| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institute of Physiological Biochemistry and Pathobiochemistry, Johannes Gutenberg University, Medical School, 55099 Mainz, Germany
Address all correspondence and requests for reprints to: Christina Zechel, Institute of Physiological Biochemistry and Pathobiochemistry, Johannes Gutenberg University, Medical School, Duesberg Weg 6, 55099 Mainz, Germany. E-mail: zechel{at}uni-mainz.de.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
For example, it has been well established that patterning of the nervous system and hindbrain development in particular, is regulated by retinoic acid (RA) signaling and the expression of the retinoid receptors RAR (RA receptor) and RXR (retinoid X receptor). The process is regulated by the formation of a shallow gradient of RA, which involves the opposing action of the RA-producing enzyme RALDH-2 and the RAdegrading enzyme CYP26 (4, 5, 6 ; for review, see Ref.7). Studies in Xenopus identified the orphan receptor GCNF (germ cell nuclear factor) [NR6A1; also known as retinoid-related testis-associated receptor (RTR) or NCNF] as another regulator of hindbrain development (8). The effect of a GCNF knock down on hindbrain patterning in Xenopus was similar to conditions of reduced RA signaling and related to misregulation of the RA-degrading enzyme CYP26 (9). The defects in gcnf-deficient mice involved the ectopic expression of the Cyp26-opponent Raldh-2 (10). Although it has not yet been clarified whether the latter defect was a causal change or an effect, this suggests multiple cross talks between RAR/RXR and GCNF signaling and that GCNF may regulate the availability of RA and, in turn, RA function in developmental processes. That GCNF was strongly up-regulated in the neurally differentiating embryonal carcinoma (EC) cell lines PCC7-Mz1 and P19 within few hours after exposure to RA (11, 12) suggests that GCNF may also act downstream of RA.
GCNF was first described as a novel orphan receptor in mouse germ cells (13). It is expressed in growing spermatids and oocytes, as well as in neuronally differentiating EC cells (11, 13, 14). With regard to neurogenesis, GCNF shows a spatially and temporally regulated expression in the developing nervous system of the embryo and was found in postmitotic neuronal cells of the adult mouse brain (11, 15). The protein is a sequence-specific repressor of transcription that binds as a homodimer to directly repeated consensus motifs PuGGTCA with zero spacing (DR0) or an extended half site (for review, see Refs.16 and 17). Interaction studies suggested that repression involves the recruitment of nuclear corepressors, which may be modulated by the RTR-associated protein (RAP) 80 (18, 19, 20). Known target genes are the protamine genes 1 and 2, which are expressed in round spermatids, the genes bmp15 and gdf-9 that are up-regulated in females at diestrus, and the oct4 gene that encodes a key regulator of cell differentiation (20, 21, 22). Gene targeting approaches showed that GCNF is required for the maintenance of somitogenesis, normal anterior-posterior development, embryonic survival, and the restriction of Oct4 expression to the germ line (10, 20, 23). Recently, the function of GCNF in the differentiation of oocytes and female fertility could be unraveled by by-passing embryonal lethality with an oocyte-specific knockout (22).
To test the as-yet-unproven prediction that GCNF plays a role in neuronal differentiation (11), we generated stably transfected EC cell lines that express gcnf sense or antisense RNA under the control of a tetracycline-regulated viral promoter. For this we chose the PCC7-Mz1 cell line, which represents an advantageous model to study neuronal cells from the stage of fate choice till the acquirement of functional competence. Upon incubation with RA, stem cells withdraw from the cell cycle and differentiate into a tissue-like pattern of neuronal and nonneuronal cells (24, 25). Cell lineage determination starts within hours after RA exposure, is completed at d 3 of differentiation (26), and is accompanied by apoptotic death of approximately 20% of the cells (27, 28). From d 6, the neuronal derivatives begin to develop polarity in a way that reflects the situation in the mouse brain, and that is completed in the second week by the acquirement of conductance properties (25). Like in brain tissue, the nonneuronal cells support survival, as well as the sequentially ordered differentiation and complete maturation of the neuronal derivatives (24, 25). The PCC7-Mz1 cell line has thus been considered as a valuable model that permits studies of most aspects that play a role during the differentiation and maturation of neurons in vivo.
