Molecular Endocrinology, doi:10.1210/me.2004-0117
Molecular Endocrinology 18 (10): 2409-2423
Copyright © 2004 by The Endocrine Society
Regulation of Androgen Receptor Signaling by PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) Tumor Suppressor through Distinct Mechanisms in Prostate Cancer Cells
Hui-Kuan Lin,
Yueh-Chiang Hu,
Dong Kun Lee and
Chawnshang Chang
George Whipple Laboratory for Cancer Research, Departments of Urology, Pathology, Radiation Oncology, and The Cancer Center, University of Rochester, Rochester, New York 14642
Address all correspondence and requests for reprints to: Chawnshang Chang, Ph.D., Department of Pathology, University of Rochester Medical Center, 601 Elmwood Avenue, Box 626, Rochester, New York 14642. E-mail: chang{at}urmc.rochester.edu.
 |
ABSTRACT
|
|---|
Defects in the PTEN (phosphatase and tensin homolog deleted on chromosome 10) tumor suppressor gene have been found in many human cancers including breast and prostate. Here we show that PTEN suppresses androgen receptor (AR) activity via a phosphatidylinositol-3-OH kinase/Akt-independent pathway in the early passage numbers prostate cancer LNCaP cells. We provide the direct links between PTEN and androgen/AR signaling by demonstrating that AR directly interacts with PTEN. The interaction between PTEN and AR inhibits the AR nuclear translocation and promotes the AR protein degradation that result in the suppression of AR transactivation and induction of apoptosis. The minimum interaction peptide within AR (amino acids 483651) disrupts the interaction of PTEN with AR and reduces the PTEN effect on AR transactivation and apoptosis. Genetic approaches using PTEN-null mouse embryonic fibroblasts (MEFs) further demonstrate that both AR expression and AR activity were much higher in PTEN-null MEFs than wild-type MEFs, and reintroducing PTEN into PTEN-null MEFs dramatically reduced AR protein levels and AR activity. Interestingly, we also found that PTEN could suppress AR activity via the phosphatidylinositol-3-OH kinase/Akt-dependent pathway in the higher passage number LNCaP cells, because restoration of Akt activity blocks the effect of PTEN on AR activity. Together, these contrasting PTEN effects on AR activity in the same prostate cancer cell line with different passage numbers suggest that PTEN, via distinct mechanisms, differentially regulates AR in various stages of prostate cancers.
 |
INTRODUCTION
|
|---|
THE ANDROGEN RECEPTOR (AR), a transcription factor, belongs to the nuclear receptor superfamily (1, 2). Once bound to androgen, AR translocates into the nucleus, leading to activation of its target genes (3). AR consists of the amino-terminal region that is involved in transcriptional activation, the DNA-binding domain (DBD), the hinge region that contains the nuclear localization signal, and the ligand-binding domain (LBD) that is involved in androgen binding and receptor dimerization (3). It is generally accepted that AR plays an important role in the development of the reproductive organs and in progression of prostate cancer (3, 4, 5). Maximal or proper androgen action may require the interaction of AR with several coregulators (6), such as ARA70 (7, 8), ARA55 (9, 10), ARA54 (11, 12), and steroid receptor coactivator-1 (13).
The tumor suppressor gene PTEN (phosphatase and tensin homolog deleted on chromosome 10), located at chromosome 10q23, is one of the most frequently mutated genes linked to a variety of human cancers (14, 15, 16, 17, 18, 19, 20). Germline mutations in PTEN cause the autosomal dominant inherited cancer syndromes such as Cowdens disease, which is associated with an elevated risk for malignant cancers (21). Loss of PTEN expression is frequently found in prostate cancer cell lines and tumor specimens (22). Mice with a heterozygous mutant PTEN develop prostate epithelial hyperplasia and dysplasia (23). Mice with inactivation of one allele of PTEN in combination with loss of the cyclin-dependent kinase (CDK)n1b (encoding p27Kip1) gene have an acceleration of spontaneous neoplastic transformation and develop prostate carcinoma (24). Interestingly, mice deficient in CDKn1b do not develop prostate cancer (25, 26, 27), suggesting that PTEN and p27Kip1 cooperate in prostate cancer suppression in the mouse. These results indicate that loss of PTEN function may be a key event in prostate cancer progression.
Recent studies demonstrated that PTEN regulates not only cell growth and apoptosis, but also controls cell adhesion and migration (28, 29, 30). Whereas the PTEN sequence suggests that it may be a dual specificity phosphatase that includes lipid phosphatase and protein phosphatase activity, its protein substrates remain largely unknown. Recently, several groups have reported that the phosphatidylinositol-3-OH kinase (PI3K)/Akt pathway is negatively regulated by PTEN through its phospholipid 3-phosphatase activity (16, 17, 31, 32, 33). Whereas the PI3K/Akt-dependent pathway is the most popular model for PTEN action, other signaling pathways were also suggested (34). For instance, dPTEN regulates cell growth and proliferation in Drosophila through the PI3K/Akt-dependent and -independent pathway (34). Furthermore, using mouse embryonic fibroblasts (MEFs) from PTEN-null mice, Wu and co-workers (35). showed that PTEN can physically interact with p53 and regulate protein stability and transcriptional activity without its phosphatase activity, indicating that PTEN regulates p53 function independent of the PI3K/Akt pathway. As a consequence, loss of one allele of PTEN dramatically accelerates tumor formation of the p53 heterozygous mouse.
As androgen/AR plays important roles in prostate cancer progression, understanding the factors involved in the regulation of androgen/AR action may provide molecular targets for prostate cancer treatment. Here we demonstrate that PTEN regulates AR activity in low-passage number LNCaP cells via a PI3K/Akt-independent pathway and interacts directly with AR to suppress androgen-induced AR nuclear translocation. The interaction between AR and PTEN may expose the active site of the AR for the recognition of caspase-3, leading to AR degradation. In contrast, PTEN regulates AR activity in high passage number LNCaP cells via a PI3K/Akt-dependent pathway.
 |
RESULTS
|
|---|
PTEN Suppresses AR Transactivation Involving the Pathways Other Than PI3K/Akt
The PTEN tumor suppressor induces cell apoptosis in a variety of cell types including prostate cancer cells. However, the molecular mechanism underlying PTEN-induced apoptosis in prostate cancer cells remains unclear. We were interested in testing the potential linkage between PTEN and androgen/AR signaling. To test this hypothesis, we determined the effect of the PTEN on AR transactivation using mouse mammary tumor virus-luciferase (MMTV-luc) as an AR reporter. PTEN suppressed AR transactivation in a dose- dependent manner in androgen-dependent prostate LNCaP cells and in androgen-independent prostate cancer PC-3 cells and DU145 cells (Fig. 1A
). Interestingly, PTEN C124S, a PTEN mutant without phosphatase activity, still can suppress AR activity in DU145, PC-3, and LNCaP cells, but to a lesser extent (Fig. 1A
). To rule out the possibility that the suppression of AR by PTEN might come from the suppressive effect of PTEN on general transcriptional machinery, we used pGL3-control vector (Promega Corp., Madison, WI) and pG5-Lucifase (a GAL4 reporter) as controls to demonstrate that PTEN has little or enhanced effect on these control luciferase vectors after being normalized with pRL-SV40 internal control used in all samples (Fig. 1B
). Northern blot analysis further confirmed that PTEN could suppress androgen-induced expression of prostate-specific antigen, an endogenous AR target gene, in prostate cancer LNCaP cells (Fig. 1C
).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1. PTEN Suppresses AR Transactivation Involving Pathways Other than PI3K/Akt
A, The LNCaP, PC-3, or DU145 cells were transfected with plasmids, as indicated, in 10% CDS media for 16 h and treated with ethanol (ETOH) or 10 nM DHT for another 16 h. The cells were harvested and assayed for luciferase activity using MMTV-luc as a reporter. B, LNCaP cells were transfected with plasmids, as indicated, in 10% FCS media for 32 h. pGL3-basic was used as control vector (lane 1). The cells were harvested and assayed for luciferase activity. C, LNCaP cells were transfected with plasmids, as indicated, in 10% CDS media for 24 h and then treated with DHT for 24 h. The cells were harvested for Northern blot analysis. D, Akt activity is higher in high-passage number of LNCAP cells. Different passages (passage 38 vs. 65) of LNCaP cells were cultured in 10% FCS media and harvested for Western blot analysis. E, LNCaP cells (passage 25) or LNCaP cells (passage 60) were transfected with MMTV-luc along with plasmids, as indicated, for 16 h, and cells were then treated with ETOH or 10 nM DHT in the presence or absence of LY294002 for 16 h. The results were normalized by pRL-SV40 activity and the data are represented as means ± SD of three independent experiments. [*, P < 0.05; **, P < 0.001 vs. control (indicated as ), Students two-tailed t test].
