[Abstract/Free Full Text]
  16. Ding XF, Anderson CM, Ma H, Hong H, Uht RM, Kushner PJ, Stallcup MR 1998 Nuclear receptor-binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities. Mol Endocrinol 12:302–313[Abstract/Free Full Text]
  17. Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B 1999 The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription. Mol Cell Biol 19:6085–6097[Abstract/Free Full Text]
  18. He B, Kemppainen JA, Wilson EM 2000 FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. J Biol Chem 275:22986–22994[Abstract/Free Full Text]
  19. Langley E, Zhou ZX, Wilson EM 1995 Evidence for an anti-parallel orientation of the ligand-activated human androgen receptor dimer. J Biol Chem 270:29983–29990[Abstract/Free Full Text]
  20. Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, Brinkmann AO, Trapman J 1997 Functional in vivo interaction between the amino-terminal, transactivation domain and the ligand binding domain of the androgen receptor. Biochemistry 36:1052–1064[CrossRef][Medline]
  21. He B, Kemppainen JA, Voegel JJ, Gronemeyer H, Wilson EM 1999 Activation function 2 in the human androgen receptor ligand binding domain mediates interdomain communication with the NH(2)-terminal domain. J Biol Chem 274:37219–37225[Abstract/Free Full Text]
  22. Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  23. Kemppainen JA, Langley E, Wong CI, Bobseine K, Kelce WR, Wilson EM 1999 Distinguishing androgen receptor agonists and antagonists: distinct mechanisms of activation by medroxyprogesterone acetate and dihydrotestosterone. Mol Endocrinol 13:440–454[Abstract/Free Full Text]
  24. Chang CY, McDonnell DP 2002 Evaluation of ligand-dependent changes in AR structure using peptide probes. Mol Endocrinol 16:647–660[Abstract/Free Full Text]
  25. Gelmann EP 2002 Molecular biology of the androgen receptor. J Clin Oncol 20:3001–3015[Abstract/Free Full Text]
  26. Berrevoets CA, Umar A, Brinkmann AO 2002 Antiandrogens: selective androgen receptor modulators. Mol Cell Endocrinol 198:97–103[CrossRef][Medline]
  27. Kuil CW, Berrevoets CA, Mulder E 1995 Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization. Studies on the mechanism of antiandrogen action. J Biol Chem 270:27569–27576[Abstract/Free Full Text]
  28. Wong C, Kelce WR, Sar M, Wilson EM 1995 Androgen receptor antagonist versus agonist activities of the fungicide vinclozolin relative to hydroxyflutamide. J Biol Chem 270:19998–20003[Abstract/Free Full Text]
  29. Fenton MA, Shuster TD, Fertig AM, Taplin ME, Kolvenbag G, Bubley GJ, Balk SP 1997 Functional characterization of mutant androgen receptors from androgen- independent prostate cancer. Clin Cancer Res 3:1383–1388[Abstract]
  30. Wilding G, Chen M, Gelmann EP 1989 Aberrant response in vitro of hormone-responsive prostate cancer cells to antiandrogens. Prostate 14:103–115[Medline]
  31. Veldscholte J, Ris-Stalpers C, Kuiper GG, Jenster G, Berrevoets C, Claassen E, van Rooij HC, Trapman J, Brinkmann AO, Mulder E 1990 A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun 173:534–540[CrossRef][Medline]
  32. Taplin ME, Bubley GJ, Ko YJ, Small EJ, Upton M, Rajeshkumar B, Balk SP 1999 Selection for androgen receptor mutations in prostate cancers treated with androgen antagonist. Cancer Res 59:2511–2515[Abstract/Free Full Text]
  33. Poyet P, Labrie F 1985 Comparison of the antiandrogenic/androgenic activities of flutamide, cyproterone acetate and megestrol acetate. Mol Cell Endocrinol 42:283–288[CrossRef][Medline]
  34. Kemppainen JA, Lane MV, Sar M, Wilson EM 1992 Androgen receptor phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J Biol Chem 267:968–974[Abstract/Free Full Text]
  35. Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz KB 1997 The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol 11:693–705[Abstract/Free Full Text]