In the present paper, we provide evidence that the level of GCNF is critical for differentiation of neuronal precursor cells into functional neurons. In particular, neurons in gcnf overexpressing (sense) cultures acquired functional competence quicker than those in the wild type, whereas maturation was largely delayed in differentiating antisense cultures, i.e. the GCNF knock down. This appeared to be related to differences in the down-regulation of the type VI intermediate filament protein nestin and the up-regulation of neuron-specific microtubule-associated proteins (MAPs) and the synaptic vesicle protein synaptophysin (Syp).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Transgene-positive clones were screened for transgene expression by RT-PCR with the primer pair gcnf-F1/flag-R, which reveals expression of the gcnf-flag transgene but not of the endogenous gcnf gene. Weak transgene expression before induction was detected in all clones, indicating that transgene expression was not completely shut down by the tetracycline repressor (examples in Fig. 1A
). When sense and antisense clones were grown for 24 h in medium containing tetracycline, transgene expression was at least 5-fold increased, and a further increase of at least 5-fold was observed when the induction was for 48 h (example in left panel of Fig. 1A). Transgene expression was also efficiently induced in neurally differentiating sense and antisense clones (example in right panel of Fig. 1A).
|
, and data not shown), which is completed 3 d after exposure to RA (26). To determine the amount of GCNF protein in the transgenic clones, we performed comparative Western blot analyses with whole cell protein extracts (WCE) from cultures at d 1, 2, and 3 of neural differentiation. In antisense clones, the GCNF-specific 60-kDa signal reached 20–50% of the level in the wild type (example in Fig. 1C), indicating that GCNF was successfully down-regulated. Down-regulation was on the RNA level, as was revealed by RT-PCR analyses with total RNA from antisense clones at the stem cell stage or during neural differentiation (example in Fig. 1B). In WCE from tetracycline-induced sense clones the 60-kDa band was equally well detected as in the wild type, in addition to a slightly larger band of at least similar intensity, which corresponded to the stably transfected gcnf-flag construct, as was revealed by incubation of the blots with the FLAG-specific antibody 
M2 (s-cl1 in Fig. 1C; M2, not shown). We investigated neuronal differentiation in three sense clones (s-cl1, -cl2, and -cl3) and four antisense clones (as-cl1, -cl2, -cl4, and -cl5).
Pattern and Restructuring of Neuronal Networks
Differentiation and organization of neuronal cells in networks was analyzed from the stage when fate choice had been completed [d 3 after cell cycle exit (26)] until stages when fully functional neurons were observed [d 12 and later (25)]. Immunocytochemistry studies with A2B5, or antibodies specific for the neuronal proteins GAP-43, MAP2, and Syp, showed that organization of neuronal cells in networks and aggregates was distinct in sense and antisense clones and differed from the wild type (typical examples in Fig. 2).
|
). Similar to the wild type, the initial network of neuronal cells began to restructure at d 4 in gcnf overexpressing cultures, with the cell bodies forming aggregates that connected to other neuron aggregates by fasciculated neurites. Whereas aggregation was completed around d 6 in the wild-type case, the cell bodies of 40–50% of the neuronal cells in the sense cultures remained in a loose network until d 9 or later, indicating that the dynamics of aggregation had changed. Moreover, although the cultures of sense clones consisted of more neuronal cells than the wild type, the neuron aggregates rarely reached the wild type’s size but formed a much denser network with smaller aggregates (compare panels G and I in Fig. 2). In both cases, the neuron aggregates became interspersed by a confluent layer of nonneuronal cells that consisted of almost only fibroblast-like cells that stained positive for Thy1.2 and were characterized by a 2- to 3-fold enlarged nucleus compared with the other cell types [Dapi nuclear stain (Hoechst 33258) in panel b and f of Fig. 2; Thy1.2 stain not shown]. Reflecting the large decrease in the relative number of fibroblast-like cells, the layer of nonneuronal cells in sense cultures reached confluency with a delay of 3–4 d, in comparison with the wild-type cultures (Fig. 2, and data not shown).
In antisense cultures (presence of tetracycline), the developing neuron aggregates were reduced in number but especially in size, reflecting the decreased number of neuronal cells. Moreover, the layer of fibroblast-like cells reached confluency before d 6, consistent with the increased relative number of this cell type (compare panels a and g with c and h in Fig. 2). This was similarly observed for as-cl1, -cl4, and -cl5, and somewhat less pronounced for as-cl2. In all antisense clones, aggregation of the cell bodies of neuronal cells began at d 4 and was completed around d 6.
Relative Number of Neuronal Cells with Progressing Time of Differentiation
Neuronal and fibroblast-like cells together made up more than 99.5% of the total cell number throughout the 3 wk of neural differentiation for which the wild-type and transgenic cultures were surveyed. The residual percentage of cells consisted of mitotic, as well as glial fibrillary acidic protein (GFAP)+ glial and Mesa+ endothelial cells, with the latter ones being absent until d 6 of differentiation (data not shown). To quantify the changes in the relative number of neuronal cells in differentiating sense and antisense cultures (d 3–9; presence of tetracycline), we counted the number of cells that coexpress GAP-43, MAP2, and Syp, related it to the total number of cells that was revealed by Dapistain, and compared it with the wild-type situation. Note that the total number of cells was nearly identical in the respective cultures, and that tetracycline did not affect the ratio of neuronal to nonneuronal cells in the wild type.