|
|
It is generally believed that PTEN exerts its role in tumor suppression by negatively regulating the PI3K/Akt pathway. We next determined whether PTEN affects AR activity via the regulation of the PI3K/Akt pathway in different passage numbers of LNCaP cells. The protein expression levels of AR and Akt are comparable between the low and high passages of LNCaP cells, but the basal Akt activity in high passage number LNCaP was much higher than in low passage number LNCaP cells (Fig. 1D
). Interestingly, in a low passage number of LNCaP cells (passage 25), PTEN suppresses AR activity via a PI3K/Akt-independent pathway, as addition of the constitutively active form of Akt (cAkt) does not reverse the suppressive effect of PTEN on AR activity (Fig. 1E
, left panel, lane 4). Interestingly, cAkt, like PTEN, also suppressed AR activity in low passage number LNCaP cells (Fig. 1E
, left panel, lane 5). PI3K/Akt inhibitor, LY294002, did not significantly enhance AR activity (Fig. 1E
, left panel, lane 6) perhaps due to a low basal activity of Akt in such cells (Fig. 1D
). However, restoration of Akt activity completely reversed the PTEN suppression of AR activity in high passage number LNCaP cells (Fig. 1E
, right panel, lane 3), suggesting that PTEN can also regulate AR signaling via a PI3K/Akt-dependent pathway in LNCaP cells with different passage numbers. Unlike its suppression of AR activity in the lower passage number LNCaP cells, cAkt enhanced AR activity in the high passage number LNCaP cells (Fig. 1E
. right panel, lane 5). Taken together, these contrasting results suggest that PTEN can regulate AR activity via the PI3K/Akt-dependent and -independent pathways in prostate cancer LNCaP cells at different growth stages.
PTEN Interacts with AR in Vitro and in Vivo
Because PTEN regulates AR activity via a PI3K/Akt-independent pathway in the early-passage LNCaP cells, we hypothesized that PTEN might function via direct interaction with AR. Indeed, our glutathione-S-transferase (GST) pull-down assay results indicated that PTEN could interact with AR in the presence or absence of androgen (Fig. 2A
). Among several nuclear receptors we tested, we found that PTEN binds preferentially to AR and estrogen receptor (ER), as compared with glucocorticoid receptor (data not shown), progesterone receptor (data not shown), or the retinoid X receptor (Fig. 2A
).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2. PTEN Interacts with AR in Vitro
A, GST or GST-PTEN incubation with the 35S-labeled AR, ER, or retinoid X receptor (RXR) for 2 h in the presence or absence of the ligand. The bound proteins were analyzed by SDS-PAGE, followed by autoradiography. B, Representative diagram of PTEN deletion mutants. PTP domain, protein tyrosine phosphatase domain; Ty-p, tyrosine phosphorylation domain. C, 35S-labeled AR was incubated with different PTEN deletion mutants. The nearly equivalent aliquots of PTEN deletion mutants used are shown in the right panel. D, Representative diagram of AR deletion mutants. E, GST or GST-PTEN was incubated with different AR deletion mutants.
|
|
To map the AR interaction domains on PTEN, the plasmids encoding a set of PTEN fragments fused with GST were constructed for the GST pull-down assays. The AR was able to interact with GST-PTEN-no. 2 [amino acids (aa) 107252], where the phosphatase domain is located, but not with GST-PTEN-no. 1 (aa 1107) or GST-PTEN-no. 3 (aa 253403) (Fig. 2
, B and C). Further peptide mapping revealed that PTEN-PTP (aa 110163) containing the phosphatase domain is sufficient for interacting with AR (Fig. 2C
).
Studies of the PTEN-interacting domain on AR indicated that the AR-DBD (aa 486651) and AR-DBD plus LBD (AR-DBD-LBD) (aa 552918), but not the AR amino-terminal region (AR-N) (aa 34560) or AR-LBD (aa 666918), were able to interact with PTEN (Fig. 2
, D and E). The GST pull-down assay results therefore suggest that AR can interact with PTEN (aa 110163) via its DBD (aa 552651).
To further confirm the physiological interaction between AR and PTEN by coimmunoprecipitation, we established PTEN-stable LNCaP cells, using the doxycycline (Dox)-inducible system. Dox treatment induced expression of PTEN or PTEN C124S in several clones (PTEN-C1, PTEN-C2, PTEN C124S-C4, and PTEN C124S-C8, Fig. 3A
). AR could be coimmunoprecipitated with PTEN, when we used cell lysates from PTEN-C1 cells (Fig. 3B
). To rule out the possibility that PTEN antibody may cross-react with AR, we demonstrated that PTEN antibody did not pull down AR, using parental LNCaP cells, which express AR but not PTEN (data not shown). To further prove that endogenous PTEN can interact with the endogenous AR in the prostate cancer cell line, we applied the CWR22R cell line (36, 37), which endogenously expresses both AR and PTEN (Fig. 3C
), for coimmunoprecipitation with PTEN antibody. The results showed that AR could be detected in the PTEN-immunoprecipitated complex (Fig. 3C
). To further determine whether the DBD plus the hinge region of AR (aa 486651, AR-D) can interact with PTEN, we transfected AR-D into CWR22R cells for coimmunoprecipitation with PTEN antibody. We found AR-D could be found in PTEN-immunoprecipitated complex (Fig. 3D
). Interestingly, AR-D could also prevent endogenous PTEN from binding to AR in CWR22R cells (Fig. 3D
). These results suggest that AR can physiologically interact with PTEN through the AR-D region in prostate cancer cells.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3. PTEN Interacts with AR in Vivo
A, The establishment of stable PTEN and PTEN C124S clones in LNCaP cells using Dox-inducible system. The cells were treated with 4 µg/ml Dox for 24 h and harvested for Western blot analysis using PTEN antibody. PTEN and PTEN C124S expression can be induced with Dox treatment in Clone C1 and C2, and C4 and C8, respectively. B, AR exists in the PTEN immunocomplex in LNCaP cells overexpressing PTEN. The stable PTEN clone (PTEN-C1) was treated with or without 4 µg/ml Dox in 10% CDS media for 24 h and treated with ethanol or 10 nM DHT for another 24 h. The cells were harvested for immunoprecipitation (IP) assay with normal mouse PTEN antibody, followed by Western blotting with AR antibody. The total cell lysates were subjected to Western blotting with PTEN and AR antibodies. C, Endogenous association between PTEN and AR in CWR22R cells. The IP and Western blot methods used are the same as described in panel B except that the cell lysates were from the CWR22R cells. D, The PTEN-AR interaction is inhibited by AR-D in CWR22R cells. The cells cultured in RPMI medium with 10% FCS were transfected with vector or FLAG-tagged AR-D for 48 h. Cells were then harvested for immunoprecipitation (IP) assay with normal mouse IgG or PTEN antibody, followed by Western blotting with AR or FLAG antibodies. The total cell lysates were subjected to Western blotting with FLAG, PTEN, and AR antibodies.