  36. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  37. Zhang X, Jeyakumar M, Petukhov S, Bagchi MK 1998 A nuclear receptor corepressor modulates transcriptional activity of antagonist-occupied steroid hormone receptor. Mol Endocrinol 12:513–524[Abstract/Free Full Text]
  38. Hu X, Lazar MA 1999 The CoRNR motif controls the recruitment of corepressors by nuclear hormone receptors. Nature 402:93–96[CrossRef][Medline]
  39. Cheng S, Brzostek S, Lee SR, Hollenberg AN, Balk SP 2002 Inhibition of the dihydrotestosterone-activated androgen receptor by nuclear receptor corepressor. Mol Endocrinol 16:1492–1501[Abstract/Free Full Text]
  40. Dotzlaw H, Moehren U, Mink S, Cato AC, Iniguez Lluhi JA, Baniahmad A 2002 The amino terminus of the human AR is target for corepressor action and antihormone agonism. Mol Endocrinol 16:661–673[Abstract/Free Full Text]
  41. Liao G, Chen LY, Zhang A, Godavarthy A, Xia F, Ghosh JC, Li H, Chen JD 2003 Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem 278:5052–5061[Abstract/Free Full Text]
  42. Truica CI, Byers S, Gelmann EP 2000 ß-Catenin affects androgen receptor transcriptional activity and ligand specificity. Cancer Res 60:4709–4713[Abstract/Free Full Text]
  43. Yang F, Li X, Sharma M, Sasaki CY, Longo DL, Lim B, Sun Z 2002 Linking ß-catenin to androgen-signaling pathway. J Biol Chem 277:11336–11344[Abstract/Free Full Text]
  44. Mulholland DJ, Cheng H, Reid K, Rennie PS, Nelson CC 2002 The androgen receptor can promote ß-catenin nuclear translocation independently of adenomatous polyposis coli. J Biol Chem 277:17933–17943[Abstract/Free Full Text]
  45. Pawlowski JE, Ertel JR, Allen MP, Xu M, Butler C, Wilson EM, Wierman ME 2002 Liganded androgen receptor interaction with ß-catenin: nuclear co-localization and modulation of transcriptional activity in neuronal cells. J Biol Chem 277:20702–20710[Abstract/Free Full Text]
  46. Chesire DR, Ewing CM, Gage WR, Isaacs WB 2002 In vitro evidence for complex modes of nuclear ß-catenin signaling during prostate growth and tumorigenesis. Oncogene 21:2679–2694[CrossRef][Medline]
  47. Chesire DR, Isaacs WB 2002 Ligand-dependent inhibition of ß-catenin/TCF signaling by androgen receptor. Oncogene 21:8453–8469[CrossRef][Medline]
  48. Song LN, Herrell R, Byers S, Shah S, Wilson EM, Gelmann EP 2003 ß-Catenin binds to the activation function 2 region of the androgen receptor and modulates the effects of the N-terminal domain and TIF2 on ligand-dependent transcription. Mol Cell Biol 23:1674–1687[Abstract/Free Full Text]
  49. List HJ, Smith CL, Martinez E, Harris VK, Danielsen M, Riegel AT 2000 Effects of antiandrogens on chromatin remodeling and transcription of the integrated mouse mammary tumor virus promoter. Exp Cell Res 260:160–165[CrossRef][Medline]
  50. Lee SR, Ramos SM, Ko A, Masiello D, Swanson KD, Lu ML, Balk SP 2002 AR and ER interaction with a p21-activated kinase (PAK6). Mol Endocrinol 16:85–99[Abstract/Free Full Text]
  51. Veldscholte J, Berrevoets CA, Ris-Stalpers C, Kuiper GG, Jenster G, Trapman J, Brinkmann AO, Mulder E 1992 The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol 41:665–669[CrossRef][Medline]
  52. Berns EM, de Boer W, Mulder E 1986 Androgen-dependent growth regulation of and release of specific protein(s) by the androgen receptor containing human prostate tumor cell line LNCaP. Prostate 9:247–259[Medline]
  53. Warriar N, Page N, Koutsilieris M, Govindan MV 1994 Antiandrogens inhibit human androgen receptor-dependent gene transcription activation in the human prostate cancer cells LNCaP. Prostate 24:176–186[Medline]
  54. Wagner BL, Norris JD, Knotts TA, Weigel NL, McDonnell DP 1998 The nuclear corepressors NCoR and SMRT are key regulators of both ligand- and 8-bromo-cyclic AMP-dependent transcriptional activity of the human progesterone receptor. Mol Cell Biol 18:1369–1378[Abstract/Free Full Text]
  55. Liu Z, Auboeuf D, Wong J, Chen JD, Tsai SY, Tsai MJ, O’Malley BW 2002 Coactivator/corepressor ratios modulate PR-mediated transcription by the selective receptor modulator RU486. Proc Natl Acad Sci USA 99:7940–7944[Abstract/Free Full Text]
  56. Schulz M, Eggert M, Baniahmad A, Dostert A, Heinzel T, Renkawitz R 2002 RU486-induced glucocorticoid receptor agonism is controlled by the receptor N terminus and by corepressor binding. J Biol Chem 277:26238–26243[Abstract/Free Full Text]
  57. Amir AL, Barua M, McKnight NC, Cheng S, Yuan X, Balk SP 2003 A direct ß-catenin-independent interaction between androgen receptor and T cell factor 4. J Biol Chem 278:30828–30834[Abstract/Free Full Text]
  58. Grigoryev DN, Long BJ, Nnane IP, Njar VC, Liu Y, Brodie AM 1999 Effects of new 17{alpha}-hydroxylase/C(17,20)-lyase inhibitors on LNCaP prostate cancer cell growth in vitro and in vivo. Br J Cancer 81:622–630[CrossRef][Medline]
  59. Long BJ, Grigoryev DN, Nnane IP, Liu Y, Ling YZ, Brodie AM 2000 Antiandrogenic effects of novel androgen synthesis inhibitors on hormone-dependent prostate cancer. Cancer Res 60:6630–6640[Abstract/Free Full Text]
  60. Hara T, Miyazaki J, Araki H, Yamaoka M, Kanzaki N, Kusaka M, Miyamoto M 2003 Novel mutations of androgen receptor: a possible mechanism of bicalutamide withdrawal syndrome. Cancer Res 63:149–153[Abstract/Free Full Text]
  61. Taplin ME, Rajeshkumar B, Halabi S, Werner CP, Woda BA, Picus J, Stadler W, Hayes DF, Kantoff PW, Vogelzang NJ, Small EJ 2003 Androgen receptor mutations in androgen-independent prostate cancer: Cancer and Leukemia Group B Study 9663. J Clin Oncol 21:2673–2678[Abstract/Free Full Text]
  62. Li H, Kim JH, Koh SS, Stallcup MR 2004 Synergistic effects of coactivators GRIP1 and ß-catenin on gene activation: cross-talk between androgen receptor and Wnt signaling pathways. J Biol Chem 279:4212–4220[Abstract/Free Full Text]
  63. Mulholland DJ, Read JT, Rennie PS, Cox ME, Nelson CC 2003 Functional localization and competition between the androgen receptor and T-cell factor for nuclear ß-catenin: a means for inhibition of the Tcf signaling axis. Oncogene 22:5602–5613[CrossRef][Medline]
  64. Dotzlaw H, Papaioannou M, Moehren U, Claessens F, Baniahmad A 2003 Agonist-antagonist induced coactivator and corepressor interplay on the human androgen receptor. Mol Cell Endocrinol 213:79–85[CrossRef][Medline]
  65. Song LN, Coghlan M, Gelmann EP 2004 Antiandrogen effects of mifepristone on coactivator and corepressor interactions with the androgen receptor. Mol Endocrinol 18:70–85[Abstract/Free Full Text]
  66. Berrevoets CA, Umar A, Trapman J, Brinkmann AO 2004 Differential modulation of androgen receptor transcriptional activity by the nuclear receptor corepressor (N-CoR). Biochem J 379(Pt 3):731–738
  67. Benhamou B, Garcia T, Lerouge T, Vergezac A, Gofflo D, Bigogne C, Chambon P, Gronemeyer H 1992 A single amino acid that determines the sensitivity of progesterone receptors to RU486. Science 255:206–209[Abstract/Free Full Text]
  68. Garcia T, Benhamou B, Gofflo D, Vergezac A, Philibert D, Chambon P, Gronemeyer H 1992 Switching agonistic, antagonistic, and mixed transcriptional responses to 11 ß-substituted progestins by mutation of the progesterone receptor. Mol Endocrinol 6:2071–2078[Abstract]
  69. Cadepond F, Ulmann A, Baulieu EE 1997 RU486 (mifepristone): mechanisms of action and clinical uses. Annu Rev Med 48:129–156[CrossRef][Medline]
  70. Honer C, Nam K, Fink C, Marshall P, Ksander G, Chatelain RE, Cornell W, Steele R, Schweitzer R, Schumacher C 2003 Glucocorticoid receptor antagonism by cyproterone acetate and RU486. Mol Pharmacol 63:1012–1020[Abstract/Free Full Text]
  71. Shiau AK, Barstad D, Radek JT, Meyers MJ, Nettles K