At d 3, neuronal cells made up approximately 90% of the total cell number in the sense, in contrast to approximately 70% in the wild-type and less than approximately 50% in the antisense cultures (as an example, see quantification of s-cl1, as-cl1, and the wild type in Fig. 3A). With progressing time of differentiation, the number of neuronal cells decreased in all three types of cultures, whereas the number of fibroblast-like cells increased. The change in the relative number of the respective cell-types was most pronounced between d 4 and 6 (Fig. 3A) and accompanied by an increase in the number of decomposed and fragmented nuclei in the developing neuron aggregates (Dapi stain in Fig. 2, and data not shown), resembling a cell death phenomenon associated with restructuring of neuronal networks (29). Importantly, in all sense cultures the number of neuronal cells remained above that of the fibroblast-like cells until d 9 and later (Fig. 3A).
|
, and data not shown).
To determine the level of MAP2 expression, we performed Western blot analysis with WCE from differentiating cultures of two sense (s-cl1 and s-cl2) and two antisense (as-cl1 and as-cl2) clones. During the first week of neuronal differentiation, MAP2 expression was similar to or above that seen in the wild type in sense clones (presence of tetracycline) (compare lanes 1 and 4 in the various panels of Fig. 3B). In contrast, the MAP2 signal was drastically impaired in antisense clones (presence of tetracycline) until d 6 (compare lanes 1 and 3 in the various panels of Fig. 3B). This decrease in MAP2 expression cannot be explained by the decrease in the relative number of neuronal cells in the corresponding cultures. For example, at d 3 (d 6) the intensity of the MAP2 signal reached less than 10% (5%) in WCE from as-cl1 than in WCE from the wild type (compare lanes 1 and 3 in panel III and V of Fig. 3B). This decrease of more than 90% in MAP2-expression corresponded to a reduction in the relative number of neuronal cells from 69% (38%) in the wild type to 47% (33%) in the as-cl1 case at d 3 (d 6) (see quantification in Fig. 3A). This was also observed for as-cl2 (panel VII in Fig. 3B). Moreover, comparative Western blot analyses with WCE from antisense clones that were differentiated in the absence or presence of tetracycline showed that MAP2 expression was lowered in tetracycline-treated cultures to a larger extent than would be explained by the tetracycline-induced 5–10% decrease in the relative number of neuronal cells in the corresponding cultures. This was more pronounced for as-cl2 than as-cl1 (compare lanes 2 and 3 in panel III and VII of Fig. 3B). In this respect, note that transgene expression was not completely shut down by the tetracycline repressor in the absence of tetracycline (Fig. 1A, and data not shown), and that tetracycline did not affect MAP2 expression at any stage in differentiating wild-type cultures (data not shown).
Immunocytochemistry analyses showed that MAP2 expression was similar or above the wild type in all sense and reduced in all antisense cultures throughout the first week of neural differentiation (d 3 in Fig. 3C, and data not shown). In older neurons of antisense cultures (d 12 and later), MAP2 expression was indistinguishable from that in the wild-type and sense case (Fig. 4C, and data not shown), indicating that MAP2 expression can recover in the GCNF knock down during later stages of differentiation. In summary, these data show that efficient up-regulation of MAP2 expression required a certain level of GCNF.
|
, and data not shown). To test whether the amount of GAP-43 was affected in the transgenic clones, we performed comparative Western blots analysis with WCE from d 1–6 cultures of the wild type, the sense clone s-cl1, and the antisense clone as-cl1, using actin as a loading control to normalize experimental variations (Fig. 3D). Based on the actin (42 kDa) signal, it appeared that the strength of the GAP-43 (43 kDa) signal was only related to the number of neuronal cells in the corresponding cultures (compare respective panels in Fig. 3, A and D), indicating that GAP-43 expression is not influenced by the GCNF level in neuronally differentiating cells.
The expression of Syp was temporally and quantitatively affected by the level GCNF expression, as was revealed by immunocytochemistry and Western blot analysis in particular. For example, the specific antibody clearly revealed the 38-kDa band of Syp in WCE from d 1 cultures of s-cl1, when the specific signal was only faint in the wild-type case (Fig. 3E). Expression of Syp was further increased within the next days, reached higher levels in s-cl1 than in the wild type until d 5 but was no more significantly different from the wild type at d 6 (Fig. 3E). Thus, enhanced levels of GCNF appeared to promote the induction of Syp and to increase its expression level during the first days after onset of differentiation. Consistent with that, the Syp stain of neuronal cells in s-cl1 cultures at d 6 or older appeared indistinguishable from those of the wild type (not shown). These data were confirmed by studies of s-cl2 and s-cl3 at selected time points of differentiation.