|
|
PTEN Colocalizes with AR and Inhibits AR Nuclear Translocation
The interaction between PTEN and AR was also analyzed by the subcellular colocalization study, using fluorescence immunostaining. As shown in Fig. 4A
, the fluorescent FITC-stained PTEN was located mainly in the cytosol, but small amounts of PTEN were also found in the nucleus. Similar to the FITC-stained PTEN, Texas Red-stained AR was also located mainly in the cytosol in the absence of androgen, but androgen treatment caused AR nuclear translocation (Fig. 4A
). Figure 4B
further demonstrates that PTEN could colocalize with AR in the presence or absence of androgen. Interestingly, we found that PTEN significantly blocked AR nuclear translocation in response to androgen and increased the AR retention (from 4% to 38%) in the cytosol. In contrast, PTEN C124S showed only a slight inhibition of AR nuclear translocation (Fig. 4C
). Similar results were also obtained in LNCaP cells with stable transfection of PTEN (passage 40). As shown in Fig. 4D
, Dox-induced PTEN expression in the PTEN-stable PTEN-C2 cells could inhibit the AR nuclear translocation. In contrast, Dox showed little effect on the AR nuclear translocation in the parental pBIG2i cells. These results suggest that PTEN may be able to bind to AR and prevent the translocation of cytosolic AR into the nucleus, which may then result in suppression of AR transactivation.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 4. PTEN Colocalizes with AR in Vivo and Prevents AR Nuclear Translocation
A, The COS-1 cells were transfected with AR or PTEN in 10% CDS media for 16 h and treated with ethanol or 10 nM DHT for another 16 h. The cells were fixed and stained with AR and PTEN antibodies, followed by examination with confocal microscopy. B, The COS-1 cells were transfected with AR and PTEN and treated with ethanol or 10 nM DHT for another 16 h. The cells were fixed and stained with AR and PTEN antibodies, followed by examination with confocal microscopy. The green and red colors represent PTEN and AR staining, respectively, and the yellow color represents PTEN and AR colocalization. C, COS-1 cells were transfected with pSG5-AR along with pCDNA3, pCDNA3 PTEN, or PTEN C124S and treated with ethanol or DHT in 10% CDS media for 16 h. The arrows indicate PTEN-positive cells, which show AR located in the cytosol. At least 150 cells were scored for each sample, and data are means ± SD from three independent experiments. D, The pBIG2i or PTEN-C2 LNCaP cells were treated with 4 µg/ml Dox for 24 h, followed by 10 nM DHT for another 16 h. The cells were fixed for immunostaining. E, The COS-1 cells were transfected with AR in combination with plasmids, as indicated on the right for 16 h, followed by 10 nM DHT treatment for another 16 h. The cells were fixed for immunostaining.
|
|
PTEN Decreases AR Protein Levels via Promotion of AR Degradation
To determine whether PTEN suppression of AR transactivation involves the modulation of AR protein stability, we assessed the transient transfection and Western blot analyses. We found that PTEN could reduce AR protein levels in COS-1 cells (Fig. 5A
). To rule out the possibility that PTEN may influence the promoter activity of the AR expression plasmid, we tested the expression of endogenous AR in PTEN-stable LNCaP cells. As shown in Fig. 5B
, Dox-induced expression of PTEN in LNCaP PTEN-C1 and PTEN-C2 reduced endogenous AR protein levels. In contrast, Dox-induced PTEN C124S expression in PTEN-C124S-C4 and PTEN-C124S-C8 failed to reduce endogenous AR protein levels. Together, our data clearly demonstrate that PTEN could interact with AR and reduce AR protein levels in COS-1 and LNCaP cells. To determine whether the reduced AR protein levels were due to reduced mRNA expression, a portion of each LNCaP cell lysate was subjected to Northern blot analysis. Whereas AR protein levels were reduced by Dox-induced PTEN, the AR mRNA levels normalized by ß-actin remained relatively unchanged (data not shown), suggesting that PTEN may reduce the AR protein levels through posttranscriptional modification.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5. PTEN Decreases AR Protein Levels via Promotion of AR Degradation
A, COS-1 cells were transfected with AR with a flag epitope in front of the AR sequence, along with pCDNA3 or PTEN in 10% CDS media for 16 h, followed by treatment with 10 nM DHT for 24 h. The cells were harvested for Western blot analysis with anti-FLAG antibody. B, Clones of LNCaP cells stably transfected with vector (pBIG2i), PTEN (PTEN-C1 and -C2), or PTEN-C124S (PTEN C124S-C4 and -C8) were treated with 4 µg/ml doxycycline in 10% CDS media for 48 h in the presence of 10 nM DHT. Western blot analysis was performed, and AR and PTEN were detected by AR antibody or PTEN antibody, respectively. C, COS-1 cells were transfected with AR along with pCDNA3 or PTEN in 10% CDS media for 16 h. The cells were then pulsed with [35S]methionine for 45 min in the presence of 10 nM DHT and harvested at different chase times as indicated. The cell extracts were immunoprecipitated with AR antibody and subjected to SDS-PAGE followed by autoradiography. The intensity of the bands was quantitated using ImageQuant (Molecular Dynamics, Inc., Sunnyvale, CA). Data were from three identical results. D, Early-passage LNCaP cells at passage 38 (p38) were transfected with or without PTEN in 10% CDS media for 16 h, pulsed with cyclohexamide (CHX) treatment in the presence of 10 nM DHT, and then harvested at different chase times as indicated. The cell extracts were Western blotted with AR, PTEN, and ß-actin antibodies. E, PTEN-regulated AR degradation is inhibited by Akt in high-passage number LNCaP cells. LNCaP cells at passage 65 (p65) were transfected with plasmids, as indicated, for 24 h, treated with 10 nM DHT for another 24 h, and harvested for Western blot assay. (*, P < 0.05; **, P < 0.001 vs. AR alone, Students two-tailed t test)
|
|
We then studied AR protein stability by pulse chase labeling. As shown in Fig. 5C
, PTEN clearly reduced the half-life of newly synthesized [35S]AR 4- to 5-fold and accelerated AR degradation. Interestingly, when we replaced PTEN with either the dominant negative form of Akt (dAkt) or PI3K inhibitor LY294002, the results (data not shown) indicated that dAkt and LY294002 did not promote AR degradation, ruling out the possibility that PTEN promotes AR degradation via regulation of the PI3K/Akt pathway. In agreement with the phenomenon that PTEN promotes AR degradation via the non-PI3K/Akt pathway, the stability of the endogenous AR in the early-passage LNCaP cells (passage 38), where the PTEN effect on AR is suggested to be independent of the PI3K/Akt pathway (Fig. 1E
), was clearly reduced in the presence of PTEN (Fig. 5D
). These data strongly suggest that other pathways, such as direct PTEN-AR protein-protein interaction, may play major roles for the PTEN-promoted AR degradation. In contrast, in high passage number LNCaP cells (passage 65) where the PI3K/Akt pathway becomes dominant (Fig. 1
, D and E), PTEN-induced AR degradation was suppressed by cAkt (Fig. 5E
), suggesting that the suppressive effect of PTEN on AR involves the Akt pathway and Akt might not promote AR ubiquitylation and degradation in high-passage LNCaP cells.
It has been suggested that PTEN regulates the stability of p27kip1 via a ubiquitin-proteasome pathway (38). Whereas MG132, a proteasome inhibitor, blocked estrogen-mediated ER degradation (see supplemental Fig. 1A
, right panel, published as supplemental data on The Endocrine Societys Journals Online web site at http://mend.endojournals.org), it did not prevent PTEN-mediated AR degradation (see supplemental Fig. 1A
, left panel), suggesting that PTEN promotes AR protein degradation via a proteasome-independent pathway. Interestingly, we found that the caspase-3 inhibitor DEVD-CHO, can block PTEN-mediated AR degradation (see supplemental Fig. 1B
). We demonstrated that caspase-3 could cleave AR into three evident fragments, and DEVD-CHO completely blocked caspase-3-mediated AR degradation (see supplemental Fig. 1B
), consistent with the previous reports (39).
Interaction between PTEN and AR Contributes to PTEN-Induced Suppression of AR Functions and Apoptosis
To further prove that PTEN suppression of AR function may go through direct PTEN-AR interaction, we used AR-D, which can interact with PTEN and disrupt the interaction between AR and PTEN in the CWR22R cells (Fig. 3D
), for functional studies. Our results further showed that AR-D could dramatically reduce PTEN-mediated inhibition of AR nuclear translocation (Fig. 4E
), PTEN-mediated promotion of AR degradation (Fig. 6A
), and PTEN-mediated suppression of AR transactivation (Fig. 6B
), suggesting that PTEN and AR interaction plays important roles for the PTEN effects on AR nuclear translocation, AR protein degradation, and AR transactivation. To extend our studies of PTEN on the suppression of AR function, we applied AR-D to another prostate cancer cell line, CWR22R, which expresses functional AR and PTEN (36, 37). As shown in Fig. 6C
, PTEN dramatically suppressed AR transactivation. Remarkably, AR-D could significantly reduce PTEN suppressive effect on AR transactivation (Fig. 6C
). Furthermore, the PTEN mutant devoid of AR binding region (
aa121200, PTEN-dPTP) failed to suppress AR expression (Fig. 6D
) and transactivation (Fig. 6E
). These results therefore are in agreement with the results from LNCaP cells (Fig. 6B
) and suggest that PTEN may be able to modulate AR functions by direct interaction with AR in the various stages of prostate cancers.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 6. Interaction between PTEN and AR Contributes to PTEN-Mediated Apoptosis and Suppression of AR Functions
A, The LNCaP cells were transfected with indicated plasmids in 10% CDS media for 16 h, followed by treatment with 10 nM DHT for 24 h. Cells were then harvested, and the cell extracts were subjected to Western blotting with anti-AR or anti-Akt antibody. B, The LNCaP cells were transfected with indicated plasmids in 10% CDS media for 16 h, followed by treatment with 10 nM DHT for another 16 h. Cells were harvested and assayed for MMTV-luciferase activity. C, The CWR22R cells were transfected with plasmids, as indicated, using (ARE)4-luc as a reporter for 16 h, followed by ethanol or 10 nM DHT treatment for another 16 h. Cells were harvested for luciferase assay. D, The 293T cells cultured in DMEM containing 10% FCS were transfected with pCDNA3-AR, pCDNA3-FLAG-PTEN, pCDNA3-FLAG-PTEN-dPTP, and/or pEGFP-C1 (BD Biosciences, Franklin Lakes, NJ), as indicated, for 24 h, and harvested. The cell extracts were subjected to SDS-PAGE. Western blot analysis was performed, and AR and PTENs were detected by AR and FLAG antibodies, respectively. Enhanced green fluorescent protein expression was used for transfection and loading control. E, The CWR22R cells were transfected with plasmids, as indicated, using (ARE)4-luc as a reporter for 16 h, followed by ethanol or 10 nM DHT treatment for another 16 h. Cells were harvested for luciferase assay. F, The LNCaP cells were transfected with plasmids, as indicated, for 16 h, and the medium was changed to 0.1% CDS media for 2 d. The cell apoptosis was determined by TUNEL assay. PTEN, but not PTEN-no. 1 (aa 1 107) or mutant PTEN-C124S, induced LNCaP cell apoptosis. Increased AR expression by transfection of AR, interrupting PTEN-AR interaction by AR-D, and overexpressing cAkt could rescue LNCaP cell apoptosis caused by PTEN. Data for luciferase activity and apoptosis are means ± SD from three independent experiments. *, P < 0.05; **, P < 0.001 vs. control (indicated as ), Students two-tailed t test.
|
|
The PTEN tumor suppressor induces cell apoptosis in a variety of cell types including the LNCaP cells. To determine whether suppression of AR activity by PTEN contributes to PTEN-induced apoptosis, we used the TUNEL (terminal deoxynucleotidyltransferase-mediated deoxyuridine triphosphate nick end-labeling) assay to study the effect of AR-D, which could partially relieve suppression of AR transactivation by PTEN (Fig. 6
, B and C), on PTEN-induced apoptosis in LNCaP cells (passage 35). As expected, PTEN could induce apoptosis markedly, whereas PTEN C124S showed only a marginal effect, and AR-D markedly reduced PTEN-induced apoptosis (Fig. 6F
). The suppressive effect of AR-D on PTEN functions was not due to the interference of PTEN phosphatase activity, because AR-D showed little influence on the PTEN-mediated inhibition of Akt activity (data not shown). Together, these data clearly suggest that interaction between PTEN and AR contributes to PTEN-induced suppression of AR functions and apoptosis. Our results (Fig. 6F
) also confirmed an earlier report (39A ) that PTEN-induced cell death could be reversed by adding cAkt, suggesting that the PTEN
PI3K
Akt pathway also plays a role in the mediation of PTEN-induced cell death.
To rule out the possibility that AR-D may have nonspecific effects, we used glioblastoma U87MG cells to test the effects of AR-D on the PTEN-induced apoptosis in AR-negative cells. Both Western blot assay and AR transactivation assay indicated that AR was undetectable in U87MG cells (data not shown). Whereas PTEN induced apoptosis in U87MG cells, the addition of AR-D showed only marginal effects on the PTEN-induced apoptosis, and cAkt suppressed PTEN- induced apoptosis (data not shown). These results suggest that the effect of AR-D on PTEN-induced apoptosis is specific and requires the intact AR signaling. Together, results from Fig. 6
clearly indicate that PTEN may have two distinct pathways (PTEN
PI3K/Akt and PTEN
AR) to induce apoptosis, and the interaction of PTEN with AR may play important roles in one of these two pathways in the LNCaP prostate cancer cells.
Inhibition of Endogenous PTEN Expression Increases AR Protein Levels and Transcriptional Activity
We have demonstrated that overexpression of PTEN promotes AR degradation and suppresses AR activity. To avoid the above observations resulting from overexpression, we used small interfering RNA (siRNA) to block endogenous PTEN and examined whether the AR protein levels and transcriptional activity would be affected by down-regulating PTEN. As shown in Fig. 7A
, transient transfection of PTEN siRNA into human embryonic kidney 293T cells reduced endogenous PTEN protein levels up to 5060%, which correlated with the transfection efficiency (
50%) in our experiment conditions. As expected, reduction of PTEN expression enhanced AR protein expression in the presence and absence of androgen (Fig. 7A
). PTEN siRNA enhanced AR transactional activity in a dose-dependent manner in the presence of androgen in 293T cells (Fig. 7B
). Furthermore, we observed that the levels of AR protein expression in PTEN-null MEFs were much higher than that in WT MEFs (Fig. 7C
), suggesting that AR may be more stable in the absence of PTEN. Reintroduction of PTEN in PTEN-null MEFs drastically reduced AR protein levels, as compared with that in WT MEFs (Fig. 7C
). We also found that AR transcriptional activity in PTEN-null MEFs was much higher than in WT MEFs, and reconstitution of PTEN in PTEN-null MEFs significantly suppressed AR activity (Fig. 7D
). cAKt did not reverse the PTEN-mediated repression of AR activity (Fig. 7D
), suggesting that PTEN suppresses AR activity via the PI3K/Akt-independent pathway in MEFs. These results suggest that endogenous PTEN is a negative regulator for controlling AR protein stability and transcriptional activity.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 7. Endogenous PTEN Negatively Regulates AR Protein Stability and Transcriptional Activity
A, 293T cells were transfected with PTEN siRNA or vector along with AR and green fluorescent protein (GFP) for 24 h, followed by ethanol or 10 nM DHT treatment for another 24 h, and harvested for Western blot analysis. GFP expression was used for transfection and loading control. B, 293T cells were transfected with various amounts of PTEN siRNA or vector along with AR and MMTV-luc for 24 h, followed by ethanol or 10 nM DHT treatment for another 24 h, and harvested for luciferase assay. C, WT and PTEN-null MEFs were transfected with AR and GFP in the presence or absence of PTEN for 36 h and harvested for Western blot analysis. GFP expression was used for transfection and loading control. D, WT and PTEN-null MEFs were transfected with plasmids as indicated for 24 h, followed by ethanol or 10 nM DHT treatment for another 24 h, and harvested for luciferase assay. *, P < 0.05; **, P < 0.001 vs. control (indicated as ), Students two-tailed t test.
|
|
 |
DISCUSSION
|
|---|
The PTEN tumor suppressor induces cell apoptosis in a variety of cell types including the prostate cancer cells. However, the molecular mechanism underlying PTEN-induced apoptosis in prostate cancers remains largely unknown. In the present study we have identified AR as a novel target of PTEN in vitro and in vivo. PTEN inhibited AR nuclear translocation, promoted AR protein degradation, and inhibited AR transactivation via direct PTEN-AR interaction. We also demonstrated that PTEN-induced suppression of AR transactivation and apoptosis could be inhibited by interruption of PTEN and AR interaction by adding AR-D peptide. Furthermore, using the PTEN siRNA and PTEN-null MEFs we found that AR protein levels and transcriptional activity were elevated. Taken together, these results indicate that PTEN is a negative regulator for controlling the AR activity and that interaction between AR and PTEN may play an important role for PTEN to suppress AR and induce apoptosis in prostate cancer cells.
Like other members of the steroid receptor superfamily, AR may move dynamically between the nucleus and the cytoplasm (40). As androgen induces AR nuclear translocation and prolongs the half-life of AR (41), it is generally accepted that AR degradation might be prevented by binding androgen and translocating into the nucleus. Because PTEN suppresses AR nuclear translocation and promotes AR degradation, it is possible that these two events occur subsequently and are functionally linked. It is likely that PTEN may first bind to AR, leading to retention of this PTEN-AR complex in the cytoplasm, which may then make AR more vulnerable to enzymatic degradation.
Sequence analysis indicates that AR contains the nuclear localization signal (NLS) (aa 617 to 633) in the hinge region between DBD and LBD. It has been reported that mutations in the NLS may lead to the disruption of AR nuclear translocation (42). It is plausible that PTEN binds to the hinge region of AR resulting in the interruption of the NLS nuclear translocation. Alternatively, PTEN could simply compete with other AR coregulators for binding to the same region, causing the inhibition of the nuclear translocation.
Recent reports suggest that PTEN may exert its biological activity by regulating stability of proteins. For example, PTEN can regulate the ubiquitin-dependent degradation of CDK inhibitor p27Kip1 through the ubiquitin E3 ligase SCFSkp2 (38). PTEN can also attenuate the hypoxia-mediated HIF-1
(hypoxia-inducible factor 1) stabilization (43). Together with our finding showing that PTEN promotes AR degradation, these results support a role of PTEN in modulation of protein degradation. Proteins containing the PEST sequence are thought to be the target proteins for ubiquitination and degradation (44). As AR contains the PEST sequence (aa 638 to 658) in the hinge region (45), it is possible that PTEN accelerates AR degradation through the ubiquitin-proteosome pathway via the PEST sequence. However, this hypothesis is not supported by our result showing that PTEN-induced AR degradation is not affected by the treatment of the proteasome inhibitor MG132 (see supplemental Fig. 1A
), suggesting the unlikelihood that PTEN goes through the ubiquitin-proteasome pathway to promote AR degradation. As the caspase-3 inhibitor completely blocked the effect of PTEN on AR degradation (see supplemental Fig. 1A
), caspase-3 may mediate the PTEN-induced AR degradation. This hypothesis is further supported by our result (see supplemental Fig. 1B
) and the earlier report showing that caspase-3 could degrade AR in vitro (39). It has been reported that PTEN-induced apoptosis can be rescued by caspase-3 inhibitor in LNCaP cells (46), which also strengthens our hypothesis that PTEN signaling can be mediated through caspase-3 via direct cleavage of AR protein (39). Although our study demonstrates that PTEN-mediated AR degradation is through caspase-3 activity (see supplemental Fig. 1
), we found that the repression of AR activity by PTEN could not be rescued by a caspase-3 inhibitor or a general caspase inhibitor (see supplemental Fig. 1C
). These contrasting results imply that PTEN suppression of AR might go through multiple pathways, and caspase-3-mediated degradation could be one of these pathways. In addition, because it has been known that caspase-3 cleaves AR at the D151 residue, we further tested the effect of PTEN on AR-D151N mutant. We found that PTEN can still repress the transactivation of AR-D151N (see supplemental Fig. 1D
), indicating that PTEN suppressed AR not only via protein degradation. Because PTEN-dPTP (lacking AR interacting domain) failed to suppress AR transactivation (Fig. 6E
) and AR-D (interaction inhibitor) can block the suppressive effect of PTEN on AR transactivation (Fig. 6
, AC and F), it is possible that in addition to degradation of AR, direct association between AR and PTEN may also contribute to suppression of AR activity.
We reported recently that the PI3K/Akt pathway promoted AR ubiquitylation, leading to AR degradation by the 26 S proteasome (47). These data clearly suggest that both PTEN and the PI3K/Akt pathway can promote AR degradation via distinct mechanisms. How can PTEN negatively regulate the PI3K/Akt pathway and at same time promote AR degradation? Because PI3K/Akt signaling promotes AR degradation, PTEN inhibition of this pathway would be expected to result in increased AR protein levels. It is possible that PTEN can go through both pathways by inhibition of PI3K/Akt-mediated AR degradation by the 26 S proteasome and caspase-3-mediated AR degradation. Yet the overall balance may favor the caspase-3- mediated AR degradation.
Because the interaction between PTEN and AR plays an important role in PTEN-mediated AR degradation (Fig. 5A
), it is possible that PTEN binding to AR may be required to expose the active site of the AR for caspase-3 recognition, thus leading to AR degradation. This hypothesis is supported by the demonstration that some apoptosis inducers, such as staurosporine and phorboester (phorbol myristate acetate), can induce caspase-3 activation (48, 49), but fail to induce AR degradation (data not shown) (50).
A mutant PTEN C124S, which does not have phosphatase activity, exhibits a significantly reduced ability to suppress AR activity in LNCaP and DU145 cells, indicating that PTEN phosphatase activity is important for PTEN-mediated AR suppression. Given that PTEN directly interacts with AR and that its phosphatase activity is important for its effect on AR activity, it is possible that PTEN may regulate AR activity via direct dephosphorylation of AR. However, we were unable to detect a significant change in AR phosphorylation upon addition of GST-PTEN in an in vitro dephosphorylation assay (data not shown). These data raise the possibility that PTEN may regulate AR activity, in part, via indirectly affecting the phosphorylation status of other proteins.
The loss of PTEN expression in prostate LNCaP cells leads to constitutive activation of Akt (15). Akt is an important survival factor in a variety of cell types including LNCaP cells (15). Several lines of evidence have indicated that PI3K/Akt is able to suppress cell apoptosis induced by growth factor deprivation (16, 51, 52). Abrogation of PI3K/Akt activity by PI3K inhibitors causes LNCaP cell apoptosis (53, 54). On the other hand, the androgen/AR signal is thought to play important roles in the prostate cancer cell growth and survival, and this signal can protect cells from apoptosis in response to treatment with PI3K inhibitors (54, 55). Thus, the PI3K/Akt and the androgen/AR signaling pathways represent two major survival pathways in the LNCaP prostate cancer cells. As PTEN could repress the androgen/AR signal and PI3K/Akt pathway in LNCaP cells, we propose that inhibition of these two pathways by PTEN might contribute to PTEN-induced cell apoptosis in the LNCaP prostate cancer cells. This assertion was further supported by the observation that restoration of AR function or the PI3K/Akt pathway rescues cells from PTEN-induced apoptosis (Fig. 6F
).
Consistent with the reporter gene assay (Fig. 1E
, right panel), in the high-passage number LNCaP cells we found that PTEN could down-regulate AR protein levels and this effect was reversed by Akt (Fig. 5E
). Furthermore, Akt did not down-regulate AR protein levels (Fig. 5E
), suggesting that Akt might not promote AR ubiquitylation and degradation in high-passage LNCaP cells. Based on our data we propose a model for PTEN action on AR signaling in prostate cancer LNCaP cells. PTEN regulates AR activity in low- passage LNCaP cells via a PI3K/Akt-independent pathway and interacts directly with AR to suppress androgen-induced AR nuclear translocation. The interaction between AR and PTEN might expose the active site of the AR for the recognition of caspase-3. The PTEN activated caspase-3 then recognizes the AR and leads to AR degradation (Fig. 8
). Although overexpression of the active form of Akt can inhibit PTEN-induced caspase-3 activation, thus potentially blocking PTEN-mediated AR degradation, Akt itself can induce AR degradation. This may explain why restoration of Akt activity does not reverse PTEN-mediated AR suppression and AR degradation in the early-passage number LNCaP cells. In contrast, PTEN promotes AR degradation and suppress AR activity in high-passage number LNCaP cells via a PI3K/Akt-dependent pathway (Fig. 8
). In such cells, Akt does not down-regulate AR protein levels (perhaps not inducing AR degradation), and it may account for the reason why PTEN-induced suppression of AR activity and AR degradation are inhibited by restoration of Akt activity. Several important questions have been raised throughout this study. First, what is the factor(s) that determines the differential effects of the PI3K/Akt pathway on AR activity in different passage numbers of LNCaP cells? What factor(s) triggers the distinct mechanisms used by PTEN to regulate AR activity in various passage numbers of LNCaP cells? What factor(s) can be dephosphorylated by PTEN and also contribute to PTEN-mediated AR suppression? Future studies should focus on these issues, and systematic analysis is required to solve these puzzles.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 8. A Model for the PI3K/Akt Pathway and PTEN Tumor Suppressor on AR Signaling in Prostate LNCaP Cells
In low-passage number LNCaP cells, the PI3K/Akt pathway suppresses AR activity and induces AR ubiquitylation and degradation by 26S proteasome (47 ). PTEN tumor suppressor also suppresses AR activity at this early-passage number of LNCaP cells via a PI3K/Akt-independent pathway. PTEN directly interacts with AR and induces caspase-3 activation. The interaction between AR and PTEN may lead AR to expose the active site for caspase-3 recognition, resulting in AR degradation. Furthermore, the interaction between AR and PTEN results in suppression of AR nuclear translocation. However, the PI3K/Akt enhances AR activity in high-passage number LNCaP cells via an unknown mechanism. PTEN, on the other hand, suppresses AR activity via a PI3K/Akt-dependent pathway.
|
|
 |
MATERIALS AND METHODS
|
|---|
Constructs and Reagents
pCDNA3-cAkt and pCDNA3-dAkt were from Dr. R. Freeman. LY294002, DEVD-CHO, and z-VAD-FMK were from Calbiochem (La Jolla, CA). 5
-Dihydrotestosterone (DHT) and Dox were from Sigma Chemical Co. (St. Louis, MO). The anti-AR polyclonal antibody, NH27, was produced as previously described (8, 56). Recombinant active caspase-3 was purchased from Pharmingen (San Diego, CA). PTEN monoclonal antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). FITC-conjugated secondary antimouse antibody and Texas Red-conjugated secondary antirabbit antibody were from ICN Biochemicals, Inc. (Aurora, OH). TNT in vitro protein expression kit was from Promega. pCDNA3-PTEN and pCDNA3-PTEN C124S were provided by Dr. C. L. Sawyers. pSG5-HA-PTEN was from Dr. W. Sellers. PTEN-no. 1 (encoding PTEN aa 1107) and AR-D (encoding AR aa 486651) were constructed into pCMV-FLAG vector. To construct GST-PTEN fragment proteins, the PTEN fragments (nos. 1, 2, and 3) were released from pGEX-KG-PTEN (from Dr. F. Furnari) and subcloned into pGEX-KG, pGEX-2t, and pGEX-3x (Amersham Pharmacia Biotech, Arlington Heights, IL), respectively. To construct GST-PTEN-PTP, the PTP fragment was obtained by PCR and inserted into pGEX-3x. pCDNA3-FLAG-PTEN and pCDNA3-FLAG-PTEN-dPTP (lacking PTEN aa 110200) were generated by PCR, and the cDNAs were inserted into pCDNA3 vector (Invitrogen).
Cell Culture and Transfections
The DU145, PC-3, 293T, COS-1, and the wild-type (WT) and PTEN-null MEFs (kindly provided by Dr. H. Wu) were maintained in DMEM containing penicillin (25 U/ml), streptomycin (25 µg/ml), and 10% fetal calf serum (FCS). The LNCaP, U87MG, and CWR22R (a gift from Dr. C. Kao) cells were maintained in RPMI-1640 with 10% FCS. Transfections were performed using the calcium phosphate precipitation method in PC-3 and DU145 cells, as previously described (57) or SuperFect in LNCaP, COS-1, and U87MG cells according to standard procedures (QIAGEN, Chatsworth, CA).
Apoptosis Assay
For the apoptosis assay, the cells were transfected with plasmids for 24 h and grown in 0.1% charcoal dextran-stripped serum (CDS) media. The apoptosis was determined 2 d after transfection using the TUNEL assay according to the standard procedures (Oncogene Science, Inc., Manhasset, NY). At least 200 cells were scored for each sample, and data are means ± SD from three independent experiments.
Luciferase Reporter Assays
The cells were transfected with plasmids in 10% CDS media for 16 h and then treated with ethanol or 10 nM DHT for 16 h. The cells were lysed and the luciferase activity was detected by the dual luciferase assay according to standard procedures (Promega). The results were normalized by pRL-SV40 activity, and the data are represented as means ± SD from at least three independent experiments.
Glutathionine-S-transferase (GST) Pull-Down Assay
The GST pull-down assay described previously (58) was performed with some modifications. GST-fusion proteins were purified as described by the manufacturer (Amersham Pharmacia Biotech). The purified GST-proteins were resuspended with 100 µl of interaction buffer [20 mM Tris-HCl (pH 8.0), 60 mM NaCl, 1 mM EDTA, 6 mM MgCl2, 1 mM dithiothreitol, 8% glycerol, 0.05% (vol/vol) Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitors] and mixed with 5 µl of 35S-labeled TNT proteins in the presence or absence of 1 µM ligands on a rotating disk at 4 C for 2 h. After extensive washes with NENT buffer (20 nM Tris-HCl/pH 8.0, 100 mM NaCl, 6 mM MgCl2, 1 mM EDTA, 0.5% (vol/vol) Nonidet P-40, 1 mM dithiothreitol, 8% glycerol, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitors) bead-bound proteins were separated on an 8% sodium dodecyl sulfate-polyacrylamide gel and visualized by autoradiography.
Immunoprecipitation and Western Blot Analysis
The immunoprecipitation and Western blotting were performed as previously described (59). The cell extracts (1 mg) were immunoprecipitated with the indicated antibody. The immunocomplexes were subjected to 8% SDS-PAGE and immunoblotted with the indicated antibodies.
Immunofluorescence and Microscopy
The COS-1 cells were plated on 12-mm coverslips, incubated overnight, and transfected with pSG5-AR in combination with pCDNA3, pCDNA3 PTEN, or pCDNA3 PTEN C124S in 10% CDS media for 16 h, followed by the treatment with ethanol or 10 nM DHT for another 16 h. The cells were fixed with 4% paraformaldehyde/PBS for 20 min on ice and permeabilized with 100% methanol for 15 min on ice. The following experiments were performed at room temperature. The coverslips were rinsed with PBS twice and incubated in 5% BSA for 30 min. The primary antibodies against AR and PTEN were added for 1 h and then washed with PBS four times. The secondary antibodies were added for 1 h, and the coverslips were washed four times with PBS, followed by application of the counting medium containing 4',6-diaminodino-2- phenylindole. Coverslips were examined by confocal microscope. A FITC-conjugating antimouse antibody and a Texas Red antirabbit antibody were used as secondary antibodies.
LNCaP Stable Transfectants
For the Dox-inducible system, PTEN or PTEN C124S were released from pGEX-KG-PTEN or pGEX-KG-PTEN C124S using EcoRI digestion and inserted into pBIG2i vector. The LNCaP cells were transfected with pBIG2i vector, pPIB2i PTEN, or pBIG2i PTEN C124S for 24 h. The cells were selected with 100 µg/ml hygromycin B. Individual colonies were picked up and grown until 70% confluent, followed by 4 µg/ml Dox treatment for 48 h. The positive clones were confirmed by Western blot analysis.
Pulse-Chase Experiments
Pulse-chase experiments were performed as described (60) with some modifications. Briefly, COS-1 cells were transfected with pSG5-AR in combination with pCDNA3 or pCDNA3 PTEN in 10% CDS media for 36 h. Cells were grown under serum starvation conditions for 2 h in methionine/cysteine-deficient medium, and then the cells were pulsed for 45 min with 200 µCi/ml [35S]methionine/cysteine (NEN Life Science Products, Boston, MA). Cells were washed with DMEM twice and incubated with DMEM containing 0.2% CDS along with 10 nM DHT. The cells were lysed by RIPA buffer in the presence of protease inhibitors, followed by immunoprecipitation using AR antibody. The immunocomplexes were subjected to 8% SDS-PAGE and visualized by autoradiography.
Construction of PTEN siRNA
A small-interfering RNA (siRNA) was expressed in mammalian cells by transfection of a DNA-based vector BS/U6 (61) containing a homologous sequence (CCCACCACAGCTAGAACTTATC), a 6-bp spacer (CTCGAG), an inverted homologous sequence (GATAAGTTCTAGCTGTGGTGGG), and 5 "T"s, at the transcription initiation site of the U6 promoter.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. C.L. Sawyers, W. Sellers, R. Freeman, F. Furnari, H. Wu, and C. Kao for reagents and E. Sampson and K. Wolf for help in manuscript preparation. We thank the members in Dr. Changs laboratory for technical support and insightful discussion.
 |
FOOTNOTES
|
|---|
This work was supported by National Institutes of Health Grant DK60905 and a George Whipple Professorship Endowment.
H.-K.L. and Y.-C.H. contributed equally to this work and should both be considered as first authors.
Abbreviations: aa, Amino acid; AR, androgen receptor; CDK, cyclin-dependent kinase; CDS, charcoal dextran-stripped serum; DBD, DNA-binding domain; DHT, 5
-dihydrotestosterone; Dox, doxycycline; ER, estrogen receptor; FCS, fetal calf serum; FITC, fluorescein isothiocyanate; GST, glutathione-S-transferase; LBD, ligand-binding domain; MEF, mouse embryonic fibroblast; MMTV-luc, mouse mammary tumor virus luciferase; NLS, nuclear localization signal; PI3K, phosphatidylinositol-3-OH-kinase; PTEN, phosphatase and tensin homolog deleted on chromosome 10; siRNA, small interfering RNA; TUNEL, terminal deoxynucleotidyltransferase-mediated deoxyuridine triphosphate end-labeling; WT, wild-type.
Received for publication March 18, 2004.
Accepted for publication June 7, 2004.
 |
REFERENCES
|
|---|
- Chang CS, Kokontis J, Liao ST 1988 Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 240:324326[Abstract/Free Full Text]
- Chang CS, Kokontis J, Liao ST 1988 Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA 85:72117215[Abstract/Free Full Text]
- Chang C, Saltzman A, Yeh S, Young W, Keller E, Lee HJ, Wang C, Mizokami A 1995 Androgen receptor: an overview. Crit Rev Eukaryot Gene Expr 5:97125[Medline]
- Heinlein CA, Chang C 2004 Androgen receptor in prostate cancer. Endocr Rev 25:276308[Abstract/Free Full Text]
- Lee DK, Chang C 2003 Endocrine mechanisms of disease: expression and degradation of androgen receptor: mechanism and clinical implication. J Clin Endocrinol Metab 88:40434054[Abstract/Free Full Text]
- Heinlein CA, Chang C 2002 The roles of androgen receptors and androgen-binding proteins in nongenomic androgen actions. Mol Endocrinol 16:21812187[Abstract/Free Full Text]
- Rahman MM, Miyamoto H, Takatera H, Yeh S, Altuwaijri S, Chang C 2003 Reducing the agonist activity of antiandrogens by a dominant-negative androgen receptor coregulator ARA70 in prostate cancer cells. J Biol Chem 278:1961919626[Abstract/Free Full Text]
- Yeh S, Chang C 1996 Cloning and characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells. Proc Natl Acad Sci USA 93:55175521[Abstract/Free Full Text]
- Rahman MM, Miyamoto H, Lardy H, Chang C 2003 Inactivation of androgen receptor coregulator ARA55 inhibits androgen receptor activity and agonist effect of antiandrogens in prostate cancer cells. Proc Natl Acad Sci USA 100:51245129[Abstract/Free Full Text]
- Fujimoto N, Yeh S, Kang HY, Inui S, Chang HC, Mizokami A, Chang C 1999 Cloning and characterization of androgen receptor coactivator, ARA55, in human prostate. J Biol Chem 274:83168321[Abstract/Free Full Text]
- Miyamoto H, Rahman M, Takatera H, Kang HY, Yeh S, Chang HC, Nishimura K, Fujimoto N, Chang C 2002 A dominant-negative mutant of androgen receptor coregulator ARA54 inhibits androgen receptor-mediated prostate cancer growth. J Biol Chem 277:46094617[Abstract/Free Full Text]
- Kang HY, Yeh S, Fujimoto N, Chang C 1999 Cloning and characterization of human prostate coactivator ARA54, a novel protein that associates with the androgen receptor. J Biol Chem 274:85708576[Abstract/Free Full Text]
- Onate SA, Tsai SY, Tsai MJ, OMalley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:13541357[Abstract/Free Full Text]
- Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R 1997 PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275:19431947[Abstract/Free Full Text]
- Davies MA, Koul D, Dhesi H, Berman H, McDonnell TJ, McConkey D, Yung WK, Steck PA 1999 Regulation of Akt/PKB activity, cellular growth, and apoptosis in prostate carcinoma cells by MMAC/PTEN. Cancer Res 59:25512556[Abstract/Free Full Text]
- Cantley LC, Neel BG 1999 New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc Natl Acad Sci USA 96:42404245[Abstract/Free Full Text]
- Di Cristofano A, Pandolfi PP 2000 The multiple roles of PTEN in tumor suppression. Cell 100:387390[CrossRef][Medline]
- Feilotter HE, Coulon V, McVeigh JL, Boag AH, Dorion-Bonnet F, Duboue B, Latham WC, Eng C, Mulligan LM, Longy M 1999 Analysis of the 10q23 chromosomal region and the PTEN gene in human sporadic breast carcinoma. Br J Cancer 79:718723[CrossRef][Medline]
- Feilotter HE, Nagai MA, Boag AH, Eng C, Mulligan LM 1998 Analysis of PTEN and the 10q23 region in primary prostate carcinomas. Oncogene 16:17431748[CrossRef][Medline]
- Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian SV 1997 Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15:356362[CrossRef][Medline]
- Liaw D, Marsh DJ, Li J, Dahia PL, Wang SI, Zheng Z, Bose S, Call KM, Tsou HC, Peacocke M, Eng C, Parsons R 1997 Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 16:6467[CrossRef][Medline]
- Vlietstra RJ, van Alewijk DC, Hermans KG, van Steenbrugge GJ, Trapman J 1998 Frequent inactivation of PTEN in prostate cancer cell lines and xenografts. Cancer Res 58:27202723[Abstract/Free Full Text]
- Di Cristofano A, Pesce B, Cordon-Cardo C, Pandolfi PP 1998 Pten is essential for embryonic development and tumour suppression. Nat Genet 19:348355[CrossRef][Medline]
- Di Cristofano A, De Acetis M, Koff A, Cordon-Cardo C, Pandolfi PP 2001 Pten and p27KIP1 cooperate in prostate cancer tumor suppression in the mouse. Nat Genet 27:222224[CrossRef][Medline]
- Kiyokawa H, Kineman RD, Manova-Todorova KO, Soares VC, Hoffman ES, Ono M, Khanam D, Hayday AC, Frohman LA, Koff A 1996 Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27(Kip1). Cell 85:721732[CrossRef][Medline]
- Fero ML, Rivkin M, Tasch M, Porter P, Carow CE, Firpo E, Polyak K, Tsai LH, Broudy V, Perlmutter RM, Kaushansky K, Roberts JM 1996 A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell 85:733744[CrossRef][Medline]
- Nakayama K, Ishida N, Shirane M, Inomata A, Inoue T, Shishido N, Horii I, Loh DY, Nakayama K 1996 Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell 85:707720[CrossRef][Medline]
- Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM 1998 Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280:16141617[Abstract/Free Full Text]
- Tamura M, Gu J, Tran H, Yamada KM 1999 PTEN gene and integrin signaling in cancer. J Natl Cancer Inst 91:18201828[Abstract/Free Full Text]
- Gu J, Tamura M, Pankov R, Danen EH, Takino T, Matsumoto K, Yamada KM 1999 Shc and FAK differentially regulate cell motility and directionality modulated by PTEN. J Cell Biol 146:389403[Abstract/Free Full Text]
- Maehama T, Dixon JE 1998 The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 273:1337513378[Abstract/Free Full Text]
- Maehama T, Dixon JE 1999 PTEN: a tumour suppressor that functions as a phospholipid phosphatase. Trends Cell Biol 9:125128[CrossRef][Medline]
- Hopkin K 1998 A surprising function for the PTEN tumor suppressor [news]. Science 282:1027, 10291030[Free Full Text]
- Gao X, Neufeld TP, Pan D 2000 Drosophila PTEN regulates cell growth and proliferation through PI3K-dependent and -independent pathways. Dev Biol 221:404418[CrossRef][Medline]
- Freeman DJ, Li AG, Wei G, Li HH, Kertesz N, Lesche R, Whale AD, Martinez-Diaz H, Rozengurt N, Cardiff RD, Liu X, Wu H 2003 PTEN tumor suppressor regulates p53 protein levels and activity through phosphatase-dependent and -independent mechanisms. Cancer Cell 3:117130[CrossRef][Medline]
- Amler LC, Agus DB, LeDuc C, Sapinoso ML, Fox WD, Kern S, Lee D, Wang V, Leysens M, Higgins B, Martin J, Gerald W, Dracopoli N, Cordon-Cardo C, Scher HI, Hampton GM 2000 Dysregulated expression of androgen-responsive and nonresponsive genes in the androgen-independent prostate cancer xenograft model CWR22R1. Cancer Res 60:61346141[Abstract/Free Full Text]
- McDonald S, Brive L, Agus DB, Scher HI, Ely KR 2000 Ligand responsiveness in human prostate cancer: structural analysis of mutant androgen receptors from LNCaP and CWR22 tumors. Cancer Res 60:23172322[Abstract/Free Full Text]
- Mamillapalli R, Gavrilova N, Mihaylova VT, Tsvetkov LM, Wu H, Zhang H, Sun H 2001 PTEN regulates the ubiquitin-dependent degradation of the CDK inhibitor p27(KIP1) through the ubiquitin E3 ligase SCF(SKP2). Curr Biol 11:263267[CrossRef][Medline]
- Ellerby LM, Hackam AS, Propp SS, Ellerby HM, Rabizadeh S, Cashman NR, Trifiro MA, Pinsky L, Wellington CL, Salvesen GS, Hayden MR, Bredesen DE 1999 Kennedys disease: caspase cleavage of the androgen receptor is a crucial event in cytotoxicity. J Neurochem 72:185195[CrossRef][Medline]
- Myers MP, Pass I, Batty IH, Van der Kaay J, Stolarov JP, Hemmings BA, Wigler MH, Downes CP, Tonks NK 1998 The lipid phosphatase activity of PTEN is critical for its tumor suppressor function. Proc Natl Acad Sci USA 95:1351313518[Abstract/Free Full Text]
- Tyagi RK, Lavrovsky Y, Ahn SC, Song CS, Chatterjee B, Roy AK 2000 Dynamics of intracellular movement and nucleocytoplasmic recycling of the ligand-activated androgen receptor in living cells. Mol Endocrinol 14:11621174[Abstract/Free Full Text]
- Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM 1995 Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 9:208218[Abstract]
- Poukka H, Karvonen U, Yoshikawa N, Tanaka H, Palvimo JJ, Janne OA 2000 The RING finger protein SNURF modulates nuclear trafficking of the androgen receptor. J Cell Sci 113:29913001[Abstract]
- Zundel W, Schindler C, Haas-Kogan D, Koong A, Kaper F, Chen E, Gottschalk AR, Ryan HE, Johnson RS, Jefferson AB, Stokoe D, Giaccia AJ 2000 Loss of PTEN facilitates HIF-1-mediated gene expression. Genes Dev 14:391396[Abstract/Free Full Text]
- Rechsteiner M, Rogers SW 1996 PEST sequences and regulation by proteolysis. Trends Biochem Sci 21:267271[CrossRef][Medline]
- Sheflin L, Keegan B, Zhang W, Spaulding SW 2000 Inhibiting proteasomes in human HepG2 and LNCaP cells increases endogenous androgen receptor levels. Biochem Biophys Res Commun 276:144150[CrossRef][Medline]
- Yuan XJ, Whang YE 2002 PTEN sensitizes prostate cancer cells to death receptor-mediated and drug-induced apoptosis through a FADD-dependent pathway. Oncogene 21:319327[CrossRef][Medline]
- Lin HK, Wang L, Hu YC, Altuwaijri S, Chang C 2002 Phosphorylation-dependent ubiquitylation and degradation of androgen receptor by Akt require Mdm2 E3 ligase. EMBO J 21:40374048[CrossRef][Medline]
- Johnson DE, Gastman BR, Wieckowski E, Wang GO, Amoscato A, Delach SM, Rabinowich H 2000 Inhibitor of apoptosis protein hILP undergoes caspase-mediated cleavage during T lymphocyte apoptosis. Cancer Res 60:18181823[Abstract/Free Full Text]
- Pandey P, Nakazawa A, Ito Y, Datta R, Kharbanda S, Kufe D 2000 Requirement for caspase activation in monocytic differentiation of myeloid leukemia cells. Oncogene 19:39413947[CrossRef][Medline]
- Sato N, Sadar MD, Bruchovsky N, Saatcioglu F, Rennie PS, Sato S, Lange PH, Gleave ME 1997 Androgenic induction of prostate-specific antigen gene is repressed by protein-protein interaction between the androgen receptor and AP-1/c-Jun in the human prostate cancer cell line LNCaP. J Biol Chem 272:1748517494[Abstract/Free Full Text]
- Crowder RJ, Freeman RS 1998 Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons. J Neurosci 18:29332943[Abstract/Free Full Text]
- Yao R, Cooper GM 1996 Growth factor-dependent survival of rodent fibroblasts requires phosphatidylinositol 3-kinase but is independent of pp70S6K activity. Oncogene 13:343351[Medline]
- Lin J, Adam RM, Santiestevan E, Freeman MR 1999 The phosphatidylinositol 3'-kinase pathway is a dominant growth factor-activated cell survival pathway in LNCaP human prostate carcinoma cells. Cancer Res 59:28912897[Abstract/Free Full Text]
- Carson JP, Kulik G, Weber MJ 1999 Antiapoptotic signaling in LNCaP prostate cancer cells: a survival signaling pathway independent of phosphatidylinositol 3'- kinase and Akt/protein kinase B. Cancer Res 59:14491453[Abstract/Free Full Text]
- Kimura K, Markowski M, Bowen C, Gelmann EP 2001 Androgen blocks apoptosis of hormone-dependent prostate cancer cells. Cancer Res 61:561156