| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
The Walter and Eliza Hall Institute of Medical Research (S.J.H., D.W.K., S.Y., R.S.N.), Parkville 3050, Australia; and Department of Medicine (S.J.H., G.B., P.K., L.A.B.), University of Melbourne, Austin Hospital, Heidelberg 3084, Australia
Address all correspondence and requests for reprints to: R. S. Norton, The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville 3050, Australia. E-mail: ray.norton{at}wehi.edu.au.
| ABSTRACT |
|---|
|
|
|---|
-helix followed by a loop, a three-stranded antiparallel ß-sheet incorporating a second loop, and finally a disulfide-bonded flexible third loop. The IGF-II binding site on the C-domain was identified by examining NMR spectral changes upon complex formation. It consists of a largely hydrophobic surface patch involving the
-helix, the first ß-strand, and the first and second loops. The site was confirmed by mutagenesis of several residues, which resulted in decreased IGF binding affinity. The IGF-II binding site lies adjacent to surfaces likely to be involved in glycosaminoglycan binding of IGFBPs, which might explain their decreased IGF affinity when bound to glycosaminoglycans, and nuclear localization. Our structure provides a framework for understanding the roles of IGFBP C-domains in modulating IGF actions and conferring IGF-independent actions, as well as ultimately for the development of therapeutic IGF inhibitors for diseases including cancer. | INTRODUCTION |
|---|
|
|
|---|
IGF actions are finely regulated by a family of six high-affinity IGF binding proteins (IGFBPs 16) (4, 5, 6). IGFBPs inhibit IGF actions by competing with the IGF-I receptor (IGFIR) for IGF binding. They can also enhance IGF actions in some situations by mechanisms that are incompletely understood. In addition, IGF-independent actions of some IGFBPs, including inhibition of cell proliferation and survival, have been described recently (6).
IGFBP-6, the subject of the present study, differs functionally from other IGFBPs in binding IGF-II with 20- to 100-fold higher affinity than IGF-I, whereas IGFBPs 15 do not have a marked IGF binding preference. As a consequence, IGFBP-6 is a relatively specific inhibitor of IGF-II actions (7). Consistent with the notion that inhibiting IGF actions may decrease cancer growth, IGFBP-6 inhibits growth of IGF-II-dependent tumors in vitro and in vivo (8, 9).
IGFBPs consist of three domains of approximately equal size (4, 6). The N- and C-terminal domains are each internally disulfide-linked and share a high degree of sequence homology across the family (10). In contrast, there is little homology among their central L-domains. The disulfide linkages of the N-domain of IGFBP-6 differ from those of other IGFBPs (10), whereas the C-domain disulfides are the same in all IGFBPs so far studied (10, 11, 12). Both the N- and C-domains of IGFBPs are implicated in high-affinity IGF binding because isolated N- and C-domains bind IGFs with lower affinity than full-length IGFBPs (6).
The three-dimensional structures of full-length IGFBPs have not yet been determined. The only structural information available is for residues 4092 of the N-domain of IGFBP-5, alone (13) and in complex with IGF-I (14). This region, dubbed mini-IGFBP-5, binds IGFs with 10- to 200-fold lower affinity than full-length IGFBP-5 (13). It contains a hydrophobic IGF binding site within a novel protein fold, and mutation of key hydrophobic residues within this region of IGFBP-5 and the equivalent region of IGFBP-3 dramatically reduces IGF binding, confirming its importance in IGF binding (15).
Residues in the C-domain are also important for high affinity IGF binding, as shown by deletion and site-directed mutagenesis (11, 16). However, the lack of a structure of the C-domain of any IGFBP precludes a complete understanding of the molecular mechanisms by which IGFBPs modulate IGF actions. We have therefore determined the structure of the C-domain of IGFBP-6 (C-BP-6) using NMR. In addition, we have mapped the surface of C-BP-6 that interacts with IGF-II by monitoring changes in the NMR spectrum of 15N-labeled C-domain upon titration with IGF-II. The C-domain of IGFBP-6 has a thyroglobulin type 1 fold that interacts with IGF-II through a largely hydrophobic surface patch involving the
-helix, the first ß-strand, and the first and second loops. This site was confirmed by site-directed mutagenesis of a number of residues, resulting in decreased IGF binding.
| RESULTS |
|---|
|
|
|---|
|
-helix from Pro162 to Thr176, followed by the first loop, from Glu177 to Thr184. This is followed by the first strand of a three-stranded antiparallel ß-sheet encompassing residues Leu185 to Asp191. The end of the first strand is stabilized by the Cys163-Cys190 disulfide bridge and the packing of relatively conserved hydrophobic side chains between the
-helix and the strand. Residues Asp191-Gly194 form a well-defined type I ß-turn, which is followed by a ß-bulge at Tyr196-Lys198. The protein backbone then forms the second and third strands of the ß-sheet involving residues Arg199-Ser204 and Cys212-Val215, stabilized by the Cys201-Cys212 disulfide bond. A second loop spans residues Gln205-Pro211 and a second distorted type I ß-turn begins at Asp216. After Pro223, there is a third, highly disordered loop, comprised largely of hydrophilic residues and restrained principally by the Cys214-Cys234 disulfide bond. The C-terminal tail, from residues Pro235-Ser240, is also disordered in the structure. A short region of well-defined structure is present in loop III from Gly230-Cys234.
|
and
angles and the side-chain
1 angles are presented in Fig. 2
and
angles are well-ordered (S
,
> 0.9) for all residues except in the three loops and the C terminus, indicating that the structure is otherwise well defined. Within the structured core of the molecule, residues in loops I and II exhibited secondary peaks in the 15N-1H heteronuclear single-quantum coherence (HSQC) spectrum, consistent with slow conformational exchange. The major conformation accounts for approximately 60% of the protein in solution. Pro211, located at the distal end of the second loop adopted a cis conformation, as defined by its Cß and C
chemical shifts (19), a strong Gly210 H
to Pro211 H
NOE, and the absence of Gly210 H
to Pro211 H
NOEs. The trans form was not observed, so it is not possible to say whether cis-trans isomerism around the peptide bond preceding Pro211 is the source of conformational heterogeneity. All other Pro residues adopted trans conformations. Of the three disulfide bridges in C-BP-6, two, Cys201-Cys212 (right-handed) and Cys214-Cys234 (left-handed) are trans and Cys163-Cys190 (left-handed) is cis.
|
-helix and the first ß-strand (Fig. 3A
|
|
|
Spin-spin relaxation rate (R2) measurements of C-BP-6 in the presence and absence of IGF-II provided an alternative measure of spectral perturbations caused by IGF-II binding. Residues with significant increases in the relaxation rate were, in order of decreasing magnitude, Val187, Gln175, Arg165, Arg199, Gly194, Arg193, Val178, Leu174, Tyr196, Asp191, Gln200, Val215, His166, Trp213, Ala182, Leu167, Asp168, Leu171, Ser221, Cys214, and Lys198. The residues of the third loop and C-terminal tail showed no change in R2. R2 data from residues Asn189 and Gly210 could not be fitted due to weak signal and rapid decay for IGF-II-bound C-BP-6, whereas His192 showed rapid decay when both free and bound. Residues excluded from analysis due to peak overlap were Val170, Gln172, Gln173, Glu177, Tyr179, Arg180, Gln183, Tyr186, Arg197, Cys201, Arg202, Arg208, and Arg217.
Site-Directed Mutagenesis Confirms the IGF Binding Site of C-BP-6
Based on the above findings, Ser203, Ser204, and Gln205 were mutated to Ala and competition binding studies performed using [125I]IGF-II. This mutation led to a 5-fold decrease in binding affinity for IGF-II but IGF-I affinity was not affected (Fig. 6
, A and B), suggesting that these residues may be involved in the IGF-II binding preference of IGFBP-6. Asn189 is conserved in IGFBPs 16 and lies within the putative IGF binding site. Mutation of this amino acid to Ala resulted in 3-fold decreased binding affinity for both IGF-I and -II (Fig. 6
, A and C). These results confirm that residues within the putative IGF binding site contribute to IGF binding.
|
| DISCUSSION |
|---|
|
|
|---|
Single or multiple thyroglobulin type 1 domains are found in many functionally unrelated proteins. Some of these inhibit cysteine proteases, and it has been proposed that these domains regulate proteolysis (25). The crystal structure of p41 Ii shows that its three loops are inserted into a cleft that forms the cathepsin L active site, thereby providing a mechanism of protease inhibition (25). These three loops exhibit the greatest divergence in amino acid sequence between p41 Ii and C-BP-6 and are also the most divergent among the IGFBP C-domains. Nevertheless, IGFBPs-3, -5, and -6 inhibit proteolysis of IGFBP-4 (27). This activity was isolated to a basic region of the C-domains of these IGFBPs corresponding to residues Cys190-Gln207 in C-BP-6. This region includes residues homologous with those that are important for cathepsin binding in the second loop of p41 Ii; in particular, Ser230 of p41 Ii interacts with cathepsin L residues in the catalytic site and this Ser is conserved in all IGFBPs except IGFBP-4.
The IGF-II Binding Site on C-BP-6
The IGF-II binding site on C-BP-6 is located on one face of the molecule encompassing the hydrophobic region between the
-helix and the first extended strand, the first strand itself, and the first and second loops (Fig. 5B
). This surface includes residues Leu174, Val178, Gly181, Val187, Asn189, Cys190, Gly194, Arg199, Ser203, Ser204, Gln205, and Gly206. Arg164, Leu167, Leu171, Ala182, Pro188, and Cys201 are also believed to be part of the binding site but this could not be verified experimentally due to spectral complexity. In contrast to the relatively compact IGF-I binding surface of the N-domain of IGFBP-5 (13, 14), this is a larger surface and it is likely that the binding site involves the summation of a large number of relatively weak contacts between the C-domain and IGF-II. It is therefore not surprising that mutation of residues within the C-domain site results in relatively modest reductions in IGF binding affinity. Indeed, many such mutations might be necessary to completely abolish C-domain interactions with the IGFs.
This surface is distinct from the loop regions of p41 Ii involved in cathepsin L binding, and its hydrophobic nature suggests a different mode of interaction. Thus, although C-BP6 and p41 Ii share a common thyroglobulin type 1 fold, they use quite distinct parts of the structure to achieve their biological functions. It will be interesting to see which parts of this fold are used by yet other proteins containing this domain, such as nidogen, a basement membrane glycoprotein that binds laminin, and saxiphilin, a transferrin-like protein that binds the neurotoxin saxitoxin.
Before the present study, there was no clear consensus as to the location of the IGF binding site in the C-domain of IGFBPs. There have therefore only been limited studies of the roles of C-domain residues of IGFBPs in high-affinity IGF binding. Knowledge of the structure of C-BP-6 now allows these studies to be cohesively integrated, and they are consistent with the proposed IGF binding site. In general, they show that the region spanning the last disulfide bond of the C-domain is not substantially involved in IGF binding, consistent with the lack of ordered structure of this part of C-BP-6. Thus, point and deletion mutations in this region of the C-domains of IGFBP-1 (28), IGFBP-2 (11), and IGFBP-4 (29) did not substantially affect IGF binding. However, photoaffinity-labeled IGF-I contacted IGFBP-2 residues beyond the equivalent of Gly230 of C-BP-6 (30); it is difficult to reconcile this with our structural information, although other findings of that study are consistent with ours (as discussed in the next paragraph).
More proximal C-domain deletions have a more marked effect on IGF binding. Deletion of IGFBP-4 beyond the equivalent of Cys212 decreased IGF-I binding approximately 7-fold (29). Deletion beyond the C-BP-6 equivalent of His192 in bovine IGFBP-2 resulted in a decrease in binding affinity that was more marked for IGF-II, suggesting that His192-Gly206 are involved in IGF binding (11). This is consistent with our mutagenesis results implicating Ser203, Ser204, and Gln205 in IGF-II but not IGF-I binding; these residues appear to contribute to the IGF-II binding preference of IGFBP-6. A contact site in IGFBP-2 corresponding to Val178-His192 of C-BP-6 was identified using photoaffinity-labeled IGF-I (30), which is also consistent with the effect of mutation of Asp189 in the present study. This residue is conserved in all IGFBPs; in contrast to the Ser203, Ser204, and Gln205 mutation, both IGF-I and -II binding were affected equally by mutation of Asn189, suggesting that it is involved in IGF binding but not in IGF-II binding specificity.
Mutation in IGFBP-5 of the C-BP-6 equivalent of Gly194 to Lys decreased IGF-I binding approximately 7-fold (16, 31). In contrast, mutation of this residue to Ala in IGFBP-6 had no effect on IGF binding. Gly194 is found on the surface of C-BP-6 in the first ß-turn (Figs. 1
and 6A
), and its NMR peak is affected by IGF-II binding, suggesting that it forms part of the IGF binding site. However, it is a conserved residue in the thyroglobulin type 1 fold and its mutation may also have altered relationships between secondary structural elements, thereby indirectly changing the conformation of the IGF binding site. The observed decreased IGF binding affinity for IGFBP-5 may therefore have been due to substitution of a large, charged residue for a Gly, resulting in perturbation of local structure, in contrast to the more conservative mutation to Ala in IGFBP-6. Mutation of a second IGFBP-5 residue, the C-BP-6 equivalent of Gln200 to Ala, decreased IGF binding approximately 5-fold (16, 31). Although circular dichroism spectroscopy suggested that this mutation did not lead to gross conformational change (32), Gln200 is only surface exposed to a very limited extent on the opposite face of the C-domain to the IGF binding site, and the effect of its mutation is likely to be due to structural disturbance rather than direct interaction with IGFs. Interestingly, mutation of the equivalent of Gly194 to Ala in conjunction with mutation of Gln200 resulted in a larger decrease in IGF binding than mutation of either residue alone (32); this may have resulted from the combined effect of two relatively small perturbations in structure.
Other Functional Motifs on C-BP-6
C-domains of some IGFBPs interact with other biomolecules that modulate IGFBP effects on IGF actions and mediate IGF-independent effects. C-BP-6 includes a region rich in basic residues that have been implicated in binding glycosaminoglycans in IGFBP-3 and -5 (33). IGFBP-6 also binds to glycosaminoglycans, although binding is inhibited by its own O-linked glycans (34). It has been postulated that the basic-rich region of IGFBP-5 forms an
-helix, resulting in the formation of a highly charged heparin binding site (31); our C-BP-6 structure clearly shows that this is not the case.
Binding to glycosaminoglycans results in cell association and reduced IGF binding affinity; these processes contribute to potentiation of IGF activity by IGFBPs under some circumstances. In IGFBP-3 and -5, the equivalents of His192, Arg193, Arg197, and Gln205 of CBP-6 are involved in binding heparin (33), and these key residues are located on the same face of C-BP-6 (Fig. 3A
). Mutation of these basic residues does not affect IGF binding by IGFBP-5 (33). However, the heparin binding patch is adjacent to the putative IGF binding site on C-BP-6, so that glycosaminoglycan binding may interfere physically with IGF binding.
IGFBPs-3 and -5 localize to the nucleus, where they interact with nuclear components including transcription factors. Nuclear localization is thought to be especially important for IGF-independent actions of these IGFBPs, and a basic sequence (Arg228, Gly229, Arg230, Lys231, and Arg232 in IGFBP-3) is essential for this process (35). The equivalent residues in C-BP-6, Gln205-Arg209, form the exposed second loop of C-BP-6 (Fig. 1
), which is contiguous with the glycosaminoglycan binding site (Fig. 3
). Other basic residues in the same region facilitate nuclear localization (35), and some of these are also important for heparin binding. IGFBP-6 may localize to the nucleus in some cells (36).
Conclusions
The C-BP-6 structure described here adds important information to our understanding of the structure-function relationships of IGFBPs. The distinct binding sites and modes of interaction for cathepsins and IGF-II within a common thyroglobulin type 1 fold exemplify the multifunctional nature of proteins containing this fold. The proximity of the IGF and glycosaminoglycan binding sites provides a structural basis for the decrease in IGF binding affinity after IGFBP interaction with glycosaminoglycans. The site-directed mutagenesis studies show the utility of a structure-based approach to investigating the function of the C-domain, although further studies are clearly needed to obtain a complete understanding of IGF-IGFBP interactions. Because excess IGF activity is implicated in diseases such as cancer, this knowledge provides a valuable framework for the development of high affinity therapeutic IGF antagonists.
| MATERIALS AND METHODS |
|---|
|
|
|---|
NMR Spectroscopy
NMR experiments for structure determination were performed in Shigemi tubes with 1 mM protein in 95% H2O/5% 2H2O containing 10 mM sodium acetate (pH 4.5) and 0.02% (wt/vol) sodium azide. Spectra were recorded mostly at 25 C on a Bruker DRX-600 spectrometer using a triple-resonance probe equipped with triple-axis gradients. Diffusion measurements were performed using a pulsed field gradient longitudinal eddy-current delay pulse sequence (37, 38). Two-dimensional DQF-COSY (double-quantum filtered correlation spectroscopy), TOCSY (total correlation spectroscopy), and NOESY (nuclear Overhauser enhancement spectroscopy) (
m = 150 msec) spectra were acquired using the 15N-labeled sample with 15N decoupling, both in H2O and 2H2O. 15N HSQC, HNHA, HNHB, 15N-edited NOESY-HSQC (
m = 100 and 150 msec) and 15N-edited TOCSY spectra were also acquired using the 15N-labeled sample. HNCA, HNCACB, HNCO, HN(CA)CO, HCCH-TOCSY, HBHA(CO)NH and 13C-edited NOESY (
m = 150 msec) spectra were recorded using 13C, 15N-labeled sample. Standard pulse sequences were used for data acquisition, and water suppression was achieved using either WATERGATE (39) or echo- and anti-echo coherence selection schemes (40). For the 13C- and 15N-edited NOESY spectra, a recycle delay of 1.6 sec was used, and data matrix sizes were 1024 x 92 x 144 and 2048 x 48 x 160, respectively. An additional 15N-edited NOESY spectrum was acquired at 800 MHz with a mixing time of 100 msec. The 1H chemical shifts were referenced to the water peak, and the 13C and 15N chemical shifts were referenced indirectly using the 13C/1H and 15N/1H
-ratios (41). NMR data were processed in XWINNMR version 3.1 (Bruker Biospin) and analyzed using XEASY version 1.3 (42). 1H, 13C, and 15N chemical shifts assignments have been deposited in the BioMagResBank database with accession no. 5545 (17).
Angle restraints were based on 3JHNH
coupling constants derived from intensity ratios in the HNHA spectrum (43) 3JHNH
values < 6 Hz were converted to restraints of 60 ± 30 degrees, whereas 3JHNH
> 8 Hz were restrained to 120 ± 40 degrees. For the remaining residues, the
angle was restricted to the negative value if a positive
could be excluded based on NOE data (44).
Angle restraints were determined from the intensity ratios of HN-H
(i)/HN-H
(i-1) cross-peaks in the 15N NOESY-HSQC spectrum and only applied to regions of well-defined secondary structure (45).
and
angle restraints were also determined with TALOS (46). Hydrogen bond restraints were assigned based on exchange rates of 15N-bound protons measured by running a series of two-dimensional 1H-15N HSQC spectra at 15 min, 30 min, 1 h, and 4 h after dissolving the protein in 2H2O at 10 C. Hydrogen bonds were only included in latter rounds of structure calculations in regions of well-defined structure that initially converged on the basis of NOE restraints alone.
NOE Assignments and Structure Calculations
NOE cross peaks were assigned and initial structures calculated using the CANDID module of CYANA (47). Input data for CANDID were the chemical shift and peak intensity lists from the 13C- and 15N-edited NOESY spectra, dihedral angle restraints, and disulfide bonds. The resulting structures were further refined manually using CYANA 1.0.3 torsion angle dynamics algorithm and then in Xplor-NIH (48) using the distance geometry-simulated annealing protocol. Finally, the protein was refined in a shell of water using Xplor-NIH (48) on the basis of NOE and dihedral restraints and the geometry of bonds, angles, and impropers. A final family of 20 structures was selected on the basis of stereochemistry and energy considerations and analyzed using PROCHECK-NMR (49) and MOLMOL (50). The coordinates for the IGFBP-6 C-domain have been deposited in the Protein Data Bank (18) under accession code 1RMJ.
C-Domain Interaction with IGF-II
The IGF-II binding site on C-BP-6 was defined by monitoring NMR spectral perturbations upon complex formation. Unlabeled IGF-II was titrated into 0.3 mM 15N-CBP-6 in 10 mM sodium acetate, 0.02% (wt/vol) sodium azide in 95% H2O/5% 2H2O at pH 4.5. A series of two-dimensional 15N, 1H-HSQC spectra was recorded at IGF-II:15N-C-BP-6 ratios of 0.05:1, 0.10:1, 0.15:1, 0.20:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 1.25:1, 1.5:1, 1.75:1, and 2:1. C-BP-6 15N transverse relaxation times (T2) were measured at a 1:1 ratio. Fourteen relaxation delays were used, ranging from 15.4 to 308 msec with a recycle delay of 2.2 sec. The matrix size was 2048 x 180, with 32 scans per t1 increment. R2 for the various 15N, 1H resonances were compared with those obtained for unbound C-domain (51).
Site-Directed Mutagenesis of IGFBP-6
Site-directed mutagenesis was performed to confirm the putative IGF-II binding site in the C-domain of IGFBP-6. The template for mutagenesis was the cDNA for full-length IGFBP-6 inserted into pProEX-HTb (Invitrogen Life Technologies, Carlsbad, CA), which encodes an N-terminal His6-tag with a tobacco etch virus protease site. Three mutants were made, in which Ala was substituted for 1) Ser203, Ser204, and Gln205; 2) Asn189; and 3) Gly194, respectively. Mutations were made using the QuikChange method (Stratagene, La Jolla, CA) with the following oligonucleotides:
1) CGGCAGTGCCGCGCCGCCGCGGGGCAGCGCC and GGCGCTGCCCCGCGGCGGCGCGGCACTGCCG;
2) CACTCTACGTGCCGGCTTGTGACCATCG and CGATGGTCACAAGCCGGCACGTAGAGTG;
3) TTGTGACCATCGCGCGTTCTACCGGAAGC and GCTTCCGGTAGAACGCGCGATGGTCACAA
Mutations were confirmed by DNA sequencing. Proteins, including native IGFBP-6, were expressed in E. coli and purified by NiNTA-agarose chromatography. After elution, proteins were incubated with His6-tagged tobacco etch virus protease (Invitrogen Life Technologies) for 3 h at room temperature. Uncleaved protein, His6 tags and the protease were then removed by incubation with NiNTA-agarose. Cleavage efficiency was typically 40%.
Competitive Binding Assays
Competitive binding studies was carried out as described previously (52). Native IGFBP-6 or mutants were incubated with [125I]IGF-II (2 x 104 cpm, specific activity 140180 µCi/µg) ± unlabeled IGF-II (0.001313.4 nM) or IGF-I (0.013131 nM) for 18 h at 4 C in 0.1 M sodium phosphate buffer (pH 7.4) containing 0.1% BSA and 0.02% sodium azide. Free tracer was removed by incubation with ice-cold 5% charcoal, 2% BSA in Dulbeccos PBS, followed by centrifugation and counting of bound radioactivity in supernatants. Specific binding was calculated by subtracting the amount of tracer in samples without added IGFBP from total binding. Within each of three independent experiments, points were measured in duplicate; results are shown as mean ± SEM. Relative IGF binding affinities were estimated by comparing IGF concentrations at which 50% displacement of tracer occurred.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
S.J.H. and D.W.K. contributed equally to this paper.
Abbreviations: C-BP-6, C-domain of IGFBP-6; DQF-COSY, double-quantum filtered correlation spectroscopy; HSQC, 15N1H heteronuclear single-quantum coherence; IGFBP, IGF binding protein; IGFIR, IGF-I receptor; IGF-II/M6PR, IGF-II/mannose-6-phosphate receptor; Kd, dissociation constant; NMR, nuclear magnetic resonance; NOESY, nuclear Overhauser enhancement spectroscopy; R2, spin-spin relaxation rate; TOCSY, total correlation spectroscopy.
Received for publication June 18, 2004. Accepted for publication August 4, 2004.
| REFERENCES |
|---|
|
|
|---|
awski W, Beisel HG, Kamionka M, Kalus W, Engh RA, Huber R, Lang K, Holak TA 2001 The interaction of insulin-like growth factor-I with the N-terminal domain of IGFBP-5. EMBO J 20:36383644[CrossRef][Medline]
ar G, Punger
i
G, Klemen
i
I, Turk V, Turk D 1999 Crystal structure of MHC class II-associated p41 Ii fragment bound to cathepsin L reveals the structural basis for differentiation between cathepsins L and S. EMBO J 18:793803[CrossRef][Medline]
J couplings in calcium-free calmodulin using new 2D and 3D water-flip-back methods. J Biomol NMR 4:871878[CrossRef][Medline]
-angles in proteins by nuclear magnetic resonance spectroscopy. J Biomol NMR 2:227233[CrossRef][Medline]
This article has been cited by other articles:
![]() |
X. Wang, L. Lu, Y. Li, M. Li, C. Chen, Q. Feng, C. Zhang, and C. Duan Molecular and functional characterization of two distinct IGF binding protein-6 genes in zebrafish Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2009; 296(5): R1348 - R1357. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Fu, J. A. Thompson, and L. A. Bach Promotion of Cancer Cell Migration: AN INSULIN-LIKE GROWTH FACTOR (IGF)-INDEPENDENT ACTION OF IGF-BINDING PROTEIN-6 J. Biol. Chem., August 3, 2007; 282(31): 22298 - 22306. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Laursen, K. Kjaer-Sorensen, M. H. Andersen, and C. Oxvig Regulation of Insulin-Like Growth Factor (IGF) Bioactivity by Sequential Proteolytic Cleavage of IGF Binding Protein-4 and -5 Mol. Endocrinol., May 1, 2007; 21(5): 1246 - 1257. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yan, R. C. Baxter, B. Perbal, and S. M. Firth The Aminoterminal Insulin-Like Growth Factor (IGF) Binding Domain of IGF Binding Protein-3 Cannot Be Functionally Substituted by the Structurally Homologous Domain of CCN3 Endocrinology, November 1, 2006; 147(11): 5268 - 5274. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sitar, G. M. Popowicz, I. Siwanowicz, R. Huber, and T. A. Holak Structural basis for the inhibition of insulin-like growth factors by insulin-like growth factor-binding proteins PNAS, August 29, 2006; 103(35): 13028 - 13033. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Novinec, D. Kordis, V. Turk, and B. Lenarcic Diversity and Evolution of the Thyroglobulin Type-1 Domain Superfamily Mol. Biol. Evol., April 1, 2006; 23(4): 744 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Allan, E. Tonner, M. Szymanowska, J. H. Shand, S. M. Kelly, K. Phillips, R. A. Clegg, I. F. Gow, J. Beattie, and D. J. Flint Cumulative Mutagenesis of the Basic Residues in the 201-218 Region of Insulin-Like Growth Factor (IGF)-Binding Protein-5 Results in Progressive Loss of Both IGF-I Binding and Inhibition of IGF-I Biological Action Endocrinology, January 1, 2006; 147(1): 338 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sala, S. Capaldi, M. Campagnoli, B. Faggion, S. Labo, M. Perduca, A. Romano, M. E. Carrizo, M. Valli, L. Visai, et al. Structure and Properties of the C-terminal Domain of Insulin-like Growth Factor-binding Protein-1 Isolated from Human Amniotic Fluid J. Biol. Chem., August 19, 2005; 280(33): 29812 - 29819. [Abstract] [Full Text] [PDF] |
||||
![]() |
F E Carrick, M G Hinds, K A McNeil, J C Wallace, B E Forbes, and R S Norton Interaction of insulin-like growth factor (IGF)-I and -II with IGF binding protein-2: mapping the binding surfaces by nuclear magnetic resonance J. Mol. Endocrinol., June 1, 2005; 34(3): 685 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fernandez-Tornero, R. M. Lozano, G. Rivas, M. A. Jimenez, L. Standker, D. Diaz-Gonzalez, W.-G. Forssmann, P. Cuevas, A. Romero, and G. Gimenez-Gallego Synthesis of the Blood Circulating C-terminal Fragment of Insulin-like Growth Factor (IGF)-binding Protein-4 in Its Native Conformation: CRYSTALLIZATION, HEPARIN AND IGF BINDING, AND OSTEOGENIC ACTIVITY J. Biol. Chem., May 13, 2005; 280(19): 18899 - 18907. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |