| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Département dEndocrinologie (V.M., O.L., J.D.-L., X.B., M.G.C.), Institut Cochin, Institut National de la Santé et de la Recherche Médicale (INSERM) Unité 567, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 8104, Université René Descartes, 75014 Paris, France; Clinique des Maladies Endocriniennes et Métaboliques (L.G., X.B.), Hôpital Cochin, 75014 Paris, France; INSERM Unité 564 (B.B., O.C.), Centre Hospitalier Universitaire, 49033 Angers Cedex, France; and INSERM Unité 478 (J.F.), 75018 Paris, France
Address all correspondence and requests for reprints to: Maria Grazia Catelli, Institut Cochin, Département dEndo-crinologie, 24, rue du Faubourg Saint Jacques, 75014 Paris, France. E-mail: catelli{at}cochin.inserm.fr.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The regulation of POMC transcription was shown to be dependent from the early induction of expression of Nur77 and Nurr1, two members of the Nur family of orphan nuclear receptors (5, 6). However, the early induction of POMC transcription by CRH and cAMP is rapid and transient and does not require de novo protein synthesis (7). Indeed, it has been recently reported that CRH, via PKA and/or MAPK, regulates the phosphorylation-dephosphorylation state of Nur77, thus increasing its DNA binding and transcriptional activation properties (8, 9). Two Nur targets have been identified in the POMC promoter, a proximal Nur77 binding response element (NBRE) (70/63), which binds Nur77 or Nurr1 monomers, and a distal one, the NurRE, constituted of two everted NBRE-related sites separated by six nucleotides (404/382). NurRE binds Nur77 homodimers or Nur77/Nurr1 heterodimers and, in the context of the POMC promoter, this site plays a dominant role, as compared with NBRE, in mediating stimulation by CRH (5, 6, 10).
In addition, it has been recently reported that T-pit, a transcription factor belonging to the Tbox family and cooperating with the homeoprotein Pitx1 for cell-specific expression of the POMC gene (11), is also a mediator of signaling by CRH and could cooperate with Nur77 at the level of POMC promoter (12). CRH also induces the protooncogene c-fos, which, in association with junB, binds the activator protein (AP)-1 site at +41/+47 within the first exon of POMC gene (13, 14). However, the induction of AP-1 components does not explain the early transcriptional activation of POMC gene by CRH, which is protein synthesis independent (7). Another site, 173/160, called POMC CRH-responsive element, located in the central part of the promoter, was shown to confer strong c-fos-independent stimulation of POMC transcription after CRH treatment (15, 16).
Leukemia inhibitory factor (LIF), a pleiotropic cytokine involved in the inflammatory response, also activates the hypothalamo-pituitary-adrenal axis (17, 18). LIF and its receptor are both expressed in corticotroph cells and in AtT-20 cell line (19, 20) where LIF activates the POMC promoter and ACTH secretion through a Janus kinase/signal transducers and activators of transcription 13 (Jak/STAT13) pathway (20, 21, 22). In this response, STAT3, activated by phosphorylation at Tyr-705-YP (tyrosine phosphorylated), plays a predominant role (22, 23). Recently, a functional STAT13 low-affinity binding site was identified in the distal region of the POMC promoter (387/379); yet a proximal subregion of the promoter, devoid of STAT13 binding properties, also mediates the LIF stimulatory effect (23, 24).
A strong synergism between LIF and CRH on POMC promoter activation was recognized early (16, 21, 23), although the underlying molecular mechanisms remain unclear. These previous studies indicated that both the 173/160 element and the AP-1 site were involved in this synergism (16, 23). Yet, these data ignored the potential role of the distal region of the POMC gene promoter that is crucial in CRH- and LIF-induced activation.
The promoter subregion 414/293, starting at the NurRE in the distal region and ending after the Pitx1 site of the central region, was recently defined as responsive to LIF (24). Here, we establish that this subregion also mediates LIF-CRH synergy and that the NurRE-STAT composite element, present in this region, is a significant target of the combined stimulation. This element is composed of two NBRE everted sites, the most 3' one overlapping in part the unique STAT13 site. Although a maximal synergistic response requires the presence of both NurRE and STAT13 sites, each site alone is sufficient to induce synergy. Binding of Nur77 and STAT13 to NurRE-STAT element, which is increased by CRH and LIF treatment, respectively, is maintained during the combined stimulation. Furthermore, the synergistic response requires recruitment of CREB to DNA-bound Nur77 and STAT13. Indeed, CREB phosphorylated at Ser-133 and present in this quaternary complex participates, in a DNA binding-independent manner, to the transcriptional activity of the NurRE-STAT site. Finally, the synergistic response to LIF-CRH combined treatment is inhibited by the dominant-negative mutant of CREB, CREB-M1, where Ser-133 is replaced by Ala (25), or by CREB-small interfering RNA (siRNA), indicating the crucial role of the level of CREB phosphorylation and expression.
