| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mediates Induction of Lipogenesis and Regulation of Glucose Homeostasis in Leptin-Deficient Mice
Laboratory of Metabolism, National Cancer Institute (K.M., Y.I., F.J.G.), and Comparative Medicine Branch, National Institutes of Allergy and Infectious Diseases (J.M.W.), Molecular Disease Branch, National Heart, Lung, and Blood Institute (H.B.B.) and Diabetes Branch, National Institute of Diabetes and Digestive and Kidney Diseases (D.L.), National Institutes of Health, Bethesda, Maryland 20892; and Institut National de la Santé et de la Recherche Médicale, Unité 539 (G.L.), Hotel Dieu, 44000 Nantes, France
Address all correspondence and requests for reprints to: Frank J. Gonzalez, Building 37, Room 3106, National Institutes of Health, Bethesda, Maryland 20892. E-mail: fjgonz{at}helix.nih.gov.
| ABSTRACT |
|---|
|
|
|---|
(C/EBP
) is a critical factor in glucose metabolism in the neonate as revealed by conventional C/EBP
-null mice that do not survive beyond the first day after birth because of severe hypoglycemia and a deficiency in hepatic glycogen accumulation. To elucidate the function of C/EBP
in leptin-deficient mouse (ob/ob) liver, a C/EBP
-liver null mouse on an ob/ob background (ob/ob-C/EBP
/Cre+) was produced using a floxed C/EBP
allele and Cre recombinase under control of the albumin promoter (AlbCre). The C/EBP
-deficient liver in ob/ob mice had significantly decreased triglyceride content compared with equivalent mice lacking the AlbCre transgene (ob/ob-C/EBP
/Cre). Expression of genes involved in lipogenesis including fatty acid synthase, acetyl-coenzyme A carboxylase, stearoyl-coenzyme A desaturase 1 and ATP-citrate lyase dramatically decreased in ob/ob-C/EBP
/Cre+ mouse liver. Induction of these lipogenic genes by a high-carbohydrate diet caused an exacerbation in the development of fatty liver and an increase in liver size, hepatic triglyceride, and cholesterol contents in ob/ob-C/EBP
/Cre mice but not in ob/ob-C/EBP
/Cre+ mice. Deficiency in hepatic C/EBP
expression caused an exacerbation of hyperglycemia because of decreased insulin secretion. Taken together, these results indicate that hepatic C/EBP
plays a critical role in the acceleration of lipogenesis in ob/ob mice and in glucose homeostasis by the indirect regulation of insulin secretion. | INTRODUCTION |
|---|
|
|
|---|
) belongs to the basic leucine zipper class of transcription factors (1). All members of the C/EBP family have a C-terminal basic leucine zipper domain that is responsible for DNA binding and dimerization (2, 3). C/EBP
is expressed in adipose tissue, liver, intestine, lung, adrenal gland, peripheral-blood mononuclear cells, and placenta (4, 5). In liver and adipose tissue, the highest levels of C/EBP
mRNA are present in terminally differentiated cells (4, 6).
The developmental and physiological roles of C/EBP
have been investigated with the C/EBP
-null mouse (7, 8). These mice did not survive beyond the first day after birth because of severe hypoglycemia and a deficiency of hepatic glycogen and gluconeogenesis (7, 8). Furthermore, analysis of homozygous newborn mice showed that hepatocytes and adipocytes failed to accumulate lipid and had a defect in control of hepatocyte growth accompanied by a marked induction of the c-myc and c-jun genes, and altered lung development with unusual development of airways. These results suggest the involvement of C/EBP
in energy homeostasis during development. To study the role of C/EBP
in energy metabolism in liver at later stages of postnatal development, a conditional knockout allele of c/ebp
including loxp site was generated (9). C/EBP
expression in the mice was deleted specifically in liver by infusion of a recombinant adenovirus carrying the cre gene and resulting in a more than 90% recombination and loss of C/EBP
expression. These mice showed a decrease in phosphoenolpyruvate carboxykinase and glycogen synthase mRNA and a diabetic phenotype suggesting that C/EBP
also has an important role in glycogenesis and gluconeogenesis in mature adult liver thus indicating a role for this factor in control of energy homeostasis
Type 2 diabetes has become the most common metabolic disorder in the developed world. Type 2 diabetes results in an abnormal energy balance associated with severe insulin resistance including hyperglycemia and hyperinsulinemia. There is considerable interest in the biochemical or molecular mechanisms that contribute to the development and progression of type 2 diabetes. Obesity is a major component of the metabolic syndrome that includes hyperlipidemia and hypertension and commonly precedes the development of type 2 diabetes in genetically predisposed individuals. C/EBPß was found to be involved in hyperglycemia in streptozotocin-induced type I diabetes model by regulating gluconeogenesis (10, 11). In the present study, to elucidate role of C/EBP
in metabolic syndrome of type 2 diabetes, a liver-specific C/EBP
-null mouse on an ob/ob background was generated. These mice exhibited an improvement in fatty liver by impaired induction of lipogenic gene expression. Surprisingly, they also had lower insulin levels and altered glucose homeostasis.
| RESULTS |
|---|
|
|
|---|
-Null Mouse on an ob/ob Background
gene consists of two loxP sites flanking the entire C/EBP
coding region (9). The loss of C/EBP
mRNA was found only in ob/ob-C/EBP
/Cre+ liver and not in brain, fat and lung, other sites of C/EBP
expression (Fig. 1A
mRNA can give rise to two polypeptides of 42 and 30 kDa by alternative use of translation initiation codons from a single mRNA (12). In support of the mRNA analysis, both proteins were completely lost in the ob/ob-C/EBP
/Cre+ liver (Fig. 1B
mRNA and proteins in OB/OB-C/EBP
/Cre+ mice were also lost in liver (data not shown). In contrast to C/EBP
, C/EBPß mRNA and protein were unchanged in ob/ob-C/EBP
/Cre+ liver. To assess the potential effects of liver-specific C/EBP
deficiency, body and tissue weights were measured. For a period of 12 wk after birth, no significant difference in body, white adipose and liver weight was observed between ob/ob-C/EBP
/Cre and Cre+ (Table 1
-null mice described in earlier reports (7, 8), these results demonstrate that deficiency of adult hepatic C/EBP
is not lethal.
|
|
-Null Mice
/Cre+ mice had considerably smaller and fewer cytoplasmic vacuoles than those in ob/ob-C/EBP
/Cre (data not shown). The hepatic triglyceride (TG) content of ob/ob-C/EBP
/Cre+ mice was significantly lower (60% of ob/ob-C/EBP
/Cre) than that in ob/ob-C/EBP
/Cre mice (Fig. 2B-a
-null mouse had markedly decreased hepatic glycogen content (7, 8). However, under our conditions, glycogen content in ob/ob-C/EBP
/Cre+ mice was higher than that found in ob/ob-C/EBP
/Cre mice (Fig. 2B-c
|
(7). Surprisingly, G6Pase and PEPCK mRNA levels in liver were not different between OB/OB and ob/ob-C/EBP
/Cre and Cre+ mice (Fig. 2A
in both OB/OB and ob/ob backgrounds (Fig. 2A
/Cre and Cre+ mice were also observed in typical lipogenic genes, fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), S14, ATP-citrate lyase, malic enzyme, glycerol-3-phosphate acyltransferase, and stearoyl-CoA desaturase 1 genes. The ob/ob leptin deficiency results in elevated expression of lipogenic genes in liver (13). However, these genes were clearly expressed at lower levels in ob/ob-C/EBP
/Cre+ mice; the levels were almost as low as that found in the wild-type OB/OB mice (Fig. 2A
/Cre+ liver but not in OB/OB-C/EBP
/Cre+ (Fig. 2A
influences lipid accumulation in ob/ob mice liver by mediating the regulation of expression of the lipogenic genes.
The Liver-Specific C/EBP
-Null Mouse Is Resistant to Acceleration of Fatty Liver by High-Carbohydrate (HC) Diet
HC diet is a robust method of lipogenic gene induction (15). Because the expression of lipogenic genes in ob/ob-C/EBP
/Cre+ mice liver was dramatically decreased (Fig. 2A
), a HC diet was used to examine the relationship between hepatic C/EBP
and lipogenesis. Livers in the ob/ob-C/EBP
/Cre mice fed a HC diet for 12 d were significantly enlarged relative to those of Cre+ mice and were yellowish in appearance, typical of fatty liver (Fig. 3
, A and F). However, ob/ob-C/EBP
/Cre+ mice exhibited a dramatically improved fatty liver (Fig. 3
, A and F). Histological analysis of liver revealed the presence of numerous and large intracytoplasmic vacuoles in hepatocytes from the ob/ob-C/EBP
Cre mice (Fig. 3B-1
), whereas hepatocytes in the ob/ob-C/EBP
/Cre+ liver (Fig. 3B-2
) were much smaller and less numerous than those seen in ob/ob-C/EBP
/Cre. These vacuoles in ob/ob-C/EBP
/Cre were positive for the presence of lipid as revealed by Oil Red O staining (Fig. 3B-5
), but staining in ob/ob-C/EBP
/Cre+ liver was clearly less intense (Fig. 3B-6
). Interestingly, a significant difference in weight and weight gained after feeding HC for 12 d was observed between ob/ob-C/EBP
/Cre and Cre+ (Fig. 3
, C and D). The hepatic TG and TC contents of ob/ob-C/EBP
/Cre+ were also significantly lower (41% TG and 47% TC of ob/ob-C/EBP
/Cre) than that for ob/ob-C/EBP
/Cre (Fig. 3
, G and H). These results strongly suggest that hepatic C/EBP
positively regulates lipogenesis in the ob/ob liver.
|
Is Involved in Induction of Lipogenic Genes in ob/ob Mice
results in a marked decrease in the expression of lipogenic genes in ob/ob mice but not in OB/OB mice, the possibility exists that hepatic C/EBP
may be involved in the induction of lipogenic genes under leptin deficiency. To examine this possibility and to determine mechanism of fatty liver aggravated after HC feeding, mRNA levels of genes involved in hepatic lipogenesis were examined by HC feeding (Fig. 4A
/Cre mice were dramatically induced by HC feeding, as compared with a normal diet, whereas the induction in ob/ob-C/EBP
/Cre+ mice was clearly impaired. The induction in OB/OB-C/EBP
/Cre+ mice was unchanged or slightly impaired as compared with OB/OB-C/EBP
/Cre mice, except for FAS gene. SREBP1 induction was slightly impaired in ob/ob-C/EBP
/Cre+ mice, but other transcription factors showed no change (Fig. 4
/Cre+ mice fed a HC diet, a significant decrease in hepatic TC content was found (Fig. 3H
/Cre+ mice, whereas 3-hydroxy-3-methylglutaryl (HMG)-coenzyme A (CoA) synthase (Fig. 4B
/Cre+ and Cre mice, whereas the expression of ABCG5 decreased in ob/ob-C/EBP
/Cre+ mice fed a HC diet. Farnesoid X receptor (FXR) was specifically decreased on all Cre+ mice fed HC diets. Among potential FXR target genes, small heterodimer partner (SHP) was decreased but only in the ob/ob-C/EBP
/Cre+ mice. It is known that SHP is regulated by FXR and represses the pathway of bile production from cholesterol by decreasing Cyp7a1 expression. Although SHP expression was decreased in ob/ob-C/EBP
/Cre+ mice fed a HC diet, Cyp7a1 expression was already decreased in both OB/OB and ob/ob fed the HC diets indicating that this is because of diet alone and not genotype (Fig. 4B
|
for in the induction of lipogenic genes a fasting-refeeding regimen was carried out. The mRNA levels of all lipogenic genes were suppressed in livers of fasted mice and were markedly elevated by refeeding (Fig. 4C
/Cre mice by refeeding was higher than that of OB/OB-C/EBP
/Cre mice. However, genes that were induced by refeeding showed lower induction in ob/ob-C/EBP
/Cre+ mice. The fold induction in ob/ob-C/EBP
/Cre+ mice was almost same level with that of OB/OB-C/EBP
/Cre mice, suggesting that hepatic C/EBP
is involved in signaling the induction of lipogenic genes in ob/ob mice.
It is known that SREBP1 is critical for the induction of lipogenic genes by HC-feeding and fasting-refeeding (15). Indeed, SREBP1 mRNA in ob/ob-C/EBP
/Cre+ mice was decreased under the normal dietary conditions (Fig. 2A
), although it was only slightly decreased under the HC-feeding and fasting-refeeding (Fig. 4
, A and C. Because SREBP1 proteins are known to translocate to the nucleus in a form competent to activate gene transcription, the levels of SREBP1-active form in the nucleus is a more reliable gauge of target gene induction than the mRNA levels. Interestingly, protein levels of SREBP1-active form in ob/ob-C/EBP
/Cre+ mice were higher than that of ob/ob-C/EBP
/Cre mice (Fig. 4D-a
). These high levels in ob/ob-C/EBP
/Cre+ mice is possibly because of the decrease in insulin-induced gene 1 (INSIG1) (16), a known regulator of nuclear translocation (Fig. 4D-b
). These results indicate that the impaired induction of lipogenic genes in ob/ob-C/EBP
/Cre+ mice is not because of decreased SREBP1 mRNA.
Deficiency of Hepatic C/EBP
Leads to Lower Insulin and Cholesterol Levels in ob/ob Mouse Blood
To assess the effects of deficiency of liver-specific C/EBP
on diabetic phenotypes, the level of glucose was measured under the nonfasting and normal dietary conditions (Table 1
). Glucose levels in 6- and 12-wk-old ob/ob-C/EBP
/Cre+ mice were significantly higher than that of ob/ob-C/EBP
/Cre mice. Because the HC diet used in this study includes 37% sucrose, blood glucose levels during HC feeding was assessed by monitoring glucose levels every 2 d for 12 d (Fig. 5A
). Surprisingly, blood glucose levels in ob/ob-C/EBP
/Cre+ were dramatically increased on the first day of HC feeding. To further characterize glucose metabolism, glucose tolerance tests (GTTs) were performed before and after HC feeding after an exogenous load of glucose (Fig. 5B
). The glucose levels in ob/ob-C/EBP
/Cre+ were significantly elevated at all time points compared with ob/ob-C/EBP
/Cre (Fig. 5B-b
). No significant difference before and after HC feeding was observed.
|
/Cre+ mice at all time points were significantly lower than that of ob/ob-C/EBP
/Cre (
50% of ob/ob-C/EBP
/Cre). Further, to asses insulin sensitivity in ob/ob-C/EBP
/Cre+, insulin tolerance test is performed under the nonfasting and normal diet condition (Fig. 5D
/Cre+ after insulin injection is significantly higher than in the ob/ob-C/EBP
/Cre mice at all time points, suggesting that the unusually high glucose levels found after HC diets and the GTT result from lower insulin levels and worsen insulin resistance in ob/ob-C/EBP
/Cre+.
The serum lipid contents of ob/ob-C/EBP
/Cre and Cre+ are summarized in Table 1
. All lipid classes, TG, free fatty acids (FFA), TC of ob/ob-C/EBP
/Cre+ mice showed a tendency toward higher levels as compared with those of nonfasting ob/ob-C/EBP
/Cre mice. Significant difference in serum lipids was observed only with FFA levels. Although HC feeding caused an elevation of serum TG levels in ob/ob-C/EBP/Cre+ and Cre mice in a time-dependent manner, TG levels were not elevated in OB/OB-C/EBP/Cre+ and Cre mice (Fig. 5E-a
). Serum TC levels in ob/ob-C/EBP/Cre+ mice dramatically decreased from 7 d after HC-feeding as compared with ob/ob-C/EBP/Cre mice (Fig. 5E-b
) as reflected in hepatic TC levels (Fig. 3H
). FFA levels in ob/ob-C/EBP
/Cre+ mice at all time points showed a higher tendency than those of ob/ob-C/EBP
/Cre mice although this difference at 7 and 12 d did not reach statistical significance (Fig. 5E-c
). The difference in FFA levels was observed not only in ob/ob-C/EBP
/Cre+ mice but also in OB/OB-C/EBP
/Cre+ mice. To elucidate mechanisms for increased serum FFA in ob/ob-C/EBP
/Cre+ mice, lipase activities were measured under normal dietary conditions. However, no significant difference in the total and hepatic lipase activity was observed between ob/ob-C/EBP
/Cre+ and Cre mice (Fig. 5G
), consistent with similar amounts of plasma TG in both lines. We next characterized the TC levels decreased in ob/ob-C/EBP
/Cre+ mice by FPLC analysis of pooled serum samples collected 7 d after the initiation of the HC challenge. The FPLC profile (Fig. 5F
) of ob/ob-C/EBP
/Cre+ mice shows a sharp decrease in plasma high-density lipoproteins (HDL) as well as low-density lipoproteins (LDL) TC levels, and a parallel decrease in the levels of the major HDL and LDL Apo (AI/AII, E, B100/B48, Fig. 5F
, inset), compared with ob/ob-C/EBP
/Cre mice. In addition, ob/ob-C/EBP
/Cre+ mice had slightly increased very LDL (VLDL) TC and associated ApoB48 vs. ob/ob-C/EBP
/Cre animals.
| DISCUSSION |
|---|
|
|
|---|
in ob/ob Mice
in the adult were viable, whereas conventional C/EBP
-null mice do not survive beyond the first day after birth because of severe hypoglycemia by a deficiency of hepatic glycogen (7, 8). Furthermore, no significant difference in PEPCK, G6Pase was observed between Cre+ and Cre for both backgrounds (OB/OB and ob/ob). This result revealed that hepatic C/EBP
is critical for glyconeogenic or gluconeogenic pathways in only neonate and not in adult. In an earlier report, deficiency of C/EBP
induced by Cre introduced by acute adenovirus infection of adult C/EBP
(fl/fl) mice resulted in a decrease in PEPCK and G6Pase mRNA similar to what was reported with conventional C/EBP
-null mice (9). This suggests that acute or short loss of C/EBP
as produced by adenovirus-Cre infusion into adult liver leads to different phenotypes from mice made using the albumin-Cre. It should be noted that the albumin promoter is expressed in liver at low levels in fetal development (d 19) with promoter activity increasing gradually until adult levels are reached at 12 wk postnatally (17, 18). This could allow for compensation by other transcription factors that control the PEPCK and G6Pase genes. In this connection C/EBPß, when expressed from the C/EBP
gene locus, can functionally replace C/EBP
in liver (19). Furthermore, C/EBPß has been shown to compensate for loss of C/EBP
in the regulation of PEPCK gene expression (20). Thus, compensation for loss of C/EBP
by C/EBPß for control of genes involved in glyconeogenic and gluconeogenic pathways in adult liver cannot be excluded (11) although C/EBPß mRNA and protein levels were not different in Cre+ and Cre mice.
Hepatic C/EBP
Promotes Lipogenesis in ob/ob Mice
Hepatic fatty acid synthesis from glucose is elevated by 4 wk of age in ob/ob mice. Further, hepatic activities of lipogenic genes in ob/ob mice are dramatically increased by 7 wk of age (21). In the present study, hepatic C/EBP
was found to have a role in the acceleration of lipogenesis in ob/ob mice. Hepatic TG content significantly decreased in ob/ob-C/EBP
/Cre+ mice. Furthermore, HC feeding, an inducer of lipogenic genes in ob/ob-C/EBP
/Cre mice, caused an exacerbation in the development of fatty liver and an increase of liver size and hepatic TG content that were not observed in Cre+ mice. These results clearly indicate that hepatic C/EBP
promotes the development of fatty liver by mediating the induction of expression of lipogenic genes. The accumulation of hepatic TG is not only because of the acceleration of de novo lipogenesis. The uptake from dietary triglycerides or fatty acids to liver also contributes to the lipid accumulation in liver. However, the HC diet used in present study is a lipid-free diet. Therefore, decreased hepatic TG content in ob/ob-C/EBP
/Cre+ mice by HC feeding is likely because of impairment of de novo lipogenesis.
Interestingly, we also observed a marked decrease in hepatic TC content in ob/ob-C/EBP
/Cre+ mice fed a HC diet. This is likely because of the levels of FPP and 7DCR that are inducible during HC feeding in ob/ob-C/EBP
/Cre mouse liver, but not induced in ob/ob-C/EBP
/Cre+ mouse liver. FPP is a key enzyme in the biosynthesis of sterols, ubiquinone, dolichol, and heme (22), whereas 7DCR catalyzes the reduction of the
(7)-double bond of sterol intermediates, which is the terminal reaction in the pathway of cholesterol biosynthesis from lanosterol (23). FPP and 7DCR are not known to be rate-limiting enzymes in cholesterol biosynthesis. However, mutations in the human 7DCR cause Smith-Lemli-Opitz Syndrome and among the symptoms in this syndrome is typical low serum and tissue cholesterol (24, 25). Indeed, it was also reported that 7-dehydrocholesterol, which accumulates from posttranslational inhibition of 7DCR, suppresses sterol biosynthesis by feedback inhibition of HMG-CoA reductase activity (26). Thus, these results suggest that even though FPP and 7DCR are not rate-limiting enzymes, the reduction in expression of these genes could result in decreased cholesterol levels in liver or blood both directly and indirectly.
No difference in the expression levels of ABCA1 and ABCG8 (data not shown) was observed between ob/ob-C/EBP
/Cre+ and Cre mice. The decrease of ABCG5 expression in ob/ob-C/EBP
/Cre+ mice fed a HC diet does not appear to be of sufficient magnitude to contribute to the decreased hepatic cholesterol levels. It is known that SHP expression is regulated by FXR and elevated SHP represses Cyp7a1 expression by forming a transcriptionally inert heterodimer with LRH-1. Our results revealed that SHP expression that is elevated in the HC-fed ob/ob-C/EBP
/Cre mice, was decreased in ob/ob-C/EBP
/Cre+ mice. This decrease may be because of lower FXR expression in the ob/ob-C/EBP
/Cre+ mice on the HC diet. However, Cyp7a1 expression was decreased in all mice fed a HC diet independent of SHP levels. The low Cyp7a1 mRNA may because of the HC diet used in this study that lacks fat. Therefore, these results indicate that the reduction of hepatic cholesterol levels in ob/ob-C/EBP
/Cre+ mice fed a HC diet is not because of increased cholesterol transport from liver or from the increased bile acid biosynthesis from cholesterol through increased Cyp7a1 expression.
Liver is the main tissue for synthesis of TC (27). Therefore, the decrease in the expression of these genes involved in TC synthesis likely explains the decrease in hepatic TC levels (28). The decrease in hepatic TC further leads to a decrease in LDL and HDL TC levels in ob/ob-C/EBP
/Cre+ mice.
Hepatic C/EBP
Is Involved in Induction Pathway of Lipogenic Genes in ob/ob Mouse Liver
Under a normal diet, the expression of lipogenic genes in ob/ob-C/EBP
/Cre+ mice returned to the basal levels found in OB/OB-C/EBP
/Cre mice. To induce the expression of these genes, two methods were used, HC feeding and fasting-refeeding. These treatments strongly induced the expression of lipogenic genes in the ob/ob-C/EBP
/Cre mouse liver, but their induction in ob/ob-C/EBP
/Cre+ mice was clearly impaired, suggesting that hepatic C/EBP
is involved in induction pathway of lipogenic genes in the ob/ob mouse liver. Interestingly, a larger contribution for C/EBP
was found in ob/ob mice as compared with OB/OB wild-type mice, suggesting that the possibility of the existence of diabetes- or deficient functional leptin-dependent signals that are mediated or potentiated by C/EBP
. Furthermore, it is noteworthy that all genes having impaired induction by deficiency of C/EBP
are known SREBP1 target genes (29, 30). Thus, the deficiency of hepatic C/EBP
in ob/ob mice leads to impaired SREBP signaling.
Several genes observed having different expression levels in between Cre and Cre+ contain typical C/EBP binding sites. By searching the gene database (MOTIF; http://motif.genome.ad.jp/, cutoff score; 85), C/EBP binding sites were revealed at position 852 to 840 and 558 to 546 bp of the ATP-citrate lyase gene and 1498 to 1486 and 720 to 707 bp of the GAPT gene, suggesting that C/EBP
could potentially directly regulate these genes. Whether C/EBP
regulates these genes by direct binding to cis-acting elements remains to be determined. However, it should be noted that constitutive expression of lipogenic genes were not different between wild-type OB/OB-C/EBP
/Cre+ and OB/OB-C/EBP
/Cre mice, indicating that this transcription factor only affects inducible expression of lipogenic genes. In contrast, the ApoA4 gene appears to be directly regulated by C/EBP
and indeed C/EBP binding sites were found 5' upstream of the ApoA4 gene at position 1653 to 1641, 1045 to 1033 and 1002 to 989 bp.
Studies using SREBP1-null mice demonstrated that SREBP1 is essential for the induction of lipogenic genes by HC feeding and fasting-refeeding cycles (15). Therefore, C/EBP
may have an indirect role in potentiating SREBP1 signaling. In this regard, it is noteworthy that C/EBPs and SREBPs have basic helix-loop-helix leucine zipper motifs and directly interact with other transcription factors (31, 32, 33). Thus, the possibility exists that an interaction occurs between C/EBP
and SREBP1c. However, coimmunoprecipitation assays were not able to reveal a direct physical interaction between these two factors (data not shown). It is also known that SREBPs are weak activators of transcription and function efficiently only in concert with other transcription factors such as nuclear factor Y (NF-Y) or Sp1 (34). Therefore, C/EBP
may in some manner regulate these factors. Indeed, it was reported that C/EBPß cooperates with Sp1 (35) or NF-Y (36) in regulating gene expression. Furthermore, it was recently demonstrated that C/EBP
activates gene expression by directly binding with DNA bound NF-Y (37). NF-Y interacts with the epoxide hydrolase 5/-1 bp CCAAT box in vitro and in vivo, but only NF-Y was unable to stimulate EPHX1 promoter activity. The NF-Y consensus sequence CCAAT is included in most genes involved in lipogenesis including FPP and 7DCR (38, 39). Therefore, the decrease in FPP and 7DCR expression in HC-fed ob/ob-C/EBP
/Cre+ mice may be because of weaker synergistic activation of SREBP1 by NF-Y because of loss of C/EBP
. This possibility remains to be explored at the experimental level.
Even though loss of expression of C/EBP
in ob/ob results in attenuated induction of typical lipogenic genes and FPP and 7DCR, SREBP1 mRNA levels are unchanged or lower in the ob/ob-C/EBP
/Cre+ mice. In addition, the activated nuclear form of SREBP1 in ob/ob-C/EBP
/Cre+ mice is expressed at a higher level in the nucleus as compared with Cre mice, a situation that should lead to the induction of SREBP1 target genes. Therefore, hepatic C/EBP
may regulate gene expression by potentiating an SREBP1-independent pathway. Recent studies suggest the existence of SREBP1-independent pathway for induction of lipogenic genes by HC feeding and fasting-refeeding cycles. A carbohydrate-response element binding protein (ChoREBP) was identified as a transcription factor required for carbohydrate-responsive activation of transcription of the L-type pyruvate kinase as well as the lipogenic enzyme genes FAS and ACC (40). The expression of ChoREBP in ob/ob-C/EBP
/Cre+ mice under a normal diet showed a tendency toward decreased levels. However, under a HC diet, the expression of ChoREBP was almost the same level in each genotype and thus did not correlate with the expression of lipogenic genes. This suggests that the ChoREBP pathway cannot account for the C/EBP
-dependent difference in inducible lipogenic genes in the ob/ob mouse.
It is known that insulin is essential for the expression of lipogenic genes (41). The expression in liver is strikingly affected by insulin levels in the blood (42). Therefore, the decrease of insulin levels in ob/ob-C/EBP
/Cre+ mice as compared with ob/ob-C/EBP
/Cre mice may be involved in one of the mechanisms of altered lipogenesis. This may also explain the specificity of ob/ob mice for "impaired induction" because no significant difference in insulin levels was observed between OB/OB-C/EBP
/Cre+ and Cre mice under normal dietary conditions. Some reports have demonstrated that insulin treatment increases the amount of mRNA for SREBP-1c in parallel with the mRNAs of its target genes (43, 44), thus suggesting that SREBP1 gene expression may be influenced by insulin. However, in our study, the expression of SREBP1 in HC-fed ob/ob-C/EBP
/Cre+, is correlated with insulin levels; decreased insulin levels do not result in lower SREBP1 mRNA. The SREBP1-nuclear form is elevated in contrast to decreased expression of lipogenic genes. We currently have no explanation for these results. Additional studies are needed to determine the molecular mechanism for induction impaired by loss of hepatic C/EBP
expression.
Hepatic C/EBP
Indirectly Regulates Glucose Homeostasis
Additional phenotypes were observed in ob/ob-C/EBP
/Cre+ mice by HC feeding. Under a normal diet (nonfasting), the serum glucose levels of ob/ob-C/EBP
/Cre+ mice were significantly higher than in the ob/ob-C/EBP
/Cre mice. These mice show a large individual difference in serum glucose levels under the normal dietary conditions. However, serum glucose levels in all ob/ob-C/EBP
/Cre+ mice were dramatically elevated on the first day from start of HC feeding and remained at high levels throughout the course of feeding (12 d). The ob/ob-C/EBP
/Cre+ mice also exhibited unusually high glucose levels after the GTT. GTT testing before and after HC feeding revealed that the diet does not appear to cause high glucose levels indicative of the worsening of insulin resistance, suggesting that ob/ob-C/EBP
/Cre+ mice potentially have a unusual glucose clearance. Whereas, the insulin levels in ob/ob-C/EBP
/Cre+ mice are significantly lower than in ob/ob-C/EBP
/Cre mice. In addition, the result of insulin tolerance test clearly demonstrated lower insulin sensitivity in ob/ob-C/EBP
/Cre+ mice. These phenotypes appear to sufficiently explain unusually high levels of glucose during HC feeding and the GTT. The lower insulin levels in ob/ob-C/EBP
/Cre+ mice are notably still elevated compared with that of the wild-type OB/OB group. This may explain why the ob/ob-C/EBP
/Cre+ mice under a normal diet did not show a striking elevation in glucose levels compared with ob/ob-C/EBP
/Cre mice.
It is still uncertain why the deficiency of hepatic C/EBP
in ob/ob mice leads to lower insulin levels and worsen insulin resistance. The lower insulin appears to be caused by an insufficient insulin secretion from a defective pancreas that results from a yet to be defined mechanism. The pathological results did not reveal a clear difference in islets between ob/ob-C/EBP
/Cre and ob/ob-C/EBP
/Cre+ mice. The islets of ob/ob-C/EBP
/Cre+ and Cre mice were hypertrophic compared with OB/OB mice. However, in the ob/ob-C/EBP
/Cre+ mice, there was a tendency toward more islet size variation and mild degenerative changes compared with ob/ob-C/EBP
/Cre mice (data not presented). In agreement with a role for systemic FFA in the development of type 2 diabetes, it was shown that elevated plasma FFA induces peripheral insulin resistance in humans and rodent models within a few hours (45, 46). FFAs can also have positive or negative effects on insulin secretion, depending on the experimental conditions used (47, 48). Thus, FFAs might have a direct impact for worsening insulin secretion and resistance, and the persistent hyperglycemia may contribute to further worsening of the diabetic phenotype. It was reported that liver-specific disruption of glucokinase also leads to impaired insulin secretion (49). These authors suggested that chronic hyperglycemia may lead to an impairment of glucose-induced insulin secretion by a mechanism that is still not established. More studies are needed to elucidate the mechanism for the more severe diabetic symptoms observed in the ob/ob-C/EBP
/Cre+ mice.
In summary, liver-specific disruption of the C/EBP
in obese diabetic mice decreased hepatic TG and TC by impairing induction of lipogenic genes and leaded to worsen diabetic phenotype. A single transcription factor expressed in liver can act globally to regulate both glucose and lipid concentrations in the whole diabetic animal. Further, the effects of deficiency of hepatic C/EBP
were more sensitive in diabetic mice, suggesting the existence of a type 2 diabetes-specific pathway. Therefore, the elucidation of a molecular mechanism might lead to potential new therapeutic opportunities for anti-diabetes therapy.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Conditional-Null Mice
(fl/fl) mice, produced as described (9), were bred with a mouse containing the albumin-Cre transgene (AlbCre) (50). This transgene was used in an earlier study to create a peroxisome proliferator-activated receptor
and hepatocyte nuclear factor 4
-liver null mice (51, 52). C/EBP
(fl/fl)AlbCre+ (C/EBP
/Cre+) or C/EBP
(fl/fl)AlbCre (C/EBP
/Cre) were crossed with heterozygotes C57BL/6J-Lepob, obtained from The Jackson Laboratory (Bar Harbor, ME) to generate double heterozygotes (C/EBP
fl/+, OB/ob). The OB/ob-C/EBP
(fl/fl)AlbCre+ or OB/ob-C/EBP
(fl/fl)AlbCre mice were then crossed to generate the ob/ob-C/EBP
/Cre+ or ob/ob-C/EBP
/Cre, OB/OB-C/EBP
/Cre+ or OB/OB-C/EBP
/Cre mice. Mice were maintained on a 12-h light, 12-h dark cycle and fed water and pellet chow diet (NIH07) ad libitum. The NCI Animal Care and Use Committee approved all animal studies that were carried out in accordance with NIH Guide for the Care and Use of Laboratory Animals and ALAC guidelines.
Feeding Treatments
A HC/fat-free diet was purchased from Harlan Teklad (TD 88232, Madison, WI). For the HC study, mice were fed the diet for 12 d and killed in a nonfasted state. Before the fasting and refeeding study, the mice were fed a regular chow diet (NIH07) ad libitum until the treatment commenced. Mice in the refeeding group were fasted 24 h (from 1800 to 1800 h) and then refed with a HC/fat-free diet for 24 h (1800 to 1800 h). Mice in the fasting group were fasted 24 h (from 1800 to 1800 h). Both groups were immediately killed within 30 min.
RNA and Protein Analysis
The cDNA probes used for Northern blotting were described in an earlier report (51, 53) except for the following probes. cDNA probes for FPP, 7-dehydrocholesterol reductase (7DCR), 6-phosphogluconate dehydrogenase (PGD), carbohydrate-responsive element-binding protein (ChREBP) were amplified by PCR from a mouse liver cDNA library by using gene-specific primers, and cloned into pGEM-T Easy Vector (Promega, Madison, WI). The primers used for PCR were as follows: ChREBP, 5' primer CTCAACTCCATACAACCCTCGG and 3' primer TGCCTCTCTGCTCAGGAACTAAGG. PGD, 5' primer GCAAACCTCATCCAGGCTCAAC and 3' primer TTATTACAAGTGGGACGGGGCG. FPP, 5' primer GCTCCAGGCTTTCTTCCTTGTG and 3' primer TCTATGAGACTCTTGAGGCGGTTG. 7DCR, 5' primer TTGTGTACTACTTCATCATGGCATG and 3' primer GGGTTGAACTCAATTCCCATCAT. The identities of the probes were confirmed by DNA sequencing.
Nuclear extracts from ob/ob mouse liver were isolated according to the protocols provided with the NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (Pierce, Rockford, IL). Nuclear extract protein was assayed by use of the BCA protein assay (Pierce) and 20 µg was subjected to electrophoresis on a 10% sodium dodecyl sulfate-polyacrylamide gel, transferred to Immobilon-P membranes (Millipore, Bedford, MA), and probed according to the manufacturers recommendations with anti-C/EBP
(14AA; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), C/EBPß (H7; Santa Cruz Biotechnology, Inc.) and SREBP-1 (IgG-2A4, BD-Pharmingen, San Diego, CA) antibodies. An enhanced chemiluminescence detection system was used to visualize immunoreactive proteins (Amersham, Inc., Arlington Heights, IL).
Serum Lipids and Lipoproteins
Serum lipid levels and lipoprotein profiles were determined as previously described (54). Post-heparin lipase activities were measured with CONFLUOLIP (PROGEN, Heidelberg, Germany) as noted in an earlier report (55).
Measurement of Hepatic Lipids, Glycogen, and Plasma Insulin
Hepatic lipids and glycogen were measure as described in previous report (56). Plasma insulin was measured with a RIA kit (Linco Research, St. Charles, MO).
Glucose Levels, Glucose, and Insulin Tolerance Tests
Glucose levels were measured analyzed for glucose concentrations using a Glucometer Elite (Bayer Corp., Elkhart, IN). Glucose tolerance tests were performed as previously described (51). Insulin tolerance tests were performed under the nonfasting and normal diet feeding. Mice were injected ip insulin (Humulin, Eli Lilly Indianapolis, IN) at 2 U/kg body weight.
Histology
Livers from 12- to 13-wk-old representative mice were fixed in 10% neutral buffered formalin and embedded in paraffin, and sections cut at a thickness of 46 µm were stained with hematoxylin and eosin. Some liver sections frozen in OCT compound were stained with Oil Red O using standard procedures.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: ACC, Acetyl-CoA carboxylase; AlbCre, albumin-Cre transgene; Apo, apolipoprotein; C/EBP
, CCAAT/enhancer binding protein
; ChREBP, carbohydrate-responsive element-binding protein; CoA, coenzyme A; 7DCR, 7-dehydrocholesterol reductase; FAS, fatty acid synthase; FFA, free fatty acid; FPP, farnesyl diphosphate synthetase; FXR, farnesoid X receptor; G6Pase, glucose-6-phosphatase; GTT, glucose tolerance test; HC, high-carbohydrate; HDL, high-density lipoprotein; HMG, 3-hydroxy-3-methylglutaryl; LDL, low-density lipoprotein; LXR, liver X receptor; NF-Y, nuclear factor Y; OB/OB, normal leptin mouse; ob/ob, leptin mutated mouse; PEPCK, phosphoenolpyruvate carboxykinase; PGD, phosphogluconate dehydrogenase; SHP, small heterodimer partner; SREBP, sterol regulatory element-binding protein; TC, total cholesterol; TG, triglyceride; VLDL, very LDL.
Received for publication May 25, 2004. Accepted for publication July 27, 2004.
| REFERENCES |
|---|
|
|
|---|
(C/EBP
). Biochem Biophys Res Commun 215:106113[CrossRef][Medline]
knockout mice. Science 269:11081112
. J Biol Chem 271:2475324760
gene in adult mouse liver. Mol Cell Biol 17:60146022[Abstract]
-fetoprotein genes in fetal tissues of mouse and rat. Dev Biol 102:5160[CrossRef][Medline]
-fetoprotein locus during development. Proc Natl Acad Sci USA 79:52545257
gene locus, can functionally replace C/EBP
in liver but not in adipose tissue. Mol Cell Biol 20:72927299
7-reductase activity in liver microsomes from Smith-Lemli-Opitz homozygotes. J Clin Invest 96:17791785
7-reductase gene at 11q1213 cause Smith-Lemli-Opitz syndrome. Am J Hum Genet 63:5562[CrossRef][Medline]
to synergize with an Sp1 protein is specified by the leucine zipper and activation domain. Mol Cell Biol 17:20382047[Abstract]
activates transcription of the human microsomal epoxide hydrolase gene (EPHX1) through the interaction with DNA Bound NF-Y. J Biol Chem 279:2990229910