Expression of Syp was decreased in differentiating cultures of the antisense clone as-cl1. Comparison of the percentage of neuronal cells in differentiating cultures with the intensity of the 38-kDa signal in corresponding Western blots revealed that the impaired expression of Syp, especially in the period between d 4 and 6 cannot be explained by the reduction in the number of neuronal cells (compare relative cell numbers in Fig. 3A with Western blot data in Fig. 3E). For example, in WCE from d 6 cultures of as-cl1 and the wild type, both of which contain approximately the same percentage of neuronal cells (WT, 38%; as-cl1 33%), the Syp signal reached less than 10% of the wild-type’s intensity in as-cl1 (Fig. 3E). Thus, low levels of GCNF resulted in inefficient expression of Syp during neuronal differentiation, which may recover with progressing time of differentiation because the Syp stain of neuronal cells in older antisense cultures appeared indistinguishable from that in the wild-type and sense case (d14 cultures in Fig. 4C, and data not shown). These data were confirmed by studies of the antisense clones as-cl2, -cl4, and -cl5 at selected time points of differentiation. Note that tetracycline affected Syp expression in about the same range as it influenced the relative number of neuronal cells in the corresponding sense or antisense cultures (Fig. 3E, and data not shown).
Expression of Nestin
The data in the previous paragraphs indicated that reduced GCNF levels lengthened the time course in which the neuronal cells reached the wild-type’s expression level of MAP2 and Syp. To elucidate whether this would reflect a general retardation in neuronal differentiation, we compared expression of nestin (31) in cultures (presence of tetracycline) of the sense clone s-cl1 and s-cl3, and the antisense clone as-cl1 and as-cl5 with that in the wild type.
Immunocytochemistry and Western blot analyses revealed low expression of nestin in proliferating cells of the wild type and both types of transgenic clones (Fig. 5A, and data not shown). Nestin expression was further enhanced with the onset of neural differentiation and peaked around 48 h after exposure to RA (Fig. 5A, and data not shown). During the early stages of neural differentiation nestin was found in GAP-43+ cells (d2 in left panel of Fig. 4A; note that nestin and GAP-43 do not colocalize, as is revealed by areas with clear red and green color in the merged micrograph).
|
). Double staining with nestin- and Syp-specific antibodies showed that the neuronal cells in the antisense cultures still express nestin at stages when their nucleus had already acquired a polar position. Within the next days, the number of nestin+ neurons also progressively decreased in antisense cultures, such that most neurons displayed a nestin–/Syp+ phenotype at d 9. The micrographs in the right panel of Fig. 4A reveal the situation at d 8, with the open arrows pointing to a nestin+/Syp+ and the filled arrows to a nestin–/Syp+ neuron, respectively. Together, this indicated that down-regulation of nestin was delayed in the neuronal cells of the GCNF knock down.
Acquirement of Polarity and Functional Competence
To test whether polarization of organelles and molecules, a prerequisite for the acquirement of neuron polarity, would be affected by the GCNF level we used immunocytochemistry. Triple stain with Dapi and antibodies specific for MAP2 and Syp revealed that the nucleus had similarly moved to a polar position in d 6 neurons of all sense and antisense cultures, and the wild type (examples in Fig. 4B). The wild type’s typical segregation of MAP2, Syp, and GAP-43 expression was similarly observed in all sense and antisense cultures because the d 9 neurons began to display the typical dotted expression of these proteins in the neurites, which largely overlapped until d 14, and became more confined to the dendritic (MAP2) or axonal (Syp, GAP-43) protrusions until d 21 (Fig. 4C, and data not shown). Moreover, all sense and antisense clones maintained the wild type’s potential to develop mature neurons with pyramidal, bipolar and complex morphology, which displayed small protrusions (spines) of various shapes (examples in Fig. 4C) that resembled structures that might mediate synaptic contacts.
To test whether neuronal cells of the differentiating s-cl1 and as-cl1 culture would have acquired typical conductance properties of mature neurons we, firstly, tested for the presence of functional voltage-dependent sodium and potassium channels, which are a prerequisite for the ability of neurons to respond to depolarizing stimuli. Whole-cell patch-clamp recordings revealed voltage-dependent transient sodium inward and persistent potassium outward currents upon electrical stimulation of d 9 neurons in the wild-type cultures (Fig. 6A). Induction of the inward current was even more efficient in d 9 neurons of the sense clone s-cl1 than in the wild type, suggesting that enhanced GCNF expression shortened the time course of neuron maturation. Neurons in as-cl1 cultures showed almost no inward current at d 9 but displayed transient inward currents at d 12 (Fig. 6A).
|
), indicating that time course of acquirement of conductance properties was faster in the wild type and s-cl1 than in as-cl1. Neurons in d 12 cultures of the all three types of cultures displayed transient depolarization that resembled proper action potentials of phenotypic neurons (Fig. 6B); the amplitude of depolarization, however, was lower (
20% less) in as-cl1 than in the wild type or s-cl1, suggesting that the number of voltage-gated sodium channels was still reduced in as-cl1 neurons at d 12. |
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
) and that cAMP, which is present in the cultures, may activate transcription from the CMV promoter (33, 34), the respective changes were already observed to variable extents in the absence of tetracycline.
Aggregation and Restructuring of Neuronal Networks in gcnf Transgenic Cultures
Our data show that gcnf expression affects aggregation of neuronal precursor cells, once fate choice had been completed. At d 4 of neural differentiation, the initial network of neuronal cells began to restructure in the sense and antisense cultures, as in the wild type. This involved the reorganization of the cell bodies of the neuronal cells in aggregates that connected to other neuron aggregates by fasciculated neurites. Restructuring was similarly accompanied by cell death in all three types of cultures, resembling a process that has been observed during the development of the vertebrate brain (Ref.29 and references therein). Confirming our previous work (24, 25), cell body aggregation was completed around d 6 in the wild-type cultures at which the neuron aggregates had become interspersed by a nearly confluent layer of fibroblast-like cells. In the antisense cultures, the layer of fibroblast-like cells reached confluency before d 6 and the neuron aggregates were reduced in number and more particularly in size, which reflected the relative increase in fibroblast-like and decrease in neuronal cells. Despite the reduced number of neuronal cells in the GCNF knock down, the temporal aspect of aggregation was not detectably different from the wild type.
In the sense cultures, however, 40–50% of the neuronal cells remained in a loose network until d 9 or later. This might be related to the large reduction of fibroblast-like cells in these cultures, as neuronal cells depend on a nonneuronal matrix or attractant for efficient aggregation. Support for this interpretation comes from data showing that composition of the extracellular matrix and the neighboring cells could modulate neural differentiation of PCC7-Mz1 cells (35), a phenomenon that was also observed in vertebrate and invertebrate neurogenesis (Refs.36, 37, 38 and references therein). That GCNF might regulate this process in a more direct way, i.e. beyond the determination of the ratio of neuronal to nonneuronal cells, is suggested by recent work in Xenopus laevis, which showed that the expression of the integrin subunits 5 and 6 was reduced in a GCNF knock down (39). Thus, the changes in the dynamics of neuron aggregation in gcnf overexpressing cultures might be related to the misregulation of a subset of transmembrane receptors for fibronectin. This would be consistent with our unpublished observation that differentiating sense cultures easily detach from uncoated, but also from poly-D-lysine-, fibronectin-, or laminin-coated coverslips.
The morphogenetic movements leading to formation of the neural tube were defective in gcnf knockout mice (10) and impaired in Xenopus embryos with reduced levels of GCNF protein (39). The latter study revealed that medial migration and radial intercalation was affected by the knock down. Proteins that have been previously identified as regulators of neuron aggregation and migration are the Pou domain factors Brn-1 and Brn-2 (40) and the nuclear orphan receptor COUP-TFI (chicken ovalbumin upstream promoter-transcription factor I) (34, 41). These transcription factors additionally affected axonal outgrowth and projection (40, 42, 43, 44). It is intriguing that COUP-TFI and GCNF take partially overlapping roles in neurogenesis-related processes, albeit with sometimes contrary results. For example, although GCNF promoted the choice of neuronal fate (Koziollek-Drechsler, I., U. Sattler, A. M. Jetten, and C. Zechel, manuscript in preparation) and subsequent neuronal differentiation in embryonal carcinoma cell lines (this paper) high levels of COUP-TFI impeded neuronal differentiation in the same model systems (33, 34). Moreover, GCNF is likely to influence cell migration through the integrin subunits 5 and 6 (39), whereas COUP-TFI may affect cell-cell contacts by regulating the levels of E-cadherin and vitronectin (34). Finally, the expression of the neuron-specific microtubule-associated protein MAP2, which is important for cellular migration and morphogenesis (45) (aspect morphogenesis is discussed below), was positively correlated to the expression level of GCNF (Fig. 3B) and negatively to that of COUP-TFI (33).
Effects of GCNF on Differentiation and Maturation of Neurons
During differentiation and maturation, neurons develop neurites that are defined as dendrites and axons by their unique morphology and function. Although not yet fully understood, the determination and outgrowth of dendrites and axons involves the highly coordinated rearrangement of the actin and microtubule cytoskeleton and associated proteins (for recent review, see Ref.45). Functional competence of mature neurons depends on the induction and later segregated expression of neuron-specific proteins, as well as on the acquirement of electrical conductance properties, which relies on the presence of functional voltage-dependent sodium and potassium channels (Refs.45, 46, 47 and references therein). Consistently, our gcnf sense and antisense clones showed that the level of gcnf expression affected the time course of neuron maturation. This was related to the down-regulation of nestin, and the induction and up-regulation of a subset of neuronal proteins, indicating that several but not all aspects of neuronal differentiation were influenced by GCNF.
Nestin is a type VI intermediate filament that is typically expressed in undifferentiated neuroepithelial cells in the developing central nervous system and absent in differentiated neuronal cells (31). At d 3 of neural differentiation, nestin expression had become similarly extinct in the nonneuronal cells of differentiating gcnf sense and antisense, as well as wild-type cultures. Within the next 48 h, nestin was down-regulated in almost all neuronal cells of the wild-type and the gcnf overexpressing cultures. In contrast, it remained detectable in most of the neuronal cells of antisense cultures until stages when the nucleus had already reached its polar position. Coexpression of nestin and the neuronal proteins GAP-43, MAP2, and Syp was observed in neuronal cells of the GCNF knock down until d 8. Because nestin is a definitive marker for not fully differentiated neuronal cells (31), this indicated that neuronal differentiation was delayed in cultures with reduced GCNF levels.
Compared with the wild type, the neuronal cells in gcnf-overexpressing cultures showed similar or enhanced levels of MAP2, and increased expression of Syp. Moreover, they reached the stage when they displayed typical electrical conductance properties of mature neurons earlier than wild-type neurons. The ability of d 9 neurons to respond to electrical pulses with transient sodium inward currents, in particular, was stronger. Syp is a synaptic vesicle protein, important for the transfer of information among mature neurons, which involves the release of neurotransmitters by a vesicle-mediated mechanism (for recent review on Syp, see Ref.46). Thus, the earlier induction and quicker up-regulation of Syp in the gcnf sense cultures, may, at least partially, account for their shortened time course of maturation.
The expression of the neuronal proteins MAP2 and Syp was largely impaired in PCC7-Mz1 cultures expressing the gcnf antisense RNA, and the time course by which the neurons acquired functional competence was significantly delayed. Because neuron-specific MAPs might affect neurite initiation through altering the microtubule function by stabilizing polymers, inducing microtubule bundles, or targeting signaling molecules to the microtubule domain (Ref.45 and references therein), and because Syp is a synaptic vesicle protein (Ref.46 and references therein), the impaired expression of these proteins may be causally linked to the delay in maturation of neuronal cells in the GCNF knock down cultures. In situ MAP2 and Syp staining of neuronal cells at d 12 and later no longer revealed significant differences between the antisense and wild-type cultures, suggesting that the expression levels of these proteins recovered during later stages of differentiation. In addition, older antisense cultures contained neurons with pyramidal, bipolar, or complex morphology that developed the wild type’s typical segregated expression of GAP-43, MAP2, and Syp. Finally, at d 12 and later, these neurons 1) displayed structures (spines) that might mediate synaptic contacts, and 2) acquired the typical conductance properties of mature neurons, indicating that reduced amounts of GCNF did not abrogate but only delayed differentiation and maturation of neuronal cells.
The induction of GAP-43 expression, its subcellular localization, and the amount of GAP-43 protein in whole cell extracts from neurally differentiating gcnf antisense clones was indistinguishable from the wild type, and very similar to the sense clones. This is important in the view that GAP-43 was shown to affect cell cycle regulation, neuronal differentiation and apoptosis in embryonal carcinoma cell lines (48, 49), and that it is crucial for the establishment of axonal outgrowth during initiation and remodeling of neural connections in the developing vertebrate nervous system (50).
In conclusion, we provide evidence that the level of GCNF expression is critical for 1) the aggregation of neuronal cells and restructuring of neuron networks, 2) the time course during which the neuron-specific microtubule-associated protein MAP2 and the synaptic vesicle protein Syp reach their full expression level, 3) the down-regulation of the type VI intermediate filament protein nestin, and 4) the acquirement of polarity and the typical conductance properties of mature neurons. In view that neuronal differentiation in the PCC7-Mz1 model reflects most aspects of the in vivo situation, our data predict mechanisms by which GCNF might regulate neuronal differentiation in the embryo and/or adult of higher vertebrates.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
To reveal expression of endogenous or transgenic gcnf RNA the following forward (F) and reverse (R) primers were used: gcnf-F1 [5'TCAAGGATTACACGTGCCTC3']; gcnf-R1 [5'GGCAAGCACATCATAAGATC3']; flag-R [5'ATCGTCGTCATCCTTGTAATC3']; gcnf-R 3'-untranslated region [5'GGAGCCTGTGCTGCCTAC3'].
Cell Culture, Neural Differentiation, and Stable Transfection
Properties, culture conditions, and RA-induced neural differentiation of PCC7-Mz1 cells were as described (25). Induction of neural differentiation was with 0.1 µM of all-trans-RA (Sigma, St. Louis, MO). At d 1 of neural differentiation, the culture medium was replaced by the same medium, additionally containing 1 mM dibutyryl cAMP (Roche Molecular Biochemicals, Mannheim, Germany).
As the recipient for the stable transfection, we first produced the cell line PCC7-Mz1 TRep (Loncarevic, I., and C. Zechel, manuscript in preparation). TRep harbors a single chromosomal integration of pcDNA6TR (Invitrogen Life Technologies) and is otherwise indistinguishable from the parental cell line PCC7-Mz1. Transfection of the gcnf-flag sense and antisense construct was with lipofectamine (Invitrogen Life Technologies). The cell population was maintained for 10–14 d under selecting conditions [DMEM/12.5% fetal calf serum, 100 µg/ml Zeocin (Invitrogen Life Technologies)], with medium exchange every second day, followed by an amplification period, and limited dilution in 96-well plates. Induction of transgene expression was with tetracycline (4 µg/ml).
Semiquantitative RT-PCR
Cells were harvested in 1x TEN [10 mM Tris-HCl (pH 7.5); 1 mM EDTA (pH 8.0); 150 mM NaCl] and subjected to extraction of total RNA by RNeasy Mini Kit (QIAGEN, Valencia, CA). Characterization of RNA was according to standard protocols (51). RT-PCR was performed with deoxyribonuclease I-treated total RNA from independent series of cells. cDNA synthesis was with the avian myeloblastosis virus-first-strand cDNA synthesis kit (Roche Molecular Biochemicals) using 100 ng RNA in oligo deoxythymidine (dT)-primed and 500 ng RNA in random-primed reactions. Second-strand synthesis was performed with 1/20 of oligo-dT-primed and 1/40 of random-primed cDNA. Analyses of gcnf and gcnf-flag expression comprised at least three independent experiments at different rounds of amplification (26, 28, 30, 32, and/or 35 cycles). Amplification of the internal control gapdh was for 20, 23, and/or 25 cycles. In general, one fifth of the individual second strand reaction was run on agarose gels, followed by quantification with the GS250 Molecular Imaging System (Bio-Rad, Hercules, CA).
Immunocytochemistry and Quantitative Assessment of Cell Numbers
For immunocytochemistry studies, cells were grown at a density of 2 x 104cells/cm2 on plastic support or on glass cover-slips in 24-well plates. Induction of differentiation was as described (25). Fixation was with ethanol/acetic acid [95:5 vol/vol]. Note that cells were not fixed before IMF with Thy1.2. Dapi nuclear staining was subsequent to antibody treatment using Hoechst 33258 according to the manufacturer’s instruction. Immunofluorescence was recorded as described previously (25) or using the Leica (Solms, Germany) DM IBRE and accompanying software. To determine the relative number of astroglia, neuronal, fibroblast-like, and endothelial cells we applied two strategies: 1) cells were stained with specific antibodies and/or Dapi followed by subsequent counting in situ. 2) Cells were harvested and replated on adhesive coverslips before immunocytochemistry and counting, as described previously (25).
Whole Cell Protein Extracts and Western Blot Analysis
Cells were washed twice with ice-cold PBS and harvested in 1x TEN [10 mM Tris-HCl (pH 7.5); 1 mM EDTA (pH 8.0); 150 mM NaCl]. Lysis was accomplished in the high-salt WCE buffer [500 mM NaCl, 250 mM Tris-HCl (pH 7.5), 20% glycerol, 5 mM dithiothreitol, containing protease inhibitor cocktail and phenylmethylsulfonyl fluoride], followed by two freeze/thaw, two sonication cycles, and high-speed centrifugation at 30 Krpm and 4 C for 30 min (L8-60M: rotor 60 Ti; Beckman-Coulter, Fullerton, CA). Proteins were characterized and quantified according to standard protocols (51).
If not indicated otherwise, Western blot analysis with antibodies specific for the FLAG-epitope, RTR/GCNF, Syp, or GAP-43 was with 20 µg of WCE. Proteins were resolved by SDS-PAGE (10% resolving gel, 4% stacking gel; Minigel system Protean II, Bio-Rad) and transferred onto nitrocellulose membrane (Bio-Rad) using the semidry transfer system TransBlot SD (Bio-Rad). For analyses with MAP2 and nestin we loaded 120 µg and 60 µg of WCE, respectively. Electrophoresis was at 35V-55V for 12 h-16 h at room temperature [run buffer: 25 mM Tris base (pH 8.3), 250 mM glycine, 0.1% (wt/vol) sodium dodecyl sulfate (SDS)], using the Hoefer electrophoresis system (SE 600 series) and discontinuous SDS polyacrylamide gels (4%–10% gradient resolving gel; 4% stacking gel). Transfer of proteins was in buffer containing 25 mM Tris-base (pH 8.3), 250 mM glycine, 0.3% [wt/vol] SDS, 20% ethanol. In any case, bound antibodies were revealed by chemiluminescence using peroxidase-conjugated secondary antibodies, SuperSignal West Pico (Pierce, Rockford, IL), and Kodak (Rochester, NY) BioMax x-ray films.
Antibodies
The following primary monoclonal (mAb) or polyclonal antibodies were used: mouse A2B5 mAb [cell culture supernatant]; mouse pan-actin mAb (Chemicon, Temecula, CA); mouse mAb against the stem cell marker ECMA [cell culture supernatant; (24)]; mouse anti-FLAG mAb M2 (Sigma); rabbit affinity-purified serum against the growth-associated protein 43 (GAP-43) [gift by Dr. T. Herget]; mouse -glial fibrillary acidic protein mAb (Chemicon); mouse MAP2a/b mAb (clone AP20; Chemicon); rat MESA mAb (gift by Dr. C. Goridis); mouse antinestin mAb (Chemicon); rabbit polyclonal serum directed against a unique peptide sequence of the mouse GCNF/RTR (gift by Dr. A. Jetten); rabbit polyclonal serum directed against Syp (gift by Dr. R. Jahn); rat Thy1.2, mAB (Pharmingen, BD Biosciences, San Diego, CA).
The secondary antibodies used in immunocytochemistry were: rabbit antimouse fluorescein isothiocyanate (FITC) (Dako, Carpinteria, CA), rabbit antirat FITC (Dako) goat antimouse FITC M4 (Caltag Laboratories), goat antirabbit Texas red (TxR) (Jackson ImmunoResearch, West Grove, PA); goat antimouse TxR (Jackson ImmunoResearch), goat antirabbit Cy3 (Jackson ImmunoResearch); goat antirat Cy3 (Dianova, Hamburg, Germany). For immunoblots we used goat antimouse and goat antirabbit IgG, both peroxidase conjugated (Immunotech, distributed by Beckman-Coulter).
Electrophysiological Studies
Differentiation of cells was as for immunocytochemistry studies, except that we used fibronectin (Sigma; Fibronectin: 2 µg/cm2)-coated glass coverslips. Experiments were in the whole cell configuration of the patch-clamp techniques, using an EPC9 amplifier (HEKA, Lambrecht, Germany) and the WinTIDA data acquisition system (HEKA). Preparation of recording pipettes, as well as the setting of current clamp and voltage clamp experiments has been detailed elsewhere (25). The Sigmaplot software (Jandel Scientific, Erkrath, Germany) was used in computer-based analysis.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Present address for U.S.: Institute of Physiology and Pathophysiology, Johannes Gutenberg University, Medical School, Duesberg Weg 6, 55099 Mainz, Germany.
Abbreviations: CMV, Cytomegalovirus; COUP-TFI, chicken ovalbumin upstream promoter-transcription factor I; dT, deoxythymidine; EC, embryonal carcinoma; FITC, fluorescein isothiocyanate; GAP, growth-associated protein; GCNF, germ cell nuclear factor; MAP, microtubule-associated protein; mAB, monoclonal antibody; RA, retinoic acid; RAP, RTR-associated protein; RAR, RA receptor; RTR, retinoid-related testis-associated receptor; RXR, retinoid X receptor; SDS, sodium dodecyl sulfate; TxR, Texas red; WCE, whole cell protein extract.
Received for publication June 23, 2004. Accepted for publication July 26, 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
NURSA Molecule Pages Link:
This article has been cited by other articles:
 |
|
 |
|
  Z.-J. Lan, X. Xu, A. C.-K. Chung, and A. J. Cooney Extra-Germ Cell Expression of Mouse Nuclear Receptor Subfamily 6, Group A, Member 1 (NR6A1) Biol Reprod, May 1, 2009; 80(5): 905 - 912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hentschke, I. Kurth, U. Borgmeyer, and C. A. Hubner Germ Cell Nuclear Factor Is a Repressor of CRIPTO-1 and CRIPTO-3 J. Biol. Chem., November 3, 2006; 281(44): 33497 - 33504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-G. Joung, D. Shin, R. H. Seong, and B.-T. Zhang Identification of regulatory modules by co-clustering latent variable models: stem cell differentiation Bioinformatics, August 15, 2006; 22(16): 2005 - 2011. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Zechel Requirement of Retinoic Acid Receptor Isotypes {alpha}, {beta}, and {gamma} during the Initial Steps of Neural Differentiation of PCC7 Cells Mol. Endocrinol., June 1, 2005; 19(6): 1629 - 1645. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