| RESULTS |
|---|
|
|
|---|
|
9-fold) as compared with the entire promoter (
9-fold) (Fig. 2B
|
10-fold) and not to CRH, yet displayed a synergism of approximately 40-fold, which may depend on its high affinity for STAT13. In conclusion, these results demonstrate that NurRE or STAT (SIE) binding sites alone could mediate the synergistic effect of LIF-CRH, even though they were not responsive to one of the single treatment (LIF or CRH, respectively). Moreover, the presence of both NurRE and STATPOMC site seems necessary to obtain a maximal LIF-CRH synergistic effect in the context of the 3xNurRE-STAT reporter.
To evaluate the contribution of the composite NurRE-STAT site to synergistic response, mutations of its sequence were introduced into the 414/293 reporter (Fig. 3A
). Figure 3B
shows that the LIF-CRH synergy of the wild-type construct was almost completely lost in the 414/293 reporter bearing a mutated NurRE-STAT, indicating the critical role played by this motif in the synergistic response of a partially reconstituted POMC promoter. When introduced into the entire promoter, the same mutations abolished the synergistic response by more than 50% (Fig. 3C
), demonstrating the major role of the NurRE-STAT element and, as already mentioned, an additional role of the 293/+63 region, in agreement with the proposed role of other targets (16, 23).
|
The NurRE-STAT biotinylated oligonucleotide was incubated with nuclear extracts derived from control or CRH- or LIF-stimulated cells. Stimulation by CRH (60 min) enhanced Nur77 binding, and stimulation by LIF (20 min)-induced STAT13-YP binding at the NurRE-STAT site (Fig. 4A
). The use of a control probe unrelated to Nur77 and STAT13 sites confirmed the specificity of Nur77 and STAT13 binding to the NurRE-STAT site.
|
Because it has been shown that the constitutive active form of CREB (CREB-VP16) activated the POMC promoter and the dominant-negative CREB-M1 inhibited this activation (29), we hypothesized that CRH-activated CREB and/or CREB binding protein (CBP) may participate to stabilization and activation of the DNA-proteins complex composed of NurRE-STAT element, Nur77 and STAT13. Using the same pull-down technique, the presence of CREB was indeed detected. Figure 4B
(bottom) shows that CREB was retained by NurRE-STAT and each mutated oligonucleotide, whereas it was absent when using the control oligonucleotide, which is also devoid of CRE-like sequences. Moreover, the level of bound CREB was always increased over the control level by the combined stimulation. Whether the level of CREB detected in control conditions with the NurRE-STAT probes (Fig. 4B
) represented a technical background or its presence into a complex, remains unclear. In similar experiments, the presence of CBP/p300 was not detected, nor the presence of glucocorticoid receptor (GR), although these proteins were detected in nuclear extracts (see Fig. 4C
for GR). Indeed, GR, which binds its DNA consensus sequence after high-salt extraction, was present in the nuclear fraction but not retained by the NurRE-STAT probe.
To exclude the fact that the binding of CREB to NurRE-STAT site was due to nonspecific trapping, a 10-fold excess of unlabeled CRE, NurRE-STAT or control oligonucleotides was added to nuclear extracts incubated with biotinylated NurRE-STAT (Fig. 4D
). A CRE or NurRE-STAT excess clearly diminished the CREB binding to NurRE-STAT probe. Moreover, as expected, an excess of NurRE-STAT abolished CREB and STAT3-YP binding. By contrast, an excess of unlabeled CRE suppressed only the binding of CREB and not that of STAT3, whereas an excess of control oligonucleotide did not compete for STAT3 and CREB binding, indicating that CREB binding to NurRE-STAT site was indirect. In addition, using control or LIF-CRH-treated nuclear extracts (Fig. 4E
), the binding of CREB to NurRE-STAT oligonucleotide was inducible as reported above (Fig. 4B
), but lower than to CRE, whereas CREB binding to mutated CRE was almost absent, suggesting again an indirect binding of CREB to NurRE-STAT.
However, when purified recombinant CREB (His-CREB) was tested directly on CRE, mutated CRE and NurRE-STAT probes, it was bound to CRE, whereas almost no binding was detected to NurRE-STAT or mutated CRE (Fig. 4F
). This suggested that CREB binding to NurRE-STAT site, only observed with nuclear extracts, was due to protein-protein interaction. Altogether, these results indicate that, after combined stimulation, increased CREB binding to NurRE-STAT probe takes place via DNA-bound Nur and/or STAT and that the integrity of one of the two sites is sufficient to obtain CREB detection. This suggests an indirect and specific recruitment of CREB at the NurRE-STAT site through a protein-protein interaction with Nur77 and activated STAT13.
To further substantiate the possibility of a simultaneous binding of Nur77 and Stat13 to the NurRE-STAT element, taking in account the overlap of sites, computer modeling of their binding was performed on the basis of existing crystallographic data (30, 31, 32). Figure 5A
shows two DNA binding domains of Nur77 monomer bound, in the major groove and in opposite sites of the DNA helix, to each half site of the NurRE sequence. The two subunits are pointing the C-ter region to each other, suggesting that Nur77 dimer could be stabilized by DNA contacts. In Fig. 5B
, NurRE, STAT13 binding site and their overlap are depicted in blue, red, and violet, respectively. Figure 5C
shows two STAT3ß subunits in contact with the NurRE-STAT sequence, each subunit interacting with a half site on both DNA strands in the major groove. In the overlapping part 5'TGCCA3' (violet), the major contacts of Nur DNA binding domain concern the second and third bases, and a subunit of STAT is in contact with the second and fourth bases. Then, we can infer that the simultaneous binding of dimeric Nur and STAT13 takes place only if one of the transcription factors is in contact with a half site.
|
|
Similarly to CREB and Nur 77, a direct interaction between recombinant STAT3 and recombinant CREB was demonstrated using GST-STAT3 resin and His-CREB, as well as in the converse experiment using His-CREB resin and GST-STAT3 fusion protein. His-CREB was bound to GST-STAT3 resin and not to GST resin (Fig. 6E
). Moreover, only His-CREB resin and not His-HSP90 resin retained GST-STAT3 (Fig. 6F
). Altogether, these results show that CREB is able to interact separately with Nur 77 and STAT13 whether bound or not to DNA.
Blunting the LIF-CRH Synergistic Response by Dominant-Negative CREB-M1 or CREB-siRNA
The preferential interaction of P-CREB with Nur77 (Fig. 6A
) suggests a role for CREB phosphorylation in the synergistic response to LIF-CRH. Two dominant-negative forms of CREB have been described, CREB-M1 (25), in which Ser-133 has been mutated to Ala, and A-CREB (34), which is constituted of an acidic amphipathic extension onto the N terminus of the CREB leucine zipper domain and disrupts the binding of CREB to its consensus DNA motif. We tested their action, first, on the activity of a CRE reporter transfected in AtT20 cells stimulated by CRH and, second, on the constitutively active simian virus 40 (SV40) promoter. Both dominant-negative forms of CREB inhibited the response to CRH of the CRE reporter by 75% (Fig. 7A
), whereas they were inactive on the SV40 promoter activity, known to be unresponsive to cAMP stimulation (Fig. 7B).
|
The efficient inhibitory effect of CREB-M1, by contrast to that obtained with A-CREB, suggested that phosphorylation of CREB at Ser133 was a key event in synergism, independent of CREB binding to CRE-like sequences.
To further confirm a functional role for CREB in LIF-CRH synergy, we used the siRNA approach. Transfection of a CREB-siRNA blunted the synergistic response to LIF-CRH stimulation of the 414/293 subregion by approximately 80%, whereas a scrambled version of the sequence had no effect (Fig. 8A
). Because transfection efficiency in AtT20 cell line is low, analysis of CREB level was performed after FACS selection of cells transfected with fluorescent siRNA oligonucleotides. The CREB-siRNA reduced of about 50% the protein level, in agreement with the reduced activity of the reporter construct. The scrambled siRNA (scr-siRNA) had no effect and neither siRNA oligonucleotide reduced the abundance of the regulatory subunit of the PKA-R1
(Fig. 8B
). We thus concluded that decreased level of CREB phosphorylation or CREB expression both negatively affected the synergistic response.
|
| DISCUSSION |
|---|
|
|
|---|
It should also be stressed that we and others, during studies on POMC promoter regions responsible for LIF responsiveness, in a STAT13 DNA binding-dependent manner, noticed that the unique STAT13 binding site of the POMC promoter overlaps in part the NurRE (23, 24), which is the target of Nur subfamily of nuclear receptors and the major determinant of CRH responsiveness (5, 6). We therefore hypothesized that the composite NurRE-STAT site could be the region in the POMC promoter where the cAMP-PKA and Jak-STAT signaling pathways converge. Indeed, the 414/293 and the 3xNurRE-STAT constructs were sufficient to confer the synergistic effect of LIF-CRH and mutations on the NurRE-STAT site in the 414/293 subregion and in the entire promoter, blunted the synergy by 90% and 50% respectively. Surprisingly, when the 3xNurRE and 3xSTATPOMC reporters were tested, we found again a synergistic response, albeit of lower amplitude as compared with 3xNurRE-STAT construct.
In the context of the entire POMC promoter or the subregion 414/293, such functional results indicate that the NurRE-STAT element mediates the synergistic effect of LIF-CRH treatment and that the presence of both parts of the composite site is required for an optimal synergy. The finding that each individual site was able to confer a suboptimal synergistic response suggests that the binding to DNA of one class of transcription factors (Nur77 or STAT13-YP) is sufficient to elicit synergy between CRH and LIF.
The partial overlapping sequences of NurRE and STAT13 sites led us to investigate whether both classes of transcription factors make contacts with the cognate DNA motif NurRE-STAT during the synergistic treatment. CRH or LIF alone induced binding of Nur77 and STAT13-YP to NurRE-STAT element, respectively. Thus, the partial overlap of NurRE and STAT13 binding site might allow simultaneous binding of Nur and STAT during the combined stimulation. This issue is reinforced by the computer modeling presented in Fig. 5
, suggesting that both transcription factors can contact the bases of NurRE-STAT if Nur or STAT is bound to a half site. Because the binding of each transcription factor seems not to be mutually exclusive, the LIF-CRH synergy may be a consequence of an interaction between the two classes of transcriptional regulators. Although coimmunoprecipitation experiments did not reveal such interactions, we cannot exclude that they take place in vivo because contacts between a nuclear receptor and STAT proteins have been already described (35).
It is also known that coactivators and adapters are present as components of supramolecular structures assembled on enhancer regions and that some transcription factors may also play the function of coactivator or adapter molecules (36).
Ser-133 phosphorylation of CREB, as seen after CRH stimulation in AtT-20 cell line (16), is known to be crucial for CBP/p300 recruitment and activation of transcription (37). Besides confirming this increased phosphorylation after the combined LIF-CRH treatment, we found that endogenous CREB from nuclear extracts was indirectly bound to NurRE-STAT element, in a stimulation-dependent manner. In these complexes, the presence of CREB requires the binding of Nur77 or STAT13 to DNA, indicating a direct or indirect interaction of CREB with each transcription factor. Indeed, we have demonstrated a direct interaction between CREB and Nur77, as well as CREB and STAT 3 recombinant proteins. Moreover, in LIF-CRH-treated nuclear extracts, CREB displays an increased affinity, related to its Ser-133 phosphorylation, toward recombinant Nur77, suggesting a crucial role for P-CREB in this interaction.
Whether the phosphorylation-dephosphorylation state of Nur77 also regulates the interaction with CREB remains to be determined. It is known that dephosphorylation of Ser-350 favors binding of Nur77 to its DNA motifs and hyperphosphorylation of the N-terminal region (activation function 1) regulates its transcriptional activity (38, 39). Indeed, after CRH stimulation, a PKA/MAPK-dependent phosphorylation of Nur77 has been reported as crucial for its activation (8, 9).
Because CREB is an essentially nuclear protein and one of the most obvious roles of STAT13 Tyr-phosphorylation is to induce their nuclear translocation, thus Tyr phosphorylation is a prerequisite for interaction with CREB to take place.
When using NurRE-STAT oligonucleotide pull-down, CREB makes contacts with both Nur77 and STAT13. When single NurRE or STAT (SIE) site is used, still CREB participates to a ternary complex with each DNA element and the respective transcription factor. In this case, whether the second DNA binding transcription factor (Nur or STAT) plays also a role remains to be determined. Although the simultaneous presence of activated STAT13 and CREB is detected with the SIE probe, as with the natural STAT POMC site, the synergism observed with NurRE alone is not explained by the physical presence of a component of each signaling pathway. It cannot be excluded that tripartite protein complexes composed of DNA-bound Nur77/CREB/STAT or DNA-bound STAT/CREB/Nur77 exist at each separate site. Nevertheless, the synergism may also be explained by cross talk between CRH and LIF signaling, resulting in posttranslational modification of each factors and/or associated coactivators.
The presence of P-CREB within such complexes can improve the stability of activated Nur and STAT binding to NurRE-STAT site and/or facilitates the recruitment of coactivators acting on chromatin structure, stabilizing contacts with the basal transcriptional machinery. The low level of synergy observed with NurRE or STATPOMC site, each activated alone, suggests that, when the second activated transcription factor (Nur or STAT) lacks the corresponding DNA-binding site, the stabilizing/activating effect of P-CREB is less pronounced, resulting in an attenuated response. However, this situation is reversed when the reporter is constituted of high affinity binding sites, like repetitions of the SIE. Functional and binding results with SIE suggest that this function of CREB in transcriptional activation, independent from its binding to CRE, could be more widely used than previously thought.
The use of dominant-negative forms of CREB, CREB-M1, and A-CREB, the first one being defective for Ser-133 phosphorylation and the second one being able to disrupt CREB binding to CRE (25, 34), confirmed the importance of P-CREB in the mechanism of LIF-CRH synergy and excluded a major role for CREB binding to CRE. Indeed, CREB-M1 inhibited LIF-CRH synergistic effects of all the constructs whereas A-CREB was modestly efficient as dominant negative. It is reasonable to propose that P-CREB plays here a role of coactivator or adapter. On the contrary, the modest effect of A-CREB suggests that the DNA binding property of CREB may be required for the induction of mRNAs of the Nur family of orphan receptor. Indeed, a CRE is present in the promoter of Nurr1 (40), and induction of Nur expression (5, 6) may constitute a secondary mechanism for its increased transcriptional activity, occurring later, after phosphorylation-dephosphorylation events.
In addition to CREB phosphorylation, the level of CREB in LIF-CRH synergy was also critical, because CREB-siRNA specifically inhibited the synergistic response.
Many transcription factors, like members of nuclear receptor or STAT families, can regulate transcription in the absence of DNA binding (36) and we propose here that CREB could also act by such a mechanism. On the POMC promoter, P-CREB may bridge Nur77 and STAT13 bound to the NurRE-STAT composite site and mediate the synergistic response to LIF-CRH. Ours results are similar to those described for p53-responsive genes where P-CREB mediates the recruitment of CBP to DNA-bound p53, constituting an alternate mechanism of coactivator recruitment (41). Future work will focus on requirement of CREB at the NurRE-STAT site for the recruitment of CBP/p300 and/or p160 coactivators because Nur77 (9) and STAT3 (42) share them. In conclusion, these results provide further knowledge on the functional analysis of the POMC gene promoter where the NurRE-STAT composite site behaves as a tethering element (43) for CREB. More importantly, they unravel a new molecular action of the transcription factor CREB that can have more general implications in the cross talk between cAMP/PKA and Jak-STAT13 signaling pathways.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids, Transfection, and Luciferase Assay
The 480/34 and 414/293 segments of the rat POMC promoter, fused to the minimal promoter 34/+63 and subcloned into the pXP1-luciferase vector were already described (5, 24). Three repetitions of the POMC [NurRE (Nur response element)-STAT] or POMC (NurRE) (5, 6) or POMC (STAT) or SIE (SIEm67) sequences (27, 28) have been introduced in the same reporter in front of the minimal POMC promoter, giving the constructs 3xNurRE-STAT, 3xNurRE, 3xSTATPOMC and 3xSIE, respectively.
The 414/293 construct was widely mutated at the NurRE-STAT site giving the 414/293 mutated reporter (TAGcagcgcccACCTCCgggcctCAGcggGGC) (lower case letters indicate the mutations; see the wild-type sequence in Biotinylated oligonucleotide-streptavidin pull-down). The cDNA of CREB and of the two dominant-negative forms of CREB, CREB-M1 and A-CREB (25, 34), were subcloned in pRSV expression vector to avoid CRE sequences of the original cytomegalovirus promoter constructs. His-CREB construct was obtained by subcloning the CREB cDNA in a modified pET-28 vector.
AtT-20 cells were plated in six-well plates (4 x 105 cells/well) and allowed to adhere for 24 h. Cells were then transfected using Lipofectamine Plus Reagent (Invitrogen Life Technologies, Carlsbad, CA) in the absence of serum. Each sample mix for lipofection contained 500 ng of POMC promoter-luciferase reporter plasmid and 250 ng of pRSV-lacZ plasmid as an internal control. For experiments with dominant-negative forms of CREB, 3 µg of CREB-M1 or A-CREB were added to the usual sample mix. The day after transfection, cells were treated or not with 1 nM recombinant mouse LIF (Sigma) and/or 50 nM rat CRH (Bachem, Bubendorf, Switzerland) for 6 h. Cells were washed with cold PBS and then lysed in Tris/H3PO4 25 mM (pH 7.8), MgCl2 10 mM, EDTA 1 mM, Triton 1%, and dithiothreitol 1 mM. The luciferase and ß-galactosidase activities were measured as described (24). Each experiment was independently repeated at least three times, with each assay in triplicate. Results are expressed as relative light units (RLU)/ßgal activities or fold induction.
Nuclear Extracts
AtT-20 cells were grown to 80% confluence, then serum-deprived during 16 h before treatment with LIF (1 nM) during 20 min, CRH (50 nM) during 60 min or LIF-CRH during 30 min. Cells were harvested in cold PBS and nuclear extracts prepared as described (24).
Western Blotting and Antibodies
Western blotting was realized as described (24). Detection of Tyr-701-phospho-STAT1 (STAT1-YP), STAT1, Tyr-705-phospho-STAT3 (STAT3-YP), STAT3, Ser-133-P-CREB, CREB, Nur77 and R1
-subunit of PKA was carried out with polyclonal anti-STAT1-YP, monoclonal anti-STAT1, monoclonal anti-STAT3-YP, polyclonal anti-STAT3, polyclonal anti-P-CREB, polyclonal anti-CREB, monoclonal 2E1anti-NGFI-B and monoclonal anti-PKA-RI
antibodies [Upstate Biotechnology (Lake Placid, NY) 06-657, Transduction Laboratories (Lexington, KY) G16920, Upstate Biotechnology 05-485, Santa Cruz Biotechnology Inc. (Santa Cruz, CA) H190, Cell Signaling (Beverly, MA) 9191/9192, a gift from J. Milbrandt and Transduction Laboratories 610609, respectively], in blocking buffer for 16 h at 4 C. Secondary antibody conjugated to horseradish peroxidase (Santa Cruz) was incubated with the membrane in blocking buffer for 1 h at room temperature and detection was accomplished using Enhanced Chemiluminescence (ECL) reagent (Amersham Biosciences Europe GmbH, Orsay, France). When reprobed, the membrane was stripped in sodium dodecyl sulfate 0.2%, NaCl 0.1 M, glycine 0.1 M/HCl (pH 2) for 1 h at room temperature and reequilibrated in Western blot buffer.
Biotinylated Oligonucleotide-Streptavidin Pull-Down
Binding of STAT13, Nur77, and CREB to the following 3'-biotinylated DNA oligonucleotides was tested using the biotin-streptavidin affinity system:
Control probe: CATCCTCCGCGGATC
SIE (Refs.27 and 28): CATTTCCCGTAAATC;
CRE (Ref.25): GATTCAATGACATCACGGCTGTG;
CRE mut: GATTCAAGgaACATagCGGCTGTG;
POMC (407/376) NurRE-STAT: TAGTGATATTTACCT CCAAATGCCAGGAAGGC; POMC(407/376) NurRE-STATmut: TAGTGATATTTAC CTCCAAATGCCAGcggGGC;
POMC (407/376) NurREmut-STAT: TAGcagcgcccAC CTCCgggTGCCAGGAAGGC.
The STAT13 and CRE sites are underlined, and the NurRE site is in boldface.
After annealing, biotinylated oligonucleotides (1 µg) were incubated with precleared nuclear extracts (0.51 mg) derived from AtT-20 cells, treated or not as above, and 100 µl streptavidin-agarose (Pierce, Rockford, IL) in a 2 ml of incubation buffer [Tris 10 mM (pH 7.4), NaCl 50 mM, glycerol 5%, EDTA 1 mM, MgCl2 5 mM, BSA 1 µg, poly-deoxyinosine-deoxycytosine 20 µg, antipain 5 µg/ml, leupeptin 5 µg/ml, aprotinin 5 µg/ml, vanadate 1 mM, okadaic acid 0.05 µM]. Incubation was carried out on a rotating wheel for 2 h at 4 C. After centrifugation, the pellet containing the streptavidin-agarose was washed four times with washing buffer [Tris 10 mM (pH 7.4), EDTA 1 mM, NaCl 100 mM] and the proteins eluted from the resin with Laemmli sample buffer were resolved on SDS-PAGE and examined by immunoblotting with the respective specific antibodies. The quantitative binding of oligonucleotides to streptavidine-agarose was verified by the analysis of the supernatant in appropriate nondenaturing polyacrylamide gel
GST-Nur77 Fusion Protein Pull-Down
Constructs encoding fusion proteins between GST and Nur77 or STAT3 were already described (6, 44). Purified GST-Nur77 or GST-STAT3 bound to gluthathione-Sepharose beads (50 µl, Amersham Biosciences) was incubated with nuclear extract (0.5 mg) derived from untreated or LIF-CRH-treated AtT-20 cells, or with purified 6xHis tagged CREB. The incubation was carried out in NTEN buffer [Tris 20 mM (pH 7.4), EDTA 1 mM, NaCl 100 mM, Nonidet P-40 0.5%] containing protease and phosphatase inhibitors (phenylmethylsulfonyl fluoride 1 mM, antipain 5 µg/ml, leupeptin 5 µg/ml, aprotinin 5µg/ml, vanadate 1 mM, okadaic acid 0.05 µM) on a rotating wheel for 2 h at 4 C. After centrifugation, the beads were washed three times with NTEN buffer then eluted with Laemmli sample buffer. The eluate was resolved on SDS-PAGE and examined for the presence of P-CREB or CREB proteins by immunoblotting with the respective specific antibodies. Control experiments included bacterial expressed GST alone to estimate nonspecific interactions with GST and gluthatione-Sepharose beads.
Ni-NTA Magnetic Agarose Beads Pull-Down
Purified 6xHis-tagged CREB (His-CREB, 90 pmol) was incubated with 10 µl of Ni-NTA Magnetic Agarose Beads (QIAGEN, Valencia, CA) in interaction buffer [Tris 0.1 M, NaCl 0.15 M, Imidazole 20 mM (pH 7.4); final volume 500 µl] on a rotating wheel during 1 h at 4 C. The beads were immobilized on a magnetic separator, the supernatant removed, and the beads washed with 500µl of interaction buffer. The His-CREB bound to the beads was then incubated with nuclear extract (1.5 µg) derived from LIF-CRH-treated AtT-20 cells or with purified GST-STAT3, in interaction buffer (final volume 500 µl), on a rotating wheel for 90 min at 4 C. The beads were washed as above and the proteins retained were eluted with Laemmli sample buffer. The eluate was resolved on SDS-PAGE and examined for the presence of STAT1-YP and 3-YP or STAT133 by immunoblotting with respective specific antibodies. Control experiments were realized with a 6xHis-tagged N-terminal segment (1221) of HSP90 protein mutated in the ATP binding site (33).
Computer Modeling of NurRE-STAT Interaction with Nur77 and STAT3
Two complexes between NBRE DNA motif and the Nur77 DNA binding domain obtained from the Protein Data Bank (ID: 1CIT) were linked to obtain a double stranded oligonucleotide of the same length as the NurRE site of the POMC promoter. Bases in this oligonucleotide were substituted or added to generate the sequence of the NurRE-STAT. The STAT 3 dimer was manually docked in its binding site accordingly to the crystal structure obtained from the Protein Data Bank (ID: 1BG1).
Transfection of CREB-siRNA
We used CREB-siRNA (5'-CCUUAGUGCAGCUGCCCAAdTdT-3') or scr-siRNA (5'-UGCCCAAGCACCUUAGUGCdTdT-3'), fluorescein-labeled at 3' end (Eurogentec, Herstal, Belgium). For studies on gene reporter, AtT-20 cells were plated in 24-well plates (105 cells/well) 24 h before transfection. Per well, 40 pmol of siRNA were cotransfected with 500 ng of 414/293 subregion reporter constructs and 250 ng of pRSV-LacZ in AtT-20 cells using Lipofectamine 2000 (Invitrogen Life Technologies). Twenty-four hours later, cells were treated or not (C) with LIF (1 nM)-CRH (50 nM) for 6 h, then washed with PBS and lysed in Tris/H3PO4 25 mM (pH 7.8), MgCl2 10 mM, EDTA 1 mM, Triton 1%, dithiothreitol 1 mM. The luciferase and ß-galactosidase activities were measured as described (24). Each experiment was independently repeated at least three times, with each assay in triplicate. For studies on the level of CREB expression, 5.106 AtT-20 cells were plated on dish (10 cm diameter). CREB-siRNA or scr-siRNA (1200 pmol/dish) was transfected with Lipofectamine 2000 (Invitrogen Life Technologies) 24 h after plating and a second transfection (boost) was realized 24 h after the first one. Cells were then washed extensively with PBS, then treated with cell dissociation buffer (Invitrogen Life Technologies), collected by 500 x g centrifugation and transferred in tubes for sorting on FACS (EPICS Elite, Coulter). Fluorescent cells were collected and treated with lysis buffer [Tris/HCl 50 mM (pH 7.5), NaCl 0.4 M, EDTA 5 mM, NaF 50 mM, okadaic acid 0,05 µM and Roche Complete proteases inhibitors cocktail] during 30 min at 4 C. After centrifugation 15 min at 3200 x g at 4 C, the supernatant was analyzed on SDS-PAGE and CREB revealed by Western blot analysis. Blot was then reprobed with monoclonal anti-PKA-RI
antibody.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Abbreviations: A-CREB, Dominant-negative form of CREB constituted of N-terminal acidic extension fused to the leucine zipper of CREB; AP, activator protein; CBP, CREB binding protein; CRE, cAMP response element; CREB, CRE binding protein; GR, glucocorticoid receptor; GST, glutathione-S-transferase; His-CREB, purified recombinant CREB; HSP, heat shock protein; Jak, Janus kinase; LIF, leukemia inhibitory factor; NBRE, Nur77 binding response element; NurRE, Nur response element; P-CREB, phoshorylated CREB; PKA, protein kinase A; POMC, proopiomelanocortin; RLU, relative light units; scr-siRNA, scrambled siRNA; SIE, Sis-inducible element; siRNA, small interfering RNA; STAT, signal transducers and activators of transcription; SV40, simian virus 40; -YP, tyrosine phosphorylated.
Received for publication October 24, 2003. Accepted for publication August 12, 2004.
| REFERENCES |
|---|
|
|
|---|
NURSA Molecule Pages Link:
This article has been cited by other articles:
![]() |
L. J Martin and J. J Tremblay The nuclear receptors NUR77 and SF1 play additive roles with c-JUN through distinct elements on the mouse Star promoter J. Mol. Endocrinol., February 1, 2009; 42(2): 119 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Labeur, D. Refojo, B. Wolfel, J. Stalla, V. Vargas, M. Theodoropoulou, M. Buchfelder, M. Paez-Pereda, E. Arzt, and G. K Stalla Interferon-{gamma} inhibits cellular proliferation and ACTH production in corticotroph tumor cells through a novel janus kinases-signal transducer and activator of transcription 1/nuclear factor-kappa B inhibitory signaling pathway J. Endocrinol., November 1, 2008; 199(2): 177 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Murakami, S. Takeuchi, T. Kudo, S. Sutou, and S. Takahashi Corticotropin-releasing hormone or dexamethasone regulates rat proopiomelanocortin transcription through Tpit/Pitx-responsive element in its promoter J. Endocrinol., May 1, 2007; 193(2): 279 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Latchoumanin, V. Mynard, J. Devin-Leclerc, M.-A. Dugue, X. Bertagna, and M. G. Catelli Reversal of Glucocorticoids-Dependent Proopiomelanocortin Gene Inhibition by Leukemia Inhibitory Factor Endocrinology, January 1, 2007; 148(1): 422 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Zbytek, J. Wortsman, and A. Slominski Characterization of a Ultraviolet B-Induced Corticotropin-Releasing Hormone-Proopiomelanocortin System in Human Melanocytes Mol. Endocrinol., October 1, 2006; 20(10): 2539 - 2547. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Pals, M. Boussemaere, E. Swinnen, H. Vankelecom, and C. Denef A Pituitary Cell Type Coexpressing Messenger Ribonucleic Acid of Proopiomelanocortin and the Glycoprotein Hormone {alpha}-Subunit in Neonatal Rat and Chicken: Rapid Decline with Age and Reappearance in Vitro under Regulatory Pressure of Corticotropin-Releasing Hormone in the Rat Endocrinology, October 1, 2006; 147(10): 4738 - 4752. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Le Goff, P. Zheng, G. Brubaker, and J. D. Smith Identification of the cAMP-Responsive Enhancer of the Murine ABCA1 Gene: Requirement for CREB1 and STAT3/4 Elements Arterioscler Thromb Vasc Biol, March 1, 2006; 26(3): 527 - 533. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chida, T. Imaki, T. Suda, and Y. Iwakura Involvement of Corticotropin-Releasing Hormone- and Interleukin (IL)-6-Dependent Proopiomelanocortin Induction in the Anterior Pituitary during Hypothalamic-Pituitary-Adrenal Axis Activation by IL-1{alpha} Endocrinology, December 1, 2005; 146(12): 5496 - 5502. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Galindo, A. A. Fadl, J. Sha, L. Pillai, C. Gutierrez Jr., and A. K. Chopra Microarray and Proteomics Analyses of Human Intestinal Epithelial Cells Treated with the Aeromonas hydrophila Cytotoxic Enterotoxin Infect. Immun., May 1, 2005; 73(5): 2628 - 2643. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |